Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Vaccination with inhibin-α provides effective immunotherapy against testicular stromal cell tumors

Vaccination with inhibin-α provides effective immunotherapy against testicular stromal cell tumors Background: Testicular cancer is the most common male neoplasm occurring in men between the ages of 20 and 34. Although germ-line testicular tumors respond favorably to current standard of care, testicular stromal cell (TSC) tumors derived from Sertoli cells or Leydig cells often fail to respond to chemotherapy or radiation therapy and have a 5-year overall survival significantly lower than the more common and more treatable germ line testicular tumors. Methods: To improve outcomes for TSC cancer, we have developed a therapeutic vaccine targeting inhibin-α,a protein produced by normal Sertoli and Leydig cells of the testes and expressed in the majority of TSC tumors. Results: We found that vaccination against recombinant mouse inhibin-α provides protection and therapy against transplantable I-10 mouse TSC tumors in male BALB/c mice. Similarly, we found that vaccination with the immunodominant p215-234 peptide of inhibin-α (Inα 215-234) inhibits the growth of autochthonous TSC tumors occurring in male SJL.AMH-SV40Tag transgenic mice. The tumor immunity and enhanced overall survival induced by inhibin-α vaccination may be passively transferred into naive male BALB/c recipients with either CD4+ T cells, B220+ B cells, or sera from inhibin-α primed mice. Conclusions: Considering the lack of any alternative effective treatment for chemo- and radiation-resistant TSC tumors, our results provide for the first time a rational basis for immune-mediated control of these aggressive and lethal variants of testicular cancer. Keywords: Testicular cancer, Stromal cell cancer, Cancer vaccines, Leydig cell tumors, Sertoli cell tumors Background against testicular stromal cell (TSC) tumors. To this Testicular cancers are the most common solid tumors end, we have developed an immunotherapeutic ap- occurring in young men aged 20–34 with a median age proach for providing improved control over TSC at diagnosis of 33 [1, 2]. The vast majority of testicular tumors and enhanced overall survival. cancers are germ cell tumors that have a 5-year overall Our approach involved immune targeting of inhibin-α, survival rate exceeding 95% when treated early with sur- a gonadal protein that belongs to the transforming gery, chemotherapy, and/or radiation therapy [1, 2]. growth factor beta superfamily and plays a role in regu- However, a small percentage of testicular tumors de- lating secretion of pituitary follicle stimulating hormone velop in the hormone-producing cells of the stroma through a negative feedback mechanism [4]. Inhibin-α is including Leydig and Sertoli cell tumors that respond a 366 amino acid protein with a molecular mass of 39.56 poorly to current standard of care and have 5-year kDa (GenBank: EDL00422.1). Inhibin-α restricts the survival rates of 91% and 77%, respectively [3]. Thus, production of mature ovarian follicles in mammalian there is a great need for more effective treatments females and regulates spermatogenesis, steroidogenesis, and germ cell development in males [4]. Inhibin-α is * Correspondence: tuohyv@ccf.org produced by normal TSC and is expressed and produced Department of Immunology, NB30, Lerner Research Institute, Cleveland Clinic, in the majority of human and canine TSC tumors [5–7]. 9500 Euclid Avenue, Cleveland, OH 44195, USA Moreover, several studies indicate that inhibin-α is a Department of Biology, Cleveland State University, Cleveland, OH, USA Full list of author information is available at the end of the article © The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 2 of 12 useful marker for human TSC tumors with intense im- (Qiagen). The purity of affinity purified rmInα was munohistochemical staining of inhibin-α occurring typ- gauged by SDS-PAGE and Western blot analysis using ically in >90% of Leydig and Sertoli cell tumors but in mouse inhibin-α antibody at 1/200 dilution and second- only about 10% of testicular germ cell tumors [5, 8, 9]. ary detection antibody at 1/5,000 dilution (Santa Cruz Therefore, inhibin-α stands out prominently as a poten- Biotechnology, Dallas, TX). Prior to use in vitro, the tially useful vaccine target for providing immunotherapy inhibin-α protein was further purified by reverse phase against TSC tumors. high performance liquid chromatography (HPLC) to Here we show that vaccination of male BALB/c mice yield endotoxin-free protein [10]. Levels of endotoxin with recombinant mouse inhibin-α (rmInα) induces a were < 5 pg/mg recombinant protein. type-1/type-17 proinflammatory T cell response suffi- cient to inhibit the growth of transplantable I-10 TSC Generation of SJL.AMH-SV40Tag transgenic mice and tumor cells using both prevention and treatment proto- autochthonous TSC tumors cols. Tumors from mice vaccinated with rmInα are The AT-t94 transgenic mouse was generously provided extensively infiltrated with CD3+ T cells, many of which by Dr. Jean-Yves Picard, Biologie Fonctionnelle et are activated CD4 + CD44+ T cells. The immunity Adaptative Université, Paris, France. This mouse ex- against TSC tumors could be transferred into naive re- presses a fusion construct containing 3.6 kb of the 5' cipient BALB/c males using inhibin-α primed CD4+ T flanking region of the human anti-Müllerian hormone cells, B220+ B cells, or sera but not with inhibin-α (AMH) gene upstream of the SV40 proto-oncogene en- primed CD8+ T cells. We also found that vaccination coding the large transforming antigen (SV40Tag) [11, 12]. with the p215-234 immunodominant peptide of mouse Female AT-t94 mice develop a high incidence of autoch- inhibin-α (Inα 215-234) provides significant inhibition of thonous granulosa cell tumors and male AT-t94 trans- autochthonous TSC tumor growth occurring spontan- genic mice develop a high incidence of autochthonous eously in SJL.AMH-SV40Tag transgenic mice. Taken to- TSC tumors [11, 12]. Male AT-t 94 transgenic mice ex- gether, our data support the view that vaccination pressing the H-2 haplotype of the major histocompatibil- against inhibin-α has the potential to provide significant ity complex (MHC) were mated at the Cleveland Clinic immunotherapy against TSC tumors that may prove with female SJL/J (H-2 ) mice obtained commercially useful in the adjuvant setting for control of this aggres- (Jackson Laboratory, Bar Harbor, ME). The resultant SJL × b,s sive form of testicular cancer and for enhancing the AT-t94 (H-2 ) transgenic offspring were backcrossed for overall survival of patients with these tumors. over 20 generations to SJL/J mice producing SJL.AMH- SV40Tag (H-2 ) transgenic mouse used in the current Methods study. Female SJL.AMH-SV40Tag transgenic mice develop Generation of recombinant mouse inhibin-α (rmInα) granulosa cell tumors starting at 8-10 months of age and Total RNA was purified from testes of 8 week old show an incidence of affected ovaries that exceeds 90% by BALB/c male mice using the RNeasy Mini Kit (Qiagen, 18 months of age [13]. Moreover, the emergence and Valencia, CA), and the RNA was stabilized in RNAlater growth of autochthonous granulosa cell tumors in female (Qiagen). cDNA was generated with random hexamers SJL.AMH-SV40Tag transgenic mice is inhibited by vaccin- using the SuperScript III First-Strand Synthesis Super- ation with the IA -restricted Inα 215-234 peptide of Mix (ThermoFisher Scientific, Waltham, MA). Inhibin-α mouse inhibin-α [13, 14]. In our hands, male SJL.AMH- cDNA was amplified using the AmpliTaq Gold DNA SV40Tag transgenic mice develop unilateral and bilateral Polymerase LD kit (ThermoFisher Scientific) with Leydig cell tumors at around 75 weeks of age and are able CCTAGGCAGGAAGAGCACAG as forward primer to respond to the IA -restricted Inα 215-234. SJL.AMH- and ACCTCCATCTGAGGTGGTTC as reverse primer. SV40Tag transgenic mice were identified by RT-PCR amp- The inhibin-α cDNA sequence was inserted into the lification of the human AMH promoter from tail DNA. NdeI-Bam HI sites of the pET-3a expression vector (GeneArt AG, Regensburg, Germany) thereby providing The I-10 mouse testicular cancer cell line and the a C-terminal 6 × His-tagged recombinant protein after transplantable TSC tumor model plasmids containing this insert was transformed in BL21 The I-10 (ATCC® CCL83™) mouse testicular cancer cell Star E. coli (Lucigen, Middleton, WI). High level expres- line was purchased from the American Type Culture sion colonies were selected following induction with iso- Collection (ATCC, Manassas, VA). I-10 cells are hyper- propyl β-D-1-thiogalactopyranoside (IPTG; Amresco, diploid, epithelial-like Leydig tumor cells derived from Solon, OH) and were sequenced for confirming proper male BALB/c mice using a single-cell plating technique orientation and alignment. The 6 × His-tagged protein [15, 16]. I-10 cells were grown in F-12K media (ATTC was purified under denaturing conditions using nickel- #30-2004) supplemented with 2.5% heat inactivated fetal nitrilo triacetic acid (Ni-NTA) affinity chromatography bovine serum and 15% heat inactivated horse serum Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 3 of 12 (ThermoFisher Scientific). Prior to use, all media were after immunization or spleens were removed 8 weeks filtered through a 0.2 μm Nalgene Rapid-Flow Dispos- after immunization. Each population was cultured with able Bottle Top Filter (ThermoFisher Scientific). The immunogen at various doses in triplicate 96-well flat- I-10 cells were culture as a single-cell suspension in bottom microtiter Falcon plates (BD Biosciences, San 2 5 75-cm tissue culture flask (ThermoFisher Scientific) Jose, CA) at 3 × 10 cells/well in a total volume of 200 μl and cultured at 37 °C in humidified air and 5% CO with of DMEM (Mediatech, Manassas, VA) supplemented intermittent feeding using warm fresh media. At 70–75% with1% penicillin/streptomycin, 2% L-glutamine, 5% confluence, adherent cells were disrupted mechanically HEPES buffer (Invitrogen Life Technologies, Grand and enzymatically by adding 10 ml F-12K media con- Island, NY), and 10% fetal bovine serum (Hyclone, taining 0.25% trypsin and 0.02% EDTA (ThermoFisher Logan, UT). Positive control wells contained 2 μg/ml Scientific). After centrifugation and thorough washing in anti-mouse CD3 (BD Biosciences), negative control wells PBS, pelleted cells were recultured in supplemented contained no antigen, and specificity controls contained F-12K media or resuspended in PBS for subcutaneous grade VII ovalbumin (Sigma-Aldrich, St. Louis, MO) at inoculation of 2 × 10 cells in the lumbar region of 8–10 various doses. In all cases, proliferation was determined week-old BALB/cJ males purchased commercially after 96 h of culture when wells were pulsed with 1.0 (Jackson Laboratory). Tumors were measured daily by μCi/well thymidine, [methyl-3H]-, specific activity: 6.7 Vernier caliper and mice were euthanized when tumors Ci/mmol (PerkinElmer, Waltham, MA) and harvested 16 reached 17 mm in either length or width. BALB/c mice h later by aspiration onto glass fiber filters. Levels of in- typically developed palpable tumors within 28 days after corporated radioactivity were determined by scintillation inoculation. spectrometry. Results are expressed as mean counts per minute (cpm) of experimental cultures with anti- Peptide synthesis gen divided by mean cpm of cultures without antigen Inα 215-234, FLVAHTRARAPSAGERARRS, was synthe- (stimulation index). In all proliferation assays, mean sized by the Molecular Biotechnology Core Facility of cpm of cultures without antigen ranged between 500 the Lerner Research Institute using standard solid phase and 2000 cpm. methodology and FMOC side chain-protected amino acids. The peptide was purified > 97% by reverse phase ELISPOT assays HPLC, and amino acid composition was confirmed by Ten days after immunization with either rmInα or Inα mass spectrometry. 