Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Response of body color change rearing under different light intensity conditions in farmed red spotted grouper, Epinephelus akaara

Response of body color change rearing under different light intensity conditions in farmed red... Background: Fish body color is one of the major factors that determine the commercial value of farmed fish, to understand for coloration mechanisms. The expression of melanin-related genes is according to the developmental stage and light intensity in the red spotted grouper, Epinephelus akaara. Methods: To investigate changes in melanin formation and melanin-related genes in the larval development stage, fish larvae were reared from fertilized egg stage to 50 days after hatching (DAH). Experiment of body color changes was performed under each different light intensity conditions. Melanin-related genes expression was analyzed by real-time qPCR, and body coloration difference was represented by RGB (red, green, blue) code value. Results: Expression levels of melanin-concentrating hormone (MCH) mRNA, pro-opiomelanocortin (POMC) mRNA, and melanocortin 1 receptor (MC1R) mRNA were at their highest 5 DAH (days after hatching). Expression levels of agouti- signaling protein (ASIP) mRNA were at their highest 10 DAH. Results of body color changes according to changes in light intensity conditions showed that the expression level of MCH mRNA in the 2000 lx group was the highest at 6 weeks. The expression levels of POMC mRNA and MC1R mRNA in the 1000 lx group were at their lowest at 9 weeks. RGB color code value under different light intensities were the brightest under 1000 lx and the darkest under 0 lx. Conclusion: Our research suggests that POMC mRNA and MC1R mRNA in the red spotted grouper are involved in melanin synthesis, and these genes are thought to be controlled by light intensity. To better understand the molecular mechanism of coloration in the red spotted grouper, further studies are needed to clarify the relationship between melanophore development and melanin-related genes. Keywords: Body coloration, Melanin-concentrating hormone (MCH), Pro-opiomelanocortin (POMC), Melanocortin 1 receptor (MC1R), Agouti-signaling protein (ASIP), Red spotted grouper Introduction receptors. Oxidation of tyrosine is increased in melano- Melanin is one of the major decision factors about hair and somes and the resulting tyrosinase induces melanin synthe- body color in vertebrate including human (Fujii 2000). It is sis in the melanosomes (Seiji et al. 1963; Korner and synthesized in the melanosomes of melanocytes and affects Pawelek 1982; Kobayashi et al. 1994). Melanin transports skin and body color. Melanin cells receive external signals, through the dendrites of melanin cells to the skin’skeratino- such as from hormones and ultraviolet rays, that vitalize cyte layer. Melanin protects skin tissues from cell deform- ation and destruction by UV rays (Sulaimon and Kitchell * Correspondence: leemri@jejunu.ac.kr 2003;Costinand Hearing 2007; Kondo and Hearing 2011). Marine Science Institute, Jeju National University, Jeju 695-965, Republic of In marine animals, melanin has a protective function Korea Full list of author information is available at the end of the article against ultraviolet rays, in that it protects cells against © The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 2 of 9 damage and stress (Adachi et al. 2005;Suzuki et al. 1994). akaara. Therefore, in order to improve the commercial The olive flounder (Paralichthys olivaceus) and octopus value of farmed red spotted grouper, research on grouper (Octopus vulgaris) have the ability to change skin color coloration is required. The coloration of fish provides eco- and camouflage themselves in response to predators and logical and physiological information and is a decisive fac- stress (Fujimoto et al. 1991;Fujii 1993;Hanlon 2007). tor in their production value (Paripatananont et al. 1999; Melanin in fish has numerous functions including, among Kalinowski et al. 2005;Wang etal. 2006). In our study, we others, skin protection, pigmentation, immunity, and aimed to understand whether rearing red spotted grouper stress responses (Amiya et al. 2008; Kittilsen et al. 2009; under different light intensity conditions affected their Sköld et al. 2013; Cal et al. 2017). body color. In order to achieve this, we reared fish under Pro-opiomelanocortin (POMC) is usually expressed in different light intensity conditions and searched for the the pituitary gland and functions like many peptide pre- presence of melanin-related gene expression and changes cursors, including alpha-melanocyte-stimulating hormone in body color brightness. (α-MSH), adrenocorticotropic hormone (ACTH), and β- endorphin (β-END). Melanocortin has five receptors from Materials and methods melanocortin 1 receptor (MC1R) to melanocortin 5 recep- Fish tor (Cone 2006; Ducrest et al. 2008;Cerdá-Reverter et al. The fish, the artificially produced red spotted grouper was 2011;Juet al. 2018). MC1R is involved in melanin synthe- provided by the CR co. ltd (Republic of Korea) and moved sis and body color. MC2R is the receptor of ACTH and is to the Marine Science Institute, Jeju National University involved in immune function. MC3R is involved in appe- (Republic of Korea). Before the experiment, fish was accli- tite and homeostasis. MC4R is involved in obesity and pri- matized under natural photoperiod and water temperature apism, and MC5R is involved in immune regulation, conditions and fed to satiation the commercial pellets separation of red blood cells, and the maintenance of (Daebong lf fishery association Co., Jeju, South Korea) homeostasis. α-MSH stimulates the synthesis of melanin twice a day (09:00 and 17:00) for a week. All experiments from melanocytes by revitalizing MC1R. This process were performed in compliance with the Animal Care and darkens skin. The agouti-signaling protein (ASIP) prevents Use Committee guidelines of laboratory animals in the Re- melanin pigmentation on the ventral side of fish by inhi- public of Korea (Borski and Hodson 2003). biting α-MSH synthesis which leads to the deactivation of MC1R (Cal et al. 2015). Melanin-concentrating hormone (MCH), which is secreted by the brain, changes body color Experimental design radically by controlling the cohesion and dispersion of For analysis of tissue specific expression of melanin-related melanin in the chromophore (Baker et al. 1995). It per- genes, adult red spotted groupers (n = 3, total length 245.3 forms various other functions related to appetite and im- ± 9.7 cm, body weight 25.0 ± 0.5 g) were taken from the munity (Takahashi et al. 2004; Matsuda 2009). aquarium tank and anesthetized with 0.01% 2- According to the Food and Agriculture Organization of phenoxyethanol (Junsei Chemical Co., Tokyo, Japan) before the United Nations (FAO), the global production of grouper sampling. After anesthetization, all tissues were extracted in aquaculture was 155,000 tons in 2015. The major produ- and divided into central nervous tissues (telencephalon, tec- cing countries are China, Taiwan Province of China (PoC), tum, cerebellum, hypothalamus, medulla oblongata, and pi- and Indonesia. These countries contribute 92% of the total tuitary gland) and peripheral tissues (retina, tongue, heart, production of grouper (Rimmer and Glamuzina 2019). Nu- kidney, stomach, intestine, liver, gonad, fin, skin, and merous grouper species studies have been performed on lar- muscle). Extracted tissues were immediately frozen using li- val development stages as well as the growth and quid nitrogen and stored at − 80 °C until analysis by real- reproductive characteristics (Chauvet 1988;Song et al. 2005; time qPCR could be completed. Kim et al. 2013; Lee et al. 2014; Lee et al. 2020). To investigate changes in melanin formation and Serranidae have high industrial value in the domestic melanin-related genes in the larval development stage, fer- aquaculture industry, and some studies (growth (Cho tilized eggs were obtained from mature females and males. et al. 2015), maturity (Lee et al. 2020), development (Song The fertilized