Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Transcriptional analysis of Saccharomyces cerevisiae during high-temperature fermentation

Transcriptional analysis of Saccharomyces cerevisiae during high-temperature fermentation Ann Microbiol (2013) 63:1433–1440 DOI 10.1007/s13213-013-0606-0 ORIGINAL ARTICLE Transcriptional analysis of Saccharomyces cerevisiae during high-temperature fermentation Qian Chen & Yang Fang & Hai Zhao & Guohua Zhang & Yanling Jin Received: 14 April 2012 /Accepted: 11 January 2013 /Published online: 30 January 2013 Springer-Verlag Berlin Heidelberg and the University of Milan 2013 . . Abstract DNA microarrays were used to investigate the Keywords DNA microarray Quantitative real-time PCR . . transcriptional response of Saccharomyces cerevisiae genes Saccharomyces cerevisiae High-temperature fermentation under high temperature fermentation. Up to 35.73 % of Stress response yeast genes were up-regulated or down-regulated at least two-fold in their expression level at the late stage of fer- mentation. Nine genes involved in the pathways of glycol- Introduction ysis, ethanol generation and stress response were selected for study of their transcription profiles during high temper- Dramatic increases in global population and energy demands ature fermentation processes by using quantitative real-time are propelling the requirement to produce ethanol as an eco- PCR assay. Our data indicated that the genes involved in friendly renewable liquid fuel (Hahn-Hagerdal et al. 2006; trehalose biosynthesis and encoding heat shock proteins Stanley et al. 2010). To improve ethanol yield and productiv- (HSPs) were significantly induced, while the genes involved ity and to search for less expensive technology for the pro- in ethanol production were down-regulated during the 40 °C duction of ethanol, the development of a fermentation process fermentation. Specially, HSP26 displayed the highest tran- at high temperature with a high concentration substrate is scription level of 166.19±15.82-fold at 6 h, indicating that necessary (Morimura et al. 1997). The advantages of fermen- this gene may play important roles at the onset of 40 °C tation at high temperature (40–45 °C) are not only reduced fermentation. Moreover, transcription levels of the nine cooling, simultaneous saccharification and fermentation genes were reduced significantly and returned to normal (SSF) and downstream distillation costs but also minimization levels compared with controls after the samples were treated of the risk of contamination (Benjaphokee et al. 2012; Nevoigt at 30 °C for another 2 h. The results of this study suggest 2008; Olofsson et al. 2008). An increase in fermentation that these genes and their related pathways are involved in temperature of only 5 °C can greatly affect ethanol production the response to high temperature; these findings will be costs (Abdel-Banat et al. 2010). The yeast strain helpful in improving the characteristics and fermentation Saccharomyces cerevisiae has long been used in the baking, capacity of industrial yeast strains by metabolic engineering. brewing and wine-making industries, and in recent years also in the production of fuel ethanol (Zhao and Bai 2009). Among the desirable properties of strains required for efficient and economical fuel ethanol production, tolerance to high temper- : : : : Q. Chen Y. Fang H. Zhao G. Zhang Y. Jin (*) ature as well as high ethanol concentration are important traits Environmental Microbiology Key Laboratory of Sichuan of yeast strains. Therefore, high temperature fermentation has Province, Chengdu Institute of Biology, Chinese Academy of been applied gradually in fuel ethanol production and a yeast Sciences (CAS), Chengdu, Sichuan Province 610041, strain that displays these phenotypes would be indispensable People’s Republic of China e-mail: jinyl@cib.ac.cn for high temperature ethanol fermentation. During high temperature fermentation processes, the yeast Q. Chen cells encounter a variety of adverse conditions including not Graduate University of the Chinese Academy of Sciences, Beijing only high temperature and ethanol concentration, but also 100049, People’s Republic of China 1434 Ann Microbiol (2013) 63:1433–1440 osmotic stress from the substrate and limitation of essential (2 %, glucose, 2 % peptone, 1 % yeast extract and 2 % agar, nutrients. Ethanol inhibits the growth and viability of yeast w/v) slants at 4 °C subcultured every 4 weeks. cell, affects different transport systems and inhibits the activity The medium used for inoculation contained glucose 100 g, of key glycolytic enzymes, which causes deterioration in yeast extract 8.5 g, (NH ) SO 1.3 g, MgSO ·7H O0.1 g, 4 2 4 4 2 ethanol fermentation efficiency (Crawford and Zochowski CaCl 0.06 g per liter at pH 6.0. Erlenmeyer flasks (250 mL) 1984; Pizarro et al. 2008; Teixeira et al. 2009). Interestingly, containing 100 mL medium were incubated at 30 °C, 150 rpm the responses of S. cerevisiae to ethanol stress and heat shock on a rotatory shaker for 16 h to prepare the inocula. A 10 %v/v are very similar, and a cross-tolerance phenomenon has been inocula was added aseptically to flasks (250 mL) containing observed (Causton et al. 2001; Snowdon et al. 2009). The 100 mL fermentation medium (pH 6.0, comprising glucose yeast cells respond rapidly to stress conditions and adapt to the 240 g, yeast extract 5 g, peptone 5 g, CaCl 2.8 g, (NH ) SO 2 4 2 4 adverse surroundings via induction or repression of specific 1.5g,MgSO ·7H O 0.65 g, inositol 0.85 g, thiamin 0.35 g, 4 2 genes involved in various response pathways (Bisson 1999; pyridoxine 4 mg, niacin 4 mg, 4-aminobenzoic acid 7 mg, Gasch et al. 2000;Piper 1995). The biochemical basis of S. biotin 24 μg per liter). Fermentation was conducted at the cerevisiae’s response to stress factors involves the accumula- temperatures indicated, 180 rpm under anaerobic conditions. tion of trehalose and heat shock proteins (HSPs) against heat Samples were taken at regular intervals and cells were collect- and ethanol stress (Alexandre et al. 2001; Brosnan et al. 2000). ed by centrifugation (9,000 g for 2 min) at 4 °C, and frozen The HSPs are a conserved group of protein families belonging immediately in liquid nitrogen. The cells were stored at −80 °C to the larger superfamily of molecular chaperones (Vos et al. until RNA extraction. All media were sterilized by autoclaving 2008). During heat shock and ethanol stress, HSPs play im- for20min at 115°C. portant roles in preventing aggregation or assisting refolding of proteins. Trehalose is reported to be a stress protectant and RNA extraction to influence membrane structure and hydrogen bonding inter- actions, which reduce membrane permeability and help proper Cells were harvested and washed with RNase-free water. Total folding of proteins (Mansure et al. 1994; Singer and Lindquist RNA was extracted and purified using RNAprep pure Plant 1998a). In response to the stresses, yeast cells also adjust the Kit (Tiangen, Beijing, China) with DNase I treatment, accord- lipid composition of the membrane by increasing the propor- ing to the manufacture’s instructions. RNA concentrations and tion of ergosterol and unsaturated fatty acids in the lipid purity were determined by measuring absorbance at 260 membrane of the cell (Swan and Watson 1999). (A ) and 280 nm (A )onaVarioskanFlash Spectral 260 280 Although much research has been undertaken, the mecha- Scanning Multimode Reader (Thermo Scientific, Waltham, nisms of the S. cerevisiae response to heat and ethanol stresses MA) and calculating the ratio of A to A .Meanwhile, 260 280 are still not fully understood, and further extensive study is RNA obtained from yeast cells of 30 °C fermentation was necessary in order to pin point these mechanisms. Today, DNA used as control samples in both microarrays and qPCR assays. microarray and quantitative real-time PCR (qPCR) can be used to determine the intracellular state and analyze the transcrip- DNA microarray analysis tional responses of S. cerevisiae under high temperature fer- mentation. Such research will improve our understanding of The cDNA synthesis, labeling and hybridization to GeneChip the yeast cell’s response to high temperature fermentation and Yeast Genome 2.0 Array (Affymetrix, Santa Clara, CA) were provide some clues for breeding thermotolerant yeast strains performed at CapitalBio Corp. (Beijing, China) according to (Gasch et al. 2000;Lietal. 2010;Varelaetal. 