215-234, frequencies of type-1, type-2, and type-17 T cells responding to each immunogen were determined Mice and immunization by ELISPOT analysis using capture/detection antibody Male BALB/cJ mice were obtained commercially pairs for interferon-gamma (IFNγ), IL-5, and IL-17 (Jackson Laboratory) at 6-7 weeks of age and usually im- (ThermoFisher Scientific), respectively. Duplicate or munized at 8–10 weeks of age by subcutaneous injection triplicate wells containing 5 × 10 LNC were cultured in the abdominal flank with 100 μgofrmInα protein in with 50 μg/ml immunogen or the irrelevant control anti- 200 μl of an emulsion of equal volumes of water and gen, grade VII ovalbumin (Sigma-Aldrich) in ELISPOT complete Freund's adjuvant (CFA) containing 400 μgof plates (Millipore, Billerica, MA) pre-coated with capture Mycobacteria tuberculosis H37RA (Difco, Detroit, MI). antibodies in 200 μl/well total culture volume in DMEM In the treatment protocol, all experimental BALB/cJ (Mediatech) supplemented as described above. At 72 h mice were inoculated on the same day with 2 × 10 I-10 of culture, wells were treated with corresponding bio- cancer cells thereby ensuring an equal initial tumor load. tinylated detection antibodies and after overnight incu- When the first tumor became palpable in any mouse, all bation and washing, spots were visualized by sequential mice in that treatment group were vaccinated. Although treatment with alkaline phosphatase-conjugated strepta- not all mice had palpable tumors on the day of vac- vidin and 5-bromo-4-chloro-3-indolyl phosphate sub- cination, all had palpable tumors within a day or two strate (R&D Systems, Minneapolis, MN). The reaction thereafter. Male SJL.AMH-SV40Tag transgenic mice was halted after 10 min by repeated washing with were immunized at 8–10 weeks as described above double-distilled deionized H O, and spots were devel- but with 100 μgofInα 215-234 peptide. All mice oped and counted using an ImmunoSpot S6 analyzer were euthanized by asphyxiation with CO followed with proprietary ImmunoSpot 5.1 software (Cellular by cervical dislocation. Technologies Limited, Shaker Heights, OH). In some ex- periments, CD4+ and CD8+ T cells were purified from Proliferation assays primed LNC by negative selection using anti-CD4- and To characterize the immune response to rmInα and Inα anti-CD8-coated magnetic beads and double passage 215-234, lymph node cells (LNC) were removed 10 days through a MACS LS column using a MidiMACS cell Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 4 of 12 separator (Miltenyi Biotec, San Diego, CA). The Isolation of tumor infiltrating lymphocytes (TILs) and flow enriched T cells were activated with various doses of im- cytometry analysis munogen in cultures containing 3 × 10 T cells/microti- Leukocytes were isolated from I-10 tumors by digestion ter well and 5 × 10 γ-irradiated (25 Gy) syngeneic of minced tissue for 30 min at 37 °C in HBSS (Thermo- splenocyte feeders. Fisher Scientific) containing 50 Kunitz Units (KU) of DNase I (Sigma-Aldrich) and 0.2 mg/ml collagenase II (ThermoFisher Scientific). Cells were then collected by ELISA assays discontinuous gradient centrifugation and the enriched Cytokine concentrations were determined by ELISA TILs were triple-stained with commercially available measurement of 48-h supernatants of 10-day-primed (ThermoFisher Scientific) CD3-specific antibody conju- LNC cultured in supplemented DMEM at 5 × 10 cells/ gated with fluorescein isothiocyanate (FITC), CD44- well in 24-well flat-bottom Falcon plates (BD Biosci- specific antibody conjugated with cyanine 5 (Cy5), and ences) in the presence of 20 μg/ml antigen in a final vol- either CD4-specific antibody conjugated with phyco- ume of 2.0 ml/well. Affinity purified capture/detection erythrin (PE) or CD8-specific antibody conjugated with antibody pairs and recombinant cytokines (Thermo- PE. Data were collected on 30,000 total events using a Fisher Scientific) were used to measure supernatant con- Becton-Dickinson FACSAria II flow cytometer (BD Bio- centrations of IFNγ, IL-5, and IL-17. Absorbance was sciences) and analyzed using FlowJo software (FlowJo, measured at 405 nm using a model 550 ELISA micro- Ashland, OR) after gating on the CD3+ population. plate reader (Bio-Rad Laboratories, Hercules, CA). Standard values were plotted as absorbance vs. cytokine Histology concentration, and sample cytokine concentrations were Mouse testes and TSC tumors were fixed in 10% determined as values within the linear part of the stand- phosphate-buffered formalin (ThermoFisher Scientific) ard curve established using known concentrations of for 24 h and stored in 70% ethanol until processed for each cytokine. embedding in paraffin. Slides with multiple 6 μm tissue sections were stained with hematoxylin and eosin (Richard-Allan Scientific, Kalamazoo, MI), dehydrated in Antibody isotyping an ascending gradient of ethanol followed by xylene, and Isotype-specific serum antibody titers to rmInα were de- mounted in Cytoseal 60 (Stephens Scientific, Riverdale, termined using the mouse MonoAB ID/SP ELISA kit NJ) for examination by light microscopy. (Zymed Laboratories, South San Francisco, CA). Immunohistochemistry Prior to immunostaining using the ImmunoCruz rabbit Passive transfer of tumor immunity LSAB Staining System (Santa Cruz Biotechnology), Three weeks after immunization of BALB/c male tissue antigens were unmasked by heat treatment as per mice with rmInα, CD4+ T cells, CD8+ T cells, and the manufacturer’s instructions. Briefly, prepared slides B220+ B cells, were enriched (>90%) from splenocytes were treated with 10 mM sodium citrate buffer (pH 6) by magnetic bead separation as described above. The and heated to 95 °C. This process was then repeated enriched T cells were cultured in supplemented 6 with fresh buffer. After the slides cooled, they were DMEM at 5 × 10 cells/well in 24-well flat-bottom washed with double distilled deionized H O and the ex- Falcon plates (BD Biosciences) in the presence of 20 cess liquid was aspirated. After unmasking and blocking μg/ml antigen in a final volume of 2.0 ml/well. Each 6 formalin-fixed 6 μm paraffin embedded tissues sections, well also contained 5 × 10 γ-irradiated (25 Gy) syn- antigens were detected using primary antibodies against geneic splenocyte feeders as antigen presenting cells. luteinizing hormone receptor (LHR; Santa Cruz Biotech- After 72 h of culture, cells were washed thoroughly 7 nology), AMH (Abcam, San Francisco, CA), SV40Tag and 2–3×10 cells were injected intraperitoneally into (Santa Cruz Biotechnology), and mouse CD3 (Novacastra, naive recipient male BALB/c mice in a total volume Buffalo Grove, IL). All primary antibodies were used at a of 200 μl PBS. For serum transfer experiments, recipi- 1/1000 dilution. ents of rmInα-primed and ovalbumin-primed CD4+ T cells were bled at euthanasia by cardiac puncture. Cell-free sera were collected and 200 μl of pooled Biostatistical analysis sera were injected intravenously into each naive Differences between mean tumor weights and mean BALB/c male recipient. After transfer of cells or tumor areas were compared using the Student’s t test. serum, mice were inoculated later on the same day Differences in Kaplan-Meier survival curves with 17 mm with I-10 TSC tumor cells as described above. tumor endpoints were compared with the log-rank test. Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 5 of 12 Results Immunogenicity of rmInα Generation of recombinant mouse inhibin-α (rmInα) To determine the immunogenicity of rmInα,8–10 week We selected inhibin-α as our vaccine target for immuno- old male BALB/c mice were immunized with rmInα, therapy against TSC tumors because it is expressed and pro- and ten days later, LNC were tested for recall prolifera- duced in the majority of mouse and human TSC tumors tive responsiveness to the priming rmInα immunogen [5–9]. Inhibin-α cDNA was inserted into the pET-3a expres- and to ovalbumin as a specificity control. The results sion vector to produce a 6 × His-tagged fusion protein after showed that immunization with rmInα induced an IPTG induction in BL21 Star E. coli.Coomassiebluestain- antigen-specific response to the priming rmInα immu- ing showed that the induced protein and the HPLC purified nogen (Fig. 1b). This immunogenicity was confirmed by protein migrate on SDS-PAGE at the anticipated molecular ELISPOT analysis that showed increased frequencies of mass of 39.56 kDa (Fig. 1a, left panel). Western blotting proinflammatory type-1 and type-17 T cells producing using a primary antibody specific for mouse inhibin-α (Santa IFNγ and IL-17, respectively, but no increased frequen- Cruz Biotechnology) confirmed the identity and purity of cies of T cells producing the regulatory cytokine IL-5 the generated rmInα protein (Fig. 1a, right panel). (Fig. 1c). In addition, ELISA analysis of supernatants Fig. 1 Immunogenicity of recombinant mouse inhibin-α (rmInα). a Coomassie blue staining (left panel) showed migration of affinity purified and HPLC purified rmInα on an SDS-PAGE gel at the anticipated molecular mass of 39.56 kDa. This correct molecular mass migration was confirmed by Western blot analysis of the HPLC purified protein using an antibody specific for mouse inhibin-α (right panel). b 8-10 week old male BALB/c mice were immunized with rmInα, and ten days later, LNC were tested for recall proliferative responsiveness. c Immunogenicity was confirmed by ELISPOT analysis of type-1, type-2, and type-17 T cells expressing IFNγ, IL-5, and IL-17, respectively. d Immunogenicity was also confirmed by ELISA measurement IFNγ, IL-5, and IL-17 concentrations in supernatants of rmInα primed LNC reactivated with antigen. e ELISPOT analysis of responses from purified T cell subpopulations showed that the response to rmInα was elicited predominantly from CD4+ T cells. f Serum antibody titers from BALB/c male mice 3 weeks after immunization with rmInα showed differential production of IgG isotypes. Error bars indicate ± SE Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 6 of 12 from rmInα primed LNC reactivated with antigen to cell transfer, T cells were cultured for 72 h with the showed production of the proinflammatory cytokines priming immunogen whereas B cells were transferred IFNγ and IL-17 but not production of the regulatory without prior restimulation. The purified cells were cytokine IL-5 (Fig. 1d). ELISPOT analysis of responses injected intraperitoneally into naive BALB/c male mice from purified T cell subpopulations showed that the re- that were inoculated on the same day with I-10 TSC sponse to rmInα was elicited predominantly from CD4+ tumor cells. Our results showed that transfer of CD4+ T T cells (Fig. 1e). Finally, high titer serum antibody cells primed against rmInα provided highly significant responses to rmInα were evident by 3 weeks after protection (P < 0.001) against the growth of I-10 TSC tu- immunization with IgG1 and IgG2b providing the pre- mors (Fig. 3a) and that this protection provided a highly dominant isotypes even at serum dilutions exceeding 1/ significant increase (P < 0.001) in overall survival com- 8,000 (Fig. 1f). pared to recipients of ovalbumin primed CD4+ T cells (Fig. 3b). In contrast, transfer of rmInα primed CD8+ T Vaccination against rmInα inhibits growth of transplantable cells failed to provide protection against the growth of TSC tumors I-10 TSC tumors (Fig. 3c) or enhancement of overall To determine whether rmInα vaccination could prevent survival (Fig. 3d). In addition, we found that transfer of the growth of transplantable TSC tumors, eight week- rmInα primed B220+ B cells provided significant protec- old male BALB/c mice were vaccinated with rmInα, and tion (P = 0.003) against the growth of I-10 TSC tumors eight days later inoculated with 2 × 10 I-10 TSC tumor (Fig. 3e) and a significant increase (P = 0.001) in overall cells. The results showed significant inhibition of tumor survival (Fig. 3f). Finally, transfer of serum from mice growth (P = 0.009) in rmInα vaccinated mice compared that received rmInα primed CD4+ T cells also provided to control mice vaccinated with CFA alone (Fig. 2a). To significant protection (P = 0.001) against the growth of determine whether rmInα vaccination could be used to I-10 TSC tumors (Fig. 3g) and significantly enhanced treat established TSC tumors, tumor inoculated BALB/c (P = 0.001) overall survival (Fig. 3h). Thus, our data mice were vaccinated when TSC tumors became palp- indicate that CD4+ T cells, B220+ B cells, and serum able. Again, rmInα vaccination showed significant inhib- specific for rmInα are independently capable of sig- ition of tumor growth (P = 0.001) in rmInα vaccinated nificantly inhibiting growth of I-10 TSC tumors. mice compared to control mice vaccinated with CFA alone (Fig. 2b). Immunohistochemical analysis showed Immunohistochemical analysis of autochthonous TSC tumors virtually no CD3+ T cells in I-10 TSC tumors 32 days Testis tissue taken from normal 75 week-old male SJL/J after vaccination with CFA alone (Fig. 2c) whereas mice showed normal non-transformed Leydig cells in extensive CD3+ T cell infiltrates occurred in I-10 TSC the interstitial space between seminiferous tubules tumors 32 days after vaccination with rmInα (Fig. 2d). (Fig. 4a). In contrast, testis tissue taken from 75 week- Thus, CD3+ tumor infiltrating lymphocytes (TILs) were old male SJL.AMH-SV40Tag mice show transformed consistently observed only in mice vaccinated with re- Leydig cell tumors in the interstitial space between sem- combinant mouse inhibin-α, and these were the only iniferous tubules (Fig. 4b). Immunohistochemical detec- mice that showed inhibited growth of TSC tumors. Flow tion of the Leydig cell marker luteinizing hormone cytometry analysis of the gated CD3+ population indi- receptor (LHR) [17] showed localization in autochthon- cated that 28.3% of the TILs were CD3 + CD4+ T cells ous TSC tumors from 75 week-old male SJL.AMH- (Fig. 2e, upper left panel) and 38.6% of these CD4+ T SV40Tag transgenic mice (Fig. 4c). In addition, TSC cells expressed the CD44 activation marker (Fig. 2e, tumors from 75 week-old male SJL.AMH-SV40Tag mice upper right panel). In contrast, only 15% of TILs were also expressed anti-Müllerian hormone (AMH; Fig. 4d), CD3 + CD8+ T cells (Fig. 2, lower left panel) and only a protein traditionally associated with Sertoli cell tumors 22.6% of these CD8+ T cells expressed the CD44 activa- that would ordinarily develop within the seminiferous tion marker (Fig. 2e, lower right panel). tubules and not in the interstitial space where Leydig cell tumors develop [18]. TSC tumors from male SJL.AMH- Passive transfer of tumor immunity SV40Tag transgenic mice also expressed the SV40Tag To determine which lymphocytes were responsible for from the transgene (Fig. 4e). Finally, the TSC tumors the induced tumor immunity, we transferred defined expressed inhibin-α (Fig. 4f), a protein expressed in the purified lymphocyte populations into naive tumor inocu- majority of Leydig cell tumors [5–9, 19] but also lated recipients. Eight week-old male BALB/c mice were expressed in a substantial number of Sertoli cell tumors immunized with either rmInα or with ovalbumin as a [5]. We estimate that about 88% of inhibin-α positive control immunogen. Three weeks later, primed CD4+ T TSCs show malignant changes. Thus, the TSC autoch- cells, CD8+ T cells, and B220+ B cells were purified thonous tumors that grow spontaneously in SJL.AMH- from splenocytes using magnetic bead separation. Prior SV40Tag transgenic mice have many of the