eggs were transferred to individual tanks and et al. 2005), digestive physiology (Hur et al. 2013), etc.) are allowed to hatch. Fish larvae were reared under natural being performed for the development of aquaculture tech- photoperiod and natural water temperature conditions nology. However, research on Serranidae was still rare. (24.0 ± 0.5 °C). After hatching, fish larvae were sampled at The body color of farmed fish tends to decline in quality 0, 1, 2, 3, 5, 7, 10, 14, 20, 25, 30, 35, 40, 45, and 50 days compared to wild fish (Booth et al. 2004). This is problem- after hatching (DAH). Samples were divided for genetic atic because it reduces the commercial value of farmed analysis and microscopic observations. Melanin distribu- fish. This problem also applies to many farmed grouper tion was observed using an optical microscope (BX43, species, including the red spotted grouper Epinephelus Olympus Corporation, Tokyo, Japan). For real-time qPCR Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 3 of 9 analysis, collected samples were immediately frozen in li- Table 1 Primer sets used in real time-quantitative PCR quid nitrogen and stored at − 80 °C. Primer information In order to investigate changes in melanin-related genes’ Primer Sequence (5’-3’) expression according to light intensity, we performed a MCH Forward CTGTTGTCGTCAGCTCTCCG fish rearing experiment under different light conditions. MCH Reverse GGGATGCAGATCTACCCACTG Sixty DAH (n = 200, total length 3.2 ± 0.2 cm, body weight POMC Forward GAACATCCGAGCTGTCAGGA 0.34 ± 0.1 g) larvae were reared. Fifty fish were randomly POMC Reverse CATGGAGTAGGAGCGCTTGG selected and divided from each aquarium tanks (90 L) and kept for 5 days under natural water temperatures and MC1R Forward GTTGGCCATCTTCAAGAACCG photoperiod conditions before the start of the experiment. MC1R Reverse TCACGTCGATGACGTTGTCC Four light intensity conditions (0 lx, 200 lx, 1000 lx, and ASIP Forward GGCCCACCTCCTGTTGTTATT 2000 lx) were regulated using a photometer, and light ASIP Reverse GACAGTTCTGAAGAGCCGACA source used was LED lights. All experimental groups were β-actin Forward GAGGGGTATCCTGACCCTGA reared under a 12 h light to 12 h dark (12 L:12D) photo- β-actin Reverse CTCCTCAGGGGCAACTCTC period using a timer under natural water temperature conditions (24.6 ± 0.4 °C) for 9 weeks. The fish was fed commercial pellets (Daehan co., MP3, Busan, South RGB color code Korea) twice a day during the experiment. Sampling was The RGB color code for the body color change in fish by performed at 3-week intervals, a total of three times, on light intensity was analyzed by obtaining the average five fish from each tank. The fish was anesthetized using color of an image. A color code was extracted from each 0.01% 2-phenoxyethanol, their weight was measured, and image (of equal area) using a free online program Get the entire length of skin and whole brain were extracted, average color of image by Matthias Klein (Klein 2018). including the pituitary gland. To analyze the body color difference between all experiments, the fish was photo- Statistical analysis graphed using a camera (F90X, Nikon, Tokyo, Japan). The experimental results were analyzed with a one-way Following sampling, samples were immediately frozen in analysis of variance (ANOVA) using SPSS version 21 liquid nitrogen and stored at − 80 °C until the real-time (SPSS Inc.) and tested using Duncan’s multiple range qPCR analyses could be performed. test (Duncan 1955) to confirm significance. Values are shown as means ± standard deviations. Statistical signifi- cance was determined at a 95% level (P < 0.05). cDNA synthesis and real-time qPCR For total RNA extraction, a RiboEx™ (GeneAll Biotechnol- Results ogy, Seoul, Korea) solution was added to the brain, pituit- Tissue-specific expression of melanin-related genes ary gland, and skin tissue samples and homogenized using We aimed to detect expression of MCH, POMC, MC1R, a homogenizer. Total RNA was extracted according to the and ASIP mRNAs in the red spotted grouper’s central ner- manufacturer’s protocol and treated using diethyl vous and peripheral tissues. MCH mRNA expression was pyrocarbonate-processed H O(DEPC H O) to cleanse significantly higher than the other tissues in the dienceph- 2 2 and dissolve the total RNA pellet. Total RNA was mea- alon (P < 0.05) (Fig. 1a). POMC mRNA expression was sig- sured using Nano Vue (GE Healthcare, Buckinghamshire, nificantly higher than the other tissues in the pituitary gland UK) for cDNA synthesis. In the experiment, total RNA (P <0.05) (Fig. 1b). MC1R mRNA showed significantly high was synthesized using the RQ1 RNase-Free DNase Kit expression, especially in pelvic fin tissues (P < 0.05) (Fig. (Promega, Madison, WI, USA). The PrimeScript™ 1st 1c). The expression of ASIP mRNA was significantly higher strand cDNA synthesis Kit (Takara Bio Inc., Otsu, Japan) in thetongueand ventralskin(P <0.05) (Fig. 1d). was used for cDNA processing. To produce a species- specific primer for real time-qPCR, partially sequenced Developmental stages: melanin formation and melanin- melanin-related genes were used (Table 1). Real-time related genes changes qPCR was performed with 0.2 μL of cDNA using an Eva- We investigated melanophore formation changes accord- green premix PCR kit (ABM, Richmond, BC, Canada). ing to development stage in red spotted grouper larvae. At Real time-qPCR was performed with an initial denatur- 0 DAH, melanophores were not observed (Fig. 2a). At 1 ation at 95 °C for 10 min after a reaction at 95 °C for 15 s DAH, a melanin line was observed outside each retina and 60 °C for 1 min using a CFX96™ real-time system (Fig. 2b). At 2 DAH, melanin had begun to spread from (Bio-Rad Laboratories, Hercules, CA, USA). Expression of the melanin line outside each retina (Fig. 2c). At 3 DAH, genes in each experiment was normalized to amount of the whole retina of each larva was covered by melano- the internal control β-actin gene. phores and more melanophores had begun to develop at Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 4 of 9 Fig. 1 Tissue specific expression of melanin-related genes in the red spotted grouper by real-time qPCR. Of, olfactory lob; Te, telencephalon; Op, optic tectum; Di, diencephalon; Ce, cerebellum; Me, medulla oblongata; Pt, pituitary; Re, retina; To, tongue; Gi, gill; He, heart; Ki, kidney; Sp, spleen; St, stomach; In, intestine; Li, liver; Go, gonad; SkD, skin dorsal; SkM, skin middle; SkV, skin ventral; FinP, pelvic fin; FinC, caudal fin; Mu, muscle. Asterisks represent highest statistical difference at P < 0.05. Values are mean ± SEM the primordial fin fold and abdominal cavity of each larva high levels at 5 DAH (P < 0.05), then decreased rad- (Fig. 2d). At 5 DAH, melanophores in the abdominal cav- ically thereafter (Fig. 3a). Expression of POMC mRNA ity were spread out to the vertebra of each larva (Fig. 2e). increased at 3 DAH, was at its significantly high At 10 DAH, the distribution range of the vertebral mela- levels at 5 DAH (P < 0.05), and then decreased until nophores had widened in each larva (Fig. 2f). At 14 DAH, 14 DAH where it remained at low levels of expression the abdominal cavity of each larva was completely covered (Fig. 3b). Expression of MC1R mRNA was signifi- by melanophores (Fig. 2g). At 20 DAH, melanophores cantly high until 5 DAH (P < 0.05), then it decreased were observed in the caudal fin of each larva (Fig. 2h). At until 25 DAH where it remained at low levels there- 25 DAH, melanophores were distributed at the edges of after (Fig. 3c). The expression of ASIP mRNA started the dorsal fins, and an increase in melanophores was ob- by increasing slowly until 10 DAH and significantly served at the caudal fins in each larva (Fig. 2i). At 30 high levels at 10 DAH and 20 DAH (P < 0.05). Then, DAH, melanophores from the caudal fin began to develop it decreased steadily until 50 DAH (Fig. 3d). round to the center and sides of each body (Fig. 2j). At 40 DAH melanophores had developed at the dorsal fin and at Changes in melanin-related genes expression according the edge of dorsal and lateral lines of each larva (Fig. 2k). to light intensity At 50 DAH, melanophores were observed at the dorsal fin At 6 weeks, the expression of MCH mRNA was at its and over the whole body (Fig. 2l). highest level at 2000 lx and its lowest level at 0 lx (P < Expression changes of MCH, POMC, MC1R, and 0.05). However, at 9 weeks, there was no significant dif- ASIP mRNAs according to development stage were ference between the experimental groups (Fig. 4a). At 6 observed in red spotted grouper. MCH mRNA ex- weeks, the expression of POMC mRNA was highest at pression increased at 3 DAH, was at its significantly 200 lx, and at 9 weeks, the highest level was confirmed Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 5 of 9 Fig. 2 Development stage of pigmentation in the red spotted grouper. 