Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Tracing the origin of fish without hatchery information: genetic management of stock enhancement for mangrove red snapper (Lutjanus argentimaculatus) in Taiwan

Tracing the origin of fish without hatchery information: genetic management of stock enhancement... Stock enhancement is considered to be a valuable approach for restoring fishery resources. Because no specific official institution in Taiwan is responsible for the production of fry, the released fry are purchased directly from the private sector. However, fishermen from the private industry have not established a genetic background, so the genetic composition for each batch of released fry is unclear. Mangrove red snapper (Lutjanus argentimaculatus), a prominent species released in Taiwan, was collected after its official release. One hundred and two field samples were compared with four batches of hatchery fry (n = 685) by using a microsatellite-based multiplex PCR assay. Four of the field samples (3.9%; 4/102) were revealed to be from a fish farm and most likely from a single batch. This study revealed that wild mangrove red snappers are genetically different from those originating from farms, and their origins can be traced through molecular markers, even without information on breeding stocks. Keywords: Broodstock, Microsatellites, Genetic diversity, Aquaculture, Release Introduction proposed as a potential method to increase or recover The human population is increasing rapidly and the biomass of depleted fishery stocks (Bell et al. 2008). exhausting the Earth’s arable land. Demand for aquatic Stock enhancement has been practiced for over a cen- products is increasing (Cressey 2009). However, ad- tury, with more than 100 species released to date world- vances in fishing technology do not provide more wide (Liao 1997). catches but exhaust or exceed the production of renew- Although stock enhancement is considered to be an able fishery resources. Approximately half of all fish improved effort toward increasing fishery resources, few stocks have been deemed “fully exploited” or “over- cases have been well evaluated or have been substantially exploited” (Cressey 2009). In addition, human activities evidenced (Kitada 2018). Confirming that changes in fish have drastically reduced the abundance and distribution resources are affected by stock enhancement or other of marine fish and invertebrate populations through pol- natural factors is a challenge (Blankenship and Leber lution and habitat destruction (Schiermeier, 2002; Pauly 1995; Kitada 2018). However, an increasing number of and Watson 2003; Islam and Tanaka 2004). Because the studies have demonstrated that unconscious aquaculture world’s fisheries are now known to be in crisis, restock- practices and inappropriate artificial release affect the ing, and stock enhancement programs have been health of natural populations through destruction of habitats, invasion of species, pathogens, and interspecies or intraspecies hybridization. Examples include case * Correspondence: panjade@nkust.edu.tw 4 studies of the Adriatic sturgeon, Acipenser naccarii Department and Graduate Institute of Aquaculture, National Kaohsiung University of Science and Technology, Kaohsiung 81157, Taiwan (Boscari and Congiu 2014); Korean starry flounder, Full list of author information is available at the end of the article © The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 2 of 7 Platichthys stellatus (An et al. 2014); and black sea Materials and methods bream, Acanthopagrus schlegelli, in Japan (Blanco Gon- A total of 787 mangrove red snapper specimens, includ- zalez and Umino 2009). Disruption of genetic structure ing 685 hatchery individuals from four batches allocated is a severe problem resulting in reduced population fit- for release (populations H1, H2, H3, and H4) and 102 ness, ecological imbalance, and natural resource short- individuals from the wild (Kaohsiung and Pingtung; ages (Stokstad 2007; Araki and Schmid 2010). population W), were obtained during 2015 and 2016 Taiwan’s government has promoted a massive stock (Table 1). Sampling locations with the abbreviated popu- enhancement program in the coastal waters of Taiwan lation name and the sample size of each population ap- every year, claiming it could enhance the fishery re- pear in Table 1. Small pieces of muscle tissues (about 3- sources. Numerous artificial breeding fry were released, 5 mm) were prepared from fresh (use of 2% alcohol for and only a small proportion of fish have been labeled to anesthesia) or frozen samples, transported to the labora- evaluate their survival rate. In addition, conventional tory for molecular study, and preserved in 95% ethanol. markers (biological, physical, chemical) cannot estimate The standard proteinase K/phenol method was modified the reproduction rate of released fish. Because the gen- from an animal DNA extraction protocol. Moreover, etic diversity and genetic structures of natural wild pop- 0.8% agarose gel electrophoresis was performed to assess ulations must be understood in fishery resource DNA template quality. management, molecular markers are useful tools to as- sist conventional methods applied in stock enhancement Table 1 Summary statistics for genetic variation at four programs (Le Vay et al. 2007). microsatellite loci in five mangrove red snapper populations Japan and several countries in Europe and the USA, Population (n) LA02 LA04 LA05 LA06 Average SE for example, have official agencies for the management H1 (130) Na 11 2 2 2 4.250 2.250 of stock enhancement. They are able not only to verify the reliability of external markers but also to evaluate Ne 6.899 1.977 1.990 1.055 2.981 1.324 the genetic composition of offspring and they are repro- Ho 0.692 0.154 0.223 0.008 0.269 0.148 ductively through mark-recapture studies (Bell et al. He 0.855 0.494 0.498 0.052 0.475 0.164 2008). Taiwan began to promote the artificial release of F 0.190 0.689 0.552 0.853 0.571 0.141 IS seedlings in the 1980s. The government has allocated a H2 (200) Na 11 2 2 2 4.250 2.225 considerable amount of money every year but has over- Ne 7.940 1.771 2.000 1.094 3.201 1.591 looked genetic factors (Liao et al. 2003). This neglect of population genetics and biodiversity has meant that no Ho 0.790 0.300 0.235 0.060 0.346 0.156 well-designed stock enhancement programs were con- He 0.874 0.435 0.500 0.086 0.474 0.161 ducted. Official fishery organizations (the Taiwan Fisher- F 0.096 0.311 0.530 0.302 0.310 0.089 IS ies Sustainable Development Association; https://www. H3 (240) Na 7 3 2 2 3.500 1.190 tfsda.org.tw/main.php) in Taiwan produce no fish fry Ne 4.835 1.381 1.999 1.082 2.324 0.858 directly. The fish fry for stock enhancement are provided Ho 0.488 0.329 0.229 0.054 0.275 0.091 by one or several private hatcheries. The source and genetic information of fishes are unknown. Moreover, He 0.793 0.276 0.500 0.076 0.411 0.154 genetic information for hatchery stocks is also unclear F 0.385 -0.194 0.541 0.288 0.255 0.159 IS and unstable. Although no genetic information is avail- H4 (115) Na 6 3 2 3 3.500 0.866 able for stocks, official organizations perform drug resi- Ne 3.027 1.018 1.995 1.322 1.840 0.445 due analysis for hatchery fry. This provides an Ho 0.165 0.017 0.235 0.148 0.141 0.045 opportunity for studying genetic diversity of fish fry and He 0.670 0.017 0.499 0.244 0.357 0.143 tracing the origins of fish without hatchery information. As human activities affect wild populations signifi- F 0.753 -0.007 0.529 0.394 0.417 0.160 IS cantly, investigating the genetic structure of wild popula- W (102) Na 13 6 2 4 6.250 2.394 tions and assessing effectiveness before and after stock Ne 6.184 1.758 1.995 1.602 2.885 1.103 enhancement are of critical concern. Therefore, we Ho 0.373 0.206 0.225 0.255 0.265 0.037 attempted to use microsatellite markers to discriminate He 0.838 0.431 0.499 0.376 0.536 0.104 between cultured and wild mangrove red snapper (Lut- F 0.556 0.522 0.548 0.322 0.487 0.055 janus argentimaculatus) and to