2005). the supplier’s manual (Affymetrix GeneChip Expression In the present study, we used DNA microarrays and qPCR Analysis Technical Manual, 2004). The array has probes for to analyze gene expression profiles during a high temperature 5,744 yeast ORFs (5,841 genes). Washing and staining of fermentation process in a study of the transcriptional changes microarrays were conducted using GeneChip Fluidics in yeast genes in response to stress. Functional analysis of the Station 400 (Affymetrix). Microarrays were scanned using selected genes may provide important information about the GeneChip Scanner 3000 and the fluorescence intensities were mechanisms involved in the thermotolerance of yeast. quantified using Affymetrix GeneChip Operating Software Version 1.4. Statistically significant differentially expressed genes were identified when their expression ratios were great- Materials and methods er than 2-fold with P<0.05. Genes that were either up- or down-regulated in 40 °C fermentation provided information Strain, media and culture conditions pertinent to transcriptional responses to heat and ethanol stresses at a molecular level. Gene descriptions and annota- The strain used in this study was Saccharomyces cerevisiae tions were identified in the Saccharomyces Genome Database CCTCC M206111. The strain was maintained on YPDA (http://www.yeastgenome.org). Ann Microbiol (2013) 63:1433–1440 1435 Table 1 Primers for quantitative real-time PCR (qPCR) analysis ID Sequence 5′→3′ Amplicon (bp) Gene/ORF Reference/source ACT-F TGTTACTCACGTCGTTCCAAT 103 ACT1 Chen and Widom ACT-R GATCTTCATCAAGTAGTCAGTCAA 2005 HSP26-F TAGCAAACACACCCGCAAAG 136 HSP26 This study HSP26-R CCAGATGGGAACAGGGACA SSA4-F ATTGCGTATGGGCTGGAC 238 SSA4 Han et al. 2008 SSA4-R AGGGACCTTTGGTTAGTTGTTA SSA3-F CGTATTATCAATGAACCCACTG 164 SSA3 Han et al. 2008 SSA3-R GTCTCCTGCGGTAGCCTTA PGM1-F GTTGTTGGAGGAGATGGTCGTTTC 97 PGM1 Ma and Liu 2010 PGM1-R TGGGTTGTGTGAGGCAGTTA HMG1-F CCATCAACTGGATCGAAGGT 109 HMG1 Ma and Liu 2010 HMG1-R AACTCAACCAATGCGGAAAC HMG2-F GGTGCCTGCAAGATATGGTT 124 HMG2 Ma and Liu 2010 HMG2-R AAAGCAAATCGCCTGCTAGA ERG9-F TGAAAGCATGGGTCTTTTCC 114 ERG9 Ma and Liu 2010 ERG9-R TGAGGAGCGTATTGTGACCA ADH4-F TGTCACAGCTGGTTTGAAGG 125 ADH4 Ma and Liu 2010 ADH4-R CGATTTCCCCACCGTTAGTA PYK2-F AATTGAAATCCTGGCACCTG 106 PYK2 Ma and Liu 2010 PYK2-R TGAATCCAGCATCTGAGTCG Quantitative real-time PCR were: 2 min at 98 °C, followed by 40 cycles of 5 s at 98 °C, 15 s at 54 °C, and then a melting curve of the amplified DNA Based on microarrays results, nine genes involved in gly- was acquired. ACT1 was used as an internal reference for colysis, ethanol generation and stress response to ethanol normalizing gene expression. Primers of the selected genes and temperature were selected for quantitative transcription are given in Table 1. The data were analyzed by calculating −ΔΔCt analysis by using qPCR. Samples were taken at the times 2 (Livak and Schmittgen 2001). All experiments were indicated and total RNA was extracted. cDNA was synthe- conducted in triplicate. sized using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. The Analytical methods qPCR was performed using SsoFast Evagreen Supermix (Bio-Rad) on a MyiQ2 Two-Color Real-Time PCR The growth of S. cerevisiae was determined by measuring Detection System (Bio-Rad). The PCR cycle parameters the optical density of a ten-fold dilution culture at 620 nm Fig. 1 Saccharomyces cerevisiae fermentation profiles at 30 °C (closed symbols) and 40 °C (open symbols): OD (black squares, white squares), residual glucose (black triangles, white triangles) and ethanol concentration (black circles, white circles). Error bars Standard deviation 1436 Ann Microbiol (2013) 63:1433–1440 using a UV 754N model spectrophotometer. Cell dry weight experiments were performed at 30 °C and 40 °C with was determined gravimetrically. Intracellular trehalose was fermentation media containing 240 g/L glucose. As shown extracted as described previously (Parrou and Francois in Fig. 1, in the first 12 h, a large increase in cell density 1997). Glucose and trehalose in samples were determined (OD ) was detected in both 30 °C and 40 °C fermenta- by high-performance liquid chromatography (HPLC; Waters tions, accompanied by a rapid increase in ethanol concen- 2795, Waters, Milford, MA). The samples were filtered tration, whichthenremainedstable tothe endof through a 0.22 μm filter before HPLC analysis. The HPLC fermentation. In addition, glucose was almost completely was equipped with Evaporative Light-scattering Detector consumed and similar ethanol concentrations (13.84 %v/v (All-Tech ELSD 2000, All-Tech, Bakersfield, CA) and at 30 °C and 13.19 %v/v at 40 °C) were finally obtained in Aminex HPX-87-Pb column (Bio-Rad). Each sample was the two fermentation experiments. However, the cell density injected (20 μL) into the column operating at 79 °C and of the fermentation broth at the late stage of 30 °C fermen- deionized water was mobile phase at flow rate of tation (about 1.40) was much higher than that at 40 °C 0.6 mL/min. Nitrogen was carrier gas at a pressure of (about 1.05) and an extended fermentation time was ob- 2.8 bar and draft temperature was 95 °C for the ELSD served at 40 °C. The fermentation efficiency and volumetric −1 −1 detector. The ethanol concentration was determined using ethanol productivities were 92.60 %, 4.04 g L h at 30 °C −1 −1 a gas chromatography (FULI 9790, FULI, Zhejiang, China) and 90.75 %, 2.89 g L h at 40 °C, respectively. The equipped with an FID detector and a GDX 103 packed results indicated that the yeast cell growth, fermentation column (3.2 mm×2 m, FULI ). The temperature of the efficiency and volumetric ethanol productivities were affect- column, detector and injector were 95 °C, 150 °C and ed greatly by the high temperature. 150 °C, respectively. Prior to the determination, n-propanol (the inner standard) was added to each sample to a concen- Microarray analysis of global gene transcription tration of 2 %v/v. To investigate the response profiles of yeast under high Statistical analysis temperature fermentation, DNA microarray analysis was performed. DNA microarray analysis is a powerful tool that The statistical analysis of results was performed by applying can be used to understand the global transcriptional re- one-way variance analysis (ANOVA) using SPSS 17.0 soft- sponse to different stresses. Samples were taken at the late ware. P-values of less than 0.05 were considered to be stage of the two fermentation experiments when the ethanol statistically significant. concentrations were over 12 %v/v. Samples were taken at 32 h and 25 h for the 40 °C and 30 °C fermentations, respectively, and total RNA was isolated for microarray Results analysis. Of 5,841 genes, the expression of 2,087 (35.73 %) exhibited a statistically significant expression Fermentation profiles change (greater than 2-fold) at the end of 40 °C fermentation relative to the corresponding time at 30 °C, indicating a To characterize the differential response of yeast cells to transcriptional response to ethanol and heat stresses. The high temperature and ethanol concentration, fermentation numbers of up- and down-regulated genes were 1,068 Table 2 The nine genes in- Systematic name Gene name Gene description Fold induction volved in important metabolic pathways as revealed by micro- Up-regulated genes array analysis YBR072W HSP26 Heat shock protein 21.90 YBL075C SSA3 Heat shock protein of HSP70 family, cytosolic 10.35 YER103W SSA4 Heat shock protein of HSP70 family, cytosolic 8.38 YKL127W PGM1 Phosphoglucomutase, minor isoform 18.27 Down-regulated genes YGL256W ADH4 Alcohol dehydrogenase IV −2.50 YML075C HMG1 3-Hydroxy-3-methylglutaryl-coenzyme A reductase 1 −4.35 YLR450W HMG2 3-Hydroxy-3-methylglutaryl-coenzyme A reductase 2 −2.70 YHR190W ERG9 Farnesyl-diphosphate farnesyltransferase −5.00 YOR347C PYK2 Pyruvate kinase, glucose-repressed isoform −10.00 Ann Microbiol (2013) 63:1433–1440 1437 Fig. 2 Relative transcription levels of S. cerevisiae genes during 40 °C temperature fermentation. Relative transcription levels were −ΔΔCt analyzed by calculating 2 using ACT1 as an internal reference. The expression levels of down-regulated genes=−1/ their relative transcription levels. Error bars Standard deviations. The letters indicate expression data that differ significantly (one letter P< 0.05; two letters P<0.01) from the reference data (o) of each gene (18.28 %) and 1,019 (17.45 %), respectively. These genes involved in the important pathways of glycolysis, ethanol were distributed in 89 pathways according to the KEGG generation and stress response to ethanol and temperature, pathway database (http://www.genome.jp/kegg/path- were selected for further research using qPCR. way.html). The results indicated that high temperature and ethanol concentration in fermentation greatly alter the phys- Relative transcription