characteristics Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 7 of 12 Fig. 2 Vaccination against rmInα inhibits growth of transplantable TSC tumors. Significant inhibition of transplantable tumor growth occurred when rmInα vaccination occurred (a) prophylactically 8 days prior to inoculation with 1-10 TSC tumor cells or (b) as treatment of palpable I-10 TSC tumors. (c) Immunohistochemical analysis showed virtually no CD3+ T cells in I-10 TSC tumors 32 days after vaccination with CFA alone whereas (d)extensive CD3+ T cell infiltrates were evident in I-10 tumors taken from mice 32 days after vaccination against rmInα. Arrows point to examples of CD3+ T cells. (e) Flow cytometry analysis showed that 28.3% of the TILs were CD3 + CD4+ T cells (upper left panel) and 57.9% of these CD4+ T cells expressed the CD44 activation marker (upper right panel). Only 15% of TILs expressed the CD3 + CD8+ phenotype (lower left panel) and only 66.1% of these CD8+ T cells expressed the CD44 activation marker (lower right panel). Error bars indicate ± SE, and asterisks indicate significance of Leydig cell tumors but also express AMH, a marker 215-234. Whole LNC and CD4+ T cells but not CD8+ T traditionally associated with tumors of Sertoli cell origin. cells purified from the primed LNC by magnetic bead sep- aration showed high frequencies of antigen-specific IFNγ- Vaccination against rmInα inhibits growth of autochthonous secreting T cells in recall responses to Inα 215-234 (Fig. 5b). TSC tumors To determine whether vaccination against Inα 215-234 Male SJL.AMH-SV40Tag transgenic mice that develop au- could inhibit the growth of autochthonous TSC tumors, tochthonous TSC tumors also express the MHC H-2 male SJL.AMH-SV40Tag mice were vaccinated at eight haplotype that allows them to respond by proliferation to weeks of age with Inα 215-234 in CFA or with CFA alone the immunodominant IA -restricted Inα 215-234 peptide as control. We found that Inα 215-234 vaccination pro- (Fig. 5a). The immunogenicity of Inα 215-234 in SJL.AMH- vided significant protection (P < 0.001) against the emer- SV40Tag transgenic mice was confirmed by ELISPOT ana- gence and growth of autochthonous TSC tumors (Fig. 5c). lysis of LNC taken 10 days after immunization with Inα This growth inhibition was confirmed when Inα 215-234 Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 8 of 12 Fig. 3 Passive transfer of tumor immunity. a Transfer of purified rmInα primed CD4+ T cells into naïve BALB/c recipient male mice provided highly significant protection against the growth of subsequently inoculated I-10 TSC tumors and (b) this protection resulted in a highly significant increase in overall survival compared to recipients of ovalbumin primed CD4+ T cells. c Transfer of rmInα primed CD8+ T cells failed to provide protection against the growth of I-10 tumors and (d) failed to enhance overall survival. (e) Transfer of rmInα primed B220+ B cells provided significant protection against the growth of I-10 TSC tumors and (f) significantly enhanced overall survival. g Transfer of serum from mice that received rmInα primed CD4+ T cells also provided significant protection against the growth of I-10 TSC tumors and (h) significantly enhanced overall survival. Error bars indicate ± SE, and asterisks indicate significance vaccinated mice showed significantly lower testicular could be transferred into naive recipients with inhibin-α weights (P = 0.02) when the experiment was terminated at primed CD4+ T cells, B cells, or serum but not with 77 weeks of age (Fig. 5d). primed CD8+ T cells. Although there is a shortage of data showing the im- Discussion munogenicity of inhibin-α in humans, several studies We have shown that a targeted immune response have shown substantial immunogenicity of inhibin-α fol- against inhibin-α is capable of inhibiting the growth of lowing immunization of mice, rats, goats, sheep, and cat- TSC tumors in mice. Inhibition of tumor growth oc- tle [20–23]. These studies suggest that inhibin-α would curred using both therapeutic and prophylactic protocols be similarly immunogenic in humans and therefore and was effective against both autochthonous and trans- likely useful as a vaccine target for immunotherapy of plantable tumors. Inhibin-α vaccination inhibited TSC human TSC tumors. tumor growth in both SJL/J and BALB/c mice and the It is noteworthy that transfer of either primed CD4+ T effectiveness was associated with tumor infiltrates of ac- cells (Fig. 3a), B cells (Fig. 3e), or sera (Fig. 3g) on the tivated CD4+ T cells. Moreover, the tumor immunity day of tumor inoculation provides superior tumor Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 9 of 12 transfer of primed sera. This enhanced tumor immunity suggests that helper function may not be the only way CD4+ T cells contribute to the TSC tumor immunity. CD4+ T cells can directly kill MHC class II positive tumor cells in a perforin/granzyme B cell-dependent manner and can indirectly eliminate tumor cells that lack expression of MHC class II by cytokine-mediated activation of macrophages [24, 25]. Experiments to de- termine how CD4+ T cells mediate inhibition of TSC tumor growth are ongoing as are experiments to deter- mine whether antibodies mediate inhibition of TSC tumor growth by neutralization of inhibin-α or by complement-dependent cytotoxicity. Our data clearly show that prophylactic inhibin-α vac- cination provides results that are far superior to those obtained by therapeutic vaccination when the tumor has already grown and developed (Fig. 2a and b). Moreover, it is our view that virtually all vaccines function best when used prophylactically and that the earlier the im- munity is provided, the better is the clinical outcome. This view is supported by the remarkable success of childhood vaccines that are designed to prevent rather than treat infectious diseases like polio, measles, and mumps. Though dramatically effective in preventing dis- ease, these traditional childhood vaccines have little im- pact on viral clearance when vaccination occurs after Fig. 4 Immunohistochemical analysis of autochthonous TSC tumors. infection and have no detectable efficacy in alleviating a Testis tissue taken from normal 75 week-old male SJL/J mice showed normal non-transformed Leydig cells in the interstitial space between disease when vaccination occurs after the appearance of the seminiferous tubules (arrows; bar = 25 μm). b Testis tissue taken clinical signs [26]. from 75 week-old male SJL.AMH-SV40Tag mice showed transformed The autoimmune consequences of inhibin-α vaccin- Leydig cell tumors in the interstitial space between the seminiferous ation must be considered. In normal human male tis- tubules (arrows; bar = 25 μm), and positive staining for (c) luteinizing sues, high levels of inhibin-α expression is confined to hormone receptor (LHR), a traditional Leydig cell marker (arrows; bar = 10 μm), d anti- Müllerian hormone (AMH), a traditional Sertoli cell marker the Sertoli cells and Leydig cells of the testis and to the (arrows; bar = 10 μm), e the transgene derived SV40Tag in Leydig cells glandular cells of the adrenal gland [27]. Inhibin-α nega- (short arrows) and Sertoli cells (long arrow; bar = 25 μm), and (f) inhibin-α, tively regulates pituitary secretion of follicle stimulating a protein commonly expressed in both Leydig cell tumors and Sertoli cell hormone (FSH) and has been shown to affect several tumors (arrows; bar = 25 μm) other processes including cell proliferation, apoptosis, immunity, steroid hormone production, spermatogen- immunity when compared to active immunization on esis, and germ cell development [4, 28]. Although the day when tumors become palpable (Fig. 2b). We be- inhibin-α vaccination may be useful in inhibiting growth lieve that this is due primarily to the fact that in the and metastasis of human TSC tumors, the tradeoff for transfer model, a mature effector immune response im- this tumor immunity may involve testicular and adrenal mediately engages the inoculated tumor cells whereas in autoimmunity due to interference with a variety of cell the therapeutic active immunization model, immune en- processes affecting these tissues. In our prior studies we gagement of the palpable tumor is delayed until a ma- showed that inhibin-α vaccination of normal female ture effector immune response develops several days if mice resulted in antibody-mediated neutralization of not weeks after vaccination. Thus the adoptive and pas- inhibin-α that resulted in unregulated FSH release, sive transfer data mimic the tumor immunity provided enhanced litter numbers, early depletion of the ovarian when the active immunization occurs long before the in- reserve, and ultimately premature ovarian failure [14]. oculation of tumor (Fig. 2a). We have not similarly characterized the inhibin-α auto- It is also worth noting that the tumor immunity pro- immune phenotype in male mice. However, prior studies vided by transfer of primed CD4+ T cells is substantially suggest that the autoimmune consequences of inhibin-α enhanced when compared to the immunity provided by vaccination may be relatively benign and quite tolerable. transfer of equal numbers of primed B cells or by No differences were detected in the interstitial tissue Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 10 of 12 Fig. 5 Vaccination against rmInα inhibits growth of autochthonous TSC tumors. Ten days after immunization of male SJL.AMH-SV40Tag (H-2 ) transgenic mice with the immunodominant IA -restricted Inα 215-234 peptide (a) LNC showed antigen-specific proliferation in response to various doses of Inα 215-234, and (b) whole LNC and purified CD4+ T cells but not CD8+ T cells showed high frequencies of antigen-specific IFNγ-secreting T cells in response to Inα 215-234. c Prophylactic Inα 215-234 vaccination of eight week-old male SJL.AMH-SV40Tag mice significantly inhibited the growth of autochthonous TSC tumors. d This inhibition of TSC tumor growth was accompanied by significantly lower testicular weights when the experiment was terminated at 77 weeks of age. Error bars indicate ± SE, and asterisks indicate significance area between control and inhibin-α immunized animals resultant autochthonous tumors clearly showed morpho- [29]. However, inhibin-α immunization does affect peak logic and histologic characteristics more consistent with testosterone levels but testosterone is still produced in Leydig cell tumors and expressed the luteinizing hor- quantities sufficient to facilitate secretion of gonadotro- mone receptor (LHR), a cell surface marker traditionally pins [30]. Thus, the published evidence indicates that associated with Leydig cells rather than Sertoli cells [17]. Leydig cells appear to be present and quite functional Moreover, dysplasia in the SJL.AMH-SV40Tag trans- following inhibin-α immunization. genic mouse was consistently observed in cells within The current version of the inhibin-α vaccine is proto- the interstitial space between seminiferous tubules where typic and could be improved substantially with a few Leydig cells are located (Fig. 4b) and their derived simple refinements. Booster vaccinations may optimize tumors were identified by their characteristic polygonal the generated immunity and thereby provide greater in- shape with a large, granular cytoplasm and round nuclei hibition of tumor growth. The unresolved granulomas with single or multiple nucleoli [32]. We did not observe associated with CFA preclude its use for human vac- dysplastic cells within the seminiferous tubules where cination and will have to be replaced by a less toxic Sertoli cell tumors typically develop as clusters of large adjuvant that may still orchestrate a broad proinflam- tumor cells with eccentric nuclei and irregularly shaped matory immune response involving Th1, Th17, and cell membranes [33]. Thus, the well-documented, estab- Th9 T cells implicated in the induction of aggressive lished characteristics of Leydig cell tumors correlated tumor immunity [31]. well with the observed features of the autochthonous It is somewhat surprising that the autochthonous TSC TSC tumors that develop in SJL.AMH-SV40Tag trans- tumors that develop in male SJL.AMH-SV40Tag trans- genic mice. genic mice are of Leydig cell origin. In their original All this being said, the expression of anti-Müllerian report, Dutertre and colleagues [11] showed that expres- hormone (AMH) in Leydig cells remains a bit of an sion of the AMH-SV40Tag transgene in mice resulted in anomaly since AMH expression has traditionally been TSC tumors of Sertoli cell origin. However, after back- associated with Sertoli cell tumors rather than Leydig crossing for more than 20 generations from the original cell tumors [18] and AMH expression in normal cells is C57BL/6 background to the SJL/J background, the widely believed to be confined to Sertoli cells and not to Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 11 of 12 Leydig cells [34–37]. However, the AMH-SV40Tag Acknowledgements The authors wish to thank Dr. Ritika Jaini, Department of Genomic Medicine, transgene is clearly expressed in both Leydig cells and Cleveland Clinic, Cleveland, OH for her technical assistance and advice. Sertoli cells of SJL.AMH-SV40Tag transgenic mice (Fig. 4e) thereby implying that both cell types may ex- Funding This work was generously supported by a grant from the Andrew and Lillian press AMH and that transgene expression of SV40Tag A. Posey Foundation (VKT). The content of this study is solely the responsibility may predispose to creation of tumors of either cell type of the authors and does not necessarily represent the official views of the Lillian with Sertoli cell tumors predominating in the original A. Posey Foundation. The funding organization played no role in the design of the study, in the collection, analysis, and