examine the possible IS sources of hatchery-reared fry. This technology was used All (787) Na 15 7 2 4 4.350 0.789 in the monitoring and evaluating of stock enhancement Ne 5.777 1.581 1.996 1.231 2.646 0.465 for the mangrove red snapper in Taiwan to evaluate the N number of samples, Na allele number, Ne allelic richness, Ho observed effectiveness of this process. heterozygosity, He expected heterozygosity, F fixation index IS Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 3 of 7 A total of seven microsatellite markers (LA01-LA07) 000 iterations. A graphical representation of the were tested (Zhang et al. 2006). Every 4 markers were STRUCTURE results was generated using Structure Plot selected into the same multiplex PCR reaction validated v2.0 (Ramasamy et al. 2014). using 10 wild individuals. Loci (LA01, LA03, and LA07) not always got amplicons by using Tm 56-60 °C, and Results Loci (LA02, LA04, LA05, and LA06) that amplified suc- Genetic diversity within populations and genetic cessfully and stable were combined into further multi- differentiation among populations plexes. The universal dye-labeled primers used were T3: Across the four microsatellites, all of the individuals PET-5′AATTAACCCTCACTAAAGGG 3′, M13 Re- were genotyped successfully. No monomorphic loci were verse: NED-5′GGATAACAATTTCACACAGG 3′ Hill: detected among hatchery and wild samples. In total, 28 6FAM-5′ TGACCGGCAGCAAAATTG 3′ and Neomy- alleles were detected in all individuals; the marker LA02 cin rev: VIC-5′ AGGTGAGATGACAGGAGATC 3′. exhibited the highest number of alleles in all individuals Each forward primer had one of the above universal pri- per locus (15 alleles) and the marker LA05 exhibited the mer sequences added to its 5′ end (Table 2). PIG-tails lowest number of alleles in all individuals per locus (2 al- were added to the 5′end of all the reverse primers. PIG- leles; Table 1). The marker LA02 in W exhibited the tailing leads to an addition of a non-templated adenosine highest number of alleles per locus (13 alleles), whereas nucleotide to the 3′ end on nearly 100% of PCR prod- the marker LA05 in H1, H2, H3, H4, and W exhibited ucts which reduces stutter caused by random addition of the lowest number of alleles (2 alleles) (Table 1). Allele dATP (Brownstein et al. 1996). Multiplex PCRs were richness ranged from 1.928 (marker MSTN2) to 4.656 performed in 5 μl reactions with 50 ng template DNA, 1 (marker Pma4) in all individuals per locus (Table 1). The × Multiplex PCR Master Mix (Qiagen), 0.2 μMof each lowest allele richness was 1.018 in H4 (LA04) and the reverse primer, 0.05 μM of each unlabeled forward pri- highest allele richness was 7.94 in H2 (marker LA02) mer (modified with the appropriate universal tail) and (Table 1). Mean estimates of expected heterozygosity for 0.2 μM of labeled universal primer for each forward pri- all loci among the five populations were between 0.052 mer labeled with matching universal tail. PCR thermal and 0.874 (Table 1). H2 had the highest expected het- cycling conditions were as follows: 1 × 95 °C (15 min); erozygosity for all the loci (average He = 0.536), whereas 30 × 94 °C (30 s), 56 − 60 °C (90 s), 72 °C (60 s); 8 × 94 °C H4 had the lowest expected heterozygosity (average He (30 s), 53 °C (90 s), 72 °C (60 s); 1 × 60 °C (30 min). The = 0.357; Table 1). The average F value among five pop- IS fragment analysis of PCR products was performed using ulations was between 0.255 and 0.571. The highest F IS an ABI 3130 Genetic Analyzer (Applied Biosystems, (0.853) was found in H1 at the LA06 marker, and the USA). The output was analyzed using the GeneMapper lowest F (− 0.194) was observed in H3 at marker LA04 IS software (versions 3.7 and 4.0, Applied Biosystems, USA). (Table 1). The number of different alleles (Na), the number of ef- Pairwise comparisons between samples were per- fective alleles (Ne), observed genetic diversity (Ho), ex- formed (Table 3). Most comparisons among populations pected genetic diversity (He), and the fixation index (F ) demonstrated high-level genetic differentiation (0.050– IS were calculated using GENALEX 6.51 (Peakall and 0.229) (Table 3). The lowest F value of 0.016 supports ST Smouse 2012). To elucidate the population genetic low-level genetic differentiation between H1 and H2. structure from multilocus genotypes, the admixture model with correlated allele frequencies was applied Structure analysis among populations using STRUCTURE v2.3.4 (Falush et al. 2003, 2007). Structure analysis revealed the best K value (K = 5), Three independent runs were performed for the total which supports five possible clusters among all samples. data set of K values ranging from 1 to 5. All runs were Most individuals from hatchery populations were based on 100,000 iterations of burn-in followed by 500, grouped into four clusters (red, yellow, green, and blue), Table 2 Microsatellite loci used for mangrove red snapper Locus Repeat motif Primer sequences Tm (°C) Size (bp) Accession no. LA02_M13 (AG)n F: GATAACAATTTCACACAGG-GTATCACGATGTCTCAGCCAGT 56-60 161-193 DQ219295 R: GTTTCTT-CAGTTCTAAGCGGTTTCTCAAG LA04_T3 (AC)n F: AATTAACCCTCACTAAAGGG-GAGGCTGTAGTGCTCTGCCC 56-60 255-317 DQ219297 R: GTTTCTT-GTTCACCTTCATGGCGACAG LA05_Hill (TGC)n F: TGACCGGCAGCAAAATTG-GAGATTTTGGAATGCTGTG 56-60 157-159 DQ247923 R: GTTTCTT-AGTAACCACTGTCTCTGCA LA06_Neo (TGC)n F: AGGTGAGATGACAGGAGATC-CCTGATCATAGTGACGCGC 56-60 159-169 DQ247924 R: GTTTCTT-AATCGGAATCGGTTCATCTC Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 4 of 7 Table 3 Pairwise F values based on four microsatellite data for mangrove red snapper populations ST and most individuals from the wild population were in official fishery organizations (the Taiwan Fisheries Sus- the gray cluster (Fig. 1). Only five (0.73%) of the hatch- tainable Development Association) in Taiwan performed ery individuals were grouped into the gray cluster but stock enhancement of 21 species (20 finfish and 1 crab) did not exhibit a high possibility of wild origins (0.53– with more than 133,593,000 individuals (https://www. 0.75; data not provided). Structure cluster ratios within tfsda.org.tw). Only a few evaluation cases exist, and the each population (red-yellow-green-blue-gray) were H1, effectiveness of stock enhancement is highly controver- 50-3.08-32.31-13.85-0.77; H2, 55.5-3.50-25-16-0; H3, 0- sial (Hsu et al. 2008). Therefore, the population genetic 55.42-27.08-17.5-0; H4, 6.09-8.7-77.39-3.48-4.35; and W, evaluation method used in this study is not only one of 2.94-0-0-0.98-96.08 (Table 4). Four of the samples from the few evaluation cases but also the first case for the wild population (3.9%; 4/102) were revealed to be from a mangrove red snapper in Taiwan. fish farm (Fig. 1). The mark-and-recapture method is considered to be the most reliable method of assessment. Turbot Discussion (Scophthalmus maximus and Psetta maxima), red sea Stock enhancement started in Taiwan with the building bream (Pagrus major), brown trout (Salmo trutta), and and casting of artificial reefs in 1973. However, until Atlantic salmon (Salmo salar) were used, with the mark- 1987, the integrated stock program was only applied for and-recapture method, to examine the contribution rate restocking broodstock and fry or seeds. Seven finfish of stock enhancement (Iglesias et al. 2003; Jonsson et al. species (5.8 million fry), four mollusks (5 million seeds), 2003; Paulsen and Støttrup 2004; Dahle et al. 2006; and six crustaceans (30 million larvae) were restocked Kitada et al. 2009). In Taiwan, taking black seabream up to 1996 (Liao et al. 2003). Between 2002 and 2018, (Acanthopagrus schlegelli) as an example, Chang et al. Fig. 1 Structure analysis among five mangrove red snapper populations. Estimated population structure based on the highest probability STRUCT URE run at K = 5. Each individual is represented by a thin vertical line partitioned into K colored segments that represent the individual’s estimated membership fractions in each of the K clusters. Cluster 1, red; Cluster 2, yellow; Cluster 3, green; Cluster 4, blue; and Cluster 