Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Role of the insulin-like growth factor system in gonad sexual maturation in Pacific oyster Crassostrea gigas

Role of the insulin-like growth factor system in gonad sexual maturation in Pacific oyster... Background: The IGF system plays important roles in controlling growth, development, reproduction, and aging of organisms. Methods: To estimate maturation of the Pacific oyster Crassostrea gigas, we investigated the expression of insulin- like growth factor (IGF) system components and sex-specific genes. To determine the role of the IGF system in the growth and spawning period of female and male oysters, we examined mRNA expression levels of the C. gigas insulin receptor-related receptor (CIR), IGF binding protein complex acid labile subunit (IGFBP_ALS), and molluscan insulin-related peptide (MIP), as well as those of vitellogenin (Vg) and receptor-type guanylate cyclase (Gyc76C) in gonads of C. gigas collected between April and October, when sex can be determined visually in this species. Results: We found that MIP, IGFBP_ALS, and CIR mRNA expression levels were dependent on sex and month and were greater in males than in females. CIR and Vg mRNA expression levels were very similar among females, whereas IGF system components and Gyc76C were very similarly expressed among males. The highest expression values were observed in May, when oysters are mature; CIR and Vg mRNA expression levels were highest in females, and those of MIP, IGFBP_ALS, CIR, and Gyc76C were highest in males. Interestingly, we observed a 1:1 proportion of females to males during this period. Conclusion: Our results suggest that IGF system components, as well as Vg and Gyc76C, are associated with sexual maturation in C. gigas. Background 2010; Marquez et al. 2011; Ventura et al. 2011; Chung The IGF system, which plays important roles in control- 2014; Huang et al. 2015). Insulin receptor homologs, ling vertebrate growth and development, comprises three which exhibit structural and functional similarities to components: ligands (IGF-I and -II), receptors (types I IGF receptors, have also been widely reported (Brogiolo and II), and IGF-binding proteins (IGFBPs) (Duan 1997). et al. 2001; Nässel et al. 2015). In mollusks, growth and The existence of traditional IGFs, IGF receptors, and associated metabolic processes are regulated under the IGFBPs has not been positively demonstrated in inverte- control of neural ganglia (Gricourt et al. 2003). Mollus- brates (Huang et al. 2015). However, several insulin-like can insulin-related peptides (MIPs) have been identified peptides (ILPs) have been discovered; these function in a in many gastropods and bivalves as functional sub- variety of biological processes including growth, metab- stances in neural ganglion neurosecretory cells (Roovers olism, molting, and reproduction (Nagasawa et al. 1986; et al. 1995; Gricourt et al. 2003). In particular, MIPs Krieger et al. 2004; Wu and Brown 2006; Grönke et al. have a beneficial effect on soft body and shell growth (Geraerts 1976, 1992; Gricourt et al. 2003). Geraerts et al. (1992) reported the various functions of MIPs ac- * Correspondence: unichoi@pknu.ac.kr 1 cording to stimulus-dependent differential patterns of Department of Fisheries Biology, Pukyong National University, Busan 48513, Republic of Korea MIP gene expression in the central nervous system. Re- Department of Marine Bio-Materials and Aquaculture, Pukyong National cently, studies have been performed to examine the bio- University, Busan 48513, Republic of Korea logical effects of various growth factors including © The Author(s). 2020 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 2 of 8 Crassostrea gigas insulin receptor-related receptor (CIR) Japan) and a digital balance (AJ Vibra, Shinko and IGFs in the mussel Mytilus galloprovincialis (Canesi Denshi, Japan). Male and female gonad pieces were et al. 1997, 1999, 2001), the Pacific oyster C. gigas (Gri- dissected, immediately frozen in liquid nitrogen, and court et al. 2003; Jouaux et al. 2012), and the Yesso scal- stored at – 75 °C until use. lop Patinopecten yessoensis (Feng et al. 2014). These factors affect growth, maturation, and reproduction in a Protein identification manner dependent on seasonal environmental condi- We investigated protein expression in gonads using 8% tions. Jouaux et al. (2012) reported a balance between sodium dodecyl sulfate–polyacrylamide gel electrophor- growth and management of environmental stresses dur- esis (SDS–PAGE). Specific proteins were confirmed ing reproduction and emphasized the involvement of in- using tandem mass spectrometry (MS/MS) and electro- sulin signaling in gametogenesis and reproduction in C. spray ionization quadrupole time-of-flight MS/MS (ESI- gigas. Many studies have reported intraspecific variation Q-TOF MS/MS, ABI, USA) as previously described in growth and reproduction in a variety of invertebrates; (Choi et al. 2015). Proteins were identified via the Na- among these, C. gigas has been used as a bivalve assess- tional Center for Biotechnology Information (NCBI; ment model (Macdonald & Thompson 1988; Bayne https://www.ncbi.nlm.nih.gov) and UniProt Knowledge- 1999; Choi et al. 2018). base (http://www.uniprot.org/uniprot) databases using C. gigas is an important aquaculture product that is the MASCOT program (Matrixscience, London, UK). mainly produced off the southern coast of Korea. However, the aquaculture production of oysters in cDNA synthesis and reverse-transcription polymerase Korea declined from 321,276 tons in 2007 to 303,183 chain reaction (RT-PCR) tons in 2018 (MOF 2020). There was a similar ten- Male and female gonads were pulverized by adding 1 mL dency in the worldwide aquaculture production (FAO Trans-Zol UP (TransGen Biotech, Beijing, China), and 2020). Oyster value is dependent on condition; how- total RNA was extracted using Trans-Zol UP according ever, fishing environments are becoming increasingly to the manufacturer’s instructions. cDNA was synthe- polluted due to high-density rearing, contaminated sized from 2 μg total RNA using the PrimeScript first- runoff from the coast, and climate change. As a result strand cDNA synthesis kit (TaKaRa Bio, Otsu, Japan) ac- of physical activity by the parent oyster in such farm- cording to the manufacturer’s instructions. RT-PCR was ing environments, oyster larval health is reduced, performed using Emerald Amp GT PCR Master Mix resulting in mass destruction and repeated seedling (TaKaRa Bio, Otsu, Japan). Each primer set was designed shortages. Oysters produced in coastal areas that have according to sequences of CIR (accession no. AJ become clearer and cleaner through nitrogen and 535669.1), IGFBP_ALS (XM_011417921.2), MIP (NM_ phosphorus regulation fail to gain weight due to a 001308866.1), Gyc76C (XM_011452292.2), Vg lack of food suitable for shellfish. These phenomena (AB084783.1), and EF1α (AB122066.1) (Table 1). PCR have unfavorable effects on oyster growth and amplification was performed using C. gigas template maturity. cDNA with the following parameters: 1 cycle at 95 °C for In this study, to estimate maturation of C. gigas oys- 5 min, 25 cycles at 95 °C for 30 s, 50 °C for 30 s, and ters, we investigated the expression of various IGF sys- 72 °C for 30 s, followed by 1 cycle at 72 °C for 5 min. tem components. To determine the role of the IGF PCR products were analyzed by gel electrophoresis on system in the growth and spawning of male and female 1% agarose gels. Densitometry was conducted using the oysters, we determined CIR, IGFBP_ALS, and MIP GeneTools v. 4.03 software (Syngene, Cambridge, UK). mRNA expression levels and those of sex-specific genes such as vitellogenin in C. gigas gonads. Statistical analyses Data are presented as means ± standard deviations. Sig- nificant differences among