interpretation of data, or in writing the AT-t94 transgenic mouse generated in the C57BL/6 manuscript. (H-2 ) background strain and Leydig cell tumors pre- dominating when the AMH-SV40Tag transgene is Availability of data and materials The datasets generated and/or analyzed during the current study are available expressed in the SJL/J (H-2 ) background strain. Indeed, from the corresponding author on reasonable request. strain-specific predispositions may occur as a result of differential epigenetic factors that are capable of shaping Authors’ contributions RA was involved in all aspects of the study including experimental design, genetic outcomes [38]. performance of the experiments, data analysis, and preparation of the TSC tumors of the testis comprise less than 5% of tes- manuscript. JMM provided expert technical assistance throughout the study ticular cancers, and this rareness predisposes to being and was particularly instrumental in providing oversight in developing the recombinant inhibin-α protein and providing technical assistance with mo- overlooked with respect to developing and testing new lecular assays and data collection. PB provided expert technical assistance therapies for such uncommon tumors [3]. However, particularly with respect to flow cytometry analysis. VKT participated in experimen- stage I TSC tumors have 5 year overall survivals that are tal design, data analysis, interpretation, design and production of figures, manu- script preparation, and obtaining financial support for the project. All authors read significantly lower compared to those of stage I germ and approved the final manuscript. cell tumors that represent the vast majority of human testicular cancers [3]. Thus, though relatively rare, the Authors’ information Not applicable. enhanced lethality of TSC tumors begs for an improve- ment in treatment and clinical control. The results of Competing interests our current study indicate that inhibin-α vaccination The authors declare that they have no competing interests. may be useful and effective as an adjuvant therapy for Consent for publication TSC tumors particularly since the vast majority of TSC Not applicable. tumors express inhibin-α [5–9] and that these tumors Ethics approval and consent to participate occur in young men in the prime of their life at a me- This study did not involve any human subjects or human tissues. All protocols dian age of 43 years [3]. involving animals were pre-approved by the Cleveland Clinic’s Institutional Animal Care and Use Committee in compliance with the Public Health Service policy on humane care and use of laboratory animals. Conclusions We have developed and characterized an immunother- Publisher’sNote apy for the most lethal forms of testicular cancer, namely Springer Nature remains neutral with regard to jurisdictional claims in TSC tumors that include Leydig cell tumors and Sertoli published maps and institutional affiliations. cell tumors. Inhibin-α vaccination provides an immuno- Author details therapeutic option that is currently unavailable for pa- Department of Immunology, NB30, Lerner Research Institute, Cleveland Clinic, tients with these lethal forms of testicular cancer. If 2 9500 Euclid Avenue, Cleveland, OH 44195, USA. Department of Biology, administered as adjuvant therapy along with current Cleveland State University, Cleveland, OH, USA. Western Reserve Academy, Hudson, OH, USA. Department of Molecular Medicine, Cleveland Clinic Lerner standard of care, inhibin-α vaccination may strengthen College of Medicine of Case Western Reserve University, Cleveland, OH, USA. the natural immune defense against TSC tumors and thereby eliminate any residual local or systemic tumor Received: 14 October 2016 Accepted: 29 March 2017 cells. This novel way to control TSC tumors may have a substantial impact on the young men in the prime of References their lives who are typically affected by this disease. 1. Howlader N, Noone AM, Krapcho M, Miller D, Bishop K, Altekruse SF, Kosary CL, Yu M, Ruhl J, Tatalovich Z, Mariotto A, Lewis DR, Chen HS, Feuer EJ, Abbreviations Cronin KA (eds). SEER Cancer Statistics Review, 1975-2013, National Cancer AMH: Anti-Müllerian hormone; AIRE: Autoimmune regulator transcription Institute. Bethesda, MD, http://seer.cancer.gov/csr/1975_2013/, based on factor; CFA: Complete Freund's adjuvant; cpm: Counts per minute; November 2015 SEER data submission, posted to the SEER web site, April 2016. Cy5: Cyanine 5; FITC: Fluorescein isothiocyanate; FSH: Follicle stimulating 2. SEER Cancer Statistics Factsheets. Testis Cancer. National Cancer Institute. hormone; HPLC: High performance liquid chromatography; IFNγ: Interferon Bethesda, MD. http://seer.cancer.gov/statfacts/html/testis.html gamma; IPTG: Isopropylthiogalactopyronidase; LNC: Lymph node cells; 3. Banerji JS, Odem-Davis K, Wolff EM, Nichols CR, Porter CR. Patterns of care LHR: Luteinizing hormone receptor; MHC: Major histocompatibility complex; and survival outcomes for malignant sex cord stromal testicular cancer: Ni-NTA: Nickel-nitrilo triacetic acid; PE: Phycoerythrin; rmInα: Recombinant Results from the National Cancer Data Base. J Urol. 2016;196:1117–22. mouse inhibin-α; RT-PCR: Reverse transcription-polymerase chain reaction; 4. Hedger MP, Winnall WR. Regulation of activin and inhibin in the adult testis SV40Tag: Simian virus 40 large transforming antigen; TSC: Testicular stromal and the evidence for functional roles in spermatogenesis and immunoregulation. cell; TILs: Tumor infiltrating lymphocytes Mol Cell Endocrinol. 2012;359:30–42. Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 12 of 12 5. Kommoss F, Oliva E, Bittinger F, Kirkpatrick CJ, Amin MB, Bhan AK, Young particle vaccine among young women with preexisting infection: a randomized RH, Scully RE. Inhibin-alpha CD99, HEA125, PLAP, and chromogranin trial. JAMA. 2007;298:743–53. immunoreactivity in testicular neoplasms and the androgen insensitivity 27. Uhlén M, Fagerberg L, Hallström BM, Lindskog C, Oksvold P, Mardinoglu A, syndrome. Hum Pathol. 2000;31:1055–61. Sivertsson Å, Kampf C, Sjöstedt E, Asplund A, Olsson I, Edlund K, Lundberg 6. Taniyama H, Hirayama K, Nakada K, Numagami K, Yaosaka N, Kagawa Y, E, Navani S, Szigyarto CA, Odeberg J, Djureinovic D, Takanen JO, Hober S, Izumisawa Y, Nakade T, Tanaka Y, Watanabe G, Taya K. Alm T, Edqvist PH, Berling H, Tegel H, Mulder J, Rockberg J, Nilsson P, Immunohistochemical detection of inhibin-alpha, -betaB, and -betaA chains Schwenk JM, Hamsten M, von Feilitzen K, Forsberg M, Persson L, Johansson and 3beta-hydroxysteroid dehydrogenase in canine testicular tumors and F, Zwahlen M, von Heijne G, Nielsen J, Pontén F. Proteomics. Tissue-based normal testes. Vet Pathol. 2001;38:661–6. map of the human proteome. Science. 2015;347:1260419. 28. Suresh PS, Rajan T, Tsutsumi R. New targets for old hormones: inhibins clinical 7. Yu C-H, Hwang D-N, Yhee J-Y, Kim J-H, Im K-S, Nho W-G, Lyoo Y-S, Sur J-H. role revisited. Endocr J. 2011;58:223–35. Comparative immunohistochemical characterization of canine seminomas 29. Lovell TM, Knight PG, Groome NP, Gladwell RT. Measurement of dimeric and Sertoli cell tumors. 2009. J Vet Sci. 2009;10:1–7. inhibins and effects of active immunization against inhibin α-subunit on 8. Zheng W, Sung CJ, Hanna I, DePetris G, Lambert-Messerlian G, Steinhoff M, plasma hormones and testis morphology in the developing cockerel. Biol Lauchlan SC. Alpha and beta subunits of inhibin/activin as sex cord-stromal Reprod. 2000;63:213–21. differentiation markers. Int J Gynecol Pathol. 1997;16:263–71. 30. Voglmayr JK, Mizumachi M, Washington DW, Chen CL, Bardin CW. Immunization 9. Iczkowski KA, Bostwick DG, Roche PC, Cheville JC. Inhibin A is a sensitive of rams against human recombinant inhibin alpha-subunit delays, augments, and and specific marker for testicular sex cord-stromal tumors. Mod Pathol. extends season-related increase in blood gonadotropin levels. Biol Reprod. 1990; 1998;11:774–9. 42:81–6. 10. Dudley A, McKinstry W, Thomas D, Best J, Jenkins A. Removal of endotoxin 31. Ivanova EA, Orekhov AN. T helper lymphocyte subsets and plasticity in by reverse phase HPLC abolishes anti-endothelial cell activity of bacterially autoimmunity and cancer: an overview. Biomed Res Int. 2015;2015:327470. expressed plasminogen kringle 5. Biotechniques. 2003;35:724–6. 32. Al-Agha OM, Axiotis CA. An in-depth look at Leydig cell tumor of the testis. 11. Dutertre M, Rey R, Porteu A, Josso N, Picard JY. A mouse Sertoli cell line Arch Pathol Lab Med. 2007;131:311–7. expressing anti-Müllerian hormone and its type II receptor. Mol Cell Endocrinol. 33. Chang B, Borer JG, Tan PE, Diamond DA. Large-cell calcifying Sertoli cell 1997;136:57–65. tumor of the testis: case report and review of the literature. Urology. 1998; 12. Dutertre M, Gouédard L, Xavier F, Long WQ, di Clemente N, Picard JY, Rey R. 52:520–3. Ovarian granulosa cell tumors express a functional membrane receptor for 34. Guerrier D, Boussin L, Mader S, Josso N, Kahn A, Picard JY. Expression of the anti-Müllerian hormone in transgenic mice. Endocrinology. 2001;142:4040–6. gene for anti-Müllerian hormone. J Reprod Fertil. 1990;88:695–706. 13. Altuntas CZ, Jaini R, Kesaraju P, Jane-wit D, Johnson JM, Covey K, Flask CA, 35. Rouiller-Fabre V, Carmona S, Merhi RA, Cate R, Habert R, Vigier B. Effect of Dutertre M, Picard JY, Tuohy VK. Autoimmune mediated regulation of ovarian anti-Müllerian hormone on Sertoli and Leydig cell functions in fetal and tumor growth. Gynecol Oncol. 2012;124:98–04. immature rats. Endocrinology. 1998;139:1213–20. 14. Altuntas CZ, Johnson JM, Tuohy VK. Autoimmune targeted disruption of the 36. Rajpert-De Meyts E, Jørgensen N, Graem N, Müller J, Cate RL, Skakkebaek pituitary-ovarian axis causes premature ovarian failure. J Immunol. 2006;177: NE. Expression of anti-Müllerian hormone during normal and pathological 1988–96. gonadal development: association with differentiation of Sertoli and granulosa 15. Yasamura Y, Tashjian Jr AH, Sato GH. Establishment of four functional, clonal cells. J Clin Endocrinol Metab. 1999;84:3836–44. strains of animal cells in culture. Science. 1966;154:1186–9. 37. La Marca A, Sighinolfi G, Radi D, Argento C, Baraldi E, Artenisio AC, Stabile G, 16. Shin SI. Studies on interstitial cells in tissue culture: steroid biosynthesis in Volpe A. Anti-Mullerian hormone (AMH) as a predictive marker in assisted monolayers of mouse testicular interstitial cells. Endocrinology. 1967;81:440–8. reproductive technology (ART). Hum Reprod Update. 2010;16:113–30. 17. Shan LX, Hardy MP. Developmental changes in levels of luteinizing hormone 38. Koturbash I, Scherhag A, Sorrentino J, Sexton K, Bodnar W, Swenberg JA, receptor and androgen receptor in Leydig cells. Endocrinology. 1992;131: Beland FA, Pardo-Manuel Devillena F, Rusyn I, Pogribny IP. Epigenetic 1107–14. mechanisms of mouse interstrain variability in genotoxicity of the environmental 18. Rey R, Sabourin JC, Venara M, Long WQ, Jaubert F, Zeller WP, Duvillard P, toxicant 1,3-butadiene. Toxicol Sci. 2011;122:448–56. Chemes H, Bidart JM. Anti-Müllerian hormone is a specific marker of Sertoli- and granulosa-cell origin in gonadal tumors. Hum Pathol. 2000;31:1202–8. 19. Ciaputa R, Nowak M, Madej JA, Poradowski D, Janus I, Dziegiel P, Gorzynska E, Kandefer-Gola M. Inhibin-α, E-cadherin, calretinin and Ki-67 antigen in the immunohistochemical evaluation of canine and human testicular neoplasms. Folia Histochem Cytobiol. 2014;52:326–34. 20. Forage RG, Brown RW, Oliver KJ, Atrache BT, Devine PL, Hudson GC, Goss NH, Bertram KC, Tolstoshev P, Robertson DM, de Kretser DM, Doughton B, Burger HG, Findlay JK. Immunization against an inhibin subunit produced by recombinant DNA techniques results in increased ovulation rate in sheep. J Endocrinol. 1987;114:R1–4. 21. Morris DG, Browne D, Diskin MG, Sreenan JM. Effect of peptide to carrier ratio on the immune and ovarian response to inhibin immunization in cattle. Anim Reprod Sci. 1997;48:1–8. 22. Hennies M,Voglmayr JK,Dietrich E,Stollmann M, Moeller R, Holtz W. Hormonal response of female goats to active immunization against a recombinant human Submit your next manuscript to BioMed Central inhibin alpha-subunit, and establishment of an enzyme-linked immunosorbent assay for caprine follicle-stimulating hormone. Reprod Domest Anim. 2001;36:65–71. and we will help you at every step: 23. Delves PJ, Lund T, Roitt IM. Antifertility vaccines. Trends Immunol. 2002;23: • We accept pre-submission inquiries 213–9. 24. Kennedy R, Celis E. Multiple roles for CD4+ T cells in anti-tumor immune � Our selector tool helps you to find the most relevant journal responses. Immunol Rev. 2008;222:129–44. � We provide round the clock customer support 25. Haabeth OA, Tveita AA, Fauskanger M, Schjesvold F, Lorvik KB, Hofgaard PO, � Convenient online submission Omholt H, Munthe LA, Dembic Z, Corthay A, Bogen B. How Do CD4(+) T Cells Detect and Eliminate Tumor Cells That Either Lack or Express MHC � Thorough peer review Class II Molecules? Front Immunol. 2014;5:174. � Inclusion in PubMed and all major indexing services 26. Hildesheim A, Herrero R, Wacholder S, Rodriguez AC, Solomon D, Bratti MC, � Maximum visibility for your research Schiller JT, Gonzalez P, Dubin G, Porras C, Jimenez SE, Lowy DR, Costa Rican HPV Vaccine Trial Group. Effect of human papillomavirus 16/18 L1 viruslike Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal for ImmunoTherapy of Cancer Springer Journals

Vaccination with inhibin-α provides effective immunotherapy against testicular stromal cell tumors

Download PDF
12 pages

Loading next page...
 
/lp/springer-journals/vaccination-with-inhibin-provides-effective-immunotherapy-against-nKNrLSwz3f

References (51)

Publisher
Springer Journals
Copyright
Copyright © 2017 by The Author(s).