5, gray. Hatchery samples: H1–H4; wild samples: W Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 5 of 7 Table 4 Structure cluster results (%) for each mangrove red snapper population Cluster results were as seen in Fig. 1 N number of samples Cluster 1, red; Cluster 2, yellow; Cluster 3, green; Cluster 4, blue; and Cluster 5, gray (2011) used a double mass-marking method by spraying the population genetic method not only for examining fluorescent pigment onto the skin and feeding with oxy- genetic diversity but also determining the contribution tetracycline. They marked 105,543 fry (4.6–8.4 cm) for rate of hatchery origin specimens. release. The estimated stocking contribution rate was In this study, genetic diversity and genetic differences between 2.00% and 9.31% from 2005 to 2008. In this between hatchery and wild populations were evident study, four of the field samples (3.9%; 4/102) were re- from the molecular marker. For genetic diversity, He in vealed to be from a fish farm and most likely from a sin- the wild population (0.536) is higher than in hatchery gle batch. It is showing a low contribution rate populations (0.357–0.475) (Table 1), meaning hatchery compared to other research. The contribution rate does populations used for stock enhancement would reduce not always reflect production enhancement, but it is one the genetic diversity of wild populations. Some fish such of the most essential parameters for stock enhancement as red sea bream (P. major), brown trout (S. trutta), and assessment. Kitada and Kishino (2006) examined the ef- black sea bream (A. schlegelii) were observed to have a ficacy of marine stock enhancement for marine fish (red possible negative effect on wild stock (Blanco Gonzalez sea bream, Pagrus major and flounder, Paralichthys oli- et al. 2008; Hansen et al. 2009; Kitada et al. 2009). We vaceus) in Japan. Although the average contribution of observed high-level genetic differentiation (0.050–0.229) hatchery-reared fish was 9.5% for red sea bream and between hatchery and wild populations and also among 11.7% for flounder, the production change of wild popu- hatchery populations (Table 3). This means that stock lations does not appear to be linked to stock enhance- enhancement potentially changed the genetic structure ment activities. This means hatchery fish might replace of wild stocks. Hansen et al. (2009) analyzed historical wild fish instead of augmenting total production. and contemporary samples of brown trout (S. trutta)to The main drawback of the mark-and-recapture compare the genetic structure of wild populations before method is expensive, time-consuming, and unfeasible for and after stocking with hatchery trout. All populations all types of released species such as crustaceans and for were observed to be strongly affected by stocking. early life stages, such as embryo or larvae. Therefore, as- Despite the genetic effects of high-level genetic differ- sessment of stock enhancement with genetic markers entiation between hatchery and wild populations, high- was considered a possible solution for red sea bream level genetic differentiation allows cultured individuals (Pagrus major), spotted halibut (Verasper variegatus), to be discriminated from wild populations after stock Pacific herring (Clupea pallasii), Japanese flounder enhancement. Assessing the contribution rate of stock (Paralichthys olivaceus), Japanese bitterling (Tanakia enhancement is possible. Structure analysis suggests that tanago), Chinook salmon (Oncorhynchus tshawytscha), four clusters (red, yellow, green, and blue) belonged to channel catfish (Ictalurus punctatus), black sea bream hatchery populations (680 individuals; 99.27%) and that (Acanthopagrus schlegelii), red drum (Sciaenops ocella- one cluster (gray) belonged to a wild population (98 in- tus), and Chinese shrimp (Fenneropenaeus chinensis), for dividuals; 96.08%) (Fig. 1). It also suggests high-level example (Sekino et al. 2005; Ortega-Villaizan Romo genetic differentiation between hatchery and wild popu- et al. 2006; Simmons et al. 2006; Blanco Gonzalez et al. lations (Fig. 1). Because four clusters (red, yellow, green, 2008; Eldridge and Killebrew 2008; Hsu et al. 2008; and blue) belonged to hatchery populations, four indi- Kubota et al. 2008; Shikano et al. 2008; Kitada et al. viduals (4/102; 3.92%) from the wild population might 2009; Katalinas et al. 2018; Song et al. 2018). Most stud- have been hatchery-reared (Fig. 1). Furthermore, we ies have evaluated genetic diversity or genetic differences could suppose that these four individuals (three red and in hatchery and wild populations but have not assessed one blue) were from H1 and H2 (Fig. 1). Although offi- the contribution rate for stock enhancement. We used cial organizations implement stock enhancement, they Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 6 of 7 do not produce fish fry directly. The seeds for stock en- designed and directed the study and finalized the manuscript. All authors read and approved the final manuscript. hancement are provided by one or several private hatch- eries. Where the source and genetic information of fish Funding are unknown, our results indicate that genetic informa- This work was supported by Fisheries Agency, Council of Agriculture, tion for hatchery stocks was mixed, and a complicated Executive Yuan, ROC (Taiwan) under project number 107AS-11.2.1-FA-F1(3) to Chieh-Yu Pan, and was also supported by grants from the Center of Excel- stock source is suggested. H1 and H2 demonstrated a lence for the Oceans (National Taiwan Ocean University), which is financially similar composition but not H3 and H4. Structure clus- supported by The Featured Areas Research Center Program within the frame- ter ratios within each population (red-yellow-green-blue- work of the Higher Education Sprout Project by the Ministry of Education, ROC (Taiwan). gray) may facilitate the tracing of origins after stock en- hancement (Table 4 and Fig. 1). Official organizations’ Availability of data and materials drug residue analyses for hatchery fry to be released pro- All datasets analyzed during the current study are available from the vide an opportunity to study the genetic composition of corresponding author on reasonable request. the fry and trace the origins of fish lacking hatchery information. Ethics approval and consent to participate Not applicable. The mangrove red snapper is a prevalent species for stock enhancement (fifth among 21 species in Taiwan), Consent for publication with 6,534,000 individuals released (https://www.tfsda. Not applicable. org.tw/main.php). Without assessment of the contribu- tion of released populations, whether stock enhancement Competing interests The authors declare that they have no competing interests. provides benefits is uncertain. The negative effects of stock enhancement are evident in many cases. The main Author details effects include lower survival and growth rates, dimin- Department of Aquaculture, National Taiwan Ocean University, Keelung 20224, Taiwan. Center of Excellence for the Oceans, National Taiwan Ocean ished reproductive fitness, and decreased genetic diver- University, Keelung 20224, Taiwan. Department of Environmental Biology sity (Hansen et al. 2009). Few studies have provided and Fisheries Science, National Taiwan Ocean University, Keelung 20224, direct evidence that wild stock has increased due to Taiwan. Department and Graduate Institute of Aquaculture, National Kaohsiung University of Science and Technology, Kaohsiung 81157, Taiwan. hatchery stocking (Kitada 2018). Competition between wild and stocked fish may reduce wild populations and Received: 11 September 2019 Accepted: 5 March 2020 hinder their replacement (Kitada 2018). Lower genetic diversity and high-level genetic differentiation often indi- cate genetic management risks. These genetic consider- References An HS, Nam MM, Myeong JI, An CM. Genetic diversity and differentiation of the ations should be carefully weighed during the design of Korean starry flounder (Platichthys stellatus) between and within cultured stocking plans, particularly for fish originating from pri- stocks and wild populations inferred from microsatellite DNA analysis. vate hatcheries and lacking genetic information in Molecular Biology Reports. 