means were tested using one- Methods way analysis of variance (ANOVA) in the SPSS v. 10.0 Sample preparation software environment (SPSS, Inc., Chicago, IL). We collected 30–40 C. gigas individuals every month from April to October in 2017 (when gonads Results can be discriminated visually) at an oyster farm in Growth parameters Tongyeong, Gyeongsangnam-do, Korea (34° 51′ We collected 40 C. gigas individuals monthly from 32.34″ N, 128° 12′ 23.44″ E). We measured shell April to October 2017, except in June. The ratio of length (SL), shell height (SH), shell width (SW), females to males differed each month, being about 1:1 total wet weight (TW), and soft tissue weight in May and September and 2:1 in June and July (Fig. (STW) using a Vernier caliper (Mitutoyo, Kawasaki, 1). Onehermaphrodite wasfound in Mayand onein Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 3 of 8 Table 1 Nucleotide sequences of primers used in reverse-transcription polymerase chain reaction (RT-PCR) analysis of adductor muscles of the Pacific oyster Crassostrea gigas Gene Accession no. Sequence (5′–3′) Amplicon (bp) CIR AJ535669 (F)-TGAGGAGGGTGATGAGGATA 375 (R)-ATTGCACTGTAGGGATTGGA IGFBP-ALS XP_011442465.1 (F)-CTTGCCCTGAAAACCCTACA 500 (R)-GGGCAAGTAGCAGAATTTGG MIP XM_011417420.2 (F)-TAAATACAAGCGGTCGGGTG 214 (R)-AGATCCTTTCTTCTTGCGGC Gyc76C XM_011452292.2 (F)-ATGAATGCAGTGAATCGCTTGA 274 (R)-TGATACTGTGCAGCTCTTGG Vg AB084783.1 (F)-ATGCTGGAGATGAACCTTGAG 273 (R)-TGCTTCGTGGTGGATATCCT EF1α AB122066.1 (F)–CCACTGGCCATCTCATTTAC 393 (R)–TGTTGACACCAATGATGAGC bp, base pairs; F, forward; R, reverse; CIR, C. gigas insulin receptor-related receptor; IGFBP-ALS, insulin-like growth factor binding protein complex acid labile subunit; MIP, molluscan insulin-related peptide; Gyc76C, receptor-type guanylate cyclase; Vg, vitellogenin June; the proportion of males was higher than that of 0.08 to 0.34 (mean, 0.16 ± 0.04) in females and males, re- females in August (Fig. 1). spectively (Fig. 2b, d). Thus, growth rates of STW/TW, The ratios of STW to TW ranged from 0.07 to 0.29 SH/SL, and SW/SL were positive in both females and (mean, 0.15 ± 0.04) and 0.08 to 0.34 (mean, 0.16 ± 0.04) males in this study (Fig. 2). in females and males, respectively (Fig. 2a, c). The ratio of SH to SL ranged from 1.35 to 3.58 (mean, 2.07 ± 0.37) Protein identification and from 1.02 to 3.36 (mean, 2.07 ± 0.36) in females and Protein expression differed between males and fe- males, respectively (Fig. 2b, d). The ratio of SW to SL males in this study. Proteins were identified as ranged from 0.07 to 0.29 (mean, 0.15 ± 0.04) and from vitellogenin-6 C-term fragments of 180 kDa and N- Fig. 1 The ratio of females to males in the Pacific oyster Crassostrea gigas from April to October. NO, not observed Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 4 of 8 Fig. 2 C. gigas growth during the collection period (April–October 2017). a Growth of soft tissue and total weight in female oysters. b Growth of shell height and length in female oysters. c Growth of soft tissue and total weight in male oysters. d Growth of shell height and length in male oysters term fragments of 110 kDa (accession no. mRNA expression in September; however, the difference tr|K1QNA2|K1QNA2_CRAGI, https://www.uniprot. between this and other months was not significant (p > org/uniprot/K1QNA2) in females and guanlylate cy- 0.05; Fig. 5a). clase (Gyc76C) protein of 96 kDa (accession no. tr|K1QS46|K1QS46_CRAGI, https://www.uniprot.org/ Discussion uniprot/K1QS46) mixed with 143 kDa of uncharacter- It is necessary that salinity, food resources, and water ized protein in males (Fig. 3). flow for oyster growth (Williamson et al. 2015). The growth difference depends on the oyster farm regions MIP, IGFBP_ALS, CIR, Vg, and Gyc76C expression analysis affected by environmental factors such as water Among components of the IGF system (MIP, IGFBP_ temperature, salinity, dissolved oxygen, nutrients, ALS, and CIR), mRNA expression was greater in males water flow and so on (Min et al. 2004). In the present than in females (Fig. 4a, b). CIR mRNA expression was study, the growth difference was not found between significantly higher in both females and males in May females and males within the same farm. In addition, and June and was 1.75–2.02 times higher in males than it was showed positive relationship among STW/TW, in females (p < 0.05; Fig. 4a, b). MIP and IGFBP_ALS SH/SL, and SW/SL. mRNA expression levels were negligible in females ex- The IGF system plays numerous roles in oyster growth cept in September, whereas those of males were signifi- and development; its components have been detected as cantly higher in May and June, the maturation season (p 150-kDa ternary complexes comprising one molecule < 0.05; Fig. 4a, b). MIP, IGFBP_ALS, and CIR mRNA ex- each of IGF, IGFBP-3/IGFBP-5, and an 85 kDa acid la- pression were relatively constant throughout the collec- bile subunit (ALS) in circulation (Baxter 1994; Brogiolo tion period (Fig. 4b) but decreased in spawning season et al. 2001). ALS is a glycosylated protein that binds to and then increased slowly after August in both females IGFBP-3:IGF and IGFBP-5:IGF binary complexes but and males (Fig. 4a, b). does not bind to IGFBP except in complex with IGF Vg and receptor Gyc76C expression levels were exam- (Brogiolo et al. 2001). The main function of ALS is to in- ined based on their identification among male and fe- crease the half-life of IGFs in circulation (Forbes et al. male gonad proteins. Expression levels were high in May 2012). The IGF insulin receptor (IGF-1R) and insulin and then decreased until August, as observed in IGF sys- receptor-related receptor (IRR) form subclass II of the tem component expression (Fig. 5a, b). Vg showed high receptor tyrosine kinase superfamily, sharing covalently Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 5 of 8 to diet restriction, lifespan, and fecundity in these spe- cies. Some research has also been conducted on the in- volvement of IRPs (molluscan IRP, MIPs) in controlling growth, reproduction, and nutritional status in C. gigas (Gricourt et al. 2003; Jouaux et al. 2012). In the present study, expression levels of IGF-related genes (MIP, CIR, and IGFBP-ALS) and sex-specific genes (Vg and Gyc76C) were significantly higher in May, when oysters have matured and are about to undergo spawn- ing. The observed changes in gene expression levels may therefore be used as indicators of annual growth, matur- ity, and spawning period in cultured C. gigas. The appli- cation of IGF system (MIP, IGFBP-ALS, and CIR) expression as a growth indicator is an attractive alterna- tive to physiological methods, which are prone to pro- cessing errors (Tran et al. 2007). IGF system component mRNA expression is associ- ated with changes in Vg and Gyc76C expression. Vg is a major precursor of vitellins, which are egg yolk proteins that provide energy reserves for embryonic development in oviparous organisms (Matozzo et al. 2008). To date, six Vg genes (1 to 6) have been iden- tified in the nematode Caenorhabditis elegans (Boag et al. 2001), and a female-specific Vg-6 has been identified in Haemonchus contortus (Hartman et al. 2001), Trichostrongylus vitrines (Nisbet and Gasser 2004), and Toxocara canis (Zhu et al. 2017). These Vg genes play roles in reproduction and may be in- volved in adult biological processes (Zhu et al. 2017). In the present study, we identified Vg-6 C-term and N-term fragments in female gonads. Vg mRNA ex- pression was highest during the maturation stage and decreased thereafter. Our results are consistent with those reported for the scallop Chlamys farreri (Qin Fig. 3. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis et al. 2012) and the Fujian oyster Crassostrea angu- (SDS-PAGE) analysis of C. gigas gonads. M, protein marker; “♀,”female oyster; “♂,”male oyster. Arrows on the female column lata (Ni et al. 2014). Ni et al. (2014) described the indicate vitellogenin-6 fragments. Arrow on the male column stages of oyster ovarian development in detail as fol- indicates guanylate cyclase and mixed uncharacterized proteins lows: (1) maturation stage, when ovaries accumulate nutrients for oogenesis, and mRNA is abundant due linked homodimers and several structural domains (Ren- to activeVggeneexpression to promoteVgprotein tería et al. 2008). Invertebrates have only a single IRR, synthesis, yolk intake, and nutrient accumulation in which regulates growth and metabolism (Leevers 2001); oocytes; (2) ripeness stage, when oocytes grow and there is no clear evidence of the existence of traditional accumulate yolk, decreasing the demand for yolk pro- IGFs, IGF receptors, or IGFBP1-6 in invertebrates tein and Vg gene expression; and (3) partially spent (Huang et al. 2015). However, several insulin-related stage, when ovaries stop developing and before new peptides (IRPs) have been identified based on biochem- oogonium inception so that Vg expression levels are ical purification or cDNA identification (Cherf-Feildel very low (Boutet et al. 2008; Zheng et al. 2012). Davis et al. 2019). Various biological functions and members et al. (2008) reported that endogenous in females and of the insulin family observed in vertebrates are gener- exogenous Vg in 17β-estradiol (E )-treated males ally conserved in invertebrates. This functional conserva- downregulate GH/IGF-1 axis support of vitellogenesis tion has been clearly demonstrated in Drosophila in the liver. E induces the shift of energy away from melanogaster and Caenorhabditis elegans (Cherf-Feildel somatic growth by suppressing the haptic GH/IGF et al. 2019). IRPs play key roles in controlling growth, axis and toward vitellogenesis by estrogen receptor α- development, energy storage, stress resistance, response mediated upregulation of multiple Vg genes, which is Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 6 of 8 Fig. 4 Molluscan insulin-related peptide (MIP), insulin-like growth factor binding protein complex acid labile subunit (IGFBP-ALS), and C. gigas insulin receptor-related receptor (CIR) mRNA expression in C. gigas a females and b males a potential endocrine mechanism contributing to sex- (Hadley 1988;Deeming 1991). Further studies focusing on ual dimorphism (Davis et al. 2008). the association between the function of cleaved Vg genes Guanylate cyclase (Gyc) is a family of soluble receptor-type and the GH/IGF axis in ovaries and on Gyc and the IGF sys- enzymes that catalyze the conversion of GTP to cGMP in tem in each developmental stage are necessary. both vertebrates and invertebrates (Patel et al. 2012). The ex- pression of Gyc mRNA is involved in oogenesis, egg cham- Conclusion ber development (Gigliotti et al. 1993; Ayoob et al. 2004), The expression of IGF system components including MIP, retinal development (Patel et al. 2012), wing development IGFBP-ALS, and CIR was associated with sex and develop- (Schleede and Blair 2015), and lumen formation (Myat and mental stage in Pacific oyster gonads. CIR and Vg expression Patel 2016)in Drosophyla and in embryonic and adult retinal levels were very similar among females, whereas those of development in Oryzias latipes (Harumi et al. 2003). In the MIP, IGFBP_ALS, CIR, and Gyc7C were very similar among present study, Gyc76C mRNA expression was high in males males. The highest expression levels occurred in May, which during the maturation season, and its trends were similar to is the maturation season. CIR and Vg are female-specific those of the IGF system. Therefore, we cautiously suggest genes in Pacific oysters, whereas MIP, IGFBP-ALS, CIR, and that Gyc76C plays a sex-specific role in male oysters. IGF-1 Gyc76C are male specific. The results of the present study inhibits adenylate cyclase and stimulates Gyc activity, thereby suggest that IGF system components, as well as Vg and lowering cyclic AMP concentrations and elevating cycle Gyc76C, are associated with sexual maturation in C. gigas. GMP levels in a manner similar to the action of insulin Fig. 5 Vitellogenin (Vg) and receptor-type guanylate cyclase (Gyc76C) mRNA expression in C. gigas a females and b males Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 7 of 8 Acknowledgements Chung JS. An insulin-like growth factor found in hepatopancreas implicates Not applicable. carbohydrate metabolism of the blue crab Callinectes sapidus. Gen Comp Endocrinol. 2014;199:56–64. Davis LK, Pierce AL, Hiramatsu N, Sullivan CV, Hirano T, Grau EG. Gender-specific Authors’ contributions expression of multiple estrogen receptors, growth hormone receptors, YHC contributed to the conceptualization, investigation, writing, supervision, insulin-like growth factors and vitellogenins, and effects of 17b-estradiol in project administration, and funding acquisition. JSM contributed to the the male tilapia (Oreochromis mossambicus). Gen Comp Endocrinol. 2008;156: investigation and data analysis. Both authors read and approved the final 544–51. manuscript. Deeming DC. Egg incubation: its effects on embryonic development in birds and reptiles. UK: Cambridge University Press; 1991. p. 448. Funding Duan C. The insulin-like growth factor system and its biological actions in fish. This research was supported by the Basic Science Research Program through Am Zool. 1997;37:491–503. the National Research Foundation of Korea (NRF) funded by the Ministry of Feng L, Li X, Yu Q, Ning X, Dou J, Zou J, Zhang L, Wang S, Hu X, Bao Z. A scallop Education (NRF-2016R1D1A1B03934914). IGF binding protein gene: molecular characterization and association of variants with growth traits. PLoS One. 2014;9:e89039. Availability of data and materials Food and Agriculture Organization. http://www.fao.org (2020). Accessed 29 Data sharing is not applicable to this article as no datasets were generated January 2020. or analyzed during the current study. Forbes BE, McCarthy P, Norton RS. Insulin-like growth factor binding proteins: a structural perspective. Front Endocrinol. 2012;3:1–13. Ethics approval and consent to participate Geraerts WP. Control of growth by the neurosecretory hormone of the light Not applicable. green cells in the freshwater snail Lymnaea stagnalis. Gen Comp Endocrinol. 1976;29:61–71. Consent for publication Geraerts WP. Neurohormonal control of growth and carbohydrate metabolism by Not applicable. the light green cells in Lymnaea stagnalis. Gen Comp Endocrinol. 1992;86: 433–44. Geraerts WP, Smit AB, Li KW, Hordijk PL. The light green cells of Lymnaea:a Competing interests neuroendocrine model system for stimulus-induced expression of multiple The authors declare that they have no competing interest. peptide genes in a single cell type. Experientia. 1992;48:464–73. Gigliotti S, Cavaliere V, Manzi A, Tino A, Graziani F, Malva C. A membrane Received: 6 January 2020 Accepted: 13 February 2020 guanylate cyclase Drosophila homolog gene exhibits maternal and zygotic expression. Dev Biol. 1993;159:450–61. Gricourt L, Bonnec G, Boujard D, Mathieu M, Kellner K. Insulin-like system and References growth regulation in the Pacific oyster Crassostrea gigas: hrIGF-1 effect on Ayoob JC, Yu HH, Terman JR, Kolodkin AL. The Drosophila receptor guanylyl protein synthesis of mantle edge cells and expression of an homologous cyclase Gyc76C is required for semaphoring-1a-plexin A-mediated axonal insulin receptor-related receptor. Gen Comp Endocrinol. 2003;134:44–56. repulsion. J Neurosci. 2004;24:6639–49. Grönke S, Clarke DF, Broughton S, Andrews TD, Partridge L. Molecular evolution Baxter RC. Insulin-like growth factor binding proteins in the human circulation: a and functional characterization of Drosophila insulin-like peptides. PLoS review. Horm Res. 1994;42:140–4. Genet. 