level analysis by qPCR iological and transcriptional profiles of yeast cells in com- plex ways. Table 2 shows the genes with significant To better understand the transcriptional response of S. ce- expression changes revealed by microarrays analysis. The revisiae to heat and ethanol stresses during high temperature nine genes with the highest significant expression changes, fermentation process, samples were taken at the beginning Fig. 3 Trehalose content of yeast cells during 30 °C and 40 °C fermentation. Samples were withdrawn at different time points. Samples at 36 h of 40 °C fermentation were incubated at 30 °C for another 2 h. No trehalose was detected at 6 h of 30 °C fermentation. Error bars Standard deviation. The letters indicate trehalose content the differed significantly (one letter P< 0.05; two letters P<0.01) from reference data (o) of each fermentation 1438 Ann Microbiol (2013) 63:1433–1440 (6 h), middle (18 h) and end of fermentation (36 h for 40 °C foranother 2h(Fig. 2). Correspondingly, trehalose content and 27 h for 30 °C) and the relative transcription levels of the decreased sharply from 72.53 and 134.73±8.28 mg/g to nine genes were determined by using qPCR. An additional 56.04 and 51.65±4.95 mg/g at 30 and 40 °C fermenta- sample at the end of 40 °C fermentation incubated at 30 °C for tion, respectively (Fig. 3). The above results suggested another 2 h was also taken for gene transcription analysis. that global gene transcriptional responses were induced Genes encoding HSPs play an important role in the by high temperature and ethanol stresses and these ethanol- and heat-tolerance of yeast (Saavedra et al. 1996). responses were crucial for yeast cells to adapt to and As shown in Fig. 2, the gene HSP26 was greatly up- survive the stresses (Pizarro et al. 2008). regulated (up to 166.19±15.82-fold) at 6 h of fermentation, whereas the ethanol concentration was only 2.14±0.09 % (v/v). At the same time point, the transcription levels of Discussion other HSP genes (SSA3 and SSA4) were relatively low (Fig. 2). The results suggest that HSP26 is important for High temperature is a severe adverse factor for yeast during the yeast cell response to high temperature at the early stage ethanol fermentation, the response of yeast cells to stresses of fermentation. But dramatically increased transcription is complex, involving various aspects of cell sensing, signal levels of SSA3 and SSA4 at 18 h were observed, which were transduction, transcriptional and posttranscriptional control, accompanied with an increased ethanol concentration (from protein-targeting, accumulation of protectants, and in- 2.14±0.09 to 5.8±0.13 %v/v). This result indicated that creased activity of repair functions (Stanley et al. 2010). In SSA3 and SSA4 might be important for yeast ethanol toler- this work, the global transcriptional response of yeast cells ance under high temperature as described previously during ethanol fermentation at high temperature was studied (Alexandre et al. 2001). by using DNA microarrays analysis, which is consistent PGM1 encodes phosphoglucomutase—a key enzyme in- with previous reports (Alexandre et al. 2001; Ma and Liu volved in trehalose and glycogen metabolism (Hirata et al. 2010). To further understand and characterize the response 2003). At the time point of 18 h, this gene was greatly up- of yeast to high temperature and ethanol stresses, based on regulated (20.94±3.16-fold) and a relatively high transcrip- microarray analysis nine candidate genes involved in differ- tion level was maintained to the end of 40 °C fermentation. ent metabolism pathways were selected for quantitative An accumulation of trehalose in yeast cell was also detected transcriptional analysis at the beginning, middle and end in the 40 °C fermentation sample. As shown in Fig. 3, the stages of high temperature fermentation. Sterol, for example trehalose contents of yeast cells were 27.47±2.33 mg/g cell ergosterol, is an essential constituent of yeast plasma mem- dry weight at 6 h, 227.08±18.49 mg/g at 18 h and 134.73± brane and plays an important role in thermotolerance and 8.28 mg/g at 36 h, while the trehalose contents in control ethanol stress. HMG1 and HMG2, encoding proteins in- samples were 0, 207.27±15.42 and 72.53±9.4 mg/g at the volved in a rate-limiting step of sterol biosynthesis, were corresponding times. Considering the fermentation process down-regulated during the high temperature fermentation. was completed under 30 °C and 40 °C, we concluded that These genes contribute to yeast cell survival under adverse accumulation of trehalose is a response mechanism for yeast environmental stresses and their transcription level changes cells to survive and maintain their normal function under might suggest a reconstruction of cell membrane in response high temperature fermentation. to high temperature and ethanol concentration, which would PYK2 and ADH4, encoding pyruvate kinase and alcohol cause cell membrane perturbation (Zhang et al. 2002). dehydrogenase, are key genes involved in ethanol biosyn- Meanwhile, the key enzymes, PYK2 and ADH4 were also thesis (Ma and Liu 2010). Their expression levels were low significantly down-regulated in the 40 °C fermentation. during 40 °C fermentation. At the end of fermentation, Consistent with these results, cell growth was slow, a low PYK2 and ADH4 were down-regulated 25.00-fold and optical density of the fermentation broth was obtained and 3.05-fold, compared with 30 °C fermentation. Meanwhile, cell viability was reduced, leading to a longer fermentation three genes involved in the sterol biosynthesis pathway were time at 40 °C compared with the 30 °C fermentation (Fig. 1). also down-regulated at different time points during 40 °C Trehalose is essential for protecting cell membranes fermentation. ERG9 was down-regulated 12.5-fold at 36 h; against adverse environmental stresses (Singer and HMG1 was down-regulated 8.42-fold at 6 h and 5-fold at Lindquist 1998b). PGM1 was up-regulated during the 40 °C 36 h; HMG2 was down-regulated 9.1-fold at 36 h. This fermentation even though a slightly down-regulation was result suggested that cell activities and membrane composi- observed at 6 h of fermentation. Accordingly, trehalose con- tion were affected by the adverse stresses. tent maintained a high level compared with the control. Moreover, significant recovery transcription levels of Trehalose content has been correlated with cell survival under these genes were observed after the sample, which was environmental stresses and can prevent irreversible dehydra- taken at 36 h of 40 °C fermentation, was incubated at 30 °C tion of yeast cells (Ma and Liu 2010). Cells without trehalose Ann Microbiol (2013) 63:1433–1440 1439 accumulation will display growth inhibition under ethanol trehalose content of yeast cells was higher than that at 30 °C challenges (Mansure et al. 1994). The cell density at 40 °C fermentation and decreased dramatically after the cells were was lower than that at 30 °C, which indicated that the cell incubated at 30 °C for 2 h. We conclude that synthesis of growth was inhibited by the high temperature. However, the trehalose was highly induced by the high temperature rather 40 °C fermentation process was completed (fermentation effi- than by the high ethanol concentration. ciency>90 %) accompanied by trehalose accumulation in yeast In this work, some insight into the transcription responses cells. Therefore, the increase of trehalose content in yeast cell, of yeast cells under high temperature fermentation were resulting from its response to high temperature, conferred much revealed by DNA microarrays and qPCR analysis, which more adaptive potential to yeast against adverse stresses. will be informative and helpful in improving the thermotol- HSPs genes act mainly as chaperones to protect intracel- erance of industrial yeast strain by rational design. lular proteins from the deleterious effects of stresses or to Acknowledgments This work was supported financially by the Na- facilitate degradation of denatured proteins. SSA3 and SSA4, tional Sci-tech Pillar R & D Program of China (No. 2011BAD22B03), which are inducible HSP70 genes in yeast cells, have sev- China Agriculture Research System (No.CARS-11-A-04) and the eral functions directly related to thermotolerance such as Knowledge Innovative Program of the Chinese Academy of Sciences stabilization of protein structure, prevention of protein ag- (NO.KSCX2-EW-J-22&NO.KSCX2-EW-G-1-1). gregation, and regulation of protein activities (Han et al. 2008; Hartl and Martin 1995). In this study, our finding that SSA3 and SSA4 levels were up-regulated is consistent with References