2014;41:7281–92. Araki H, Schmid C. Is hatchery stocking a help or harm? Evidence, limitations and Taiwan. future directions in ecological and genetic surveys. Aquaculture. 2010;308: S2–11. Bell JD, Leber KM, Blankenship HL, Loneragan NR, Masuda R. A new era for Conclusions restocking, stock enhancement and sea ranching of coastal fisheries This study demonstrates that hatchery stocks were ad- resources. Rev Fish Sci. 2008;16:1–9. Blanco Gonzalez E, Nagasawa K, Umino T. Stock enhancement program for black mixture with the complicated genetic sources. Before sea bream (Acanthopagrus schlegelii) in Hiroshima Bay: monitoring the the release, the same batch of fry may originate from genetic effects. Aquaculture. 2008;276:36–43. various hatcheries. By contrast, the genetic composition Blanco Gonzalez E, Umino T. Fine-scale genetic structure derived from stocking black sea bream, Acanthopagrus schlegelii (Bleeker, 1854), in Hiroshima Bay. of the wild population is relatively simple, and the low Japan. Journal of Applied Ichthyology. 2009;25:407–10. contribution rate of hatchery stock (3.92%) indicates that Blankenship HL, Leber KM. A responsible approach to marine stock the genetic effect after stock enhancement is weak or enhancement. Am Fish Soc Symp. 1995;15:167–75. Boscari E, Congiu L. The need for genetic support in restocking activities and ex nonexistent. Wild mangrove red snappers are genetically situ conservation programmes: the case of the Adriatic sturgeon (Acipenser different from those originating from farms, and their naccarii Bonaparte, 1836) in the Ticino River Park. Journal of Applied origins can be traced through molecular markers, even Ichthyology. 2014;30:1416–22. Brownstein MJ, Carpten JD, Smith JR. Modulation of non-templated nucleotide without information on breeding stocks. addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques. 1996;20:1004–10. Acknowledgements Chang WC, Lee YC, Shih CH, Chu TJ, Chang PH. Population size and stocking Not applicable. contribution rates for marked and recaptured black porgy Acanthopagrus schlegelli, in Northwestern Taiwan, 2005–2008. Fish Res. 2011;109:252–6. Authors’ contributions Cressey D. Future fish. Nature. 2009;458:398–400. Te-Hua Hsu conducted the research, analyzed the materials, and prepared Dahle G, Jorstad KE, Rusaas HE, Ottera H. Genetic characteristics of broodstock the draft manuscript. Chang-Wen Huang, Cheng-Hui Lin, and Hung-Tai Lee collected from four Norwegian coastal cod (Gadus morhua) populations. ICES collect all the samples and help prepared the draft manuscript. Chieh-Yu Pan J Mar Sci. 2006;63:209–15. Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 7 of 7 Eldridge WH, Killebrew K. Genetic diversity over multiple generations of Song N, Li PF, Zhang XM, Gao TX. Changing phylogeographic pattern of supplementation: an example from Chinook salmon using microsatellite and Fenneropenaeus chinensis in the Yellow Sea and Bohai Sea inferred from demographic data. Conservat Genet. 2008;9:13–28. microsatellite DNA: implications for genetic management. Fish Res. 2018;200:11–6. Falush D, Stephens M, Pritchard JK. Inference of population structure using Stokstad E. Parasites from fish farms driving wild salmon to extinction. Science. multilocus genotype data: linked loci and correlated allele frequencies. 2007;318:1711. Genetics. 2003;164:1567–87. Zhang J, Cai Z, Huang H. Isolation and characterization of microsatellite loci from mangrove red snapper Lutjanus argentimaculatus. Mol Ecol Notes. 2006;6: Falush D, Stephens M, Pritchard JK. Inference of population structure using 408–11. multilocus genotype data: dominant markers and null alleles. Mol Ecol Notes. 2007;7:574–8. Hansen MM, Fraser DJ, Meier K, Mensberg KLD. Sixty years of anthropogenic Publisher’sNote pressure: a spatio-temporal genetic analysis of brown trout populations Springer Nature remains neutral with regard to jurisdictional claims in subject to stocking and population declines. Mol Ecol. 2009;18:2549–62. published maps and institutional affiliations. Hsu TH, Ning Y, Wang ZY, Lee YC, Chiou CC, Lin KH, Gwo JC. The utilization of molecular marker to identify wild and cultured black sea bream (Acanthopagrus schlegeli)–a preliminary study. J Ecol Eviron Sci. 2008;1:31–46 (In Chinese with English abstract). Iglesias J, Ojea G, Otero JJ, Fuentes L, Ellis T. Comparison of mortality of wild and released reared 0-group turbot, Scophthalmus maximus, on an exposed beach (Ría de Vigo, NW Spain) and a study of the population dynamics and ecology of the natural population. Fish Manag Ecol. 2003;10:51–9. Islam MS, Tanaka M. Impacts of pollution on coastal and marine ecosystems including coastal and marine fisheries and approach for management: a review and synthesis. Mar Pollut Bull. 2004;48:624–49. Jonsson N, Jonsson B, Hansen LP. The marine survival and growth of wild and hatchery-reared Atlantic salmon. J Appl Ecol. 2003;40:900–11. Katalinas CJ, Brenkert K, Darden T, Denson MR. A genetic assessment of a red drum, Sciaenops ocellatus, stock enhancement program. J World Aquaculture Soc. 2018;49:523–39. Kitada S. Economic, ecological and genetic impacts of marine stock enhancement and sea ranching: a systematic review. Fish Fish. 2018;19:511–32. Kitada S, Kishino H. Lessons learned from Japanese marine finfish stock enhancement programmes. Fish. Res. 2006;80:101–12. Kitada S, Shishidou H, Sugaya T, Kitakado T, Hamasaki K, Kishino H. Genetic effects of long-term stock enhancement programs. Aquaculture. 2009;290: 69–79. Kubota H, Watanabe K, Kakehi Y, Watanabe S. An assessment of genetic diversity in wild and captive populations of endangered Japanese bitterling Tanakia tanago (Cyprinidae) using amplified fragment length polymorphism (AFLP) markers. Fish Sci. 2008;74:494–502. Le Vay L, Carvalho GR, Quinitio ET, Lebata JH, Ut VN, Fushimi H. Quality of hatchery-reared juveniles for marine fisheries stock enhancement. Aquaculture. 2007;268:169–80. Liao IC. Status, problems and prospects of stock enhancement in Taiwan. Hydrobiologia. 1997;352:167–80. Liao IC, Su MS, Leano EM. Status of research in stock enhancement and sea ranching. Rev Fish Biol Fish. 2003;13:151–63. Ortega-Villaizan Romo M, Aritaki M, Taniguchi N. Pedigree analysis of recaptured fish in the stock enhancement program of spotted halibut Verasper variegatus. Fish Sci. 2006;72:48–52. Paulsen H, Støttrup JG. Growth rate and nutritional status of wild and released reared juvenile turbot in southern Kattegat. Denmark. J Fish Biol. 2004;65: 210–30. Pauly D, Watson R. Counting the last fish. Sci Am. 2003;289:42–7. Peakall R, Smouse PE. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and researchーan update. Bioinformatics. 2012;28: 2537–9. Ramasamy RK, Ramasamy S, Bindroo BB, Naik VG. STRUCTURE PLOT: a program for drawing elegant STRUCTURE bar plots in user friendly interface. SpringerPlus. 2014;3:431. Schiermeier Q. How many more fish in the sea? Nature. 2002;419:662–5. Sekino M, Saitoh K, Yamada T, Hara M, Yamashita Y. Genetic tagging of released Japanese flounder (Paralichthys olivaceus) based on polymorphic DNA markers. Aquaculture. 2005;244:49–61. Shikano T, Shimada Y, Suzuki H. Comparison of genetic diversity at microsatellite loci and quantitative traits in hatchery populations of Japanese flounder Paralichthys olivaceus. J Fish Biol. 2008;72:386–99. Simmons M, Mickett K, Kucuktas H, Li P, Dunham R, Liu Z. Comparison of domestic and wild channel catfish (Ictalurus punctatus) populations provides no evidence for genetic impact. Aquaculture. 2006;252:133–46. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Fisheries and Aquatic Sciences Springer Journals

Tracing the origin of fish without hatchery information: genetic management of stock enhancement for mangrove red snapper (Lutjanus argentimaculatus) in Taiwan

Loading next page...