2010;6:e1000857. Bayne BL. Physiological components of growth differences between individual Hadley ME. Endocrinology: 2nd ed. Prentice-Hall, Englewood Cliffs, NJ, 1988. 550 oysters (Crassostrea gigas) and a comparison with Saccostrea commercialis. pp. In General and Comparative Endocrinology 1988;72:329–329. Physiol Biochem Zool. 1999;72:705–13. Hartman D, Donald DR, Nikolaou S, Savin KW, Hasse D, J.A Presidente P, Newton Boag PR, Newton SE, Gasser RB. Molecular aspects of sexual development SE. Analysis of developmentally regulated genes of the parasite Haemonchus and reproduction in nematodes and schistosomes. Advan Parasitol. 2001; contortus. Int J Parasitol. 2001;31:1236–45. 50:153–98. Harumi T, Watanabe T, Yamamoto T, Tanabe Y, Suzuki N. Expression of Boutet I, Moraga D, Marinovic L, Obreque J, Chavez-Crooker P. Characterization of membrane-bound and soluble guanylyl cyclase mRNAs in embryonic and reproduction-specific genes in a marine bivalve mollusc: influence of adult retina of the medaka fish Oryzias latipes. Zool Sci. 2003;20:133–40. maturation stage and sex on mRNA expression. Gene. 2008;407:130–8. Huang X, Ye H, Feng B, Huang H. Insights into insulin-like peptide system in Brogiolo W, Stocker H, Ikeya T, Rintelen F, Fernandez R, Hafen E. An evolutionarily invertebrates from studies on IGF binding domain-containing proteins in the conserved function of the Drosophila insulin receptor and insulin-like female mud crab, Scylla paramamosain. Mol Cell Endocrinol. 2015;416:36–45. peptides in growth control. Curr Biol. 2001;11:213–21. Jouaux A, Franco A, Heude-Berthelin C, Sourdaine P, Blin JL, Mathieu M, Kellner K. Canesi L, Betti M, Ciacci C, Gallo G. Insulin-like effect of zinc in Mytilus digestive Identification of Ras, Pten and p70S6K homologs in the Pacific oyster gland cells: modulation of tyrosine kinase-mediated cell signaling. Gen Comp Crassostrea gigas and diet control of insulin pathway. Gen Comp Endocrinol. Endocrinol. 2001;122:60–6. 2012;176:28–38. Canesi L, Ciacci C, Betti M, Malatesta M, Gazzanelli G, Gallo G. Growth factors Krieger MJB, Jahan N, Riehle MA, Cao C, Brown MR. Molecular characterization of stimulate the activity of key glycolytic enzymes in isolated digestive gland insulin-like peptide genes and their expression in the African malaria cells from mussels (Mytilus galloprovincialis Lam.) through tyrosine kinase mosquito, Anopheles gambiae. Insect Mol Biol. 2004;13:305–15. mediated signal transduction. Gen Comp Endocrinol. 1999;116:241–8. Leevers SJ. Growth control: invertebrate insulin surprises. Curr Biol. 2001;11:R209–12. Canesi L, Ciacci C, Orunesu M, Gallo G. Effects of epidermal growth factor on Macdonald BA, Thompson RJ. Intraspecific variation in growth and reproduction isolated digestive gland cells from mussels (Mytilus galloprovincialis Lam.). in latitudinally differentiated populations of the giant scallop Placopecten Gen Comp Endocrinol. 1997;107:221–8. magellanicus (Gmelin). Biol Bull. 1988;175:361–71. Cherif-Feildel M, Berthelin H, Adeline B, Rivière G, Favrel P, Kellner K. Molecular Marquez AG, Pietri JE, Smithers HM, Nuss A, Antonova Y, Drexler AL, Riehle MA, evolution and functional characterization of insulin related peptides in Brown MR, Luckhart S. Insulin-like peptides in the mosquito Anopheles molluscs: contributions of Crassostrea gigas genomic and transcriptomic- stephensi: identification and expression in response to diet and infection with wide screening. Gen Comp Endocrinol. 2019;271:15–29. Plasmodium falciparum. Gen Comp Endocrinol. 2011;173:303–12. Choi YH, Kim EY, Nam TJ. Involvement of insulin-like growth factor in intraspecific Matozzo V, Gagné F, Marin MG, Ricciardi F, Christian BC. Vitellogenin as a variation in growth of Pacific oyster Crassostrea gigas during winter. Fish Sci. biomarker of exposure to estrogenic compounds in aquatic invertebrates: a 2018;84:1017–24. review. Environ Int. 2008;34:531–45. Choi YH, Yamaguchi K, Oda T, Nam TJ. Chemical and mass spectrometry characterization of the red alga Pyropia yezoensis chemoprotective protein Min KS, Kim BS, Kim TI, Hur YB, Chung EY. Reproductive cycle and induced sexual (PYP): protective activity of the N-terminal fragment of PYP1 against maturation of the Pacific oyster. Crassostrea gigas. 2004;20:75–84. acetaminophen-induced cell death in Chang liver cells. Int J Mol Med. 2015; Ministry of Oceans and Fisheries. http://www.mof.go.kr (2020). Accessed 29 35:271–6. January 2020. Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 8 of 8 Myat MM, Patel U. Receptor-type guanylyl cyclase at 76C (Gyc76C) regulates De Novo lumen formation during Drosophila tracheal development. PLoS ONE. 2016;11:e0161865. Nagasawa H, Kataoka H, Isogai A, Tamura S, Suzuki A, Mizoguchi A, Fujiwara Y, Suzuki A, Takahashi SY, Ishizaki H. Amino acid sequence of a prothoracicotropic hormone of the silkworm Bombyx mori. PNAS USA. 1986; 83:5840–3. Nässel DR, Liu Y, Luo J. Insulin/IGF signaling and its regulation in Drosophila. Gen Comp Endocrinol. 2015;221:255–66. Ni J, Zeng Z, Kong D, Hou L, Huang H, Ke C. Vitellogenin of Fujian oyster, Crassostrea angulata: synthesized in the ovary and controlled by estradiol- 17β. Gen Comp Endocrinol. 2014;202:35–43. Nisbet AJ, Gasser RB. Profiling of gender-specific gene expression for Trichostrongylus vitrinus (Nematoda: Strongylida) by microarray analysis of expressed sequence tag libraries constructed by suppressive-subtractive hybridisation. Int J Parasitol. 2004;34:633–43. Patel U, Davies SA, Myat MM. Receptor-type guanylyl cyclase Gyc76C is required for development of the Drosophila embryonic somatic muscle. Biol Open. 2012;1:507–15. Qin Z, Li Y, Sun D, Shao M, Zhang Z. Cloning and expression analysis of the vitellogenin gene in the scallop Chlamys farreri and the effects of estradiol- 17b on its synthesis. Inverte Biol. 2012;131:312–21. Rentería ME, Gandhi NS, Vinuesa P, Helmerhorst E, Mancera RL. A comparative structural bioinformatics analysis of the insulin receptor family ectodomain based on phylogenetic information. 2008;3:e3667. Roovers E, Vincent ME, van Kesteren E, Geraerts WP, Planta RJ, Vreugdenhil E, van Heerikhuizen H. Characterization of a putative molluscan insulin-related peptide receptor. Gene. 1995;11:81–8. Schleede J, Blair SS. The Gyc76C receptor guanylyl cyclase and the foraging cGMP-dependent kinase regulate extracellular matrix organization and BMP signaling in the developing wing of Drosophila melanogaster. PLOS Gene. 2015;11:e1005576. Tran TQ, Boring RL, Dudenhoeffer DD, Hallbert BP, Keller MD, Anderson TM. Advantages and disadvantages of physiological assessment for next generation control room design. Hfpp HPRCT 13th Annual Meeting 2007; IEEE 8th. Ventura T, Rosen O, Sagi O. From the discovery of the crustacean androgenic gland to the insulin-like hormone in six decades. Gen Comp Endocrinol. 2011;173:381–8. Williamson TR, Tilley DR, Campbell E. Emergy analysis to evaluate the sustainability of two oyster aquaculture systems in the Chesapeake Bay. Ecol Eng. 2015;85:103–20. Wu A, Brown MR. Signaling and function of insulin-like peptides in insects. Annual Review Entomol. 2006;51:1–24. Zheng H, Zhang Q, Liu H, Liu W, Sun Z, Li S, Zhang T. Cloning and expression of vitellogenin (Vg) gene and its correlations with total carenoids content and total antioxidant capacity in noble scallop Chlamys nobilis (Bivalve: Pectinidae). Aquaculture. 2012;366–367:46–53. Zhu HH, Ma GX, Luo YF, Luo YL, Yin SS, Xiong Y, Zhou RQ. Tissue distribution and functional analysis of vitellogenin-6 of Toxocara canis. Exp Parasitol. 2017;177:22–7. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Fisheries and Aquatic Sciences Springer Journals

Role of the insulin-like growth factor system in gonad sexual maturation in Pacific oyster Crassostrea gigas

Fisheries and Aquatic Sciences , Volume 23 (1) – Feb 25, 2020

Loading next page...