previously observed results. The increased transcription lev- els observed by us suggested that HSPs play important roles Abdel-Banat BMA, Hoshida H, Ano A, Nonklang S, Akada R (2010) in stress tolerance in 40 °C fermentation, especially in the High-temperature fermentation: how can processes for ethanol production at high temperatures become superior to the traditional late stage of the fermentation. process using mesophilic yeast? Appl Microbiol Biotechnol Hsp26, a temperature-regulated molecular chaperone, 85:861–867 forms large oligomeric complexes and dissociates into Alexandre H, Ansanay-Galeote V, Dequin S, Blondin B (2001) Global dimers at elevated temperature (Haslbeck et al. 1999). The gene expression during short term ethanol stress in Saccharomy- ces cerevisiae. FEBS Lett 498:98–103 deletion of HSP26 in S. cerevisiae causes an abnormal cell Benjaphokee S, Hasegawa D, Yokota D, Asvarak T, Auesukaree C, shape and protein aggregates under stress conditions, but Sugiyama M, Kaneko Y, Boonchird C, Harashima S (2012) does not affect thermotolerance (Franzmann et al. 2008). Highly efficient bioethanol production by a Saccharomyces ce- Piper et al. (1994) reported that HSP26 increased progres- revisiae strain with multiple stress tolerance to high temperature, acid and ethanol. New Biotechnol 29:379–386 sively as the ethanol addition increased from 4 to 10 %v/v. Bisson LF (1999) Stuck and sluggish fermentations. Am J Enol Vitic In this study, the HSP26 gene showed the highest transcrip- 50:107–119 tion level at 6 h of 40 °C fermentation. However, the Brosnan MP, Donnelly D, James TC, Bond U (2000) The stress transcription level gradually decreased, accompanied by an response is repressed during fermentation in brewery strains of yeast. J Appl Microbiol 88:746–755 increase in ethanol concentration, which may be due to a Causton HC, Ren B, Koh SS, Harbison CT, Kanin E, Jennings EG, Lee loss of cellular activities caused by the extra stress from high TI, True HL, Lander ES, Young RA (2001) Remodeling of yeast ethanol concentration. Besides, the up-regulation of SSA3 genome expression in response to environmental changes. Mol and SSA4 suggestedthatthese twogenes maybemore Biol Cell 12:323–337 Chen LY, Widom J (2005) Mechanism of transcriptional silencing in important than HSP26 for yeast cells to adapt to the high yeast. Cell 120:37–48 temperature and ethanol concentration at the late stage of the Crawford RMM, Zochowski ZM (1984) Tolerance of anoxia and fermentation. The increase in trehalose content and HSP ethanol toxicity in chickpea seedlings (Cicer arietinum L.). J gene transcription levels indicates that there may be a co- Exp Bot 35:1472–1480 Franzmann TM, Menhorn P, Walter S, Buchner J (2008) Activation of induction of trehalose and HSPs against stresses, and sug- the chaperone Hsp26 is controlled by the rearrangement of its gests a tight link between the two protective agents thermosensor domain. Mol Cell 29:207–216 (Alexandre et al. 2001). Gasch AP, Spellman PT, Kao CM, Carmel-Harel O, Eisen MB, Storz High temperature is a severe stress factor in ethanol G, Botstein D, Brown PO (2000) Genomic expression programs in the response of yeast cells to environmental changes. Mol Biol fermentation. The responses of yeast cells were complicated Cell 11:4241–4257 and involved many metabolism pathways, such as the tre- Hahn-Hagerdal B, Galbe M, Gorwa-Grauslund MF, Liden G, Zacchi G halose, sterol and HSP synthesis and glycolysis pathways. (2006) Bio-ethanol—the fuel of tomorrow from the residues of The global transcription responses of yeast cells are essen- today. Trends Biotechnol 24:549–556 Han QJ, Lu J, Duan JZ, Su DM, Hou XZ, Li F, Wang XL, Huang BQ tial for their adaptation to stresses. In this study, we found (2008) Gcn5- and Elp3-induced histone H3 acetylation regulates that the transcript level of HSP26 was highly induced at the hsp70 gene transcription in yeast. Biochem J 409:779–788 beginning of 40 °C fermentation, which might be one of the Hartl FU, Martin J (1995) Molecular chaperones in cellular protein main responses of yeast cells to high temperature. The folding. Curr Opin Struct Biol 5:92–102 1440 Ann Microbiol (2013) 63:1433–1440 Haslbeck M, Walke S, Stromer T, Ehrnsperger M, White HE, Chen SX, Pizarro FJ, Jewett MC, Nielsen J, Agosin E (2008) Growth temperature Saibil HR, Buchner J (1999) Hsp26: a temperature-regulated exerts differential physiological and transcriptional responses in chaperone. EMBO J 18:6744–6751 laboratory and wine strains of Saccharomyces cerevisiae. Appl Hirata Y, Andoh T, Asahara T, Kikuchi A (2003) Yeast glycogen Environ Microbiol 74:6358–6368 synthase kinase-3 activates Msn2p-dependent transcription of Saavedra C, Tung KS, Amberg DC, Hopper AK, Cole CN (1996) stress responsive genes. Mol Biol Cell 14:302–312 Regulation of mRNA export in response to stress in Saccharomy- Li BZ, Cheng JS, Ding MZ, Yuan YJ (2010) Transcriptome analysis of ces cerevisiae. Genes Dev 10:1608–1620 differential responses of diploid and haploid yeast to ethanol Singer MA, Lindquist S (1998a) Multiple effects of trehalose on stress. J Biotechnol 148:194–203 protein folding in vitro and in vivo. Mol Cell 1:639–648 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression Singer MA, Lindquist S (1998b) Thermotolerance in Saccharomyces −ΔΔCt data using real-time quantitative PCR and the 2 method. cerevisiae: the Yin and Yang of trehalose. Trends Biotechnol Methods 25:402–408 16:460–468 Ma MG, Liu ZL (2010) Quantitative transcription dynamic analysis Snowdon C, Schierholtz R, Poliszczuk P, Hughes S, van der Merwe G reveals candidate genes and key regulators for ethanol tolerance in (2009) ETP1/YHL010c is a novel gene needed for the adaptation of Saccharomyces cerevisiae. BMC Microbiol 10:169–188 Saccharomyces cerevisiae to ethanol. FEMS Yeast Res 9:372–380 Mansure JJC, Panek AD, Crowe LM, Crowe JH (1994) Trehalose Stanley D, Bandara A, Fraser S, Chambers PJ, Stanley G (2010) The inhibits ethanol effects on intact yeast-cells and liposomes. ethanol stress response and ethanol tolerance of Saccharomyces BBA-Biomembranes 1191:309–316 cerevisiae. J Appl Microbiol 109:13–24 Morimura S, Ling ZY, Kida K (1997) Ethanol production by repeated- Swan TM, Watson K (1999) Stress tolerance in a yeast lipid mutant: batch fermentation at high temperature in a molasses medium membrane lipids influence tolerance to heat and ethanol indepen- containing a high concentration of total sugar by a thermotolerant dently of heat shock proteins and trehalose. Can J Microbiol flocculating yeast with improved salt-tolerance. J Ferment Bioeng 45:472–479 83:271–274 Teixeira MC, Raposo LR, Mira NP, Lourenco AB, Sa-Correia I (2009) Nevoigt E (2008) Progress in metabolic engineering of Saccharomyces Genome-wide identification of Saccharomyces cerevisiae genes cerevisiae. Microbiol Mol Biol Rev 72:379–412 required for maximal tolerance to ethanol. Appl Environ Micro- Olofsson K, Bertilsson M, Liden G (2008) A short review on SSF—an biol 75:5761–5772 interesting process option for ethanol production from lignocellu- Varela C, Cardenas J, Melo F, Agosin E (2005) Quantitative analysis of losic feedstocks. Biotechnol Biofuels 1:1–14 wine yeast gene expression profiles under winemaking conditions. Parrou JL, Francois J (1997) A simplified procedure for a rapid and Yeast 22:369–383 reliable assay of both glycogen and trehalose in whole yeast cells. Vos MJ, Hageman J, Carra S, Kampinga HH (2008) Structural and func- Anal Biochem 248:186–188 tional diversities between members of the human HSPB, HSPH, Piper PW (1995) The heat-shock and ethanol stress responses of yeast HSPA, and DNAJ chaperone families. Biochemistry 47:7001–7011 exhibit extensive similarity and functional overlap. FEMS Micro- Zhang L, Zhang Y, Zhou YM, An S, Zhou YX, Cheng J (2002) biol Lett 134:121–127 Response of gene expression in Saccharomyces cerevisiae to Piper PW, Talreja K, Panaretou B, Moradasferreira P, Byrne K, Prae- amphotericin B and nystatin measured by microarrays. J Antimi- kelt UM, Meacock P, Recnacq M, Boucherie H (1994) Induction crob Chemother 49:905–915 of major heat-shock proteins of Saccharomyces cerevisiae, in- Zhao XQ, Bai FW (2009) Mechanisms of yeast stress tolerance and its cluding plasma-membrane Hsp30, by ethanol levels above a manipulation for efficient fuel ethanol production. J Biotechnol critical threshold. Microbiology 140:3031–3038 144:23–30 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

Transcriptional analysis of Saccharomyces cerevisiae during high-temperature fermentation

Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/transcriptional-analysis-of-saccharomyces-cerevisiae-during-high-akFRtOLuEf