 
/lp/springer-journals/tracing-the-origin-of-fish-without-hatchery-information-genetic-Hj8q4uEjXm
Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2020
eISSN
2234-1757
DOI
10.1186/s41240-020-00156-9
Publisher site
See Article on Publisher Site

Abstract

Stock enhancement is considered to be a valuable approach for restoring fishery resources. Because no specific official institution in Taiwan is responsible for the production of fry, the released fry are purchased directly from the private sector. However, fishermen from the private industry have not established a genetic background, so the genetic composition for each batch of released fry is unclear. Mangrove red snapper (Lutjanus argentimaculatus), a prominent species released in Taiwan, was collected after its official release. One hundred and two field samples were compared with four batches of hatchery fry (n = 685) by using a microsatellite-based multiplex PCR assay. Four of the field samples (3.9%; 4/102) were revealed to be from a fish farm and most likely from a single batch. This study revealed that wild mangrove red snappers are genetically different from those originating from farms, and their origins can be traced through molecular markers, even without information on breeding stocks. Keywords: Broodstock, Microsatellites, Genetic diversity, Aquaculture, Release Introduction proposed as a potential method to increase or recover The human population is increasing rapidly and the biomass of depleted fishery stocks (Bell et al. 2008). exhausting the Earth’s arable land. Demand for aquatic Stock enhancement has been practiced for over a cen- products is increasing (Cressey 2009). However, ad- tury, with more than 100 species released to date world- vances in fishing technology do not provide more wide (Liao 1997). catches but exhaust or exceed the production of renew- Although stock enhancement is considered to be an able fishery resources. Approximately half of all fish improved effort toward increasing fishery resources, few stocks have been deemed “fully exploited” or “over- cases have been well evaluated or have been substantially exploited” (Cressey 2009). In addition, human activities evidenced (Kitada 2018). Confirming that changes in fish have drastically reduced the abundance and distribution resources are affected by stock enhancement or other of marine fish and invertebrate populations through pol- natural factors is a challenge (Blankenship and Leber lution and habitat destruction (Schiermeier, 2002; Pauly 1995; Kitada 2018). However, an increasing number of and Watson 2003; Islam and Tanaka 2004). Because the studies have demonstrated that unconscious aquaculture world’s fisheries are now known to be in crisis, restock- practices and inappropriate artificial release affect the ing, and stock enhancement programs have been health of natural populations through destruction of habitats, invasion of species, pathogens, and interspecies or intraspecies hybridization. Examples include case * Correspondence: panjade@nkust.edu.tw 4 studies of the Adriatic sturgeon, Acipenser naccarii Department and Graduate Institute of Aquaculture, National Kaohsiung University of Science and Technology, Kaohsiung 81157, Taiwan (Boscari and Congiu 2014); Korean starry flounder, Full list of author information is available at the end of the article © The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 2 of 7 Platichthys stellatus (An et al. 2014); and black sea Materials and methods bream, Acanthopagrus schlegelli, in Japan (Blanco Gon- A total of 787 mangrove red snapper specimens, includ- zalez and Umino 2009). Disruption of genetic structure ing 685 hatchery individuals from four batches allocated is a severe problem resulting in reduced population fit- for release (populations H1, H2, H3, and H4) and 102 ness, ecological imbalance, and natural resource short- individuals from the wild (Kaohsiung and Pingtung; ages (Stokstad 2007; Araki and Schmid 2010). population W), were obtained during 2015 and 2016 Taiwan’s government has promoted a massive stock (Table 1). Sampling locations with the abbreviated popu- enhancement program in the coastal waters of Taiwan lation name and the sample size of each population ap- every year, claiming it could enhance the fishery re- pear in Table 1. Small pieces of muscle tissues (about 3- sources. Numerous artificial breeding fry were released, 5 mm) were prepared from fresh (use of 2% alcohol for and only a small proportion of fish have been labeled to anesthesia) or frozen samples, transported to the labora- evaluate their survival rate. In addition, conventional tory for molecular study, and preserved in 95% ethanol. markers (biological, physical, chemical) cannot estimate The standard proteinase K/phenol method was modified the reproduction rate of released fish. Because the gen- from an animal DNA extraction protocol. Moreover, etic diversity and genetic structures of natural wild pop- 0.8% agarose gel electrophoresis was performed to assess ulations must be understood in fishery resource DNA template quality. management, molecular markers are useful tools to as- sist conventional methods applied in stock enhancement Table 1 Summary statistics for genetic variation at four programs (Le Vay et al. 2007). microsatellite loci in five mangrove red snapper populations Japan and several countries in Europe and the USA, Population (n) LA02 LA04 LA05 LA06 Average SE for example, have official agencies for the management H1 (130) Na 11 2 2 2 4.250 2.250 of stock enhancement. They are able not only to verify the reliability of external markers but also to evaluate Ne 6.899 1.977 1.990 1.055 2.981 1.324 the genetic composition of offspring and they are repro- Ho 0.692 0.154 0.223 0.008 0.269 0.148 ductively through mark-recapture studies (Bell et al. He 0.855 0.494 0.498 0.052 0.475 0.164 2008). Taiwan began to promote the artificial release of F 0.190 0.689 0.552 0.853 0.571 0.141 IS seedlings in the 1980s. The government has allocated a H2 (200) Na 11 2 2 2 4.250 2.225 considerable amount of money every year but has over- Ne 7.940 1.771 2.000 1.094 3.201 1.591 looked genetic factors (Liao et al. 2003). This neglect of population genetics and biodiversity has meant that no Ho 0.790 0.300 0.235 0.060 0.346 0.156 well-designed stock enhancement programs were con- He 0.874 0.435 0.500 0.086 0.474 0.161 ducted. Official fishery organizations (the Taiwan Fisher- F 0.096 0.311 0.530 0.302 0.310 0.089 IS ies Sustainable Development Association; https://www. H3 (240) Na 7 3 2 2 3.500 1.190 tfsda.org.tw/main.php) in Taiwan produce no fish fry Ne 4.835 1.381 1.999 1.082 2.324 0.858 directly. The fish fry for stock enhancement are provided Ho 0.488 0.329 0.229 0.054 0.275 0.091 by one or several private hatcheries. The source and genetic information of fishes are unknown. Moreover, He 0.793 0.276 0.500 0.076 0.411 0.154 genetic information for hatchery stocks is also unclear F 0.385 -0.194 0.541 0.288 0.255 0.159 IS and unstable. Although no genetic information is avail- H4 (115) Na 6 3 2 3 3.500 0.866 able for stocks, official organizations perform drug resi- Ne 3.027 1.018 1.995 1.322 1.840 0.445 due analysis for hatchery fry. This provides an Ho 0.165 0.017 0.235 0.148 0.141 0.045 opportunity for studying genetic diversity of fish fry and He 0.670 0.017 0.499 0.244 0.357 0.143 tracing the origins of fish without hatchery information. As human activities affect wild populations signifi- F 0.753 -0.007 0.529 0.394 0.417 0.160 IS cantly, investigating the genetic structure of wild popula- W (102) Na 13 6 2 4 6.250 2.394 tions and assessing effectiveness before and after stock Ne 6.184 1.758 1.995 1.602 2.885 1.103 enhancement are of critical concern. Therefore, we Ho 0.373 0.206 0.225 0.255 0.265 0.037 attempted to use microsatellite markers to discriminate He 0.838 0.431 0.499 0.376 0.536 0.104 between cultured and wild mangrove red snapper (Lut- F 0.556 0.522 0.548 0.322 0.487 0.055 janus argentimaculatus) and to