 
/lp/springer-journals/role-of-the-insulin-like-growth-factor-system-in-gonad-sexual-tGofImtNLo
Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2020
eISSN
2234-1757
DOI
10.1186/s41240-020-00152-z
Publisher site
See Article on Publisher Site

Abstract

Background: The IGF system plays important roles in controlling growth, development, reproduction, and aging of organisms. Methods: To estimate maturation of the Pacific oyster Crassostrea gigas, we investigated the expression of insulin- like growth factor (IGF) system components and sex-specific genes. To determine the role of the IGF system in the growth and spawning period of female and male oysters, we examined mRNA expression levels of the C. gigas insulin receptor-related receptor (CIR), IGF binding protein complex acid labile subunit (IGFBP_ALS), and molluscan insulin-related peptide (MIP), as well as those of vitellogenin (Vg) and receptor-type guanylate cyclase (Gyc76C) in gonads of C. gigas collected between April and October, when sex can be determined visually in this species. Results: We found that MIP, IGFBP_ALS, and CIR mRNA expression levels were dependent on sex and month and were greater in males than in females. CIR and Vg mRNA expression levels were very similar among females, whereas IGF system components and Gyc76C were very similarly expressed among males. The highest expression values were observed in May, when oysters are mature; CIR and Vg mRNA expression levels were highest in females, and those of MIP, IGFBP_ALS, CIR, and Gyc76C were highest in males. Interestingly, we observed a 1:1 proportion of females to males during this period. Conclusion: Our results suggest that IGF system components, as well as Vg and Gyc76C, are associated with sexual maturation in C. gigas. Background 2010; Marquez et al. 2011; Ventura et al. 2011; Chung The IGF system, which plays important roles in control- 2014; Huang et al. 2015). Insulin receptor homologs, ling vertebrate growth and development, comprises three which exhibit structural and functional similarities to components: ligands (IGF-I and -II), receptors (types I IGF receptors, have also been widely reported (Brogiolo and II), and IGF-binding proteins (IGFBPs) (Duan 1997). et al. 2001; Nässel et al. 2015). In mollusks, growth and The existence of traditional IGFs, IGF receptors, and associated metabolic processes are regulated under the IGFBPs has not been positively demonstrated in inverte- control of neural ganglia (Gricourt et al. 2003). Mollus- brates (Huang et al. 2015). However, several insulin-like can insulin-related peptides (MIPs) have been identified peptides (ILPs) have been discovered; these function in a in many gastropods and bivalves as functional sub- variety of biological processes including growth, metab- stances in neural ganglion neurosecretory cells (Roovers olism, molting, and reproduction (Nagasawa et al. 1986; et al. 1995; Gricourt et al. 2003). In particular, MIPs Krieger et al. 2004; Wu and Brown 2006; Grönke et al. have a beneficial effect on soft body and shell growth (Geraerts 1976, 1992; Gricourt et al. 2003). Geraerts et al. (1992) reported the various functions of MIPs ac- * Correspondence: unichoi@pknu.ac.kr 1 cording to stimulus-dependent differential patterns of Department of Fisheries Biology, Pukyong National University, Busan 48513, Republic of Korea MIP gene expression in the central nervous system. Re- Department of Marine Bio-Materials and Aquaculture, Pukyong National cently, studies have been performed to examine the bio- University, Busan 48513, Republic of Korea logical effects of various growth factors including © The Author(s). 2020 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 2 of 8 Crassostrea gigas insulin receptor-related receptor (CIR) Japan) and a digital balance (AJ Vibra, Shinko and IGFs in the mussel Mytilus galloprovincialis (Canesi Denshi, Japan). Male and female gonad pieces were et al. 1997, 1999, 2001), the Pacific oyster C. gigas (Gri- dissected, immediately frozen in liquid nitrogen, and court et al. 2003; Jouaux et al. 2012), and the Yesso scal- stored at – 75 °C until use. lop Patinopecten yessoensis (Feng et al. 2014). These factors affect growth, maturation, and reproduction in a Protein identification manner dependent on seasonal environmental condi- We investigated protein expression in gonads using 8% tions. Jouaux et al. (2012) reported a balance between sodium dodecyl sulfate–polyacrylamide gel electrophor- growth and management of environmental stresses dur- esis (SDS–PAGE). Specific proteins were confirmed ing reproduction and emphasized the involvement of in- using tandem mass spectrometry (MS/MS) and electro- sulin signaling in gametogenesis and reproduction in C. spray ionization quadrupole time-of-flight MS/MS (ESI- gigas. Many studies have reported intraspecific variation Q-TOF MS/MS, ABI, USA) as previously described in growth and reproduction in a variety of invertebrates; (Choi et al. 2015). Proteins were identified via the Na- among these, C. gigas has been used as a bivalve assess- tional Center for Biotechnology Information (NCBI; ment model (Macdonald & Thompson 1988; Bayne https://www.ncbi.nlm.nih.gov) and UniProt Knowledge- 1999; Choi et al. 2018). base (http://www.uniprot.org/uniprot) databases using C. gigas is an important aquaculture product that is the MASCOT program (Matrixscience, London, UK). mainly produced off the southern coast of Korea. However, the aquaculture production of oysters in cDNA synthesis and reverse-transcription polymerase Korea declined from 321,276 tons in 2007 to 303,183 chain reaction (RT-PCR) tons in 2018 (MOF 2020). There was a similar ten- Male and female gonads were pulverized by adding 1 mL dency in the worldwide aquaculture production (FAO Trans-Zol UP (TransGen Biotech, Beijing, China), and 2020). Oyster value is dependent on condition; how- total RNA was extracted using Trans-Zol UP according ever, fishing environments are becoming increasingly to the manufacturer’s instructions. cDNA was synthe- polluted due to high-density rearing, contaminated sized from 2 μg total RNA using the PrimeScript first- runoff from the coast, and climate change. As a result strand cDNA synthesis kit (TaKaRa Bio, Otsu, Japan) ac- of physical activity by the parent oyster in such farm- cording to the manufacturer’s instructions. RT-PCR was ing environments, oyster larval health is reduced, performed using Emerald Amp GT PCR Master Mix resulting in mass destruction and repeated seedling (TaKaRa Bio, Otsu, Japan). Each primer set was designed shortages. Oysters produced in coastal areas that have according to sequences of CIR (accession no. AJ become clearer and cleaner through nitrogen and 535669.1), IGFBP_ALS (XM_011417921.2), MIP (NM_ phosphorus regulation fail to gain weight due to a 001308866.1), Gyc76C (XM_011452292.2), Vg lack of food suitable for shellfish. These phenomena (AB084783.1), and EF1α (AB122066.1) (Table 1). PCR have unfavorable effects on oyster growth and amplification was performed using C. gigas template maturity. cDNA with the following parameters: 1 cycle at 95 °C for In this study, to estimate maturation of C. gigas oys- 5 min, 25 cycles at 95 °C for 30 s, 50 °C for 30 s, and ters, we investigated the expression of various IGF sys- 72 °C for 30 s, followed by 1 cycle at 72 °C for 5 min. tem components. To determine the role of the IGF PCR products were analyzed by gel electrophoresis on system in the growth and spawning of male and female 1% agarose gels. Densitometry was conducted using the oysters, we determined CIR, IGFBP_ALS, and MIP GeneTools v. 4.03 software (Syngene, Cambridge, UK). mRNA expression levels and those of sex-specific genes such as vitellogenin in C. gigas gonads. Statistical analyses Data are presented as means ± standard