0 DAH (a), 1 DAH (b), 2 DAH (c), 3 DAH (d), 5 DAH (e), 10 DAH (f), 14 DAH (g), 20 DAH (h), 25 DAH (i), 30 DAH (j), 40 DAH (k), 50 DAH (l). DAH, days after hatching; arrows indicate melanin at 0 lx. The lowest level of POMC mRNA was confirmed development in red spotted grouper larvae showed that the at 1000 lx (P < 0.05) (Fig. 4b). Expression of MC1R expression of MCH, POMC, and MC1R mRNAs began to mRNA was at its highest level at 200 lx, and at 3 weeks, increase at 3 DAH, with the highest levels observed at 5 it was at its lowest at 2000 lx (P < 0.05). However, at 6 DAH. During this period, melanophores completely cov- weeks, there was no significant difference in the expres- ered the body and started to form dorsal fin fold and ab- sion of MC1R mRNA between the experimental groups. dominal cavities. These results are considered to reflect the At 9 weeks, the highest level was observed at 0 lx, and activation of melanin-related genes’ expression from 3 the lowest level was observed at 1000 lx (Fig. 4c). The DAH to 5 DAH, which leads to melanin synthesis in the expression of ASIP mRNA was at its highest level imme- red spotted grouper. ASIP mRNA was highly expressed 7 diately after the beginning of the experiment. It then to 25 DAH, and during this period, the abdominal cavity maintained a low level of expression and showed no sig- was covered with melanophores and the outer part of the nificant difference between the experimental groups (Fig abdominal cavity was surrounded by iridophores. 4d). When we measured the RGB color value of the red The ASIP gene prevents the division and increase of spotted grouper’s skin, the 0 lx group returned values of melanin cells and makes skin color brighter (Suzuki 86, 71, and 58 as their darkest colors. The RGB values 2013). From experimental results on goldfish (Carassius from the 200 lx group were 88, 71, and 59 and from the auratus) (Cerdá-Reverter et al. 2005), ASIP mRNA was 1000 lx group were 137, 116, and 99, in which 1000 lx found to have a genetic homogeny of mammal ASIP was the brightest colors. The RGB values of the 2000 lx mRNA, along with mice, and it plays an important role group were 105, 92, and 81 (Table 2). in forming the ventral color pattern. In goldfish, ASIP mRNA is mainly expressed in ventral skin and has not Discussion been detected in dorsal skin. These results suggest that Recently, photobiology studies on fish have been conducted ASIP mRNA is mainly involved in differentiation to iri- on various adaptive physiological characteristics, including dophores in ventral skin. Therefore, the increased ASIP body color, growth, and metabolism (Appelbaum and Kam- mRNA expression in red spotted grouper larvae at 7 ler 2000;Petrell andAng 2001). This study investigated the DAH, that we observed, may stimulate the development adaptive physiology of red spotted grouper’s melanin- of iridophores outside the abdominal cavity. related genes with respect to light intensity. According to Melanophores in red spotted grouper larvae specimens our results, the expression of genes related to melanin were observed at 1 DAH formed outside the iris and Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 6 of 9 Fig. 3 Expression of development stage of melanin-related genes in the red spotted grouper by real-time qPCR. MCH (a), POMC (b), MC1R (c), and ASIP (d). Asterisks represent highest statistical difference at P < 0.05. Values are mean ± SEM shaped in a ring. At 3 DAH, the melanophore was ob- after 15 h, which is termed organogenesis. When hatched, served, in each specimen, in the dorsal fin fold and abdom- the melanophore is already developed around the oil drop inal cavity. At 5 DAH, the melanophore was observed at and covers the body’s entire skin surface. In starry flounder the lateral line in larvae. At 20 DAH, larvae coloration (Platichthys stellatus), before larval melanophore develop- started to develop when the expression of the melanophore ment in the eyes, the melanophore has already begun to was at the end of lateral line. At 40 DAH, the melanophore develop in the primordial fin and tail (Yamashita et al. started to color the whole body and tail fin. The body color 2014). After melanophore development has been com- development of red spotted grouper larvae showed a simi- pleted in the eyes, the melanophore begins to develop lar development pattern as the brown-marble grouper throughout the body from the primordial fin fold and body (Epinephelus fuscoguttatus), which is in the same family center. Based on these contrasting results, melanophore (Kohno et al. 1993). The color development of brown- development patterns are likely to be species-specific. marble grouper larvae also starts with observation of mela- We investigated melanin-related gene expression in red nophores in the eyes, after which it develops chromo- spotted grouper according to different light intensities. At phores throughout the abdominal cavity, dorsal fin spine, 6 weeks, MCH mRNA tended to increase its expression and caudal parts. The melanophore starts to condense at levels with an increase in light intensity. However, the the dorsal fin spine and caudal parts, and the body color expressions of POMC mRNA and MC1R mRNA were develops through the head, tail, dorsal fin spine, and whole highest at 0 lx and lowest at 1000 lx. At the end of the ex- body. However, some studies have reported melanophore periment, the expression of MC1R mRNA was at its high- development stages that differ from our results. In rock est at 0 lx and its lowest at 1000 lx. In case of MC1R porgy (Oplegnathus punctatus), the melanophore can be mRNA expression, it was significantly higher in dark observed before hatching (Park et al. 2015). The rock conditions in the 3 weeks and 9 weeks, and there was no porgy’s melanophore pigments move back to the head and significant difference in the 6 weeks, but in the dark condi- surround the myotome throughout the tail at fertilization tions, MC1R mRNA expression tended to be high. Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 7 of 9 Fig. 4 Expression changes of melanin-related genes in the red spotted grouper brain, pituitary, and skin under different light intensity conditions by real-time qPCR. MCH (a), POMC (b), MC1R (c), and ASIP (d). The different letters indicate statistical difference at P <0.05. Values are mean ±SEM However, the expression of ASIP mRNA was at its highest the background color change. Mizusawa was suggested that during the initial period of the experiment but maintained MC5R might be a major factor reinforcing the function of a low level of expression afterwards. In terms of body MSH in morphological color change. ASIP mRNA has high color (RGB cord value), the darkest color value was ob- expression in the ventral skin butnoexpressioninthe dor- served in the 0 lx group, and bright color value was ob- sal skin. Therefore, MC1R, MC5R, MCH, and MSH were served in the 200 lx, 2000 lx, and the 1000 lx groups. associated with background color adaptation and ASIP A lot of research studies have reported that MCH is mRNA might be not. closely involved with background color (Yamanome et al. Many studies have aimed to determine the effects of 2005; Chung et al. 2018; Diniz and Bittencourt 2019; Kasagi light intensity on survival rate, growth, swimming, feeding, et al. 2020). To observe morphological color changes in coloration, and various other physiological phenomena