Subject
Medicine & Public Health; Oncology; Immunology
eISSN
2051-1426
DOI
10.1186/s40425-017-0237-2
pmid
28428886
Publisher site
See Article on Publisher Site

Abstract

Background: Testicular cancer is the most common male neoplasm occurring in men between the ages of 20 and 34. Although germ-line testicular tumors respond favorably to current standard of care, testicular stromal cell (TSC) tumors derived from Sertoli cells or Leydig cells often fail to respond to chemotherapy or radiation therapy and have a 5-year overall survival significantly lower than the more common and more treatable germ line testicular tumors. Methods: To improve outcomes for TSC cancer, we have developed a therapeutic vaccine targeting inhibin-α,a protein produced by normal Sertoli and Leydig cells of the testes and expressed in the majority of TSC tumors. Results: We found that vaccination against recombinant mouse inhibin-α provides protection and therapy against transplantable I-10 mouse TSC tumors in male BALB/c mice. Similarly, we found that vaccination with the immunodominant p215-234 peptide of inhibin-α (Inα 215-234) inhibits the growth of autochthonous TSC tumors occurring in male SJL.AMH-SV40Tag transgenic mice. The tumor immunity and enhanced overall survival induced by inhibin-α vaccination may be passively transferred into naive male BALB/c recipients with either CD4+ T cells, B220+ B cells, or sera from inhibin-α primed mice. Conclusions: Considering the lack of any alternative effective treatment for chemo- and radiation-resistant TSC tumors, our results provide for the first time a rational basis for immune-mediated control of these aggressive and lethal variants of testicular cancer. Keywords: Testicular cancer, Stromal cell cancer, Cancer vaccines, Leydig cell tumors, Sertoli cell tumors Background against testicular stromal cell (TSC) tumors. To this Testicular cancers are the most common solid tumors end, we have developed an immunotherapeutic ap- occurring in young men aged 20–34 with a median age proach for providing improved control over TSC at diagnosis of 33 [1, 2]. The vast majority of testicular tumors and enhanced overall survival. cancers are germ cell tumors that have a 5-year overall Our approach involved immune targeting of inhibin-α, survival rate exceeding 95% when treated early with sur- a gonadal protein that belongs to the transforming gery, chemotherapy, and/or radiation therapy [1, 2]. growth factor beta superfamily and plays a role in regu- However, a small percentage of testicular tumors de- lating secretion of pituitary follicle stimulating hormone velop in the hormone-producing cells of the stroma through a negative feedback mechanism [4]. Inhibin-α is including Leydig and Sertoli cell tumors that respond a 366 amino acid protein with a molecular mass of 39.56 poorly to current standard of care and have 5-year kDa (GenBank: EDL00422.1). Inhibin-α restricts the survival rates of 91% and 77%, respectively [3]. Thus, production of mature ovarian follicles in mammalian there is a great need for more effective treatments females and regulates spermatogenesis, steroidogenesis, and germ cell development in males [4]. Inhibin-α is * Correspondence: tuohyv@ccf.org produced by normal TSC and is expressed and produced Department of Immunology, NB30, Lerner Research Institute, Cleveland Clinic, in the majority of human and canine TSC tumors [5–7]. 9500 Euclid Avenue, Cleveland, OH 44195, USA Moreover, several studies indicate that inhibin-α is a Department of Biology, Cleveland State University, Cleveland, OH, USA Full list of author information is available at the end of the article © The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 2 of 12 useful marker for human TSC tumors with intense im- (Qiagen). The purity of affinity purified rmInα was munohistochemical staining of inhibin-α occurring typ- gauged by SDS-PAGE and Western blot analysis using ically in >90% of Leydig and Sertoli cell tumors but in mouse inhibin-α antibody at 1/200 dilution and second- only about 10% of testicular germ cell tumors [5, 8, 9]. ary detection antibody at 1/5,000 dilution (Santa Cruz Therefore, inhibin-α stands out prominently as a poten- Biotechnology, Dallas, TX). Prior to use in vitro, the tially useful vaccine target for providing immunotherapy inhibin-α protein was further purified by reverse phase against TSC tumors. high performance liquid chromatography (HPLC) to Here we show that vaccination of male BALB/c mice yield endotoxin-free protein [10]. Levels of endotoxin with recombinant mouse inhibin-α (rmInα) induces a were < 5 pg/mg recombinant protein. type-1/type-17 proinflammatory T cell response suffi- cient to inhibit the growth of transplantable I-10 TSC Generation of SJL.AMH-SV40Tag transgenic mice and tumor cells using both prevention and treatment proto- autochthonous TSC tumors cols. Tumors from mice vaccinated with rmInα are The AT-t94 transgenic mouse was generously provided extensively infiltrated with CD3+ T cells, many of which by Dr. Jean-Yves Picard, Biologie Fonctionnelle et are activated CD4 + CD44+ T cells. The immunity Adaptative Université, Paris, France. This mouse ex- against TSC tumors could be transferred into naive re- presses a fusion construct containing 3.6 kb of the 5' cipient BALB/c males using inhibin-α primed CD4+ T flanking region of the human anti-Müllerian hormone cells, B220+ B cells, or sera but not with inhibin-α (AMH) gene upstream of the SV40 proto-oncogene en- primed CD8+ T cells. We also found that vaccination coding the large transforming antigen (SV40Tag) [11, 12]. with the p215-234 immunodominant peptide of mouse Female AT-t94 mice develop a high incidence of autoch- inhibin-α (Inα 215-234) provides significant inhibition of thonous granulosa cell tumors and male AT-t94 trans- autochthonous TSC tumor growth occurring spontan- genic mice develop a high incidence of autochthonous eously in SJL.AMH-SV40Tag transgenic mice. Taken to- TSC tumors [11, 12]. Male AT-t 94 transgenic mice ex- gether, our data support the view that vaccination pressing the H-2 haplotype of the major histocompatibil- against inhibin-α has the potential to provide significant ity complex (MHC) were mated at the Cleveland Clinic immunotherapy against TSC tumors that may prove with female SJL/J (H-2 ) mice obtained commercially useful in the adjuvant setting for control of this aggres- (Jackson Laboratory, Bar Harbor, ME). The resultant SJL × b,s sive form of testicular cancer and for enhancing the AT-t94 (H-2 ) transgenic offspring were backcrossed for overall survival of patients with these tumors. over 20 generations to SJL/J mice producing SJL.AMH- SV40Tag (H-2 ) transgenic mouse used in the current Methods study. Female SJL.AMH-SV40Tag transgenic mice develop Generation of recombinant mouse inhibin-α (rmInα) granulosa cell tumors starting at 8-10 months of age and Total RNA was purified from testes of 8 week old show an incidence of affected ovaries that exceeds 90% by BALB/c male mice using the RNeasy Mini Kit (Qiagen, 18 months of age [13]. Moreover, the emergence and Valencia, CA), and the RNA was stabilized in RNAlater growth of autochthonous granulosa cell tumors in female (Qiagen). cDNA was generated with random hexamers SJL.AMH-SV40Tag transgenic mice is inhibited by vaccin- using the SuperScript III First-Strand Synthesis Super- ation with the IA -restricted Inα 215-234 peptide of Mix (ThermoFisher Scientific, Waltham, MA). Inhibin-α mouse inhibin-α [13, 14]. In our hands, male SJL.AMH- cDNA was amplified using the AmpliTaq Gold DNA SV40Tag transgenic mice develop unilateral and bilateral Polymerase LD kit (ThermoFisher Scientific) with Leydig cell tumors at around 75 weeks of age and are able CCTAGGCAGGAAGAGCACAG as forward primer to respond to the IA -restricted Inα 215-234. SJL.AMH- and ACCTCCATCTGAGGTGGTTC as reverse primer. SV40Tag transgenic mice were identified by RT-PCR amp- The inhibin-α cDNA sequence was inserted into the lification of the human AMH promoter from tail DNA. NdeI-Bam HI sites of the pET-3a expression vector (GeneArt AG, Regensburg, Germany) thereby providing The I-10 mouse testicular cancer cell line and the a C-terminal 6 × His-tagged recombinant protein after transplantable TSC tumor model plasmids containing this insert was transformed in BL21 The I-10 (ATCC® CCL83™) mouse testicular cancer cell Star E. coli (Lucigen, Middleton, WI). High level expres- line was purchased from the American Type Culture sion colonies were selected following induction with iso- Collection (ATCC, Manassas, VA). I-10 cells are hyper- propyl β-D-1-thiogalactopyranoside (IPTG; Amresco, diploid, epithelial-like Leydig tumor cells derived from Solon, OH) and were sequenced for confirming proper male BALB/c mice using a single-cell plating technique orientation and alignment. The 6 × His-tagged protein [15, 16]. I-10 cells were grown in F-12K media (ATTC was purified under denaturing conditions using nickel- #30-2004) supplemented with 2.5% heat inactivated fetal nitrilo triacetic acid (Ni-NTA) affinity chromatography bovine serum and 15% heat inactivated horse serum Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 3 of 12 (ThermoFisher Scientific). Prior to use, all media were after immunization or spleens were removed 8 weeks filtered through a 0.2 μm Nalgene Rapid-Flow Dispos- after immunization. Each population was cultured with able Bottle Top Filter (ThermoFisher Scientific). The immunogen at various doses in triplicate 96-well flat- I-10 cells were culture as a single-cell suspension in bottom microtiter Falcon plates (BD Biosciences, San 2 5 75-cm tissue culture flask (ThermoFisher Scientific) Jose, CA) at 3 × 10 cells/well in a total volume of 200 μl and cultured at 37 °C in humidified air and 5% CO with of DMEM (Mediatech, Manassas, VA) supplemented intermittent feeding using warm fresh media. At 70–75% with1% penicillin/streptomycin, 2% L-glutamine, 5% confluence, adherent cells were disrupted mechanically HEPES buffer (Invitrogen Life Technologies, Grand and enzymatically by adding 10 ml F-12K media con- Island, NY), and 10% fetal bovine serum (Hyclone, taining 0.25% trypsin and 0.02% EDTA (ThermoFisher Logan, UT). Positive control wells contained 2 μg/ml Scientific). After centrifugation and thorough washing in anti-mouse CD3 (BD Biosciences), negative control wells PBS, pelleted cells were recultured in supplemented contained no antigen, and specificity controls contained F-12K media or resuspended in PBS for subcutaneous grade VII ovalbumin (Sigma-Aldrich, St. Louis, MO) at inoculation of 2 × 10 cells in the lumbar region of 8–10 various doses. In all cases, proliferation was determined week-old BALB/cJ males purchased commercially after 96 h of culture when wells were pulsed with 1.0 (Jackson Laboratory). Tumors were measured daily by μCi/well thymidine, [methyl-3H]-, specific activity: 6.7 Vernier caliper and mice were euthanized when tumors Ci/mmol (PerkinElmer, Waltham, MA) and harvested 16 reached 17 mm in either length or width. BALB/c mice h later by aspiration onto glass fiber filters. Levels of in- typically developed palpable tumors within 28 days after corporated radioactivity were determined by scintillation inoculation. spectrometry. Results are expressed as mean counts per minute (cpm) of experimental cultures with anti- Peptide synthesis gen divided by mean cpm of cultures without antigen Inα 215-234, FLVAHTRARAPSAGERARRS, was synthe- (stimulation index). In all proliferation assays, mean sized by the Molecular Biotechnology Core Facility of cpm of cultures without antigen ranged between 500 the Lerner Research Institute using standard solid phase and 2000 cpm. methodology and FMOC side chain-protected amino acids. The peptide was purified > 97% by reverse phase ELISPOT assays HPLC, and amino acid composition was confirmed by Ten days after immunization with either rmInα or Inα mass spectrometry. 