examine the possible IS sources of hatchery-reared fry. This technology was used All (787) Na 15 7 2 4 4.350 0.789 in the monitoring and evaluating of stock enhancement Ne 5.777 1.581 1.996 1.231 2.646 0.465 for the mangrove red snapper in Taiwan to evaluate the N number of samples, Na allele number, Ne allelic richness, Ho observed effectiveness of this process. heterozygosity, He expected heterozygosity, F fixation index IS Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 3 of 7 A total of seven microsatellite markers (LA01-LA07) 000 iterations. A graphical representation of the were tested (Zhang et al. 2006). Every 4 markers were STRUCTURE results was generated using Structure Plot selected into the same multiplex PCR reaction validated v2.0 (Ramasamy et al. 2014). using 10 wild individuals. Loci (LA01, LA03, and LA07) not always got amplicons by using Tm 56-60 °C, and Results Loci (LA02, LA04, LA05, and LA06) that amplified suc- Genetic diversity within populations and genetic cessfully and stable were combined into further multi- differentiation among populations plexes. The universal dye-labeled primers used were T3: Across the four microsatellites, all of the individuals PET-5′AATTAACCCTCACTAAAGGG 3′, M13 Re- were genotyped successfully. No monomorphic loci were verse: NED-5′GGATAACAATTTCACACAGG 3′ Hill: detected among hatchery and wild samples. In total, 28 6FAM-5′ TGACCGGCAGCAAAATTG 3′ and Neomy- alleles were detected in all individuals; the marker LA02 cin rev: VIC-5′ AGGTGAGATGACAGGAGATC 3′. exhibited the highest number of alleles in all individuals Each forward primer had one of the above universal pri- per locus (15 alleles) and the marker LA05 exhibited the mer sequences added to its 5′ end (Table 2). PIG-tails lowest number of alleles in all individuals per locus (2 al- were added to the 5′end of all the reverse primers. PIG- leles; Table 1). The marker LA02 in W exhibited the tailing leads to an addition of a non-templated adenosine highest number of alleles per locus (13 alleles), whereas nucleotide to the 3′ end on nearly 100% of PCR prod- the marker LA05 in H1, H2, H3, H4, and W exhibited ucts which reduces stutter caused by random addition of the lowest number of alleles (2 alleles) (Table 1). Allele dATP (Brownstein et al. 1996). Multiplex PCRs were richness ranged from 1.928 (marker MSTN2) to 4.656 performed in 5 μl reactions with 50 ng template DNA, 1 (marker Pma4) in all individuals per locus (Table 1). The × Multiplex PCR Master Mix (Qiagen), 0.2 μMof each lowest allele richness was 1.018 in H4 (LA04) and the reverse primer, 0.05 μM of each unlabeled forward pri- highest allele richness was 7.94 in H2 (marker LA02) mer (modified with the appropriate universal tail) and (Table 1). Mean estimates of expected heterozygosity for 0.2 μM of labeled universal primer for each forward pri- all loci among the five populations were between 0.052 mer labeled with matching universal tail. PCR thermal and 0.874 (Table 1). H2 had the highest expected het- cycling conditions were as follows: 1 × 95 °C (15 min); erozygosity for all the loci (average He = 0.536), whereas 30 × 94 °C (30 s), 56 − 60 °C (90 s), 72 °C (60 s); 8 × 94 °C H4 had the lowest expected heterozygosity (average He (30 s), 53 °C (90 s), 72 °C (60 s); 1 × 60 °C (30 min). The = 0.357; Table 1). The average F value among five pop- IS fragment analysis of PCR products was performed using ulations was between 0.255 and 0.571. The highest F IS an ABI 3130 Genetic Analyzer (Applied Biosystems, (0.853) was found in H1 at the LA06 marker, and the USA). The output was analyzed using the GeneMapper lowest F (− 0.194) was observed in H3 at marker LA04 IS software (versions 3.7 and 4.0, Applied Biosystems, USA). (Table 1). The number of different alleles (Na), the number of ef- Pairwise comparisons between samples were per- fective alleles (Ne), observed genetic diversity (Ho), ex- formed (Table 3). Most comparisons among populations pected genetic diversity (He), and the fixation index (F ) demonstrated high-level genetic differentiation (0.050– IS were calculated using GENALEX 6.51 (Peakall and 0.229) (Table 3). The lowest F value of 0.016 supports ST Smouse 2012). To elucidate the population genetic low-level genetic differentiation between H1 and H2. structure from multilocus genotypes, the admixture model with correlated allele frequencies was applied Structure analysis among populations using STRUCTURE v2.3.4 (Falush et al. 2003, 2007). Structure analysis revealed the best K value (K = 5), Three independent runs were performed for the total which supports five possible clusters among all samples. data set of K values ranging from 1 to 5. All runs were Most individuals from hatchery populations were based on 100,000 iterations of burn-in followed by 500, grouped into four clusters (red, yellow, green, and blue), Table 2 Microsatellite loci used for mangrove red snapper Locus Repeat motif Primer sequences Tm (°C) Size (bp) Accession no. LA02_M13 (AG)n F: GATAACAATTTCACACAGG-GTATCACGATGTCTCAGCCAGT 56-60 161-193 DQ219295 R: GTTTCTT-CAGTTCTAAGCGGTTTCTCAAG LA04_T3 (AC)n F: AATTAACCCTCACTAAAGGG-GAGGCTGTAGTGCTCTGCCC 56-60 255-317 DQ219297 R: GTTTCTT-GTTCACCTTCATGGCGACAG LA05_Hill (TGC)n F: TGACCGGCAGCAAAATTG-GAGATTTTGGAATGCTGTG 56-60 157-159 DQ247923 R: GTTTCTT-AGTAACCACTGTCTCTGCA LA06_Neo (TGC)n F: AGGTGAGATGACAGGAGATC-CCTGATCATAGTGACGCGC 56-60 159-169 DQ247924 R: GTTTCTT-AATCGGAATCGGTTCATCTC Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 4 of 7 Table 3 Pairwise F values based on four microsatellite data for mangrove red snapper populations ST and most individuals from the wild population were in official fishery organizations (the Taiwan Fisheries Sus- the gray cluster (Fig. 1). Only five (0.73%) of the hatch- tainable Development Association) in Taiwan performed ery individuals were grouped into the gray cluster but stock enhancement of 21 species (20 finfish and 1 crab) did not exhibit a high possibility of wild origins (0.53– with more than 133,593,000 individuals (https://www. 0.75; data not provided). Structure cluster ratios within tfsda.org.tw). Only a few evaluation cases exist, and the each population (red-yellow-green-blue-gray) were H1, effectiveness of stock enhancement is highly controver- 50-3.08-32.31-13.85-0.77; H2, 55.5-3.50-25-16-0; H3, 0- sial (Hsu et al. 2008). Therefore, the population genetic 55.42-27.08-17.5-0; H4, 6.09-8.7-77.39-3.48-4.35; and W, evaluation method used in this study is not only one of 2.94-0-0-0.98-96.08 (Table 4). Four of the samples from the few evaluation cases but also the first case for the wild population (3.9%; 4/102) were revealed to be from a mangrove red snapper in Taiwan. fish farm (Fig. 1). The mark-and-recapture method is considered to be the most reliable method of assessment. Turbot Discussion (Scophthalmus maximus and Psetta maxima), red sea Stock enhancement started in Taiwan with the building bream (Pagrus major), brown trout (Salmo trutta), and and casting of artificial reefs in 1973. However, until Atlantic salmon (Salmo salar) were used, with the mark- 1987, the integrated stock program was only applied for and-recapture method, to examine the contribution rate restocking broodstock and fry or seeds. Seven finfish of stock enhancement (Iglesias et al. 2003; Jonsson et al. species (5.8 million fry), four mollusks (5 million seeds), 2003; Paulsen and Støttrup 2004; Dahle et al. 2006; and six crustaceans (30 million larvae) were restocked Kitada et al. 2009). In Taiwan, taking black seabream up to 1996 (Liao et al. 2003). Between 2002 and 2018, (Acanthopagrus schlegelli) as an example, Chang et al. Fig. 1 Structure analysis among five mangrove red snapper populations. Estimated population structure based on the highest probability STRUCT URE run at K = 5. Each individual is represented by a thin vertical line partitioned into K colored segments that represent the individual’s estimated membership fractions in each of the K clusters. Cluster 1, red; Cluster 2, yellow; Cluster 