goldfish, fish was reared under different background color (Batty et al. 1990; Boeuf and Le Bail 1999; Reichard et al. conditions and the expression of M1CR, MC5R, MSH, 2002;Richmond et al. 2004; Luchiari et al. 2006; Liu et al. MCH, and ASIP mRNAs was checked (Mizusawa et al. 2012; Lee et al. 2017). Light can induce melanogenesis 2018). In the white-reared fish, MCH mRNA expression and increase the synthesis of the melanophore, which can was higher than that in black-reared fish, and POMC make the body coloration darker (Odiorne 1957). When mRNA expression was lower than that in the black-reared the Australian snapper (Pagrus auratus) was reared under fish. In the xanthophores in the scale, MC1R did not always different degree of shading conditions (0%, 50%, and 95% follow the background color change, but MC5R followed shading form incident radiation), the group under the 0% degree of shading conditions showed darker body color- ation than the other groups (Booth et al. 2004). In Table 2 RGB code value extracted form red spotted grouper addition, the body color of Chinese longsnout catfish skin. 0 lux (A) 200 lux (B) 1000 lux (C) and 2000 lux (D) (Leiocassis longirostris) tends to be dark under a strong 0 lux 200 lux 1000 lux 2000 lux light intensity, and their survival rate tends to drop under RGB (Red, Greed, Blue) 86, 71, 58 88, 71, 59 137, 116, 99 105, 92, 81 extremely strong light intensity conditions (Han et al. Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 8 of 9 2005). This study indicates that the light intensity affects Acknowledgements This work was supported by the Korea Institute of Planning and Evaluation for melanin synthesis. In these experiments, we conclude that Technology in Food, Agriculture, Forestry (IPET) through Golden Seed Project, funded the light sources such as sun or ultraviolet rays stimulate by Ministry of Oceans and Fisheries (MOF) (grant number 213008-05-4-SB510). the skin and lead to melanin synthesis for skin protection. And by that result, the body colors became more dark. Authors’ contributions SH designed and carried out the data analysis and manuscript writing. BH Research on body color change in red porgy (Pagrus and CH participated in the fish sampling and data analysis. YD participated pagrus) as a result of changes in light intensity has shown in its design and coordination and helped to draft the manuscript. All that red porgy tends to have bright body coloration beside authors read and approved the final manuscript. a white background with a high intensity of light (Pavlidis Funding et al. 2008). After observing body color change in ocellaris This work was supported by the Korea Institute of Planning and Evaluation clownfish (Amphiprion ocellaris)under 20–50, 600–850, for Technology in Food, Agriculture, Forestry (IPET) through Golden Seed and 2700–3500 lx conditions, specimens were found to Project, funded by Ministry of Oceans and Fisheries (MOF) (grant number 213008-05-4-SB510). have a bright color on their back and tail fins under low intensity light (Yasir and Qin 2009). These results indicate Availability of data and materials that the body color has adapted to the environment condi- Not applicable. tion, affected by the amount of light. These researches suggest that light intensity can affect body color. Compar- Ethics approval and consent to participate All experiments were conducted in compliance with both the Animal Care ing our research results, the bright light intensity is and Use Committee guidelines of the Jeju National University. thought to brighten up the body color because of the mel- anin concentrated due to increased expression of MCH Consent for publication mRNA, and melanin synthesis decreased due to reduced Not applicable. expression of POMC and MC1R mRNA. In our study on the melanin-related genes of the red Competing interests The authors declare that they have no competing interests. spotted grouper, POMC mRNA, MC1R mRNA, and MCH mRNA showed different gene expression patterns Author details under different light intensity conditions. The expression Marine Science Institute, Jeju National University, Jeju 695-965, Republic of Korea. CR Co., Ltd, Jeju 63333, South Korea. of ASIP mRNA was not affected by light intensity. It is thought that under controlled light intensity conditions, Received: 23 March 2020 Accepted: 27 October 2020 the expression of POMC mRNA and MC1R mRNA in- duces melanin synthesis. The concentration of MCH References mRNA was affected by light conditions. The low expres- Adachi K, Kato K, Wakamatsu K, Ito S, Ishimaru K, Hirata T, Osamu M, Kumai H. sion of ASIP mRNA is most likely due to the develop- The histological analysis, colorimetric evaluation, and chemical quantification ment of iridophores in the abdominal cavity as the of melanin content in ‘suntanned’fish. Pigment Cell Res. 2005;18:465–8. Amiya N, Amano M, Iigo M, Yamanome T, Takahashi A, Yamamori K. Interaction larvae grew. of orexin/hypocretin-like immunoreactive neurons with melanin- concentrating hormone and α-melanocyte-stimulating hormone neurons in brain of a pleuronectiform fish, barfin flounder. Fisheries Sci. 2008;74:1040–6. Conclusion Appelbaum S, Kamler E. Survival, growth, metabolism and behaviour of Clarias The aim of this study is the change in the body color and gariepinus (Burchell 1822) early stages under different light conditions. Aquacult Eng. 2000;22:269–87. melanin-related gene expression of red spotted grouper by Baker B, Levy A, Hall L, Lightman S. Cloning and expression of melanin- light intensity. Our results suggested that when light inten- concentrating hormone genes in the rainbow trout brain. sity goes stronger, MCH mRNA expressed higher, and Neuroendocrinology. 1995;61:67–76. Batty RS, Blaxter JHS, Richard JM. Light intensity and the feeding behavior of POMC and MC1R mRNAs expressed lower. However, herring, Clupea harengus. Mar Biol. 1990;107:383–8. ASIP mRNA expression did not changed. With these re- Boeuf G, Le Bail PY. Does light have an influence on fish growth? Aquaculture. sults, we suggest that MCH, POMC, and MC1R mRNAs 1999;177:129–52. Booth MA, Warner-Smith RJ, Allan GL, Glencross BD. Effects of dietary astaxanthin are affected by light intensity. Further research is needed to source and light manipulation on the skin colour of Australian snapper understand the relationship between melanin composition Pagrus auratus (Bloch & Schneider, 1801). Aquac Res. 2004;35:458–64. and gene expression in relation to the external environment Borski RJ, Hodson RG. Fish research and the institutional animal care and use committee. Ilar J. 2003;44:286–94. and body color change. Our study contributes valuable Cal L, Gómez-Marín C, Gómez-Skarmeta JL, Cerdá-Reverter JM, Kelsh RN, Rotllant baseline data that advances our knowledge of body color J. A Bac transgenic analysis of the asip1 locus reveals developmental stimulation under environmental conditions in the red mechanisms of dorso-ventral pigmentation in fish. In: The International Symposium on Genetics in Aquaculture XII. James HT, Shawn DC and Leigh spotted grouper. AB, eds. Santiago de Compostela, Spain. 2015; 122. Cal L, Suarez-Bregua P, Cerdá-Reverter JM, Braasch I, Rotllant J. Fish pigmentation Abbreviations and the melanocortin system. Comp Biochem Phys A. 2017;211:26–33. POMC: Pro-opiomelanocortin; MC1R: Melanocortin 1 receptor; ASIP: Agouti- Cerdá-Reverter JM, Agulleiro MJ, Guillot R, Sánchez E, Ceinos R, Rotllant J. Fish signaling protein; MCH: Melanin-concentrating hormone melanocortin system. Eur J Pharmacol. 2011;660:53–60. Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 9 of 9 Cerdá-Reverter JM, Haitina T, Schiöth HB, Peter RE. Gene structure of the goldfish Matsuda K. Recent advances in the regulation of feeding behavior by agouti-signaling protein: a putative role in the dorsal-ventral pigment pattern neuropeptides in fish. Ann Ny Acad Sci. 2009;1163:241–50. of fish. Endocrinology. 2005;146:1597–610. Mizusawa K, Yamamura Y, Kasagi S, Cerdá-Reverter JM, Takahashi A. Expression of Chauvet C. Etude de la croissance du mérou Epinephelus guaza (Linné, 1758) des genes for melanotropic peptides and their receptors for morphological color côtes tunisiennes. Aquat Living Resour. 