215-234, frequencies of type-1, type-2, and type-17 T cells responding to each immunogen were determined Mice and immunization by ELISPOT analysis using capture/detection antibody Male BALB/cJ mice were obtained commercially pairs for interferon-gamma (IFNγ), IL-5, and IL-17 (Jackson Laboratory) at 6-7 weeks of age and usually im- (ThermoFisher Scientific), respectively. Duplicate or munized at 8–10 weeks of age by subcutaneous injection triplicate wells containing 5 × 10 LNC were cultured in the abdominal flank with 100 μgofrmInα protein in with 50 μg/ml immunogen or the irrelevant control anti- 200 μl of an emulsion of equal volumes of water and gen, grade VII ovalbumin (Sigma-Aldrich) in ELISPOT complete Freund's adjuvant (CFA) containing 400 μgof plates (Millipore, Billerica, MA) pre-coated with capture Mycobacteria tuberculosis H37RA (Difco, Detroit, MI). antibodies in 200 μl/well total culture volume in DMEM In the treatment protocol, all experimental BALB/cJ (Mediatech) supplemented as described above. At 72 h mice were inoculated on the same day with 2 × 10 I-10 of culture, wells were treated with corresponding bio- cancer cells thereby ensuring an equal initial tumor load. tinylated detection antibodies and after overnight incu- When the first tumor became palpable in any mouse, all bation and washing, spots were visualized by sequential mice in that treatment group were vaccinated. Although treatment with alkaline phosphatase-conjugated strepta- not all mice had palpable tumors on the day of vac- vidin and 5-bromo-4-chloro-3-indolyl phosphate sub- cination, all had palpable tumors within a day or two strate (R&D Systems, Minneapolis, MN). The reaction thereafter. Male SJL.AMH-SV40Tag transgenic mice was halted after 10 min by repeated washing with were immunized at 8–10 weeks as described above double-distilled deionized H O, and spots were devel- but with 100 μgofInα 215-234 peptide. All mice oped and counted using an ImmunoSpot S6 analyzer were euthanized by asphyxiation with CO followed with proprietary ImmunoSpot 5.1 software (Cellular by cervical dislocation. Technologies Limited, Shaker Heights, OH). In some ex- periments, CD4+ and CD8+ T cells were purified from Proliferation assays primed LNC by negative selection using anti-CD4- and To characterize the immune response to rmInα and Inα anti-CD8-coated magnetic beads and double passage 215-234, lymph node cells (LNC) were removed 10 days through a MACS LS column using a MidiMACS cell Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 4 of 12 separator (Miltenyi Biotec, San Diego, CA). The Isolation of tumor infiltrating lymphocytes (TILs) and flow enriched T cells were activated with various doses of im- cytometry analysis munogen in cultures containing 3 × 10 T cells/microti- Leukocytes were isolated from I-10 tumors by digestion ter well and 5 × 10 γ-irradiated (25 Gy) syngeneic of minced tissue for 30 min at 37 °C in HBSS (Thermo- splenocyte feeders. Fisher Scientific) containing 50 Kunitz Units (KU) of DNase I (Sigma-Aldrich) and 0.2 mg/ml collagenase II (ThermoFisher Scientific). Cells were then collected by ELISA assays discontinuous gradient centrifugation and the enriched Cytokine concentrations were determined by ELISA TILs were triple-stained with commercially available measurement of 48-h supernatants of 10-day-primed (ThermoFisher Scientific) CD3-specific antibody conju- LNC cultured in supplemented DMEM at 5 × 10 cells/ gated with fluorescein isothiocyanate (FITC), CD44- well in 24-well flat-bottom Falcon plates (BD Biosci- specific antibody conjugated with cyanine 5 (Cy5), and ences) in the presence of 20 μg/ml antigen in a final vol- either CD4-specific antibody conjugated with phyco- ume of 2.0 ml/well. Affinity purified capture/detection erythrin (PE) or CD8-specific antibody conjugated with antibody pairs and recombinant cytokines (Thermo- PE. Data were collected on 30,000 total events using a Fisher Scientific) were used to measure supernatant con- Becton-Dickinson FACSAria II flow cytometer (BD Bio- centrations of IFNγ, IL-5, and IL-17. Absorbance was sciences) and analyzed using FlowJo software (FlowJo, measured at 405 nm using a model 550 ELISA micro- Ashland, OR) after gating on the CD3+ population. plate reader (Bio-Rad Laboratories, Hercules, CA). Standard values were plotted as absorbance vs. cytokine Histology concentration, and sample cytokine concentrations were Mouse testes and TSC tumors were fixed in 10% determined as values within the linear part of the stand- phosphate-buffered formalin (ThermoFisher Scientific) ard curve established using known concentrations of for 24 h and stored in 70% ethanol until processed for each cytokine. embedding in paraffin. Slides with multiple 6 μm tissue sections were stained with hematoxylin and eosin (Richard-Allan Scientific, Kalamazoo, MI), dehydrated in Antibody isotyping an ascending gradient of ethanol followed by xylene, and Isotype-specific serum antibody titers to rmInα were de- mounted in Cytoseal 60 (Stephens Scientific, Riverdale, termined using the mouse MonoAB ID/SP ELISA kit NJ) for examination by light microscopy. (Zymed Laboratories, South San Francisco, CA). Immunohistochemistry Prior to immunostaining using the ImmunoCruz rabbit Passive transfer of tumor immunity LSAB Staining System (Santa Cruz Biotechnology), Three weeks after immunization of BALB/c male tissue antigens were unmasked by heat treatment as per mice with rmInα, CD4+ T cells, CD8+ T cells, and the manufacturer’s instructions. Briefly, prepared slides B220+ B cells, were enriched (>90%) from splenocytes were treated with 10 mM sodium citrate buffer (pH 6) by magnetic bead separation as described above. The and heated to 95 °C. This process was then repeated enriched T cells were cultured in supplemented 6 with fresh buffer. After the slides cooled, they were DMEM at 5 × 10 cells/well in 24-well flat-bottom washed with double distilled deionized H O and the ex- Falcon plates (BD Biosciences) in the presence of 20 cess liquid was aspirated. After unmasking and blocking μg/ml antigen in a final volume of 2.0 ml/well. Each 6 formalin-fixed 6 μm paraffin embedded tissues sections, well also contained 5 × 10 γ-irradiated (25 Gy) syn- antigens were detected using primary antibodies against geneic splenocyte feeders as antigen presenting cells. luteinizing hormone receptor (LHR; Santa Cruz Biotech- After 72 h of culture, cells were washed thoroughly 7 nology), AMH (Abcam, San Francisco, CA), SV40Tag and 2–3×10 cells were injected intraperitoneally into (Santa Cruz Biotechnology), and mouse CD3 (Novacastra, naive recipient male BALB/c mice in a total volume Buffalo Grove, IL). All primary antibodies were used at a of 200 μl PBS. For serum transfer experiments, recipi- 1/1000 dilution. ents of rmInα-primed and ovalbumin-primed CD4+ T cells were bled at euthanasia by cardiac puncture. Cell-free sera were collected and 200 μl of pooled Biostatistical analysis sera were injected intravenously into each naive Differences between mean tumor weights and mean BALB/c male recipient. After transfer of cells or tumor areas were compared using the Student’s t test. serum, mice were inoculated later on the same day Differences in Kaplan-Meier survival curves with 17 mm with I-10 TSC tumor cells as described above. tumor endpoints were compared with the log-rank test. Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 5 of 12 Results Immunogenicity of rmInα Generation of recombinant mouse inhibin-α (rmInα) To determine the immunogenicity of rmInα,8–10 week We selected inhibin-α as our vaccine target for immuno- old male BALB/c mice were immunized with rmInα, therapy against TSC tumors because it is expressed and pro- and ten days later, LNC were tested for recall prolifera- duced in the majority of mouse and human TSC tumors tive responsiveness to the priming rmInα immunogen [5–9]. Inhibin-α cDNA was inserted into the pET-3a expres- and to ovalbumin as a specificity control. The results sion vector to produce a 6 × His-tagged fusion protein after showed that immunization with rmInα induced an IPTG induction in BL21 Star E. coli.Coomassiebluestain- antigen-specific response to the priming rmInα immu- ing showed that the induced protein and the HPLC purified nogen (Fig. 1b). This immunogenicity was confirmed by protein migrate on SDS-PAGE at the anticipated molecular ELISPOT analysis that showed increased frequencies of mass of 39.56 kDa (Fig. 1a, left panel). Western blotting proinflammatory type-1 and type-17 T cells producing using a primary antibody specific for mouse inhibin-α (Santa IFNγ and IL-17, respectively, but no increased frequen- Cruz Biotechnology) confirmed the identity and purity of cies of T cells producing the regulatory cytokine IL-5 the generated rmInα protein (Fig. 1a, right panel). (Fig. 1c). In addition, ELISA analysis of supernatants Fig. 1 Immunogenicity of recombinant mouse inhibin-α (rmInα). a Coomassie blue staining (left panel) showed migration of affinity purified and HPLC purified rmInα on an SDS-PAGE gel at the anticipated molecular mass of 39.56 kDa. This correct molecular mass migration was confirmed by Western blot analysis of the HPLC purified protein using an antibody specific for mouse inhibin-α (right panel). b 8-10 week old male BALB/c mice were immunized with rmInα, and ten days later, LNC were tested for recall proliferative responsiveness. c Immunogenicity was confirmed by ELISPOT analysis of type-1, type-2, and type-17 T cells expressing IFNγ, IL-5, and IL-17, respectively. d Immunogenicity was also confirmed by ELISA measurement IFNγ, IL-5, and IL-17 concentrations in supernatants of rmInα primed LNC reactivated with antigen. e ELISPOT analysis of responses from purified T cell subpopulations showed that the response to rmInα was elicited predominantly from CD4+ T cells. f Serum antibody titers from BALB/c male mice 3 weeks after immunization with rmInα showed differential production of IgG isotypes. Error bars indicate ± SE Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 6 of 12 from rmInα primed LNC reactivated with antigen to cell transfer, T cells were cultured for 72 h with the showed production of the proinflammatory cytokines priming immunogen whereas B cells were transferred IFNγ and IL-17 but not production of the regulatory without prior restimulation. The purified cells were cytokine IL-5 (Fig. 1d). ELISPOT analysis of responses injected intraperitoneally into naive BALB/c male mice from purified T cell subpopulations showed that the re- that were inoculated on the same day with I-10 TSC sponse to rmInα was elicited predominantly from CD4+ tumor cells. Our results showed that transfer of CD4+ T T cells (Fig. 1e). Finally, high titer serum antibody cells primed against rmInα provided highly significant responses to rmInα were evident by 3 weeks after protection (P < 0.001) against the growth of I-10 TSC tu- immunization with IgG1 and IgG2b providing the pre- mors (Fig. 3a) and that this protection provided a highly dominant isotypes even at serum dilutions exceeding 1/ significant increase (P < 0.001) in overall survival com- 8,000 (Fig. 1f). pared to recipients of ovalbumin primed CD4+ T cells (Fig. 3b). In contrast, transfer of rmInα primed CD8+ T Vaccination against rmInα inhibits growth of transplantable cells failed to provide protection against the growth of TSC tumors I-10 TSC tumors (Fig. 3c) or enhancement of overall To determine whether rmInα vaccination could prevent survival (Fig. 3d). In addition, we found that transfer of the growth of transplantable TSC tumors, eight week- rmInα primed B220+ B cells provided significant protec- old male BALB/c mice were vaccinated with rmInα, and tion (P = 0.003) against the growth of I-10 TSC tumors eight days later inoculated with 2 × 10 I-10 TSC tumor (Fig. 3e) and a significant increase (P = 0.001) in overall cells. The results showed significant inhibition of tumor survival (Fig. 3f). Finally, transfer of serum from mice growth (P = 0.009) in rmInα vaccinated mice compared that received rmInα primed CD4+ T cells also provided to control mice vaccinated with CFA alone (Fig. 2a). To significant protection (P = 0.001) against the growth of determine whether rmInα vaccination could be used to I-10 TSC tumors (Fig. 3g) and significantly enhanced treat established TSC tumors, tumor inoculated BALB/c (P = 0.001) overall survival (Fig. 3h). Thus, our data mice were vaccinated when TSC tumors became palp- indicate that CD4+ T cells, B220+ B cells, and serum able. Again, rmInα vaccination showed significant inhib- specific for rmInα are independently capable of sig- ition of tumor growth (P = 0.001) in rmInα vaccinated nificantly inhibiting growth of I-10 TSC tumors. mice compared to control mice vaccinated with CFA alone (Fig. 2b). Immunohistochemical analysis showed Immunohistochemical analysis of autochthonous TSC tumors virtually no CD3+ T cells in I-10 TSC tumors 32 days Testis tissue taken from normal 75 week-old male SJL/J after vaccination with CFA alone (Fig. 2c) whereas mice showed normal non-transformed Leydig cells in extensive CD3+ T cell infiltrates occurred in I-10 TSC the interstitial space between seminiferous tubules tumors 32 days after vaccination with rmInα (Fig. 2d). (Fig. 4a). In contrast, testis tissue taken from 75 week- Thus, CD3+ tumor infiltrating lymphocytes (TILs) were old male SJL.AMH-SV40Tag mice show transformed consistently observed only in mice vaccinated with re- Leydig cell tumors in the interstitial space between sem- combinant mouse inhibin-α, and these were the only iniferous tubules (Fig. 4b). Immunohistochemical detec- mice that showed inhibited growth of TSC tumors. Flow tion of the Leydig cell marker luteinizing hormone cytometry analysis of the gated CD3+ population indi- receptor (LHR) [17] showed localization in autochthon- cated that 28.3% of the TILs were CD3 + CD4+ T cells ous TSC tumors from 75 week-old male SJL.AMH- (Fig. 2e, upper left panel) and 38.6% of these CD4+ T SV40Tag transgenic mice (Fig. 4c). In addition, TSC cells expressed the CD44 activation marker (Fig. 2e, tumors from 75 week-old male SJL.AMH-SV40Tag mice upper right panel). In contrast, only 15% of TILs were also expressed anti-Müllerian hormone (AMH; Fig. 4d), CD3 + CD8+ T cells (Fig. 2, lower left panel) and only a protein traditionally associated with Sertoli cell tumors 22.6% of these CD8+ T cells expressed the CD44 activa- that would ordinarily develop within the seminiferous tion marker (Fig. 2e, lower right panel). tubules and not in the interstitial space where Leydig cell tumors develop [18]. TSC tumors from male SJL.AMH- Passive transfer of tumor immunity SV40Tag transgenic mice also expressed the SV40Tag To determine which lymphocytes were responsible for from the transgene (Fig. 4e). Finally, the TSC tumors the induced tumor immunity, we transferred defined expressed inhibin-α (Fig. 4f), a protein expressed in the purified lymphocyte populations into naive tumor inocu- majority of Leydig cell tumors [5–9, 19] but also lated recipients. Eight week-old male BALB/c mice were expressed in a substantial number of Sertoli cell tumors immunized with either rmInα or with ovalbumin as a [5]. We estimate that about 88% of inhibin-α positive control immunogen. Three weeks later, primed CD4+ T TSCs show malignant changes. Thus, the TSC autoch- cells, CD8+ T cells, and B220+ B cells were purified thonous tumors that grow spontaneously in SJL.AMH- from splenocytes using magnetic bead separation. Prior