deviations. Sig- nificant differences among means were tested using one- Methods way analysis of variance (ANOVA) in the SPSS v. 10.0 Sample preparation software environment (SPSS, Inc., Chicago, IL). We collected 30–40 C. gigas individuals every month from April to October in 2017 (when gonads Results can be discriminated visually) at an oyster farm in Growth parameters Tongyeong, Gyeongsangnam-do, Korea (34° 51′ We collected 40 C. gigas individuals monthly from 32.34″ N, 128° 12′ 23.44″ E). We measured shell April to October 2017, except in June. The ratio of length (SL), shell height (SH), shell width (SW), females to males differed each month, being about 1:1 total wet weight (TW), and soft tissue weight in May and September and 2:1 in June and July (Fig. (STW) using a Vernier caliper (Mitutoyo, Kawasaki, 1). Onehermaphrodite wasfound in Mayand onein Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 3 of 8 Table 1 Nucleotide sequences of primers used in reverse-transcription polymerase chain reaction (RT-PCR) analysis of adductor muscles of the Pacific oyster Crassostrea gigas Gene Accession no. Sequence (5′–3′) Amplicon (bp) CIR AJ535669 (F)-TGAGGAGGGTGATGAGGATA 375 (R)-ATTGCACTGTAGGGATTGGA IGFBP-ALS XP_011442465.1 (F)-CTTGCCCTGAAAACCCTACA 500 (R)-GGGCAAGTAGCAGAATTTGG MIP XM_011417420.2 (F)-TAAATACAAGCGGTCGGGTG 214 (R)-AGATCCTTTCTTCTTGCGGC Gyc76C XM_011452292.2 (F)-ATGAATGCAGTGAATCGCTTGA 274 (R)-TGATACTGTGCAGCTCTTGG Vg AB084783.1 (F)-ATGCTGGAGATGAACCTTGAG 273 (R)-TGCTTCGTGGTGGATATCCT EF1α AB122066.1 (F)–CCACTGGCCATCTCATTTAC 393 (R)–TGTTGACACCAATGATGAGC bp, base pairs; F, forward; R, reverse; CIR, C. gigas insulin receptor-related receptor; IGFBP-ALS, insulin-like growth factor binding protein complex acid labile subunit; MIP, molluscan insulin-related peptide; Gyc76C, receptor-type guanylate cyclase; Vg, vitellogenin June; the proportion of males was higher than that of 0.08 to 0.34 (mean, 0.16 ± 0.04) in females and males, re- females in August (Fig. 1). spectively (Fig. 2b, d). Thus, growth rates of STW/TW, The ratios of STW to TW ranged from 0.07 to 0.29 SH/SL, and SW/SL were positive in both females and (mean, 0.15 ± 0.04) and 0.08 to 0.34 (mean, 0.16 ± 0.04) males in this study (Fig. 2). in females and males, respectively (Fig. 2a, c). The ratio of SH to SL ranged from 1.35 to 3.58 (mean, 2.07 ± 0.37) Protein identification and from 1.02 to 3.36 (mean, 2.07 ± 0.36) in females and Protein expression differed between males and fe- males, respectively (Fig. 2b, d). The ratio of SW to SL males in this study. Proteins were identified as ranged from 0.07 to 0.29 (mean, 0.15 ± 0.04) and from vitellogenin-6 C-term fragments of 180 kDa and N- Fig. 1 The ratio of females to males in the Pacific oyster Crassostrea gigas from April to October. NO, not observed Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 4 of 8 Fig. 2 C. gigas growth during the collection period (April–October 2017). a Growth of soft tissue and total weight in female oysters. b Growth of shell height and length in female oysters. c Growth of soft tissue and total weight in male oysters. d Growth of shell height and length in male oysters term fragments of 110 kDa (accession no. mRNA expression in September; however, the difference tr|K1QNA2|K1QNA2_CRAGI, https://www.uniprot. between this and other months was not significant (p > org/uniprot/K1QNA2) in females and guanlylate cy- 0.05; Fig. 5a). clase (Gyc76C) protein of 96 kDa (accession no. tr|K1QS46|K1QS46_CRAGI, https://www.uniprot.org/ Discussion uniprot/K1QS46) mixed with 143 kDa of uncharacter- It is necessary that salinity, food resources, and water ized protein in males (Fig. 3). flow for oyster growth (Williamson et al. 2015). The growth difference depends on the oyster farm regions MIP, IGFBP_ALS, CIR, Vg, and Gyc76C expression analysis affected by environmental factors such as water Among components of the IGF system (MIP, IGFBP_ temperature, salinity, dissolved oxygen, nutrients, ALS, and CIR), mRNA expression was greater in males water flow and so on (Min et al. 2004). In the present than in females (Fig. 4a, b). CIR mRNA expression was study, the growth difference was not found between significantly higher in both females and males in May females and males within the same farm. In addition, and June and was 1.75–2.02 times higher in males than it was showed positive relationship among STW/TW, in females (p < 0.05; Fig. 4a, b). MIP and IGFBP_ALS SH/SL, and SW/SL. mRNA expression levels were negligible in females ex- The IGF system plays numerous roles in oyster growth cept in September, whereas those of males were signifi- and development; its components have been detected as cantly higher in May and June, the maturation season (p 150-kDa ternary complexes comprising one molecule < 0.05; Fig. 4a, b). MIP, IGFBP_ALS, and CIR mRNA ex- each of IGF, IGFBP-3/IGFBP-5, and an 85 kDa acid la- pression were relatively constant throughout the collec- bile subunit (ALS) in circulation (Baxter 1994; Brogiolo tion period (Fig. 4b) but decreased in spawning season et al. 2001). ALS is a glycosylated protein that binds to and then increased slowly after August in both females IGFBP-3:IGF and IGFBP-5:IGF binary complexes but and males (Fig. 4a, b). does not bind to IGFBP except in complex with IGF Vg and receptor Gyc76C expression levels were exam- (Brogiolo et al. 2001). The main function of ALS is to in- ined based on their identification among male and fe- crease the half-life of IGFs in circulation (Forbes et al. male gonad proteins. Expression levels were high in May 2012). The IGF insulin receptor (IGF-1R) and insulin and then decreased until August, as observed in IGF sys- receptor-related receptor (IRR) form subclass II of the tem component expression (Fig. 5a, b). Vg showed high receptor tyrosine kinase superfamily, sharing covalently Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 5 of 8 to diet restriction, lifespan, and fecundity in these spe- cies. Some research has also been conducted on the in- volvement of IRPs (molluscan IRP, MIPs) in controlling growth, reproduction, and nutritional status in C. gigas (Gricourt et al. 2003; Jouaux et al. 2012). In the present study, expression levels of IGF-related genes (MIP, CIR, and IGFBP-ALS) and sex-specific genes (Vg and Gyc76C) were significantly higher in May, when oysters have matured and are about to undergo spawn- ing. The observed changes in gene expression levels may therefore be used as indicators of annual growth, matur- ity, and spawning period in cultured C. gigas. The appli- cation of IGF system (MIP, IGFBP-ALS, and CIR) expression as a growth indicator is an attractive alterna- tive to physiological methods, which are prone to pro- cessing errors (Tran et al. 2007). IGF system component mRNA expression is associ- ated with changes in Vg and Gyc76C expression. Vg is a major precursor of vitellins, which are egg yolk proteins that provide energy reserves for embryonic development in oviparous organisms (Matozzo et al. 2008). To date, six Vg genes (1 to 6) have been iden- tified in the nematode Caenorhabditis elegans (Boag et al. 2001), and a female-specific Vg-6 has been identified in Haemonchus contortus (Hartman et al. 2001), Trichostrongylus vitrines (Nisbet and Gasser 2004), and Toxocara canis (Zhu et al. 2017). These Vg genes play roles in reproduction and may be in- volved in adult biological processes (Zhu et al. 2017). In the present study, we identified Vg-6 C-term and N-term fragments in female gonads. Vg mRNA ex- pression was highest during the maturation stage and decreased thereafter. Our results are consistent with those reported for the scallop Chlamys farreri (Qin Fig. 3. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis et al. 2012) and the Fujian oyster Crassostrea angu- (SDS-PAGE) analysis of C. gigas gonads. M, protein marker; “♀,”female oyster; “♂,”male oyster. Arrows on the female column lata (Ni et al. 2014). Ni et al. (2014) described the indicate vitellogenin-6 fragments. Arrow on the male column stages of oyster ovarian development in detail as fol- indicates guanylate cyclase and mixed uncharacterized proteins lows: (1) maturation stage, when ovaries accumulate nutrients for oogenesis, and mRNA is abundant due linked homodimers and several structural domains (Ren- to activeVggeneexpression to promoteVgprotein tería et al. 2008). Invertebrates have only a single IRR, synthesis, yolk intake, and nutrient accumulation in which regulates growth and metabolism (Leevers 2001); oocytes; (2) ripeness stage, when oocytes grow and there is no clear evidence of the existence of traditional accumulate yolk, decreasing the demand for yolk pro- IGFs, IGF receptors, or IGFBP1-6 in invertebrates tein and Vg gene expression; and (3) partially spent (Huang et al. 2015). However, several insulin-related stage, when ovaries stop developing and before new peptides (IRPs) have been identified based on biochem- oogonium inception so that Vg expression levels are ical purification or cDNA identification (Cherf-Feildel very low (Boutet et al. 2008; Zheng et al. 2012). Davis et al. 2019). Various biological functions and members et al. (2008) reported that endogenous in females and of the insulin family observed in vertebrates are gener- exogenous Vg in 17β-estradiol (E )-treated males ally conserved in invertebrates. This functional conserva- downregulate GH/IGF-1 axis support of vitellogenesis tion has been clearly demonstrated in Drosophila in the liver. E induces the shift of energy away from melanogaster and Caenorhabditis elegans (Cherf-Feildel somatic growth by suppressing the haptic GH/IGF et al. 2019). IRPs play key roles in controlling growth, axis and toward vitellogenesis by estrogen receptor α- development, energy storage, stress resistance, response mediated upregulation of multiple Vg genes, which is Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 6 of 8 Fig. 4 Molluscan insulin-related peptide (MIP), insulin-like growth factor binding protein complex acid labile subunit (IGFBP-ALS), and C. gigas insulin receptor-related receptor (CIR) mRNA expression in C. gigas a females and b males a potential endocrine mechanism contributing to sex- (Hadley 1988;Deeming 1991). Further studies focusing on ual dimorphism (Davis et al. 2008). the association between the function of cleaved Vg genes Guanylate cyclase (Gyc) is a family of soluble receptor-type and the GH/IGF axis in ovaries and on Gyc and the IGF sys- enzymes that catalyze the conversion of GTP to cGMP in tem in each developmental stage are necessary. both vertebrates and invertebrates (Patel et al. 2012). The ex- pression of Gyc mRNA is involved in oogenesis, egg cham- Conclusion ber development (Gigliotti et al. 1993; Ayoob et al. 2004), The expression of IGF system components including MIP, retinal development (Patel et al. 2012), wing development IGFBP-ALS, and CIR was associated with sex and develop- (Schleede and Blair 2015), and lumen formation (Myat and mental stage in Pacific oyster gonads. CIR and Vg expression Patel 2016)in Drosophyla and in embryonic and adult retinal levels were very similar among females, whereas those of development in Oryzias latipes (Harumi et al. 2003). In the MIP, IGFBP_ALS, CIR, and Gyc7C were very similar among present study, Gyc76C mRNA expression was high in males males. The highest expression levels occurred in May, which during the maturation season, and its trends were similar to is the maturation season. CIR and Vg are female-specific those of the IGF system. Therefore, we cautiously suggest genes in Pacific oysters, whereas MIP, IGFBP-ALS, CIR, and that Gyc76C plays a sex-specific role in male oysters. IGF-1 Gyc76C are male specific. The results of the present study inhibits adenylate cyclase and stimulates Gyc activity, thereby suggest that IGF system components, as well as Vg and lowering cyclic AMP concentrations and elevating cycle Gyc76C, are associated with sexual maturation in C. gigas. GMP levels in a manner similar to the action of insulin Fig. 5 Vitellogenin (Vg) and receptor-type guanylate cyclase (Gyc76C) mRNA expression in C. gigas a females and b males Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 7 of 8 Acknowledgements Chung JS. An insulin-like growth factor found in hepatopancreas implicates Not applicable. carbohydrate metabolism of the blue crab Callinectes sapidus. Gen Comp Endocrinol. 2014;199:56–64. Davis LK, Pierce AL, Hiramatsu N, Sullivan CV, Hirano T, Grau EG. Gender-specific Authors’ contributions expression of multiple estrogen receptors, growth hormone receptors, YHC contributed to the conceptualization, investigation, writing, supervision, insulin-like growth factors and vitellogenins, and effects of 17b-estradiol in project administration, and funding acquisition. JSM contributed to the the male tilapia (Oreochromis mossambicus). Gen Comp Endocrinol. 2008;156: investigation and data analysis. Both authors read and approved the final 544–51. manuscript. Deeming DC. Egg incubation: its effects on embryonic development in birds and reptiles. UK: Cambridge University Press; 1991. p. 448. Funding Duan C. The insulin-like growth factor system and its biological actions in fish. This research was supported by the Basic Science Research Program through Am Zool. 1997;37:491–503. the National Research Foundation of Korea (NRF) funded by the Ministry of Feng L, Li X, Yu Q, Ning X, Dou J, Zou J, Zhang L, Wang S, Hu X, Bao Z. A scallop Education (NRF-2016R1D1A1B03934914). IGF binding protein gene: molecular characterization and association of variants with growth traits. PLoS One. 2014;9:e89039. Availability of data and materials Food and Agriculture Organization. http://www.fao.org (2020). Accessed 29 Data sharing is not applicable to this article as no datasets were generated January 2020. or analyzed during the current study. Forbes BE, McCarthy P, Norton RS. Insulin-like growth factor binding proteins: a structural perspective. Front Endocrinol. 2012;3:1–13. Ethics approval and consent to participate Geraerts WP. Control of growth by the neurosecretory hormone of the light Not applicable. green cells in the freshwater snail Lymnaea stagnalis. Gen Comp Endocrinol. 1976;29:61–71. Consent for publication Geraerts WP. Neurohormonal control of growth and carbohydrate metabolism by Not applicable. the light green cells in Lymnaea stagnalis. Gen Comp Endocrinol. 1992;86: 433–44. Geraerts WP, Smit AB, Li KW, Hordijk PL. The light green cells of Lymnaea:a Competing interests neuroendocrine model system for stimulus-induced expression of multiple The authors declare that they have no competing interest. peptide genes in a single cell type. Experientia. 1992;48:464–73. Gigliotti S, Cavaliere V, Manzi A, Tino A, Graziani F, Malva C. A membrane Received: 6 January 2020 Accepted: 13 February 2020 guanylate cyclase Drosophila homolog gene exhibits maternal and zygotic expression. Dev Biol. 1993;159:450–61. Gricourt L, Bonnec G, Boujard D, Mathieu M, Kellner K. Insulin-like system and References growth regulation in the Pacific oyster Crassostrea gigas: hrIGF-1 effect on Ayoob JC, Yu HH, Terman JR, Kolodkin AL. The Drosophila receptor guanylyl protein synthesis of mantle edge cells and expression of an homologous cyclase Gyc76C is required for semaphoring-1a-plexin A-mediated axonal insulin receptor-related receptor. Gen Comp Endocrinol. 2003;134:44–56. repulsion. J Neurosci. 2004;24:6639–49. Grönke S, Clarke DF, Broughton S, Andrews TD, Partridge L. Molecular evolution Baxter RC. Insulin-like growth factor binding proteins in the human circulation: a and functional characterization of Drosophila insulin-like peptides. PLoS review. Horm Res. 1994;42:140–4. Genet. 