1988;1:277–88. change in goldfish Carassius auratus. Gen Comp Endocr. 2018;264:138–50. Odiorne JM. Color changes. In: Brown ME, editor. The physiology of fishes, vol. 2. Cho HC, Kim JE, Kim HB, Baek HJ. Effects of water temperature change on the New York: Academic press; 1957. p. 387–401. hematological responses and plasma cortisol levels in growing of red Paripatananont T, Tangtrongpairoj J, Sailasuta A, Chansue N. Effect of astaxanthin spotted grouper, Epinephelus akaara. Dev Reprod. 2015;19:19–24. on the pigmentation of goldfish Carassius auratus. J World Aquacult Soc. Chung IY, Jeon JM, Song YH. Characterization of melanin-concentrating hormone 1999;30:454–60. from olive flounder (Paralichthys olivaceus). J. Life Sci. 2018;28:284–92. Park JM, Lee SH, Yun SM, Na HC, Han KH. Egg development and morphology of Cone RD. Studies on the physiological functions of the melanocortin system. larvae and juveniles of spotted knifejaw, Oplegnathus punctatus. Korean J Endocr Rev. 2006;27:736–49. Ichthyol. 2015;27:71–7. Costin GE, Hearing VJ. Human skin pigmentation: melanocytes modulate skin Pavlidis M, Karkana M, Fanouraki E, Papandroulakis N. Environmental control of color in response to stress. Faseb J. 2007;21:976–94. skin colour in the red porgy, Pagrus pagrus. Aquac Res. 2008;39:837–49. Diniz GB, Bittencourt JC. The melanin-concentrating hormone (MCH) system: a Petrell RJ, Ang KP. Effects of pellet contrast and light intensity on salmonid tale of two peptides. Front Neurosci-Switz. 2019;13:1280. feeding behaviours. Aquacult Eng. 2001;25:175–86. Ducrest AL, Keller L, Roulin A. Pleiotropy in the melanocortin system, coloration Reichard M, Jurajda P, Ondračková M. The effect of light intensity on the drift of and behavioural syndromes. Trends Ecol Evol. 2008;23:502–10. young-of-the-year cyprinid fishes. J Fish Biol. 2002;61:1063–6. Duncan DB. Multiple range and multiple F tests. Biometrics. 1955;11:1–42. Richmond HE, Hrabik TR, Mensinger AF. Light intensity, prey detection and foraging Fujii R. Coloration and chromatophores. In: Evans DH, editor. The physiology of mechanisms of age 0 year yellow perch. J Fish Biol. 2004;65:195–205. fishes. Boca Raton: CRC Press; 1993. p. 535–62. Rimmer MA, Glamuzina B. A review of grouper (Family Serranidae : Subfamily Fujii R. The regulation of motile activity in fish chromatophores. Pigm Cell Res. Epinephelinae) aquaculture from a sustainability science perspective. Rev 2000;13:300–19. Aquacult. 2019;11:58–87. Fujimoto M, Arimoto T, Morishita F, Naitoh T. The background adaptation of the Seiji M, Shimao K, Birbeck MSC, Fitzpatrick TB. Subcellular localization of melanin flatfish, Paralichthys olivaceus. Physiol Behav. 1991;50:185–8. biosynthesis. Ann Ny Acad Sci. 1963;100:497–533. Han D, Xie S, Lei W, Zhu X, Yang Y. Effect of light intensity on growth, survival Sköld HN, Aspengren S, Wallin M. Rapid color change in fish and amphibians– and skin color of juvenile Chinese longsnout catfish (Leiocassis longirostris function, regulation, and emerging applications. Pigm Cell Melanoma R. Günther). Aquaculture. 2005;248:299–306. 2013;26:29–38. Hanlon R. Cephalopod dynamic camouflage. Curr Biol. 2007;17:400–4. Song YB, Oh SR, Seo JP, Ji BG, Lim BS, Lee YD, Kim HB. Larval development and Hur SW, Lee CH, Lee SH, Kim BH, Kim HB, Baek HJ, Lee YD. Characterization of rearing of longtooth grouper Epinephelus bruneus in Jeju Island, Korea. J cholecystokinin-producing cells and mucus-secreting goblet cells in the World Aquacult Soc. 2005;36:209–16. blacktip grouper, Epinephelus fasciatus. Tissue Cell. 2013;45:153–7. Sulaimon SS, Kitchell BE. The biology of melanocytes. Vet Dermatol. 2003;14:57–65. Ju SH, Cho GB, Sohn JW. Understanding melanocortin-4 receptor control of neuronal Suzuki H. Evolutionary and phylogeographic views on Mc1r and Asip variation in circuits: toward novel therapeutics for obesity syndrome. Pharmacol Res. 2018;129:10–9. mammals. Genes Genet Syst. 2013;88:155–64. Kalinowski CT, Robaina LE, Fernandez-Palacios H, Schuchardt D, Izquierdo MS. Suzuki I, Im S, Tada A, Barsh G, Hearing V, Scott C, Akcali C, Davis MB, Abdel- Effect of different carotenoid sources and their dietary levels on red porgy Malek Z. Participation of the melanocortin-1 receptor in the UV control of (Pagrus pagrus) growth and skin colour. Aquaculture. 2005;244:223–31. pigmentation. In: J Invest Derm Sym P. 1994;4:29–34. Kasagi S, Mizusawa K, Takahashi A. The effects of chromatic lights on body color and Takahashi A, Tsuchiya K, Yamanome T, Amano M, Yasuda A, Yamamori K, gene expressions of melanin-concentrating hormone and proopiomelanocortin Kawauchi H. Possible involvement of melanin-concentrating hormone in in goldfish (Carassius auratus). Gen Comp Endocr. 2020;285:113266. food intake in a teleost fish, barfin flounder. Peptides. 2004;25:1613–22. Kim SH, Lee CH, Song YB, Hur SW, Kim HB, Lee YD. Ultrastructure of late Wang YJ, Chien YH, Pan CH. Effects of dietary supplementation of carotenoids on spermatids and spermatozoa during spermiogenesis in longtooth grouper survival, growth, pigmentation, and antioxidant capacity of characins, Epinephelus bruneus from Jeju, Korea. Tissue Cell. 2013;45:261–8. Hyphessobrycon callistus. Aquaculture. 2006;261:641–8. Kittilsen S, Schjolden J, Beitnes-Johansen I, Shaw JC, Pottinger TG, Sørensen C, Yamanome T, Amano M, Takahashi A. White background reduces the occurrence Braastad BO, Bakken M, Øverli Ø. Melanin-based skin spots reflect stress of staining, activates melanin-concentrating hormone and promotes somatic responsiveness in salmonid fish. Horm Behav. 2009;56:292–8. growth in barfin flounder. Aquaculture. 2005;244:323–9. Klein M. 2018. Get average color of image. Retrieved from https://matkl.github.io/ Yamashita YT, Aritaki M, Kurita Y, Tanaka M. Early growth and development of average-color/ on Jun 20. reciprocal hybrids of the starry flounder Platichthys stellatus and stone Kobayashi T, Urabe K, Winder A, Jiménez-Cervantes C, Imokawa G, Brewington T, flounder Kareius bicoloratus. J Fish Biol. 2014;84:1503–18. Solano F, García-Borrón JC, Hearing VJ. Tyrosinase related protein 1 (TRP1) Yasir I, Qin JG. Effect of light intensity on color performance of false clownfish, functions as a DHICA oxidase in melanin biosynthesis. Embo J. 1994;13:5818–25. Amphiprion ocellaris Cuvier. J World Aquacult Soc. 2009;40:337–50. Kohno H, Diani S, Supriatna A. Morphological development of larval and juvenile grouper, Epinephelus fuscoguttatus. Jpn J Ichthyol. 1993;40:307–16. Publisher’sNote Kondo T, Hearing VJ. Update on the regulation of mammalian melanocyte Springer Nature remains neutral with regard to jurisdictional claims in function and skin pigmentation. Expert Rev Dermatol. 2011;6:97–108. published maps and institutional affiliations. Korner A, Pawelek J. Mammalian tyrosinase catalyzes three reactions in the biosynthesis of melanin. Science. 1982;217:1163–5. Lee CH, Hur SW, Kim BH, Soyano K, Lee YD. Induced maturation and fertilized egg production of the red-spotted grouper, Epinephelus akaara, using adaptive physiology of photoperiod and water temperature. Aquac Res. 2020;00:1–7. Lee CH, Hur SW, Na OS, Baek HJ, Noh CH, Han SH, Lee YD. Induction of primary male in juvenile red spotted grouper Epinephelus akaara by immersion of 17α-methyltestosterone. Dev Reprod. 2014;18:127. Lee JS, Britt LL, Cook MA, Wade TH, Berejikian BA, Goetz FW. Effect of light intensity and feed density on feeding behaviour, growth and survival of larval sablefish Anoplopoma fimbria. Aquac Res. 2017;48:4438–48. Liu Y, Mou Z, Xu G, Li Y, Wang C. The effect of light intensity on the growth of Brachymystax lenok (Pallas, 1773). Aquac Res. 2012;43:1838–44. Luchiari AC, De Morais-Freire FA, Koskela J, Pirhonen J. Light intensity preference of juvenile pikeperch Sander lucioperca (L.). Aquac Res. 2006;37:1572–7. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Fisheries and Aquatic Sciences Springer Journals

Response of body color change rearing under different light intensity conditions in farmed red spotted grouper, Epinephelus akaara

Loading next page...