SV40Tag transgenic mice have many of the characteristics Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 7 of 12 Fig. 2 Vaccination against rmInα inhibits growth of transplantable TSC tumors. Significant inhibition of transplantable tumor growth occurred when rmInα vaccination occurred (a) prophylactically 8 days prior to inoculation with 1-10 TSC tumor cells or (b) as treatment of palpable I-10 TSC tumors. (c) Immunohistochemical analysis showed virtually no CD3+ T cells in I-10 TSC tumors 32 days after vaccination with CFA alone whereas (d)extensive CD3+ T cell infiltrates were evident in I-10 tumors taken from mice 32 days after vaccination against rmInα. Arrows point to examples of CD3+ T cells. (e) Flow cytometry analysis showed that 28.3% of the TILs were CD3 + CD4+ T cells (upper left panel) and 57.9% of these CD4+ T cells expressed the CD44 activation marker (upper right panel). Only 15% of TILs expressed the CD3 + CD8+ phenotype (lower left panel) and only 66.1% of these CD8+ T cells expressed the CD44 activation marker (lower right panel). Error bars indicate ± SE, and asterisks indicate significance of Leydig cell tumors but also express AMH, a marker 215-234. Whole LNC and CD4+ T cells but not CD8+ T traditionally associated with tumors of Sertoli cell origin. cells purified from the primed LNC by magnetic bead sep- aration showed high frequencies of antigen-specific IFNγ- Vaccination against rmInα inhibits growth of autochthonous secreting T cells in recall responses to Inα 215-234 (Fig. 5b). TSC tumors To determine whether vaccination against Inα 215-234 Male SJL.AMH-SV40Tag transgenic mice that develop au- could inhibit the growth of autochthonous TSC tumors, tochthonous TSC tumors also express the MHC H-2 male SJL.AMH-SV40Tag mice were vaccinated at eight haplotype that allows them to respond by proliferation to weeks of age with Inα 215-234 in CFA or with CFA alone the immunodominant IA -restricted Inα 215-234 peptide as control. We found that Inα 215-234 vaccination pro- (Fig. 5a). The immunogenicity of Inα 215-234 in SJL.AMH- vided significant protection (P < 0.001) against the emer- SV40Tag transgenic mice was confirmed by ELISPOT ana- gence and growth of autochthonous TSC tumors (Fig. 5c). lysis of LNC taken 10 days after immunization with Inα This growth inhibition was confirmed when Inα 215-234 Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 8 of 12 Fig. 3 Passive transfer of tumor immunity. a Transfer of purified rmInα primed CD4+ T cells into naïve BALB/c recipient male mice provided highly significant protection against the growth of subsequently inoculated I-10 TSC tumors and (b) this protection resulted in a highly significant increase in overall survival compared to recipients of ovalbumin primed CD4+ T cells. c Transfer of rmInα primed CD8+ T cells failed to provide protection against the growth of I-10 tumors and (d) failed to enhance overall survival. (e) Transfer of rmInα primed B220+ B cells provided significant protection against the growth of I-10 TSC tumors and (f) significantly enhanced overall survival. g Transfer of serum from mice that received rmInα primed CD4+ T cells also provided significant protection against the growth of I-10 TSC tumors and (h) significantly enhanced overall survival. Error bars indicate ± SE, and asterisks indicate significance vaccinated mice showed significantly lower testicular could be transferred into naive recipients with inhibin-α weights (P = 0.02) when the experiment was terminated at primed CD4+ T cells, B cells, or serum but not with 77 weeks of age (Fig. 5d). primed CD8+ T cells. Although there is a shortage of data showing the im- Discussion munogenicity of inhibin-α in humans, several studies We have shown that a targeted immune response have shown substantial immunogenicity of inhibin-α fol- against inhibin-α is capable of inhibiting the growth of lowing immunization of mice, rats, goats, sheep, and cat- TSC tumors in mice. Inhibition of tumor growth oc- tle [20–23]. These studies suggest that inhibin-α would curred using both therapeutic and prophylactic protocols be similarly immunogenic in humans and therefore and was effective against both autochthonous and trans- likely useful as a vaccine target for immunotherapy of plantable tumors. Inhibin-α vaccination inhibited TSC human TSC tumors. tumor growth in both SJL/J and BALB/c mice and the It is noteworthy that transfer of either primed CD4+ T effectiveness was associated with tumor infiltrates of ac- cells (Fig. 3a), B cells (Fig. 3e), or sera (Fig. 3g) on the tivated CD4+ T cells. Moreover, the tumor immunity day of tumor inoculation provides superior tumor Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 9 of 12 transfer of primed sera. This enhanced tumor immunity suggests that helper function may not be the only way CD4+ T cells contribute to the TSC tumor immunity. CD4+ T cells can directly kill MHC class II positive tumor cells in a perforin/granzyme B cell-dependent manner and can indirectly eliminate tumor cells that lack expression of MHC class II by cytokine-mediated activation of macrophages [24, 25]. Experiments to de- termine how CD4+ T cells mediate inhibition of TSC tumor growth are ongoing as are experiments to deter- mine whether antibodies mediate inhibition of TSC tumor growth by neutralization of inhibin-α or by complement-dependent cytotoxicity. Our data clearly show that prophylactic inhibin-α vac- cination provides results that are far superior to those obtained by therapeutic vaccination when the tumor has already grown and developed (Fig. 2a and b). Moreover, it is our view that virtually all vaccines function best when used prophylactically and that the earlier the im- munity is provided, the better is the clinical outcome. This view is supported by the remarkable success of childhood vaccines that are designed to prevent rather than treat infectious diseases like polio, measles, and mumps. Though dramatically effective in preventing dis- ease, these traditional childhood vaccines have little im- pact on viral clearance when vaccination occurs after Fig. 4 Immunohistochemical analysis of autochthonous TSC tumors. infection and have no detectable efficacy in alleviating a Testis tissue taken from normal 75 week-old male SJL/J mice showed normal non-transformed Leydig cells in the interstitial space between disease when vaccination occurs after the appearance of the seminiferous tubules (arrows; bar = 25 μm). b Testis tissue taken clinical signs [26]. from 75 week-old male SJL.AMH-SV40Tag mice showed transformed The autoimmune consequences of inhibin-α vaccin- Leydig cell tumors in the interstitial space between the seminiferous ation must be considered. In normal human male tis- tubules (arrows; bar = 25 μm), and positive staining for (c) luteinizing sues, high levels of inhibin-α expression is confined to hormone receptor (LHR), a traditional Leydig cell marker (arrows; bar = 10 μm), d anti- Müllerian hormone (AMH), a traditional Sertoli cell marker the Sertoli cells and Leydig cells of the testis and to the (arrows; bar = 10 μm), e the transgene derived SV40Tag in Leydig cells glandular cells of the adrenal gland [27]. Inhibin-α nega- (short arrows) and Sertoli cells (long arrow; bar = 25 μm), and (f) inhibin-α, tively regulates pituitary secretion of follicle stimulating a protein commonly expressed in both Leydig cell tumors and Sertoli cell hormone (FSH) and has been shown to affect several tumors (arrows; bar = 25 μm) other processes including cell proliferation, apoptosis, immunity, steroid hormone production, spermatogen- immunity when compared to active immunization on esis, and germ cell development [4, 28]. Although the day when tumors become palpable (Fig. 2b). We be- inhibin-α vaccination may be useful in inhibiting growth lieve that this is due primarily to the fact that in the and metastasis of human TSC tumors, the tradeoff for transfer model, a mature effector immune response im- this tumor immunity may involve testicular and adrenal mediately engages the inoculated tumor cells whereas in autoimmunity due to interference with a variety of cell the therapeutic active immunization model, immune en- processes affecting these tissues. In our prior studies we gagement of the palpable tumor is delayed until a ma- showed that inhibin-α vaccination of normal female ture effector immune response develops several days if mice resulted in antibody-mediated neutralization of not weeks after vaccination. Thus the adoptive and pas- inhibin-α that resulted in unregulated FSH release, sive transfer data mimic the tumor immunity provided enhanced litter numbers, early depletion of the ovarian when the active immunization occurs long before the in- reserve, and ultimately premature ovarian failure [14]. oculation of tumor (Fig. 2a). We have not similarly characterized the inhibin-α auto- It is also worth noting that the tumor immunity pro- immune phenotype in male mice. However, prior studies vided by transfer of primed CD4+ T cells is substantially suggest that the autoimmune consequences of inhibin-α enhanced when compared to the immunity provided by vaccination may be relatively benign and quite tolerable. transfer of equal numbers of primed B cells or by No differences were detected in the interstitial tissue Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 10 of 12 Fig. 5 Vaccination against rmInα inhibits growth of autochthonous TSC tumors. Ten days after immunization of male SJL.AMH-SV40Tag (H-2 ) transgenic mice with the immunodominant IA -restricted Inα 215-234 peptide (a) LNC showed antigen-specific proliferation in response to various doses of Inα 215-234, and (b) whole LNC and purified CD4+ T cells but not CD8+ T cells showed high frequencies of antigen-specific IFNγ-secreting T cells in response to Inα 215-234. c Prophylactic Inα 215-234 vaccination of eight week-old male SJL.AMH-SV40Tag mice significantly inhibited the growth of autochthonous TSC tumors. d This inhibition of TSC tumor growth was accompanied by significantly lower testicular weights when the experiment was terminated at 77 weeks of age. Error bars indicate ± SE, and asterisks indicate significance area between control and inhibin-α immunized animals resultant autochthonous tumors clearly showed morpho- [29]. However, inhibin-α immunization does affect peak logic and histologic characteristics more consistent with testosterone levels but testosterone is still produced in Leydig cell tumors and expressed the luteinizing hor- quantities sufficient to facilitate secretion of gonadotro- mone receptor (LHR), a cell surface marker traditionally pins [30]. Thus, the published evidence indicates that associated with Leydig cells rather than Sertoli cells [17]. Leydig cells appear to be present and quite functional Moreover, dysplasia in the SJL.AMH-SV40Tag trans- following inhibin-α immunization. genic mouse was consistently observed in cells within The current version of the inhibin-α vaccine is proto- the interstitial space between seminiferous tubules where typic and could be improved substantially with a few Leydig cells are located (Fig. 4b) and their derived simple refinements. Booster vaccinations may optimize tumors were identified by their characteristic polygonal the generated immunity and thereby provide greater in- shape with a large, granular cytoplasm and round nuclei hibition of tumor growth. The unresolved granulomas with single or multiple nucleoli [32]. We did not observe associated with CFA preclude its use for human vac- dysplastic cells within the seminiferous tubules where cination and will have to be replaced by a less toxic Sertoli cell tumors typically develop as clusters of large adjuvant that may still orchestrate a broad proinflam- tumor cells with eccentric nuclei and irregularly shaped matory immune response involving Th1, Th17, and cell membranes [33]. Thus, the well-documented, estab- Th9 T cells implicated in the induction of aggressive lished characteristics of Leydig cell tumors correlated tumor immunity [31]. well with the observed features of the autochthonous It is somewhat surprising that the autochthonous TSC TSC tumors that develop in SJL.AMH-SV40Tag trans- tumors that develop in male SJL.AMH-SV40Tag trans- genic mice. genic mice are of Leydig cell origin. In their original All this being said, the expression of anti-Müllerian report, Dutertre and colleagues [11] showed that expres- hormone (AMH) in Leydig cells remains a bit of an sion of the AMH-SV40Tag transgene in mice resulted in anomaly since AMH expression has traditionally been TSC tumors of Sertoli cell origin. However, after back- associated with Sertoli cell tumors rather than Leydig crossing for more than 20 generations from the original cell tumors [18] and AMH expression in normal cells is C57BL/6 background to the SJL/J background, the widely believed to be confined to Sertoli cells and not to Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 11 of 12 Leydig cells [34–37]. However, the AMH-SV40Tag Acknowledgements The authors wish to thank Dr. Ritika Jaini, Department of Genomic Medicine, transgene is clearly expressed in both Leydig cells and Cleveland Clinic, Cleveland, OH for her technical assistance and advice. Sertoli cells of SJL.AMH-SV40Tag transgenic mice (Fig. 4e) thereby implying that both cell types may ex- Funding This work was generously supported by a grant from the Andrew and Lillian press AMH and that transgene expression of SV40Tag A. Posey Foundation (VKT). The content of this study is solely the responsibility may predispose to creation of tumors of either cell type of the authors and does not necessarily represent the official views of the Lillian with Sertoli