References (37)

Publisher
Springer Journals
Copyright
Copyright © 2013 by Springer-Verlag Berlin Heidelberg and the University of Milan
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Fungus Genetics; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/s13213-013-0606-0
Publisher site
See Article on Publisher Site

Abstract

Ann Microbiol (2013) 63:1433–1440 DOI 10.1007/s13213-013-0606-0 ORIGINAL ARTICLE Transcriptional analysis of Saccharomyces cerevisiae during high-temperature fermentation Qian Chen & Yang Fang & Hai Zhao & Guohua Zhang & Yanling Jin Received: 14 April 2012 /Accepted: 11 January 2013 /Published online: 30 January 2013 Springer-Verlag Berlin Heidelberg and the University of Milan 2013 . . Abstract DNA microarrays were used to investigate the Keywords DNA microarray Quantitative real-time PCR . . transcriptional response of Saccharomyces cerevisiae genes Saccharomyces cerevisiae High-temperature fermentation under high temperature fermentation. Up to 35.73 % of Stress response yeast genes were up-regulated or down-regulated at least two-fold in their expression level at the late stage of fer- mentation. Nine genes involved in the pathways of glycol- Introduction ysis, ethanol generation and stress response were selected for study of their transcription profiles during high temper- Dramatic increases in global population and energy demands ature fermentation processes by using quantitative real-time are propelling the requirement to produce ethanol as an eco- PCR assay. Our data indicated that the genes involved in friendly renewable liquid fuel (Hahn-Hagerdal et al. 2006; trehalose biosynthesis and encoding heat shock proteins Stanley et al. 2010). To improve ethanol yield and productiv- (HSPs) were significantly induced, while the genes involved ity and to search for less expensive technology for the pro- in ethanol production were down-regulated during the 40 °C duction of ethanol, the development of a fermentation process fermentation. Specially, HSP26 displayed the highest tran- at high temperature with a high concentration substrate is scription level of 166.19±15.82-fold at 6 h, indicating that necessary (Morimura et al. 1997). The advantages of fermen- this gene may play important roles at the onset of 40 °C tation at high temperature (40–45 °C) are not only reduced fermentation. Moreover, transcription levels of the nine cooling, simultaneous saccharification and fermentation genes were reduced significantly and returned to normal (SSF) and downstream distillation costs but also minimization levels compared with controls after the samples were treated of the risk of contamination (Benjaphokee et al. 2012; Nevoigt at 30 °C for another 2 h. The results of this study suggest 2008; Olofsson et al. 2008). An increase in fermentation that these genes and their related pathways are involved in temperature of only 5 °C can greatly affect ethanol production the response to high temperature; these findings will be costs (Abdel-Banat et al. 2010). The yeast strain helpful in improving the characteristics and fermentation Saccharomyces cerevisiae has long been used in the baking, capacity of industrial yeast strains by metabolic engineering. brewing and wine-making industries, and in recent years also in the production of fuel ethanol (Zhao and Bai 2009). Among the desirable properties of strains required for efficient and economical fuel ethanol production, tolerance to high temper- : : : : Q. Chen Y. Fang H. Zhao G. Zhang Y. Jin (*) ature as well as high ethanol concentration are important traits Environmental Microbiology Key Laboratory of Sichuan of yeast strains. Therefore, high temperature fermentation has Province, Chengdu Institute of Biology, Chinese Academy of been applied gradually in fuel ethanol production and a yeast Sciences (CAS), Chengdu, Sichuan Province 610041, strain that displays these phenotypes would be indispensable People’s Republic of China e-mail: jinyl@cib.ac.cn for high temperature ethanol fermentation. During high temperature fermentation processes, the yeast Q. Chen cells encounter a variety of adverse conditions including not Graduate University of the Chinese Academy of Sciences, Beijing only high temperature and ethanol concentration, but also 100049, People’s Republic of China 1434 Ann Microbiol (2013) 63:1433–1440 osmotic stress from the substrate and limitation of essential (2 %, glucose, 2 % peptone, 1 % yeast extract and 2 % agar, nutrients. Ethanol inhibits the growth and viability of yeast w/v) slants at 4 °C subcultured every 4 weeks. cell, affects different transport systems and inhibits the activity The medium used for inoculation contained glucose 100 g, of key glycolytic enzymes, which causes deterioration in yeast extract 8.5 g, (NH ) SO 1.3 g, MgSO ·7H O0.1 g, 4 2 4 4 2 ethanol fermentation efficiency (Crawford and Zochowski CaCl 0.06 g per liter at pH 6.0. Erlenmeyer flasks (250 mL) 1984; Pizarro et al. 2008; Teixeira et al. 2009). Interestingly, containing 100 mL medium were incubated at 30 °C, 150 rpm the responses of S. cerevisiae to ethanol stress and heat shock on a rotatory shaker for 16 h to prepare the inocula. A 10 %v/v are very similar, and a cross-tolerance phenomenon has been inocula was added aseptically to flasks (250 mL) containing observed (Causton et al. 2001; Snowdon et al. 2009). The 100 mL fermentation medium (pH 6.0, comprising glucose yeast cells respond rapidly to stress conditions and adapt to the 240 g, yeast extract 5 g, peptone 5 g, CaCl 2.8 g, (NH ) SO 2 4 2 4 adverse surroundings via induction or repression of specific 1.5g,MgSO ·7H O 0.65 g, inositol 0.85 g, thiamin 0.35 g, 4 2 genes involved in various response pathways (Bisson 1999; pyridoxine 4 mg, niacin 4 mg, 4-aminobenzoic acid 7 mg, Gasch et al. 2000;Piper 1995). The biochemical basis of S. biotin 24 μg per liter). Fermentation was conducted at the cerevisiae’s response to stress factors involves the accumula- temperatures indicated, 180 rpm under anaerobic conditions. tion of trehalose and heat shock proteins (HSPs) against heat Samples were taken at regular intervals and cells were collect- and ethanol stress (Alexandre et al. 2001; Brosnan et al. 2000). ed by centrifugation (9,000 g for 2 min) at 4 °C, and frozen The HSPs are a conserved group of protein families belonging immediately in liquid nitrogen. The cells were stored at −80 °C to the larger superfamily of molecular chaperones (Vos et al. until RNA extraction. All media were sterilized by autoclaving 2008). During heat shock and ethanol stress, HSPs play im- for20min at 115°C. portant roles in preventing aggregation or assisting refolding of proteins. Trehalose is reported to be a stress protectant and RNA extraction to influence membrane structure and hydrogen bonding inter- actions, which reduce membrane permeability and help proper Cells were harvested and washed with RNase-free water. Total folding of proteins (Mansure et al. 1994; Singer and Lindquist RNA was extracted and purified using RNAprep pure Plant 1998a). In response to the stresses, yeast cells also adjust the Kit (Tiangen, Beijing, China) with DNase I treatment, accord- lipid composition of the membrane by increasing the propor- ing to the manufacture’s instructions. RNA concentrations and tion of ergosterol and unsaturated fatty acids in the lipid purity were determined by measuring absorbance at 260 membrane of the cell (Swan and Watson 1999). (A ) and 280 nm (A )onaVarioskanFlash Spectral 260 280 Although much research has been undertaken, the mecha- Scanning Multimode Reader (Thermo Scientific, Waltham, nisms of the S. cerevisiae response to heat and ethanol stresses MA) and calculating the ratio of A to A .Meanwhile, 260 280 are still not fully understood, and further extensive study is RNA obtained from yeast cells of 30 °C fermentation was necessary in order to pin point these mechanisms. Today, DNA used as control samples in both microarrays and qPCR assays. microarray and quantitative real-time PCR (qPCR) can be used to determine the intracellular state and analyze the transcrip- DNA microarray analysis tional responses of S. cerevisiae under high temperature fer- mentation. Such research will improve our understanding of The cDNA synthesis, labeling and hybridization to GeneChip the yeast cell’s response to high temperature fermentation and Yeast Genome 2.0 Array (Affymetrix, Santa Clara, CA) were provide some clues for breeding thermotolerant yeast strains performed at CapitalBio Corp. (Beijing, China) according to (Gasch et al. 2000;Lietal. 2010;Varelaetal. 