Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Genetic relationship of milkfish ( Chanos chanos ) from Indonesia, the Philippines and Taiwan using mitochondrial cytochrome b sequences

Genetic relationship of milkfish ( Chanos chanos ) from Indonesia, the Philippines and Taiwan... Introduction The milkfish ( Chanos chanos ) is an important food fish in Southeast Asia ( Sumagaysay, 1998 ). Aquaculture of milkfish was begun in Indonesia over 500 years ago, followed by Taiwan and the Philippines. In 2007, the global production reached more than 0.5 million tonnes. Major producing countries were the Philippines, Indonesia and Taiwan ( FAO, 2009 ). Although these studies are important for a sustaining aquaculture, few studies have been conducted thus far that address the molecular phylogenetic relationship of milkfish. This study aims to investigate regional genetic relationships among milkfish from Indonesia, the Philippines and Taiwan. Mitochondrial cytochrome b sequences became widely accepted in phylogenetic studies of fishes within the past decade ( Fraga et al., 2007 ; Krieger et al., 2008 ; Ludwig, 2008 ; Nazia et al., 2010 ) and were therefore used for our study. Materials and methodology Fifty samples were collected from 16 locations ( Fig. 1 ). Genomic DNA was extracted using Proteinase‐K (Amresco) digestion and AxyPrep Multisource Genomic DNA Miniprep kit (Axygen Bioscience) following the manufacture’s methods. Cytochrome b sequences were amplified using primers MtDNAGlu‐F2 (5′ACTTGAAAAACCGCCGTTGT‐3′) and MtDNAThr‐R3 (5′‐GATTACAAGACCGCTTT‐3′). PCR was conducted using an Eppendorf Mastercycle Gradient in http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Applied Ichthyology Wiley

Genetic relationship of milkfish ( Chanos chanos ) from Indonesia, the Philippines and Taiwan using mitochondrial cytochrome b sequences

Download PDF
4 pages

Loading next page...
 
/lp/wiley/genetic-relationship-of-milkfish-chanos-chanos-from-indonesia-the-457VETSNZd

References (19)

Publisher
Wiley
Copyright
© 2010 Blackwell Verlag, Berlin
ISSN
0175-8659
eISSN
1439-0426
DOI
10.1111/j.1439-0426.2010.01629.x
Publisher site
See Article on Publisher Site

Abstract

Introduction The milkfish ( Chanos chanos ) is an important food fish in Southeast Asia ( Sumagaysay, 1998 ). Aquaculture of milkfish was begun in Indonesia over 500 years ago, followed by Taiwan and the Philippines. In 2007, the global production reached more than 0.5 million tonnes. Major producing countries were the Philippines, Indonesia and Taiwan ( FAO, 2009 ). Although these studies are important for a sustaining aquaculture, few studies have been conducted thus far that address the molecular phylogenetic relationship of milkfish. This study aims to investigate regional genetic relationships among milkfish from Indonesia, the Philippines and Taiwan. Mitochondrial cytochrome b sequences became widely accepted in phylogenetic studies of fishes within the past decade ( Fraga et al., 2007 ; Krieger et al., 2008 ; Ludwig, 2008 ; Nazia et al., 2010 ) and were therefore used for our study. Materials and methodology Fifty samples were collected from 16 locations ( Fig. 1 ). Genomic DNA was extracted using Proteinase‐K (Amresco) digestion and AxyPrep Multisource Genomic DNA Miniprep kit (Axygen Bioscience) following the manufacture’s methods. Cytochrome b sequences were amplified using primers MtDNAGlu‐F2 (5′ACTTGAAAAACCGCCGTTGT‐3′) and MtDNAThr‐R3 (5′‐GATTACAAGACCGCTTT‐3′). PCR was conducted using an Eppendorf Mastercycle Gradient in

Journal

Journal of Applied Ichthyology – Wiley

Published: Aug 1, 2011

There are no references for this article.