2010;6:e1000857. Bayne BL. Physiological components of growth differences between individual Hadley ME. Endocrinology: 2nd ed. Prentice-Hall, Englewood Cliffs, NJ, 1988. 550 oysters (Crassostrea gigas) and a comparison with Saccostrea commercialis. pp. In General and Comparative Endocrinology 1988;72:329–329. Physiol Biochem Zool. 1999;72:705–13. Hartman D, Donald DR, Nikolaou S, Savin KW, Hasse D, J.A Presidente P, Newton Boag PR, Newton SE, Gasser RB. Molecular aspects of sexual development SE. Analysis of developmentally regulated genes of the parasite Haemonchus and reproduction in nematodes and schistosomes. Advan Parasitol. 2001; contortus. Int J Parasitol. 2001;31:1236–45. 50:153–98. Harumi T, Watanabe T, Yamamoto T, Tanabe Y, Suzuki N. Expression of Boutet I, Moraga D, Marinovic L, Obreque J, Chavez-Crooker P. Characterization of membrane-bound and soluble guanylyl cyclase mRNAs in embryonic and reproduction-specific genes in a marine bivalve mollusc: influence of adult retina of the medaka fish Oryzias latipes. Zool Sci. 2003;20:133–40. maturation stage and sex on mRNA expression. Gene. 2008;407:130–8. Huang X, Ye H, Feng B, Huang H. Insights into insulin-like peptide system in Brogiolo W, Stocker H, Ikeya T, Rintelen F, Fernandez R, Hafen E. An evolutionarily invertebrates from studies on IGF binding domain-containing proteins in the conserved function of the Drosophila insulin receptor and insulin-like female mud crab, Scylla paramamosain. Mol Cell Endocrinol. 2015;416:36–45. peptides in growth control. Curr Biol. 2001;11:213–21. Jouaux A, Franco A, Heude-Berthelin C, Sourdaine P, Blin JL, Mathieu M, Kellner K. Canesi L, Betti M, Ciacci C, Gallo G. Insulin-like effect of zinc in Mytilus digestive Identification of Ras, Pten and p70S6K homologs in the Pacific oyster gland cells: modulation of tyrosine kinase-mediated cell signaling. Gen Comp Crassostrea gigas and diet control of insulin pathway. Gen Comp Endocrinol. Endocrinol. 2001;122:60–6. 2012;176:28–38. Canesi L, Ciacci C, Betti M, Malatesta M, Gazzanelli G, Gallo G. Growth factors Krieger MJB, Jahan N, Riehle MA, Cao C, Brown MR. Molecular characterization of stimulate the activity of key glycolytic enzymes in isolated digestive gland insulin-like peptide genes and their expression in the African malaria cells from mussels (Mytilus galloprovincialis Lam.) through tyrosine kinase mosquito, Anopheles gambiae. Insect Mol Biol. 2004;13:305–15. mediated signal transduction. Gen Comp Endocrinol. 1999;116:241–8. Leevers SJ. Growth control: invertebrate insulin surprises. Curr Biol. 2001;11:R209–12. Canesi L, Ciacci C, Orunesu M, Gallo G. Effects of epidermal growth factor on Macdonald BA, Thompson RJ. Intraspecific variation in growth and reproduction isolated digestive gland cells from mussels (Mytilus galloprovincialis Lam.). in latitudinally differentiated populations of the giant scallop Placopecten Gen Comp Endocrinol. 1997;107:221–8. magellanicus (Gmelin). Biol Bull. 1988;175:361–71. Cherif-Feildel M, Berthelin H, Adeline B, Rivière G, Favrel P, Kellner K. Molecular Marquez AG, Pietri JE, Smithers HM, Nuss A, Antonova Y, Drexler AL, Riehle MA, evolution and functional characterization of insulin related peptides in Brown MR, Luckhart S. Insulin-like peptides in the mosquito Anopheles molluscs: contributions of Crassostrea gigas genomic and transcriptomic- stephensi: identification and expression in response to diet and infection with wide screening. Gen Comp Endocrinol. 2019;271:15–29. Plasmodium falciparum. Gen Comp Endocrinol. 2011;173:303–12. Choi YH, Kim EY, Nam TJ. Involvement of insulin-like growth factor in intraspecific Matozzo V, Gagné F, Marin MG, Ricciardi F, Christian BC. Vitellogenin as a variation in growth of Pacific oyster Crassostrea gigas during winter. Fish Sci. biomarker of exposure to estrogenic compounds in aquatic invertebrates: a 2018;84:1017–24. review. Environ Int. 2008;34:531–45. Choi YH, Yamaguchi K, Oda T, Nam TJ. Chemical and mass spectrometry characterization of the red alga Pyropia yezoensis chemoprotective protein Min KS, Kim BS, Kim TI, Hur YB, Chung EY. Reproductive cycle and induced sexual (PYP): protective activity of the N-terminal fragment of PYP1 against maturation of the Pacific oyster. Crassostrea gigas. 2004;20:75–84. acetaminophen-induced cell death in Chang liver cells. Int J Mol Med. 2015; Ministry of Oceans and Fisheries. http://www.mof.go.kr (2020). Accessed 29 35:271–6. January 2020. Moon and Choi Fisheries and Aquatic Sciences (2020) 23:3 Page 8 of 8 Myat MM, Patel U. Receptor-type guanylyl cyclase at 76C (Gyc76C) regulates De Novo lumen formation during Drosophila tracheal development. PLoS ONE. 2016;11:e0161865. Nagasawa H, Kataoka H, Isogai A, Tamura S, Suzuki A, Mizoguchi A, Fujiwara Y, Suzuki A, Takahashi SY, Ishizaki H. Amino acid sequence of a prothoracicotropic hormone of the silkworm Bombyx mori. PNAS USA. 1986; 83:5840–3. Nässel DR, Liu Y, Luo J. Insulin/IGF signaling and its regulation in Drosophila. Gen Comp Endocrinol. 2015;221:255–66. Ni J, Zeng Z, Kong D, Hou L, Huang H, Ke C. Vitellogenin of Fujian oyster, Crassostrea angulata: synthesized in the ovary and controlled by estradiol- 17β. Gen Comp Endocrinol. 2014;202:35–43. Nisbet AJ, Gasser RB. Profiling of gender-specific gene expression for Trichostrongylus vitrinus (Nematoda: Strongylida) by microarray analysis of expressed sequence tag libraries constructed by suppressive-subtractive hybridisation. Int J Parasitol. 2004;34:633–43. Patel U, Davies SA, Myat MM. Receptor-type guanylyl cyclase Gyc76C is required for development of the Drosophila embryonic somatic muscle. Biol Open. 2012;1:507–15. Qin Z, Li Y, Sun D, Shao M, Zhang Z. Cloning and expression analysis of the vitellogenin gene in the scallop Chlamys farreri and the effects of estradiol- 17b on its synthesis. Inverte Biol. 2012;131:312–21. Rentería ME, Gandhi NS, Vinuesa P, Helmerhorst E, Mancera RL. A comparative structural bioinformatics analysis of the insulin receptor family ectodomain based on phylogenetic information. 2008;3:e3667. Roovers E, Vincent ME, van Kesteren E, Geraerts WP, Planta RJ, Vreugdenhil E, van Heerikhuizen H. Characterization of a putative molluscan insulin-related peptide receptor. Gene. 1995;11:81–8. Schleede J, Blair SS. The Gyc76C receptor guanylyl cyclase and the foraging cGMP-dependent kinase regulate extracellular matrix organization and BMP signaling in the developing wing of Drosophila melanogaster. PLOS Gene. 2015;11:e1005576. Tran TQ, Boring RL, Dudenhoeffer DD, Hallbert BP, Keller MD, Anderson TM. Advantages and disadvantages of physiological assessment for next generation control room design. Hfpp HPRCT 13th Annual Meeting 2007; IEEE 8th. Ventura T, Rosen O, Sagi O. From the discovery of the crustacean androgenic gland to the insulin-like hormone in six decades. Gen Comp Endocrinol. 2011;173:381–8. Williamson TR, Tilley DR, Campbell E. Emergy analysis to evaluate the sustainability of two oyster aquaculture systems in the Chesapeake Bay. Ecol Eng. 2015;85:103–20. Wu A, Brown MR. Signaling and function of insulin-like peptides in insects. Annual Review Entomol. 2006;51:1–24. Zheng H, Zhang Q, Liu H, Liu W, Sun Z, Li S, Zhang T. Cloning and expression of vitellogenin (Vg) gene and its correlations with total carenoids content and total antioxidant capacity in noble scallop Chlamys nobilis (Bivalve: Pectinidae). Aquaculture. 2012;366–367:46–53. Zhu HH, Ma GX, Luo YF, Luo YL, Yin SS, Xiong Y, Zhou RQ. Tissue distribution and functional analysis of vitellogenin-6 of Toxocara canis. Exp Parasitol. 2017;177:22–7. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Journal

Fisheries and Aquatic SciencesSpringer Journals

Published: Feb 25, 2020

There are no references for this article.