3, green; Cluster 4, blue; and Cluster 5, gray. Hatchery samples: H1–H4; wild samples: W Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 5 of 7 Table 4 Structure cluster results (%) for each mangrove red snapper population Cluster results were as seen in Fig. 1 N number of samples Cluster 1, red; Cluster 2, yellow; Cluster 3, green; Cluster 4, blue; and Cluster 5, gray (2011) used a double mass-marking method by spraying the population genetic method not only for examining fluorescent pigment onto the skin and feeding with oxy- genetic diversity but also determining the contribution tetracycline. They marked 105,543 fry (4.6–8.4 cm) for rate of hatchery origin specimens. release. The estimated stocking contribution rate was In this study, genetic diversity and genetic differences between 2.00% and 9.31% from 2005 to 2008. In this between hatchery and wild populations were evident study, four of the field samples (3.9%; 4/102) were re- from the molecular marker. For genetic diversity, He in vealed to be from a fish farm and most likely from a sin- the wild population (0.536) is higher than in hatchery gle batch. It is showing a low contribution rate populations (0.357–0.475) (Table 1), meaning hatchery compared to other research. The contribution rate does populations used for stock enhancement would reduce not always reflect production enhancement, but it is one the genetic diversity of wild populations. Some fish such of the most essential parameters for stock enhancement as red sea bream (P. major), brown trout (S. trutta), and assessment. Kitada and Kishino (2006) examined the ef- black sea bream (A. schlegelii) were observed to have a ficacy of marine stock enhancement for marine fish (red possible negative effect on wild stock (Blanco Gonzalez sea bream, Pagrus major and flounder, Paralichthys oli- et al. 2008; Hansen et al. 2009; Kitada et al. 2009). We vaceus) in Japan. Although the average contribution of observed high-level genetic differentiation (0.050–0.229) hatchery-reared fish was 9.5% for red sea bream and between hatchery and wild populations and also among 11.7% for flounder, the production change of wild popu- hatchery populations (Table 3). This means that stock lations does not appear to be linked to stock enhance- enhancement potentially changed the genetic structure ment activities. This means hatchery fish might replace of wild stocks. Hansen et al. (2009) analyzed historical wild fish instead of augmenting total production. and contemporary samples of brown trout (S. trutta)to The main drawback of the mark-and-recapture compare the genetic structure of wild populations before method is expensive, time-consuming, and unfeasible for and after stocking with hatchery trout. All populations all types of released species such as crustaceans and for were observed to be strongly affected by stocking. early life stages, such as embryo or larvae. Therefore, as- Despite the genetic effects of high-level genetic differ- sessment of stock enhancement with genetic markers entiation between hatchery and wild populations, high- was considered a possible solution for red sea bream level genetic differentiation allows cultured individuals (Pagrus major), spotted halibut (Verasper variegatus), to be discriminated from wild populations after stock Pacific herring (Clupea pallasii), Japanese flounder enhancement. Assessing the contribution rate of stock (Paralichthys olivaceus), Japanese bitterling (Tanakia enhancement is possible. Structure analysis suggests that tanago), Chinook salmon (Oncorhynchus tshawytscha), four clusters (red, yellow, green, and blue) belonged to channel catfish (Ictalurus punctatus), black sea bream hatchery populations (680 individuals; 99.27%) and that (Acanthopagrus schlegelii), red drum (Sciaenops ocella- one cluster (gray) belonged to a wild population (98 in- tus), and Chinese shrimp (Fenneropenaeus chinensis), for dividuals; 96.08%) (Fig. 1). It also suggests high-level example (Sekino et al. 2005; Ortega-Villaizan Romo genetic differentiation between hatchery and wild popu- et al. 2006; Simmons et al. 2006; Blanco Gonzalez et al. lations (Fig. 1). Because four clusters (red, yellow, green, 2008; Eldridge and Killebrew 2008; Hsu et al. 2008; and blue) belonged to hatchery populations, four indi- Kubota et al. 2008; Shikano et al. 2008; Kitada et al. viduals (4/102; 3.92%) from the wild population might 2009; Katalinas et al. 2018; Song et al. 2018). Most stud- have been hatchery-reared (Fig. 1). Furthermore, we ies have evaluated genetic diversity or genetic differences could suppose that these four individuals (three red and in hatchery and wild populations but have not assessed one blue) were from H1 and H2 (Fig. 1). Although offi- the contribution rate for stock enhancement. We used cial organizations implement stock enhancement, they Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 6 of 7 do not produce fish fry directly. The seeds for stock en- designed and directed the study and finalized the manuscript. All authors read and approved the final manuscript. hancement are provided by one or several private hatch- eries. Where the source and genetic information of fish Funding are unknown, our results indicate that genetic informa- This work was supported by Fisheries Agency, Council of Agriculture, tion for hatchery stocks was mixed, and a complicated Executive Yuan, ROC (Taiwan) under project number 107AS-11.2.1-FA-F1(3) to Chieh-Yu Pan, and was also supported by grants from the Center of Excel- stock source is suggested. H1 and H2 demonstrated a lence for the Oceans (National Taiwan Ocean University), which is financially similar composition but not H3 and H4. Structure clus- supported by The Featured Areas Research Center Program within the frame- ter ratios within each population (red-yellow-green-blue- work of the Higher Education Sprout Project by the Ministry of Education, ROC (Taiwan). gray) may facilitate the tracing of origins after stock en- hancement (Table 4 and Fig. 1). Official organizations’ Availability of data and materials drug residue analyses for hatchery fry to be released pro- All datasets analyzed during the current study are available from the vide an opportunity to study the genetic composition of corresponding author on reasonable request. the fry and trace the origins of fish lacking hatchery information. Ethics approval and consent to participate Not applicable. The mangrove red snapper is a prevalent species for stock enhancement (fifth among 21 species in Taiwan), Consent for publication with 6,534,000 individuals released (https://www.tfsda. Not applicable. org.tw/main.php). Without assessment of the contribu- tion of released populations, whether stock enhancement Competing interests The authors declare that they have no competing interests. provides benefits is uncertain. The negative effects of stock enhancement are evident in many cases. The main Author details effects include lower survival and growth rates, dimin- Department of Aquaculture, National Taiwan Ocean University, Keelung 20224, Taiwan. Center of Excellence for the Oceans, National Taiwan Ocean ished reproductive fitness, and decreased genetic diver- University, Keelung 20224, Taiwan. Department of Environmental Biology sity (Hansen et al. 2009). Few studies have provided and Fisheries Science, National Taiwan Ocean University, Keelung 20224, direct evidence that wild stock has increased due to Taiwan. Department and Graduate Institute of Aquaculture, National Kaohsiung University of Science and Technology, Kaohsiung 81157, Taiwan. hatchery stocking (Kitada 2018). Competition between wild and stocked fish may reduce wild populations and Received: 11 September 2019 Accepted: 5 March 2020 hinder their replacement (Kitada 2018). Lower genetic diversity and high-level genetic differentiation often indi- cate genetic management risks. These genetic consider- References An HS, Nam MM, Myeong JI, An CM. Genetic diversity and differentiation of the ations should be carefully weighed during the design of Korean starry flounder (Platichthys stellatus) between and within cultured stocking plans, particularly for fish originating from pri- stocks and wild populations inferred from microsatellite DNA analysis. vate hatcheries and lacking genetic information in Molecular Biology Reports. 