 
/lp/springer-journals/response-of-body-color-change-rearing-under-different-light-intensity-10KLfYQXru
Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2020
eISSN
2234-1757
DOI
10.1186/s41240-020-00173-8
Publisher site
See Article on Publisher Site

Abstract

Background: Fish body color is one of the major factors that determine the commercial value of farmed fish, to understand for coloration mechanisms. The expression of melanin-related genes is according to the developmental stage and light intensity in the red spotted grouper, Epinephelus akaara. Methods: To investigate changes in melanin formation and melanin-related genes in the larval development stage, fish larvae were reared from fertilized egg stage to 50 days after hatching (DAH). Experiment of body color changes was performed under each different light intensity conditions. Melanin-related genes expression was analyzed by real-time qPCR, and body coloration difference was represented by RGB (red, green, blue) code value. Results: Expression levels of melanin-concentrating hormone (MCH) mRNA, pro-opiomelanocortin (POMC) mRNA, and melanocortin 1 receptor (MC1R) mRNA were at their highest 5 DAH (days after hatching). Expression levels of agouti- signaling protein (ASIP) mRNA were at their highest 10 DAH. Results of body color changes according to changes in light intensity conditions showed that the expression level of MCH mRNA in the 2000 lx group was the highest at 6 weeks. The expression levels of POMC mRNA and MC1R mRNA in the 1000 lx group were at their lowest at 9 weeks. RGB color code value under different light intensities were the brightest under 1000 lx and the darkest under 0 lx. Conclusion: Our research suggests that POMC mRNA and MC1R mRNA in the red spotted grouper are involved in melanin synthesis, and these genes are thought to be controlled by light intensity. To better understand the molecular mechanism of coloration in the red spotted grouper, further studies are needed to clarify the relationship between melanophore development and melanin-related genes. Keywords: Body coloration, Melanin-concentrating hormone (MCH), Pro-opiomelanocortin (POMC), Melanocortin 1 receptor (MC1R), Agouti-signaling protein (ASIP), Red spotted grouper Introduction receptors. Oxidation of tyrosine is increased in melano- Melanin is one of the major decision factors about hair and somes and the resulting tyrosinase induces melanin synthe- body color in vertebrate including human (Fujii 2000). It is sis in the melanosomes (Seiji et al. 1963; Korner and synthesized in the melanosomes of melanocytes and affects Pawelek 1982; Kobayashi et al. 1994). Melanin transports skin and body color. Melanin cells receive external signals, through the dendrites of melanin cells to the skin’skeratino- such as from hormones and ultraviolet rays, that vitalize cyte layer. Melanin protects skin tissues from cell deform- ation and destruction by UV rays (Sulaimon and Kitchell * Correspondence: leemri@jejunu.ac.kr 2003;Costinand Hearing 2007; Kondo and Hearing 2011). Marine Science Institute, Jeju National University, Jeju 695-965, Republic of In marine animals, melanin has a protective function Korea Full list of author information is available at the end of the article against ultraviolet rays, in that it protects cells against © The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 2 of 9 damage and stress (Adachi et al. 2005;Suzuki et al. 1994). akaara. Therefore, in order to improve the commercial The olive flounder (Paralichthys olivaceus) and octopus value of farmed red spotted grouper, research on grouper (Octopus vulgaris) have the ability to change skin color coloration is required. The coloration of fish provides eco- and camouflage themselves in response to predators and logical and physiological information and is a decisive fac- stress (Fujimoto et al. 1991;Fujii 1993;Hanlon 2007). tor in their production value (Paripatananont et al. 1999; Melanin in fish has numerous functions including, among Kalinowski et al. 2005;Wang etal. 2006). In our study, we others, skin protection, pigmentation, immunity, and aimed to understand whether rearing red spotted grouper stress responses (Amiya et al. 2008; Kittilsen et al. 2009; under different light intensity conditions affected their Sköld et al. 2013; Cal et al. 2017). body color. In order to achieve this, we reared fish under Pro-opiomelanocortin (POMC) is usually expressed in different light intensity conditions and searched for the the pituitary gland and functions like many peptide pre- presence of melanin-related gene expression and changes cursors, including alpha-melanocyte-stimulating hormone in body color brightness. (α-MSH), adrenocorticotropic hormone (ACTH), and β- endorphin (β-END). Melanocortin has five receptors from Materials and methods melanocortin 1 receptor (MC1R) to melanocortin 5 recep- Fish tor (Cone 2006; Ducrest et al. 2008;Cerdá-Reverter et al. The fish, the artificially produced red spotted grouper was 2011;Juet al. 2018). MC1R is involved in melanin synthe- provided by the CR co. ltd (Republic of Korea) and moved sis and body color. MC2R is the receptor of ACTH and is to the Marine Science Institute, Jeju National University involved in immune function. MC3R is involved in appe- (Republic of Korea). Before the experiment, fish was accli- tite and homeostasis. MC4R is involved in obesity and pri- matized under natural photoperiod and water temperature apism, and MC5R is involved in immune regulation, conditions and fed to satiation the commercial pellets separation of red blood cells, and the maintenance of (Daebong lf fishery association Co., Jeju, South Korea) homeostasis. α-MSH stimulates the synthesis of melanin twice a day (09:00 and 17:00) for a week. All experiments from melanocytes by revitalizing MC1R. This process were performed in compliance with the Animal Care and darkens skin. The agouti-signaling protein (ASIP) prevents Use Committee guidelines of laboratory animals in the Re- melanin pigmentation on the ventral side of fish by inhi- public of Korea (Borski and Hodson 2003). biting α-MSH synthesis which leads to the deactivation of MC1R (Cal et al. 2015). Melanin-concentrating hormone (MCH), which is secreted by the brain, changes body color Experimental design radically by controlling the cohesion and dispersion of For analysis of tissue specific expression of melanin-related melanin in the chromophore (Baker et al. 1995). It per- genes, adult red spotted groupers (n = 3, total length 245.3 forms various other functions related to appetite and im- ± 9.7 cm, body weight 25.0 ± 0.5 g) were taken from the munity (Takahashi et al. 2004; Matsuda 2009). aquarium tank and anesthetized with 0.01% 2- According to the Food and Agriculture Organization of phenoxyethanol (Junsei Chemical Co., Tokyo, Japan) before the United Nations (FAO), the global production of grouper sampling. After anesthetization, all tissues were extracted in aquaculture was 155,000 tons in 2015. The major produ- and divided into central nervous tissues (telencephalon, tec- cing countries are China, Taiwan Province of China (PoC), tum, cerebellum, hypothalamus, medulla oblongata, and pi- and Indonesia. These countries contribute 92% of the total tuitary gland) and peripheral tissues (retina, tongue, heart, production of grouper (Rimmer and Glamuzina 2019). Nu- kidney, stomach, intestine, liver, gonad, fin, skin, and merous grouper species studies have been performed on lar- muscle). Extracted tissues were immediately frozen using li- val development stages as well as the growth and quid nitrogen and stored at − 80 °C until analysis by real- reproductive characteristics (Chauvet 1988;Song et al. 2005; time qPCR could be completed. Kim et al. 2013; Lee et al. 2014; Lee et al. 2020). To investigate changes in melanin formation and Serranidae have high industrial value in the domestic melanin-related genes in the larval development stage, fer- aquaculture industry, and some studies (growth (Cho tilized eggs were obtained from mature females and males. et al. 2015), maturity (Lee et al. 2020), development (Song The fertilized eggs were transferred to individual tanks and et al. 2005), digestive physiology (Hur et al. 2013), etc.) are allowed to hatch. Fish larvae were reared under natural being performed for the development of aquaculture tech- photoperiod and natural water temperature conditions nology. However, research on Serranidae was still rare. (24.0 ± 0.5 °C). After hatching, fish larvae were sampled at The body color of farmed fish tends to decline in quality 0, 1, 2, 3, 5, 7, 10, 14, 20, 25, 30, 35, 40, 45, and 50 days compared to wild fish (Booth et al. 2004). This is problem- after hatching (DAH). Samples were divided for genetic atic because it reduces the commercial value of farmed analysis and microscopic observations. Melanin