2005). the supplier’s manual (Affymetrix GeneChip Expression In the present study, we used DNA microarrays and qPCR Analysis Technical Manual, 2004). The array has probes for to analyze gene expression profiles during a high temperature 5,744 yeast ORFs (5,841 genes). Washing and staining of fermentation process in a study of the transcriptional changes microarrays were conducted using GeneChip Fluidics in yeast genes in response to stress. Functional analysis of the Station 400 (Affymetrix). Microarrays were scanned using selected genes may provide important information about the GeneChip Scanner 3000 and the fluorescence intensities were mechanisms involved in the thermotolerance of yeast. quantified using Affymetrix GeneChip Operating Software Version 1.4. Statistically significant differentially expressed genes were identified when their expression ratios were great- Materials and methods er than 2-fold with P<0.05. Genes that were either up- or down-regulated in 40 °C fermentation provided information Strain, media and culture conditions pertinent to transcriptional responses to heat and ethanol stresses at a molecular level. Gene descriptions and annota- The strain used in this study was Saccharomyces cerevisiae tions were identified in the Saccharomyces Genome Database CCTCC M206111. The strain was maintained on YPDA (http://www.yeastgenome.org). Ann Microbiol (2013) 63:1433–1440 1435 Table 1 Primers for quantitative real-time PCR (qPCR) analysis ID Sequence 5′→3′ Amplicon (bp) Gene/ORF Reference/source ACT-F TGTTACTCACGTCGTTCCAAT 103 ACT1 Chen and Widom ACT-R GATCTTCATCAAGTAGTCAGTCAA 2005 HSP26-F TAGCAAACACACCCGCAAAG 136 HSP26 This study HSP26-R CCAGATGGGAACAGGGACA SSA4-F ATTGCGTATGGGCTGGAC 238 SSA4 Han et al. 2008 SSA4-R AGGGACCTTTGGTTAGTTGTTA SSA3-F CGTATTATCAATGAACCCACTG 164 SSA3 Han et al. 2008 SSA3-R GTCTCCTGCGGTAGCCTTA PGM1-F GTTGTTGGAGGAGATGGTCGTTTC 97 PGM1 Ma and Liu 2010 PGM1-R TGGGTTGTGTGAGGCAGTTA HMG1-F CCATCAACTGGATCGAAGGT 109 HMG1 Ma and Liu 2010 HMG1-R AACTCAACCAATGCGGAAAC HMG2-F GGTGCCTGCAAGATATGGTT 124 HMG2 Ma and Liu 2010 HMG2-R AAAGCAAATCGCCTGCTAGA ERG9-F TGAAAGCATGGGTCTTTTCC 114 ERG9 Ma and Liu 2010 ERG9-R TGAGGAGCGTATTGTGACCA ADH4-F TGTCACAGCTGGTTTGAAGG 125 ADH4 Ma and Liu 2010 ADH4-R CGATTTCCCCACCGTTAGTA PYK2-F AATTGAAATCCTGGCACCTG 106 PYK2 Ma and Liu 2010 PYK2-R TGAATCCAGCATCTGAGTCG Quantitative real-time PCR were: 2 min at 98 °C, followed by 40 cycles of 5 s at 98 °C, 15 s at 54 °C, and then a melting curve of the amplified DNA Based on microarrays results, nine genes involved in gly- was acquired. ACT1 was used as an internal reference for colysis, ethanol generation and stress response to ethanol normalizing gene expression. Primers of the selected genes and temperature were selected for quantitative transcription are given in Table 1. The data were analyzed by calculating −ΔΔCt analysis by using qPCR. Samples were taken at the times 2 (Livak and Schmittgen 2001). All experiments were indicated and total RNA was extracted. cDNA was synthe- conducted in triplicate. sized using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. The Analytical methods qPCR was performed using SsoFast Evagreen Supermix (Bio-Rad) on a MyiQ2 Two-Color Real-Time PCR The growth of S. cerevisiae was determined by measuring Detection System (Bio-Rad). The PCR cycle parameters the optical density of a ten-fold dilution culture at 620 nm Fig. 1 Saccharomyces cerevisiae fermentation profiles at 30 °C (closed symbols) and 40 °C (open symbols): OD (black squares, white squares), residual glucose (black triangles, white triangles) and ethanol concentration (black circles, white circles). Error bars Standard deviation 1436 Ann Microbiol (2013) 63:1433–1440 using a UV 754N model spectrophotometer. Cell dry weight experiments were performed at 30 °C and 40 °C with was determined gravimetrically. Intracellular trehalose was fermentation media containing 240 g/L glucose. As shown extracted as described previously (Parrou and Francois in Fig. 1, in the first 12 h, a large increase in cell density 1997). Glucose and trehalose in samples were determined (OD ) was detected in both 30 °C and 40 °C fermenta- by high-performance liquid chromatography (HPLC; Waters tions, accompanied by a rapid increase in ethanol concen- 2795, Waters, Milford, MA). The samples were filtered tration, whichthenremainedstable tothe endof through a 0.22 μm filter before HPLC analysis. The HPLC fermentation. In addition, glucose was almost completely was equipped with Evaporative Light-scattering Detector consumed and similar ethanol concentrations (13.84 %v/v (All-Tech ELSD 2000, All-Tech, Bakersfield, CA) and at 30 °C and 13.19 %v/v at 40 °C) were finally obtained in Aminex HPX-87-Pb column (Bio-Rad). Each sample was the two fermentation experiments. However, the cell density injected (20 μL) into the column operating at 79 °C and of the fermentation broth at the late stage of 30 °C fermen- deionized water was mobile phase at flow rate of tation (about 1.40) was much higher than that at 40 °C 0.6 mL/min. Nitrogen was carrier gas at a pressure of (about 1.05) and an extended fermentation time was ob- 2.8 bar and draft temperature was 95 °C for the ELSD served at 40 °C. The fermentation efficiency and volumetric −1 −1 detector. The ethanol concentration was determined using ethanol productivities were 92.60 %, 4.04 g L h at 30 °C −1 −1 a gas chromatography (FULI 9790, FULI, Zhejiang, China) and 90.75 %, 2.89 g L h at 40 °C, respectively. The equipped with an FID detector and a GDX 103 packed results indicated that the yeast cell growth, fermentation column (3.2 mm×2 m, FULI ). The temperature of the efficiency and volumetric ethanol productivities were affect- column, detector and injector were 95 °C, 150 °C and ed greatly by the high temperature. 150 °C, respectively. Prior to the determination, n-propanol (the inner standard) was added to each sample to a concen- Microarray analysis of global gene transcription tration of 2 %v/v. To investigate the response profiles of yeast under high Statistical analysis temperature fermentation, DNA microarray analysis was performed. DNA microarray analysis is a powerful tool that The statistical analysis of results was performed by applying can be used to understand the global transcriptional re- one-way variance analysis (ANOVA) using SPSS 17.0 soft- sponse to different stresses. Samples were taken at the late ware. P-values of less than 0.05 were considered to be stage of the two fermentation experiments when the ethanol statistically significant. concentrations were over 12 %v/v. Samples were taken at 32 h and 25 h for the 40 °C and 30 °C fermentations, respectively, and total RNA was isolated for microarray Results analysis. Of 5,841 genes, the expression of 2,087 (35.73 %) exhibited a statistically significant expression Fermentation profiles change (greater than 2-fold) at the end of 40 °C fermentation relative to the corresponding time at 30 °C, indicating a To characterize the differential response of yeast cells to transcriptional response to ethanol and heat stresses. The high temperature and ethanol concentration, fermentation numbers of up- and down-regulated genes were 1,068 Table 2 The nine genes in- Systematic name Gene name Gene description Fold induction volved in important metabolic pathways as revealed by micro- Up-regulated genes array analysis YBR072W HSP26 Heat shock protein 21.90 YBL075C SSA3 Heat shock protein of HSP70 family, cytosolic 10.35 YER103W SSA4 Heat shock protein of HSP70 family, cytosolic 8.38 YKL127W PGM1 Phosphoglucomutase, minor isoform 18.27 Down-regulated genes YGL256W ADH4 Alcohol dehydrogenase IV −2.50 YML075C HMG1 3-Hydroxy-3-methylglutaryl-coenzyme A reductase 1 −4.35 YLR450W HMG2 3-Hydroxy-3-methylglutaryl-coenzyme A reductase 2 −2.70 YHR190W ERG9 Farnesyl-diphosphate farnesyltransferase −5.00 YOR347C PYK2 Pyruvate kinase, glucose-repressed isoform −10.00 Ann Microbiol (2013) 63:1433–1440 1437 Fig. 2 Relative transcription levels of S. cerevisiae genes during 40 °C temperature fermentation. Relative transcription levels were −ΔΔCt analyzed by calculating 2 using ACT1 as an internal reference. The expression levels of down-regulated genes=−1/ their relative transcription levels. Error bars Standard deviations. The letters indicate expression data that differ significantly (one letter P< 0.05; two letters P<0.01) from the reference data (o) of each gene (18.28 %) and 1,019 (17.45 %), respectively. These genes involved in the important pathways of glycolysis, ethanol were distributed in 89 pathways according to the KEGG generation and stress response to ethanol and temperature, pathway database (http://www.genome.jp/kegg/path- were selected for further research using qPCR. way.html). The