2014;41:7281–92. Araki H, Schmid C. Is hatchery stocking a help or harm? Evidence, limitations and Taiwan. future directions in ecological and genetic surveys. Aquaculture. 2010;308: S2–11. Bell JD, Leber KM, Blankenship HL, Loneragan NR, Masuda R. A new era for Conclusions restocking, stock enhancement and sea ranching of coastal fisheries This study demonstrates that hatchery stocks were ad- resources. Rev Fish Sci. 2008;16:1–9. Blanco Gonzalez E, Nagasawa K, Umino T. Stock enhancement program for black mixture with the complicated genetic sources. Before sea bream (Acanthopagrus schlegelii) in Hiroshima Bay: monitoring the the release, the same batch of fry may originate from genetic effects. Aquaculture. 2008;276:36–43. various hatcheries. By contrast, the genetic composition Blanco Gonzalez E, Umino T. Fine-scale genetic structure derived from stocking black sea bream, Acanthopagrus schlegelii (Bleeker, 1854), in Hiroshima Bay. of the wild population is relatively simple, and the low Japan. Journal of Applied Ichthyology. 2009;25:407–10. contribution rate of hatchery stock (3.92%) indicates that Blankenship HL, Leber KM. A responsible approach to marine stock the genetic effect after stock enhancement is weak or enhancement. Am Fish Soc Symp. 1995;15:167–75. Boscari E, Congiu L. The need for genetic support in restocking activities and ex nonexistent. Wild mangrove red snappers are genetically situ conservation programmes: the case of the Adriatic sturgeon (Acipenser different from those originating from farms, and their naccarii Bonaparte, 1836) in the Ticino River Park. Journal of Applied origins can be traced through molecular markers, even Ichthyology. 2014;30:1416–22. Brownstein MJ, Carpten JD, Smith JR. Modulation of non-templated nucleotide without information on breeding stocks. addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques. 1996;20:1004–10. Acknowledgements Chang WC, Lee YC, Shih CH, Chu TJ, Chang PH. Population size and stocking Not applicable. contribution rates for marked and recaptured black porgy Acanthopagrus schlegelli, in Northwestern Taiwan, 2005–2008. Fish Res. 2011;109:252–6. Authors’ contributions Cressey D. Future fish. Nature. 2009;458:398–400. Te-Hua Hsu conducted the research, analyzed the materials, and prepared Dahle G, Jorstad KE, Rusaas HE, Ottera H. Genetic characteristics of broodstock the draft manuscript. Chang-Wen Huang, Cheng-Hui Lin, and Hung-Tai Lee collected from four Norwegian coastal cod (Gadus morhua) populations. ICES collect all the samples and help prepared the draft manuscript. Chieh-Yu Pan J Mar Sci. 2006;63:209–15. Hsu et al. Fisheries and Aquatic Sciences (2020) 23:13 Page 7 of 7 Eldridge WH, Killebrew K. Genetic diversity over multiple generations of Song N, Li PF, Zhang XM, Gao TX. Changing phylogeographic pattern of supplementation: an example from Chinook salmon using microsatellite and Fenneropenaeus chinensis in the Yellow Sea and Bohai Sea inferred from demographic data. Conservat Genet. 2008;9:13–28. microsatellite DNA: implications for genetic management. Fish Res. 2018;200:11–6. Falush D, Stephens M, Pritchard JK. Inference of population structure using Stokstad E. Parasites from fish farms driving wild salmon to extinction. Science. multilocus genotype data: linked loci and correlated allele frequencies. 2007;318:1711. Genetics. 2003;164:1567–87. Zhang J, Cai Z, Huang H. Isolation and characterization of microsatellite loci from mangrove red snapper Lutjanus argentimaculatus. Mol Ecol Notes. 2006;6: Falush D, Stephens M, Pritchard JK. Inference of population structure using 408–11. multilocus genotype data: dominant markers and null alleles. Mol Ecol Notes. 2007;7:574–8. Hansen MM, Fraser DJ, Meier K, Mensberg KLD. Sixty years of anthropogenic Publisher’sNote pressure: a spatio-temporal genetic analysis of brown trout populations Springer Nature remains neutral with regard to jurisdictional claims in subject to stocking and population declines. Mol Ecol. 2009;18:2549–62. published maps and institutional affiliations. Hsu TH, Ning Y, Wang ZY, Lee YC, Chiou CC, Lin KH, Gwo JC. The utilization of molecular marker to identify wild and cultured black sea bream (Acanthopagrus schlegeli)–a preliminary study. J Ecol Eviron Sci. 2008;1:31–46 (In Chinese with English abstract). Iglesias J, Ojea G, Otero JJ, Fuentes L, Ellis T. Comparison of mortality of wild and released reared 0-group turbot, Scophthalmus maximus, on an exposed beach (Ría de Vigo, NW Spain) and a study of the population dynamics and ecology of the natural population. Fish Manag Ecol. 2003;10:51–9. Islam MS, Tanaka M. Impacts of pollution on coastal and marine ecosystems including coastal and marine fisheries and approach for management: a review and synthesis. Mar Pollut Bull. 2004;48:624–49. Jonsson N, Jonsson B, Hansen LP. The marine survival and growth of wild and hatchery-reared Atlantic salmon. J Appl Ecol. 2003;40:900–11. Katalinas CJ, Brenkert K, Darden T, Denson MR. A genetic assessment of a red drum, Sciaenops ocellatus, stock enhancement program. J World Aquaculture Soc. 2018;49:523–39. Kitada S. Economic, ecological and genetic impacts of marine stock enhancement and sea ranching: a systematic review. Fish Fish. 2018;19:511–32. Kitada S, Kishino H. Lessons learned from Japanese marine finfish stock enhancement programmes. Fish. Res. 2006;80:101–12. Kitada S, Shishidou H, Sugaya T, Kitakado T, Hamasaki K, Kishino H. Genetic effects of long-term stock enhancement programs. Aquaculture. 2009;290: 69–79. Kubota H, Watanabe K, Kakehi Y, Watanabe S. An assessment of genetic diversity in wild and captive populations of endangered Japanese bitterling Tanakia tanago (Cyprinidae) using amplified fragment length polymorphism (AFLP) markers. Fish Sci. 2008;74:494–502. Le Vay L, Carvalho GR, Quinitio ET, Lebata JH, Ut VN, Fushimi H. Quality of hatchery-reared juveniles for marine fisheries stock enhancement. Aquaculture. 2007;268:169–80. Liao IC. Status, problems and prospects of stock enhancement in Taiwan. Hydrobiologia. 1997;352:167–80. Liao IC, Su MS, Leano EM. Status of research in stock enhancement and sea ranching. Rev Fish Biol Fish. 2003;13:151–63. Ortega-Villaizan Romo M, Aritaki M, Taniguchi N. Pedigree analysis of recaptured fish in the stock enhancement program of spotted halibut Verasper variegatus. Fish Sci. 2006;72:48–52. Paulsen H, Støttrup JG. Growth rate and nutritional status of wild and released reared juvenile turbot in southern Kattegat. Denmark. J Fish Biol. 2004;65: 210–30. Pauly D, Watson R. Counting the last fish. Sci Am. 2003;289:42–7. Peakall R, Smouse PE. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and researchーan update. Bioinformatics. 2012;28: 2537–9. Ramasamy RK, Ramasamy S, Bindroo BB, Naik VG. STRUCTURE PLOT: a program for drawing elegant STRUCTURE bar plots in user friendly interface. SpringerPlus. 2014;3:431. Schiermeier Q. How many more fish in the sea? Nature. 2002;419:662–5. Sekino M, Saitoh K, Yamada T, Hara M, Yamashita Y. Genetic tagging of released Japanese flounder (Paralichthys olivaceus) based on polymorphic DNA markers. Aquaculture. 2005;244:49–61. Shikano T, Shimada Y, Suzuki H. Comparison of genetic diversity at microsatellite loci and quantitative traits in hatchery populations of Japanese flounder Paralichthys olivaceus. J Fish Biol. 2008;72:386–99. Simmons M, Mickett K, Kucuktas H, Li P, Dunham R, Liu Z. Comparison of domestic and wild channel catfish (Ictalurus punctatus) populations provides no evidence for genetic impact. Aquaculture. 2006;252:133–46.

Journal

Fisheries and Aquatic SciencesSpringer Journals

Published: May 1, 2020

There are no references for this article.