distribu- fish. This problem also applies to many farmed grouper tion was observed using an optical microscope (BX43, species, including the red spotted grouper Epinephelus Olympus Corporation, Tokyo, Japan). For real-time qPCR Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 3 of 9 analysis, collected samples were immediately frozen in li- Table 1 Primer sets used in real time-quantitative PCR quid nitrogen and stored at − 80 °C. Primer information In order to investigate changes in melanin-related genes’ Primer Sequence (5’-3’) expression according to light intensity, we performed a MCH Forward CTGTTGTCGTCAGCTCTCCG fish rearing experiment under different light conditions. MCH Reverse GGGATGCAGATCTACCCACTG Sixty DAH (n = 200, total length 3.2 ± 0.2 cm, body weight POMC Forward GAACATCCGAGCTGTCAGGA 0.34 ± 0.1 g) larvae were reared. Fifty fish were randomly POMC Reverse CATGGAGTAGGAGCGCTTGG selected and divided from each aquarium tanks (90 L) and kept for 5 days under natural water temperatures and MC1R Forward GTTGGCCATCTTCAAGAACCG photoperiod conditions before the start of the experiment. MC1R Reverse TCACGTCGATGACGTTGTCC Four light intensity conditions (0 lx, 200 lx, 1000 lx, and ASIP Forward GGCCCACCTCCTGTTGTTATT 2000 lx) were regulated using a photometer, and light ASIP Reverse GACAGTTCTGAAGAGCCGACA source used was LED lights. All experimental groups were β-actin Forward GAGGGGTATCCTGACCCTGA reared under a 12 h light to 12 h dark (12 L:12D) photo- β-actin Reverse CTCCTCAGGGGCAACTCTC period using a timer under natural water temperature conditions (24.6 ± 0.4 °C) for 9 weeks. The fish was fed commercial pellets (Daehan co., MP3, Busan, South RGB color code Korea) twice a day during the experiment. Sampling was The RGB color code for the body color change in fish by performed at 3-week intervals, a total of three times, on light intensity was analyzed by obtaining the average five fish from each tank. The fish was anesthetized using color of an image. A color code was extracted from each 0.01% 2-phenoxyethanol, their weight was measured, and image (of equal area) using a free online program Get the entire length of skin and whole brain were extracted, average color of image by Matthias Klein (Klein 2018). including the pituitary gland. To analyze the body color difference between all experiments, the fish was photo- Statistical analysis graphed using a camera (F90X, Nikon, Tokyo, Japan). The experimental results were analyzed with a one-way Following sampling, samples were immediately frozen in analysis of variance (ANOVA) using SPSS version 21 liquid nitrogen and stored at − 80 °C until the real-time (SPSS Inc.) and tested using Duncan’s multiple range qPCR analyses could be performed. test (Duncan 1955) to confirm significance. Values are shown as means ± standard deviations. Statistical signifi- cance was determined at a 95% level (P < 0.05). cDNA synthesis and real-time qPCR For total RNA extraction, a RiboEx™ (GeneAll Biotechnol- Results ogy, Seoul, Korea) solution was added to the brain, pituit- Tissue-specific expression of melanin-related genes ary gland, and skin tissue samples and homogenized using We aimed to detect expression of MCH, POMC, MC1R, a homogenizer. Total RNA was extracted according to the and ASIP mRNAs in the red spotted grouper’s central ner- manufacturer’s protocol and treated using diethyl vous and peripheral tissues. MCH mRNA expression was pyrocarbonate-processed H O(DEPC H O) to cleanse significantly higher than the other tissues in the dienceph- 2 2 and dissolve the total RNA pellet. Total RNA was mea- alon (P < 0.05) (Fig. 1a). POMC mRNA expression was sig- sured using Nano Vue (GE Healthcare, Buckinghamshire, nificantly higher than the other tissues in the pituitary gland UK) for cDNA synthesis. In the experiment, total RNA (P <0.05) (Fig. 1b). MC1R mRNA showed significantly high was synthesized using the RQ1 RNase-Free DNase Kit expression, especially in pelvic fin tissues (P < 0.05) (Fig. (Promega, Madison, WI, USA). The PrimeScript™ 1st 1c). The expression of ASIP mRNA was significantly higher strand cDNA synthesis Kit (Takara Bio Inc., Otsu, Japan) in thetongueand ventralskin(P <0.05) (Fig. 1d). was used for cDNA processing. To produce a species- specific primer for real time-qPCR, partially sequenced Developmental stages: melanin formation and melanin- melanin-related genes were used (Table 1). Real-time related genes changes qPCR was performed with 0.2 μL of cDNA using an Eva- We investigated melanophore formation changes accord- green premix PCR kit (ABM, Richmond, BC, Canada). ing to development stage in red spotted grouper larvae. At Real time-qPCR was performed with an initial denatur- 0 DAH, melanophores were not observed (Fig. 2a). At 1 ation at 95 °C for 10 min after a reaction at 95 °C for 15 s DAH, a melanin line was observed outside each retina and 60 °C for 1 min using a CFX96™ real-time system (Fig. 2b). At 2 DAH, melanin had begun to spread from (Bio-Rad Laboratories, Hercules, CA, USA). Expression of the melanin line outside each retina (Fig. 2c). At 3 DAH, genes in each experiment was normalized to amount of the whole retina of each larva was covered by melano- the internal control β-actin gene. phores and more melanophores had begun to develop at Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 4 of 9 Fig. 1 Tissue specific expression of melanin-related genes in the red spotted grouper by real-time qPCR. Of, olfactory lob; Te, telencephalon; Op, optic tectum; Di, diencephalon; Ce, cerebellum; Me, medulla oblongata; Pt, pituitary; Re, retina; To, tongue; Gi, gill; He, heart; Ki, kidney; Sp, spleen; St, stomach; In, intestine; Li, liver; Go, gonad; SkD, skin dorsal; SkM, skin middle; SkV, skin ventral; FinP, pelvic fin; FinC, caudal fin; Mu, muscle. Asterisks represent highest statistical difference at P < 0.05. Values are mean ± SEM the primordial fin fold and abdominal cavity of each larva high levels at 5 DAH (P < 0.05), then decreased rad- (Fig. 2d). At 5 DAH, melanophores in the abdominal cav- ically thereafter (Fig. 3a). Expression of POMC mRNA ity were spread out to the vertebra of each larva (Fig. 2e). increased at 3 DAH, was at its significantly high At 10 DAH, the distribution range of the vertebral mela- levels at 5 DAH (P < 0.05), and then decreased until nophores had widened in each larva (Fig. 2f). At 14 DAH, 14 DAH where it remained at low levels of expression the abdominal cavity of each larva was completely covered (Fig. 3b). Expression of MC1R mRNA was signifi- by melanophores (Fig. 2g). At 20 DAH, melanophores cantly high until 5 DAH (P < 0.05), then it decreased were observed in the caudal fin of each larva (Fig. 2h). At until 25 DAH where it remained at low levels there- 25 DAH, melanophores were distributed at the edges of after (Fig. 3c). The expression of ASIP mRNA started the dorsal fins, and an increase in melanophores was ob- by increasing slowly until 10 DAH and significantly served at the caudal fins in each larva (Fig. 2i). At 30 high levels at 10 DAH and 20 DAH (P < 0.05). Then, DAH, melanophores from the caudal fin began to develop it decreased steadily until 50 DAH (Fig. 3d). round to the center and sides of each body (Fig. 2j). At 40 DAH melanophores had developed at the dorsal fin and at Changes in melanin-related genes expression according the edge of dorsal and lateral lines of each larva (Fig. 2k). to light intensity At 50 DAH, melanophores were observed at the dorsal fin At 6 weeks, the expression of MCH mRNA was at its and over the whole body (Fig. 2l). highest level at 2000 lx and its lowest level at 0 lx (P < Expression changes of MCH, POMC, MC1R, and 0.05). However, at 9 weeks, there was no significant dif- ASIP mRNAs according to development stage were ference between the experimental groups (Fig. 4a). At 6 observed in red spotted grouper. MCH mRNA ex- weeks, the expression of POMC mRNA was highest at pression increased at 3 DAH, was at its significantly 200 lx, and at 9 weeks, the highest level was confirmed Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 5 of 9 Fig. 2 Development stage of pigmentation in the red spotted grouper. 