results indicated that high temperature and ethanol concentration in fermentation greatly alter the phys- Relative transcription level analysis by qPCR iological and transcriptional profiles of yeast cells in com- plex ways. Table 2 shows the genes with significant To better understand the transcriptional response of S. ce- expression changes revealed by microarrays analysis. The revisiae to heat and ethanol stresses during high temperature nine genes with the highest significant expression changes, fermentation process, samples were taken at the beginning Fig. 3 Trehalose content of yeast cells during 30 °C and 40 °C fermentation. Samples were withdrawn at different time points. Samples at 36 h of 40 °C fermentation were incubated at 30 °C for another 2 h. No trehalose was detected at 6 h of 30 °C fermentation. Error bars Standard deviation. The letters indicate trehalose content the differed significantly (one letter P< 0.05; two letters P<0.01) from reference data (o) of each fermentation 1438 Ann Microbiol (2013) 63:1433–1440 (6 h), middle (18 h) and end of fermentation (36 h for 40 °C foranother 2h(Fig. 2). Correspondingly, trehalose content and 27 h for 30 °C) and the relative transcription levels of the decreased sharply from 72.53 and 134.73±8.28 mg/g to nine genes were determined by using qPCR. An additional 56.04 and 51.65±4.95 mg/g at 30 and 40 °C fermenta- sample at the end of 40 °C fermentation incubated at 30 °C for tion, respectively (Fig. 3). The above results suggested another 2 h was also taken for gene transcription analysis. that global gene transcriptional responses were induced Genes encoding HSPs play an important role in the by high temperature and ethanol stresses and these ethanol- and heat-tolerance of yeast (Saavedra et al. 1996). responses were crucial for yeast cells to adapt to and As shown in Fig. 2, the gene HSP26 was greatly up- survive the stresses (Pizarro et al. 2008). regulated (up to 166.19±15.82-fold) at 6 h of fermentation, whereas the ethanol concentration was only 2.14±0.09 % (v/v). At the same time point, the transcription levels of Discussion other HSP genes (SSA3 and SSA4) were relatively low (Fig. 2). The results suggest that HSP26 is important for High temperature is a severe adverse factor for yeast during the yeast cell response to high temperature at the early stage ethanol fermentation, the response of yeast cells to stresses of fermentation. But dramatically increased transcription is complex, involving various aspects of cell sensing, signal levels of SSA3 and SSA4 at 18 h were observed, which were transduction, transcriptional and posttranscriptional control, accompanied with an increased ethanol concentration (from protein-targeting, accumulation of protectants, and in- 2.14±0.09 to 5.8±0.13 %v/v). This result indicated that creased activity of repair functions (Stanley et al. 2010). In SSA3 and SSA4 might be important for yeast ethanol toler- this work, the global transcriptional response of yeast cells ance under high temperature as described previously during ethanol fermentation at high temperature was studied (Alexandre et al. 2001). by using DNA microarrays analysis, which is consistent PGM1 encodes phosphoglucomutase—a key enzyme in- with previous reports (Alexandre et al. 2001; Ma and Liu volved in trehalose and glycogen metabolism (Hirata et al. 2010). To further understand and characterize the response 2003). At the time point of 18 h, this gene was greatly up- of yeast to high temperature and ethanol stresses, based on regulated (20.94±3.16-fold) and a relatively high transcrip- microarray analysis nine candidate genes involved in differ- tion level was maintained to the end of 40 °C fermentation. ent metabolism pathways were selected for quantitative An accumulation of trehalose in yeast cell was also detected transcriptional analysis at the beginning, middle and end in the 40 °C fermentation sample. As shown in Fig. 3, the stages of high temperature fermentation. Sterol, for example trehalose contents of yeast cells were 27.47±2.33 mg/g cell ergosterol, is an essential constituent of yeast plasma mem- dry weight at 6 h, 227.08±18.49 mg/g at 18 h and 134.73± brane and plays an important role in thermotolerance and 8.28 mg/g at 36 h, while the trehalose contents in control ethanol stress. HMG1 and HMG2, encoding proteins in- samples were 0, 207.27±15.42 and 72.53±9.4 mg/g at the volved in a rate-limiting step of sterol biosynthesis, were corresponding times. Considering the fermentation process down-regulated during the high temperature fermentation. was completed under 30 °C and 40 °C, we concluded that These genes contribute to yeast cell survival under adverse accumulation of trehalose is a response mechanism for yeast environmental stresses and their transcription level changes cells to survive and maintain their normal function under might suggest a reconstruction of cell membrane in response high temperature fermentation. to high temperature and ethanol concentration, which would PYK2 and ADH4, encoding pyruvate kinase and alcohol cause cell membrane perturbation (Zhang et al. 2002). dehydrogenase, are key genes involved in ethanol biosyn- Meanwhile, the key enzymes, PYK2 and ADH4 were also thesis (Ma and Liu 2010). Their expression levels were low significantly down-regulated in the 40 °C fermentation. during 40 °C fermentation. At the end of fermentation, Consistent with these results, cell growth was slow, a low PYK2 and ADH4 were down-regulated 25.00-fold and optical density of the fermentation broth was obtained and 3.05-fold, compared with 30 °C fermentation. Meanwhile, cell viability was reduced, leading to a longer fermentation three genes involved in the sterol biosynthesis pathway were time at 40 °C compared with the 30 °C fermentation (Fig. 1). also down-regulated at different time points during 40 °C Trehalose is essential for protecting cell membranes fermentation. ERG9 was down-regulated 12.5-fold at 36 h; against adverse environmental stresses (Singer and HMG1 was down-regulated 8.42-fold at 6 h and 5-fold at Lindquist 1998b). PGM1 was up-regulated during the 40 °C 36 h; HMG2 was down-regulated 9.1-fold at 36 h. This fermentation even though a slightly down-regulation was result suggested that cell activities and membrane composi- observed at 6 h of fermentation. Accordingly, trehalose con- tion were affected by the adverse stresses. tent maintained a high level compared with the control. Moreover, significant recovery transcription levels of Trehalose content has been correlated with cell survival under these genes were observed after the sample, which was environmental stresses and can prevent irreversible dehydra- taken at 36 h of 40 °C fermentation, was incubated at 30 °C tion of yeast cells (Ma and Liu 2010). Cells without trehalose Ann Microbiol (2013) 63:1433–1440 1439 accumulation will display growth inhibition under ethanol trehalose content of yeast cells was higher than that at 30 °C challenges (Mansure et al. 1994). The cell density at 40 °C fermentation and decreased dramatically after the cells were was lower than that at 30 °C, which indicated that the cell incubated at 30 °C for 2 h. We conclude that synthesis of growth was inhibited by the high temperature. However, the trehalose was highly induced by the high temperature rather 40 °C fermentation process was completed (fermentation effi- than by the high ethanol concentration. ciency>90 %) accompanied by trehalose accumulation in yeast In this work, some insight into the transcription responses cells. Therefore, the increase of trehalose content in yeast cell, of yeast cells under high temperature fermentation were resulting from its response to high temperature, conferred much revealed by DNA microarrays and qPCR analysis, which more adaptive potential to yeast against adverse stresses. will be informative and helpful in improving the thermotol- HSPs genes act mainly as chaperones to protect intracel- erance of industrial yeast strain by rational design. lular proteins from the deleterious effects of stresses or to Acknowledgments This work was supported financially by the Na- facilitate degradation of denatured proteins. SSA3 and SSA4, tional Sci-tech Pillar R & D Program of China (No. 2011BAD22B03), which are inducible HSP70 genes in yeast cells, have sev- China Agriculture Research System (No.CARS-11-A-04) and the eral functions directly related to thermotolerance such as Knowledge Innovative Program of the Chinese Academy of Sciences stabilization of protein structure, prevention of protein ag- (NO.KSCX2-EW-J-22&NO.KSCX2-EW-G-1-1). gregation, and regulation of protein activities (Han et al. 