cell tumors predominating in the original A. Posey Foundation. The funding organization played no role in the design of the study, in the collection, analysis, and interpretation of data, or in writing the AT-t94 transgenic mouse generated in the C57BL/6 manuscript. (H-2 ) background strain and Leydig cell tumors pre- dominating when the AMH-SV40Tag transgene is Availability of data and materials The datasets generated and/or analyzed during the current study are available expressed in the SJL/J (H-2 ) background strain. Indeed, from the corresponding author on reasonable request. strain-specific predispositions may occur as a result of differential epigenetic factors that are capable of shaping Authors’ contributions RA was involved in all aspects of the study including experimental design, genetic outcomes [38]. performance of the experiments, data analysis, and preparation of the TSC tumors of the testis comprise less than 5% of tes- manuscript. JMM provided expert technical assistance throughout the study ticular cancers, and this rareness predisposes to being and was particularly instrumental in providing oversight in developing the recombinant inhibin-α protein and providing technical assistance with mo- overlooked with respect to developing and testing new lecular assays and data collection. PB provided expert technical assistance therapies for such uncommon tumors [3]. However, particularly with respect to flow cytometry analysis. VKT participated in experimen- stage I TSC tumors have 5 year overall survivals that are tal design, data analysis, interpretation, design and production of figures, manu- script preparation, and obtaining financial support for the project. All authors read significantly lower compared to those of stage I germ and approved the final manuscript. cell tumors that represent the vast majority of human testicular cancers [3]. Thus, though relatively rare, the Authors’ information Not applicable. enhanced lethality of TSC tumors begs for an improve- ment in treatment and clinical control. The results of Competing interests our current study indicate that inhibin-α vaccination The authors declare that they have no competing interests. may be useful and effective as an adjuvant therapy for Consent for publication TSC tumors particularly since the vast majority of TSC Not applicable. tumors express inhibin-α [5–9] and that these tumors Ethics approval and consent to participate occur in young men in the prime of their life at a me- This study did not involve any human subjects or human tissues. All protocols dian age of 43 years [3]. involving animals were pre-approved by the Cleveland Clinic’s Institutional Animal Care and Use Committee in compliance with the Public Health Service policy on humane care and use of laboratory animals. Conclusions We have developed and characterized an immunother- Publisher’sNote apy for the most lethal forms of testicular cancer, namely Springer Nature remains neutral with regard to jurisdictional claims in TSC tumors that include Leydig cell tumors and Sertoli published maps and institutional affiliations. cell tumors. Inhibin-α vaccination provides an immuno- Author details therapeutic option that is currently unavailable for pa- Department of Immunology, NB30, Lerner Research Institute, Cleveland Clinic, tients with these lethal forms of testicular cancer. If 2 9500 Euclid Avenue, Cleveland, OH 44195, USA. Department of Biology, administered as adjuvant therapy along with current Cleveland State University, Cleveland, OH, USA. Western Reserve Academy, Hudson, OH, USA. Department of Molecular Medicine, Cleveland Clinic Lerner standard of care, inhibin-α vaccination may strengthen College of Medicine of Case Western Reserve University, Cleveland, OH, USA. the natural immune defense against TSC tumors and thereby eliminate any residual local or systemic tumor Received: 14 October 2016 Accepted: 29 March 2017 cells. This novel way to control TSC tumors may have a substantial impact on the young men in the prime of References their lives who are typically affected by this disease. 1. Howlader N, Noone AM, Krapcho M, Miller D, Bishop K, Altekruse SF, Kosary CL, Yu M, Ruhl J, Tatalovich Z, Mariotto A, Lewis DR, Chen HS, Feuer EJ, Abbreviations Cronin KA (eds). SEER Cancer Statistics Review, 1975-2013, National Cancer AMH: Anti-Müllerian hormone; AIRE: Autoimmune regulator transcription Institute. Bethesda, MD, http://seer.cancer.gov/csr/1975_2013/, based on factor; CFA: Complete Freund's adjuvant; cpm: Counts per minute; November 2015 SEER data submission, posted to the SEER web site, April 2016. Cy5: Cyanine 5; FITC: Fluorescein isothiocyanate; FSH: Follicle stimulating 2. SEER Cancer Statistics Factsheets. Testis Cancer. National Cancer Institute. hormone; HPLC: High performance liquid chromatography; IFNγ: Interferon Bethesda, MD. http://seer.cancer.gov/statfacts/html/testis.html gamma; IPTG: Isopropylthiogalactopyronidase; LNC: Lymph node cells; 3. Banerji JS, Odem-Davis K, Wolff EM, Nichols CR, Porter CR. Patterns of care LHR: Luteinizing hormone receptor; MHC: Major histocompatibility complex; and survival outcomes for malignant sex cord stromal testicular cancer: Ni-NTA: Nickel-nitrilo triacetic acid; PE: Phycoerythrin; rmInα: Recombinant Results from the National Cancer Data Base. J Urol. 2016;196:1117–22. mouse inhibin-α; RT-PCR: Reverse transcription-polymerase chain reaction; 4. Hedger MP, Winnall WR. Regulation of activin and inhibin in the adult testis SV40Tag: Simian virus 40 large transforming antigen; TSC: Testicular stromal and the evidence for functional roles in spermatogenesis and immunoregulation. cell; TILs: Tumor infiltrating lymphocytes Mol Cell Endocrinol. 2012;359:30–42. Aguilar et al. Journal for ImmunoTherapy of Cancer (2017) 5:37 Page 12 of 12 5. Kommoss F, Oliva E, Bittinger F, Kirkpatrick CJ, Amin MB, Bhan AK, Young particle vaccine among young women with preexisting infection: a randomized RH, Scully RE. Inhibin-alpha CD99, HEA125, PLAP, and chromogranin trial. JAMA. 2007;298:743–53. immunoreactivity in testicular neoplasms and the androgen insensitivity 27. Uhlén M, Fagerberg L, Hallström BM, Lindskog C, Oksvold P, Mardinoglu A, syndrome. Hum Pathol. 2000;31:1055–61. Sivertsson Å, Kampf C, Sjöstedt E, Asplund A, Olsson I, Edlund K, Lundberg 6. Taniyama H, Hirayama K, Nakada K, Numagami K, Yaosaka N, Kagawa Y, E, Navani S, Szigyarto CA, Odeberg J, Djureinovic D, Takanen JO, Hober S, Izumisawa Y, Nakade T, Tanaka Y, Watanabe G, Taya K. Alm T, Edqvist PH, Berling H, Tegel H, Mulder J, Rockberg J, Nilsson P, Immunohistochemical detection of inhibin-alpha, -betaB, and -betaA chains Schwenk JM, Hamsten M, von Feilitzen K, Forsberg M, Persson L, Johansson and 3beta-hydroxysteroid dehydrogenase in canine testicular tumors and F, Zwahlen M, von Heijne G, Nielsen J, Pontén F. Proteomics. Tissue-based normal testes. Vet Pathol. 2001;38:661–6. map of the human proteome. Science. 2015;347:1260419. 28. Suresh PS, Rajan T, Tsutsumi R. New targets for old hormones: inhibins clinical 7. Yu C-H, Hwang D-N, Yhee J-Y, Kim J-H, Im K-S, Nho W-G, Lyoo Y-S, Sur J-H. role revisited. Endocr J. 2011;58:223–35. Comparative immunohistochemical characterization of canine seminomas 29. Lovell TM, Knight PG, Groome NP, Gladwell RT. Measurement of dimeric and Sertoli cell tumors. 2009. J Vet Sci. 2009;10:1–7. inhibins and effects of active immunization against inhibin α-subunit on 8. Zheng W, Sung CJ, Hanna I, DePetris G, Lambert-Messerlian G, Steinhoff M, plasma hormones and testis morphology in the developing cockerel. Biol Lauchlan SC. Alpha and beta subunits of inhibin/activin as sex cord-stromal Reprod. 2000;63:213–21. differentiation markers. Int J Gynecol Pathol. 1997;16:263–71. 30. Voglmayr JK, Mizumachi M, Washington DW, Chen CL, Bardin CW. Immunization 9. Iczkowski KA, Bostwick DG, Roche PC, Cheville JC. Inhibin A is a sensitive of rams against human recombinant inhibin alpha-subunit delays, augments, and and specific marker for testicular sex cord-stromal tumors. Mod Pathol. extends season-related increase in blood gonadotropin levels. Biol Reprod. 1990; 1998;11:774–9. 42:81–6. 10. Dudley A, McKinstry W, Thomas D, Best J, Jenkins A. Removal of endotoxin 31. Ivanova EA, Orekhov AN. T helper lymphocyte subsets and plasticity in by reverse phase HPLC abolishes anti-endothelial cell activity of bacterially autoimmunity and cancer: an overview. Biomed Res Int. 2015;2015:327470. expressed plasminogen kringle 5. Biotechniques. 2003;35:724–6. 32. Al-Agha OM, Axiotis CA. An in-depth look at Leydig cell tumor of the testis. 11. Dutertre M, Rey R, Porteu A, Josso N, Picard JY. A mouse Sertoli cell line Arch Pathol Lab Med. 2007;131:311–7. expressing anti-Müllerian hormone and its type II receptor. Mol Cell Endocrinol. 33. Chang B, Borer JG, Tan PE, Diamond DA. Large-cell calcifying Sertoli cell 1997;136:57–65. tumor of the testis: case report and review of the literature. Urology. 1998; 12. Dutertre M, Gouédard L, Xavier F, Long WQ, di Clemente N, Picard JY, Rey R. 52:520–3. Ovarian granulosa cell tumors express a functional membrane receptor for 34. Guerrier D, Boussin L, Mader S, Josso N, Kahn A, Picard JY. Expression of the anti-Müllerian hormone in transgenic mice. Endocrinology. 2001;142:4040–6. gene for anti-Müllerian hormone. J Reprod Fertil. 1990;88:695–706. 13. Altuntas CZ, Jaini R, Kesaraju P, Jane-wit D, Johnson JM, Covey K, Flask CA, 35. Rouiller-Fabre V, Carmona S, Merhi RA, Cate R, Habert R, Vigier B. Effect of Dutertre M, Picard JY, Tuohy VK. Autoimmune mediated regulation of ovarian anti-Müllerian hormone on Sertoli and Leydig cell functions in fetal and tumor growth. Gynecol Oncol. 2012;124:98–04. immature rats. Endocrinology. 1998;139:1213–20. 14. Altuntas CZ, Johnson JM, Tuohy VK. Autoimmune targeted disruption of the 36. Rajpert-De Meyts E, Jørgensen N, Graem N, Müller J, Cate RL, Skakkebaek pituitary-ovarian axis causes premature ovarian failure. J Immunol. 2006;177: NE. Expression of anti-Müllerian hormone during normal and pathological 1988–96. gonadal development: association with differentiation of Sertoli and granulosa 15. Yasamura Y, Tashjian Jr AH, Sato GH. Establishment of four functional, clonal cells. J Clin Endocrinol Metab. 1999;84:3836–44. strains of animal cells in culture. Science. 1966;154:1186–9. 37. La Marca A, Sighinolfi G, Radi D, Argento C, Baraldi E, Artenisio AC, Stabile G, 16. Shin SI. Studies on interstitial cells in tissue culture: steroid biosynthesis in Volpe A. Anti-Mullerian hormone (AMH) as a predictive marker in assisted monolayers of mouse testicular interstitial cells. Endocrinology. 1967;81:440–8. reproductive technology (ART). Hum Reprod Update. 2010;16:113–30. 17. Shan LX, Hardy MP. Developmental changes in levels of luteinizing hormone 38. Koturbash I, Scherhag A, Sorrentino J, Sexton K, Bodnar W, Swenberg JA, receptor and androgen receptor in Leydig cells. Endocrinology. 1992;131: Beland FA, Pardo-Manuel Devillena F, Rusyn I, Pogribny IP. Epigenetic 1107–14. mechanisms of mouse interstrain variability in genotoxicity of the environmental 18. Rey R, Sabourin JC, Venara M, Long WQ, Jaubert F, Zeller WP, Duvillard P, toxicant 1,3-butadiene. Toxicol Sci. 2011;122:448–56. Chemes H, Bidart JM. Anti-Müllerian hormone is a specific marker of Sertoli- and granulosa-cell origin in gonadal tumors. Hum Pathol. 2000;31:1202–8. 19. Ciaputa R, Nowak M, Madej JA, Poradowski D, Janus I, Dziegiel P, Gorzynska E, Kandefer-Gola M. Inhibin-α, E-cadherin, calretinin and Ki-67 antigen in the immunohistochemical evaluation of canine and human testicular neoplasms. Folia Histochem Cytobiol. 2014;52:326–34. 20. Forage RG, Brown RW, Oliver KJ, Atrache BT, Devine PL, Hudson GC, Goss NH, Bertram KC, Tolstoshev P, Robertson DM, de Kretser DM, Doughton B, Burger HG, Findlay JK. Immunization against an inhibin subunit produced by recombinant DNA techniques results in increased ovulation rate in sheep. J Endocrinol. 1987;114:R1–4. 21. Morris DG, Browne D, Diskin MG, Sreenan JM. Effect of peptide to carrier ratio on the immune and ovarian response to inhibin immunization in cattle. Anim Reprod Sci. 1997;48:1–8. 22. Hennies M,Voglmayr JK,Dietrich E,Stollmann M, Moeller R, Holtz W. Hormonal response of female goats to active immunization against a recombinant human Submit your next manuscript to BioMed Central inhibin alpha-subunit, and establishment of an enzyme-linked immunosorbent assay for caprine follicle-stimulating hormone. Reprod Domest Anim. 2001;36:65–71. and we will help you at every step: 23. Delves PJ, Lund T, Roitt IM. Antifertility vaccines. Trends Immunol. 2002;23: • We accept pre-submission inquiries 213–9. 24. Kennedy R, Celis E. Multiple roles for CD4+ T cells in anti-tumor immune � Our selector tool helps you to find the most relevant journal responses. Immunol Rev. 2008;222:129–44. � We provide round the clock customer support 25. Haabeth OA, Tveita AA, Fauskanger M, Schjesvold F, Lorvik KB, Hofgaard PO, � Convenient online submission Omholt H, Munthe LA, Dembic Z, Corthay A, Bogen B. How Do CD4(+) T Cells Detect and Eliminate Tumor Cells That Either Lack or Express MHC � Thorough peer review Class II Molecules? Front Immunol. 2014;5:174. � Inclusion in PubMed and all major indexing services 26. Hildesheim A, Herrero R, Wacholder S, Rodriguez AC, Solomon D, Bratti MC, � Maximum visibility for your research Schiller JT, Gonzalez P, Dubin G, Porras C, Jimenez SE, Lowy DR, Costa Rican HPV Vaccine Trial Group. Effect of human papillomavirus 16/18 L1 viruslike Submit your manuscript at www.biomedcentral.com/submit

Journal

Journal for ImmunoTherapy of Cancer – Springer Journals

Published: Apr 18, 2017

There are no references for this article.