2008; Hartl and Martin 1995). In this study, our finding that SSA3 and SSA4 levels were up-regulated is consistent with References previously observed results. The increased transcription lev- els observed by us suggested that HSPs play important roles Abdel-Banat BMA, Hoshida H, Ano A, Nonklang S, Akada R (2010) in stress tolerance in 40 °C fermentation, especially in the High-temperature fermentation: how can processes for ethanol production at high temperatures become superior to the traditional late stage of the fermentation. process using mesophilic yeast? Appl Microbiol Biotechnol Hsp26, a temperature-regulated molecular chaperone, 85:861–867 forms large oligomeric complexes and dissociates into Alexandre H, Ansanay-Galeote V, Dequin S, Blondin B (2001) Global dimers at elevated temperature (Haslbeck et al. 1999). The gene expression during short term ethanol stress in Saccharomy- ces cerevisiae. FEBS Lett 498:98–103 deletion of HSP26 in S. cerevisiae causes an abnormal cell Benjaphokee S, Hasegawa D, Yokota D, Asvarak T, Auesukaree C, shape and protein aggregates under stress conditions, but Sugiyama M, Kaneko Y, Boonchird C, Harashima S (2012) does not affect thermotolerance (Franzmann et al. 2008). Highly efficient bioethanol production by a Saccharomyces ce- Piper et al. (1994) reported that HSP26 increased progres- revisiae strain with multiple stress tolerance to high temperature, acid and ethanol. New Biotechnol 29:379–386 sively as the ethanol addition increased from 4 to 10 %v/v. Bisson LF (1999) Stuck and sluggish fermentations. Am J Enol Vitic In this study, the HSP26 gene showed the highest transcrip- 50:107–119 tion level at 6 h of 40 °C fermentation. However, the Brosnan MP, Donnelly D, James TC, Bond U (2000) The stress transcription level gradually decreased, accompanied by an response is repressed during fermentation in brewery strains of yeast. J Appl Microbiol 88:746–755 increase in ethanol concentration, which may be due to a Causton HC, Ren B, Koh SS, Harbison CT, Kanin E, Jennings EG, Lee loss of cellular activities caused by the extra stress from high TI, True HL, Lander ES, Young RA (2001) Remodeling of yeast ethanol concentration. Besides, the up-regulation of SSA3 genome expression in response to environmental changes. Mol and SSA4 suggestedthatthese twogenes maybemore Biol Cell 12:323–337 Chen LY, Widom J (2005) Mechanism of transcriptional silencing in important than HSP26 for yeast cells to adapt to the high yeast. Cell 120:37–48 temperature and ethanol concentration at the late stage of the Crawford RMM, Zochowski ZM (1984) Tolerance of anoxia and fermentation. The increase in trehalose content and HSP ethanol toxicity in chickpea seedlings (Cicer arietinum L.). J gene transcription levels indicates that there may be a co- Exp Bot 35:1472–1480 Franzmann TM, Menhorn P, Walter S, Buchner J (2008) Activation of induction of trehalose and HSPs against stresses, and sug- the chaperone Hsp26 is controlled by the rearrangement of its gests a tight link between the two protective agents thermosensor domain. Mol Cell 29:207–216 (Alexandre et al. 2001). Gasch AP, Spellman PT, Kao CM, Carmel-Harel O, Eisen MB, Storz High temperature is a severe stress factor in ethanol G, Botstein D, Brown PO (2000) Genomic expression programs in the response of yeast cells to environmental changes. Mol Biol fermentation. The responses of yeast cells were complicated Cell 11:4241–4257 and involved many metabolism pathways, such as the tre- Hahn-Hagerdal B, Galbe M, Gorwa-Grauslund MF, Liden G, Zacchi G halose, sterol and HSP synthesis and glycolysis pathways. (2006) Bio-ethanol—the fuel of tomorrow from the residues of The global transcription responses of yeast cells are essen- today. Trends Biotechnol 24:549–556 Han QJ, Lu J, Duan JZ, Su DM, Hou XZ, Li F, Wang XL, Huang BQ tial for their adaptation to stresses. In this study, we found (2008) Gcn5- and Elp3-induced histone H3 acetylation regulates that the transcript level of HSP26 was highly induced at the hsp70 gene transcription in yeast. Biochem J 409:779–788 beginning of 40 °C fermentation, which might be one of the Hartl FU, Martin J (1995) Molecular chaperones in cellular protein main responses of yeast cells to high temperature. The folding. Curr Opin Struct Biol 5:92–102 1440 Ann Microbiol (2013) 63:1433–1440 Haslbeck M, Walke S, Stromer T, Ehrnsperger M, White HE, Chen SX, Pizarro FJ, Jewett MC, Nielsen J, Agosin E (2008) Growth temperature Saibil HR, Buchner J (1999) Hsp26: a temperature-regulated exerts differential physiological and transcriptional responses in chaperone. EMBO J 18:6744–6751 laboratory and wine strains of Saccharomyces cerevisiae. Appl Hirata Y, Andoh T, Asahara T, Kikuchi A (2003) Yeast glycogen Environ Microbiol 74:6358–6368 synthase kinase-3 activates Msn2p-dependent transcription of Saavedra C, Tung KS, Amberg DC, Hopper AK, Cole CN (1996) stress responsive genes. Mol Biol Cell 14:302–312 Regulation of mRNA export in response to stress in Saccharomy- Li BZ, Cheng JS, Ding MZ, Yuan YJ (2010) Transcriptome analysis of ces cerevisiae. Genes Dev 10:1608–1620 differential responses of diploid and haploid yeast to ethanol Singer MA, Lindquist S (1998a) Multiple effects of trehalose on stress. J Biotechnol 148:194–203 protein folding in vitro and in vivo. Mol Cell 1:639–648 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression Singer MA, Lindquist S (1998b) Thermotolerance in Saccharomyces −ΔΔCt data using real-time quantitative PCR and the 2 method. cerevisiae: the Yin and Yang of trehalose. Trends Biotechnol Methods 25:402–408 16:460–468 Ma MG, Liu ZL (2010) Quantitative transcription dynamic analysis Snowdon C, Schierholtz R, Poliszczuk P, Hughes S, van der Merwe G reveals candidate genes and key regulators for ethanol tolerance in (2009) ETP1/YHL010c is a novel gene needed for the adaptation of Saccharomyces cerevisiae. BMC Microbiol 10:169–188 Saccharomyces cerevisiae to ethanol. FEMS Yeast Res 9:372–380 Mansure JJC, Panek AD, Crowe LM, Crowe JH (1994) Trehalose Stanley D, Bandara A, Fraser S, Chambers PJ, Stanley G (2010) The inhibits ethanol effects on intact yeast-cells and liposomes. ethanol stress response and ethanol tolerance of Saccharomyces BBA-Biomembranes 1191:309–316 cerevisiae. J Appl Microbiol 109:13–24 Morimura S, Ling ZY, Kida K (1997) Ethanol production by repeated- Swan TM, Watson K (1999) Stress tolerance in a yeast lipid mutant: batch fermentation at high temperature in a molasses medium membrane lipids influence tolerance to heat and ethanol indepen- containing a high concentration of total sugar by a thermotolerant dently of heat shock proteins and trehalose. Can J Microbiol flocculating yeast with improved salt-tolerance. J Ferment Bioeng 45:472–479 83:271–274 Teixeira MC, Raposo LR, Mira NP, Lourenco AB, Sa-Correia I (2009) Nevoigt E (2008) Progress in metabolic engineering of Saccharomyces Genome-wide identification of Saccharomyces cerevisiae genes cerevisiae. Microbiol Mol Biol Rev 72:379–412 required for maximal tolerance to ethanol. Appl Environ Micro- Olofsson K, Bertilsson M, Liden G (2008) A short review on SSF—an biol 75:5761–5772 interesting process option for ethanol production from lignocellu- Varela C, Cardenas J, Melo F, Agosin E (2005) Quantitative analysis of losic feedstocks. Biotechnol Biofuels 1:1–14 wine yeast gene expression profiles under winemaking conditions. Parrou JL, Francois J (1997) A simplified procedure for a rapid and Yeast 22:369–383 reliable assay of both glycogen and trehalose in whole yeast cells. Vos MJ, Hageman J, Carra S, Kampinga HH (2008) Structural and func- Anal Biochem 248:186–188 tional diversities between members of the human HSPB, HSPH, Piper PW (1995) The heat-shock and ethanol stress responses of yeast HSPA, and DNAJ chaperone families. Biochemistry 47:7001–7011 exhibit extensive similarity and functional overlap. FEMS Micro- Zhang L, Zhang Y, Zhou YM, An S, Zhou YX, Cheng J (2002) biol Lett 134:121–127 Response of gene expression in Saccharomyces cerevisiae to Piper PW, Talreja K, Panaretou B, Moradasferreira P, Byrne K, Prae- amphotericin B and nystatin measured by microarrays. J Antimi- kelt UM, Meacock P, Recnacq M, Boucherie H (1994) Induction crob Chemother 49:905–915 of major heat-shock proteins of Saccharomyces cerevisiae, in- Zhao XQ, Bai FW (2009) Mechanisms of yeast stress tolerance and its cluding plasma-membrane Hsp30, by ethanol levels above a manipulation for efficient fuel ethanol production. J Biotechnol critical threshold. Microbiology 140:3031–3038 144:23–30

Journal

Annals of Microbiology – Springer Journals

Published: Jan 30, 2013

There are no references for this article.