0 DAH (a), 1 DAH (b), 2 DAH (c), 3 DAH (d), 5 DAH (e), 10 DAH (f), 14 DAH (g), 20 DAH (h), 25 DAH (i), 30 DAH (j), 40 DAH (k), 50 DAH (l). DAH, days after hatching; arrows indicate melanin at 0 lx. The lowest level of POMC mRNA was confirmed development in red spotted grouper larvae showed that the at 1000 lx (P < 0.05) (Fig. 4b). Expression of MC1R expression of MCH, POMC, and MC1R mRNAs began to mRNA was at its highest level at 200 lx, and at 3 weeks, increase at 3 DAH, with the highest levels observed at 5 it was at its lowest at 2000 lx (P < 0.05). However, at 6 DAH. During this period, melanophores completely cov- weeks, there was no significant difference in the expres- ered the body and started to form dorsal fin fold and ab- sion of MC1R mRNA between the experimental groups. dominal cavities. These results are considered to reflect the At 9 weeks, the highest level was observed at 0 lx, and activation of melanin-related genes’ expression from 3 the lowest level was observed at 1000 lx (Fig. 4c). The DAH to 5 DAH, which leads to melanin synthesis in the expression of ASIP mRNA was at its highest level imme- red spotted grouper. ASIP mRNA was highly expressed 7 diately after the beginning of the experiment. It then to 25 DAH, and during this period, the abdominal cavity maintained a low level of expression and showed no sig- was covered with melanophores and the outer part of the nificant difference between the experimental groups (Fig abdominal cavity was surrounded by iridophores. 4d). When we measured the RGB color value of the red The ASIP gene prevents the division and increase of spotted grouper’s skin, the 0 lx group returned values of melanin cells and makes skin color brighter (Suzuki 86, 71, and 58 as their darkest colors. The RGB values 2013). From experimental results on goldfish (Carassius from the 200 lx group were 88, 71, and 59 and from the auratus) (Cerdá-Reverter et al. 2005), ASIP mRNA was 1000 lx group were 137, 116, and 99, in which 1000 lx found to have a genetic homogeny of mammal ASIP was the brightest colors. The RGB values of the 2000 lx mRNA, along with mice, and it plays an important role group were 105, 92, and 81 (Table 2). in forming the ventral color pattern. In goldfish, ASIP mRNA is mainly expressed in ventral skin and has not Discussion been detected in dorsal skin. These results suggest that Recently, photobiology studies on fish have been conducted ASIP mRNA is mainly involved in differentiation to iri- on various adaptive physiological characteristics, including dophores in ventral skin. Therefore, the increased ASIP body color, growth, and metabolism (Appelbaum and Kam- mRNA expression in red spotted grouper larvae at 7 ler 2000;Petrell andAng 2001). This study investigated the DAH, that we observed, may stimulate the development adaptive physiology of red spotted grouper’s melanin- of iridophores outside the abdominal cavity. related genes with respect to light intensity. According to Melanophores in red spotted grouper larvae specimens our results, the expression of genes related to melanin were observed at 1 DAH formed outside the iris and Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 6 of 9 Fig. 3 Expression of development stage of melanin-related genes in the red spotted grouper by real-time qPCR. MCH (a), POMC (b), MC1R (c), and ASIP (d). Asterisks represent highest statistical difference at P < 0.05. Values are mean ± SEM shaped in a ring. At 3 DAH, the melanophore was ob- after 15 h, which is termed organogenesis. When hatched, served, in each specimen, in the dorsal fin fold and abdom- the melanophore is already developed around the oil drop inal cavity. At 5 DAH, the melanophore was observed at and covers the body’s entire skin surface. In starry flounder the lateral line in larvae. At 20 DAH, larvae coloration (Platichthys stellatus), before larval melanophore develop- started to develop when the expression of the melanophore ment in the eyes, the melanophore has already begun to was at the end of lateral line. At 40 DAH, the melanophore develop in the primordial fin and tail (Yamashita et al. started to color the whole body and tail fin. The body color 2014). After melanophore development has been com- development of red spotted grouper larvae showed a simi- pleted in the eyes, the melanophore begins to develop lar development pattern as the brown-marble grouper throughout the body from the primordial fin fold and body (Epinephelus fuscoguttatus), which is in the same family center. Based on these contrasting results, melanophore (Kohno et al. 1993). The color development of brown- development patterns are likely to be species-specific. marble grouper larvae also starts with observation of mela- We investigated melanin-related gene expression in red nophores in the eyes, after which it develops chromo- spotted grouper according to different light intensities. At phores throughout the abdominal cavity, dorsal fin spine, 6 weeks, MCH mRNA tended to increase its expression and caudal parts. The melanophore starts to condense at levels with an increase in light intensity. However, the the dorsal fin spine and caudal parts, and the body color expressions of POMC mRNA and MC1R mRNA were develops through the head, tail, dorsal fin spine, and whole highest at 0 lx and lowest at 1000 lx. At the end of the ex- body. However, some studies have reported melanophore periment, the expression of MC1R mRNA was at its high- development stages that differ from our results. In rock est at 0 lx and its lowest at 1000 lx. In case of MC1R porgy (Oplegnathus punctatus), the melanophore can be mRNA expression, it was significantly higher in dark observed before hatching (Park et al. 2015). The rock conditions in the 3 weeks and 9 weeks, and there was no porgy’s melanophore pigments move back to the head and significant difference in the 6 weeks, but in the dark condi- surround the myotome throughout the tail at fertilization tions, MC1R mRNA expression tended to be high. Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 7 of 9 Fig. 4 Expression changes of melanin-related genes in the red spotted grouper brain, pituitary, and skin under different light intensity conditions by real-time qPCR. MCH (a), POMC (b), MC1R (c), and ASIP (d). The different letters indicate statistical difference at P <0.05. Values are mean ±SEM However, the expression of ASIP mRNA was at its highest the background color change. Mizusawa was suggested that during the initial period of the experiment but maintained MC5R might be a major factor reinforcing the function of a low level of expression afterwards. In terms of body MSH in morphological color change. ASIP mRNA has high color (RGB cord value), the darkest color value was ob- expression in the ventral skin butnoexpressioninthe dor- served in the 0 lx group, and bright color value was ob- sal skin. Therefore, MC1R, MC5R, MCH, and MSH were served in the 200 lx, 2000 lx, and the 1000 lx groups. associated with background color adaptation and ASIP A lot of research studies have reported that MCH is mRNA might be not. closely involved with background color (Yamanome et al. Many studies have aimed to determine the effects of 2005; Chung et al. 2018; Diniz and Bittencourt 2019; Kasagi light intensity on survival rate, growth, swimming, feeding, et al. 2020). To observe morphological color changes in coloration, and various other physiological phenomena goldfish, fish was reared under different background color (Batty et al. 1990; Boeuf and Le Bail 1999; Reichard et al. conditions and the expression of M1CR, MC5R, MSH, 2002;Richmond et al. 2004; Luchiari et al. 2006; Liu et al. MCH, and ASIP mRNAs was checked (Mizusawa et al. 2012; Lee et al. 2017). Light can induce melanogenesis 2018). In the white-reared fish, MCH mRNA expression and increase the synthesis of the melanophore, which can was higher than that in black-reared fish, and POMC make the body coloration darker (Odiorne 1957). When mRNA expression was lower than that in the black-reared the Australian snapper (Pagrus auratus) was reared under fish. In the xanthophores in the scale, MC1R did not always different degree of shading conditions (0%, 50%, and 95% follow the background color change, but MC5R followed shading form incident radiation), the group under the 0% degree of shading conditions showed darker body color- ation than the other groups (Booth et al. 2004). In Table 2 RGB code value extracted form red spotted grouper addition, the body color of Chinese longsnout catfish skin. 0 lux (A) 200 lux (B) 1000 lux (C) and 2000 lux (D) (Leiocassis longirostris) tends to be dark under a strong 0 lux 200 lux 1000 lux 2000 lux light intensity, and their survival rate tends to drop under RGB (Red, Greed, Blue) 86, 71, 58 88, 71, 59 137, 116, 99 105, 92, 81 extremely strong light intensity conditions (Han et al. Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 8 of 9 2005). This study indicates that the light intensity affects Acknowledgements This work was supported by the Korea Institute of Planning and Evaluation for melanin synthesis. In these experiments, we conclude that Technology in Food, Agriculture, Forestry (IPET) through Golden Seed Project, funded the light sources such as sun or ultraviolet rays stimulate by Ministry of Oceans and Fisheries (MOF) (grant number 213008-05-4-SB510). the skin and lead to melanin synthesis for skin protection. And by that result, the body colors became more dark. Authors’ contributions SH designed and carried out the data analysis and manuscript writing. BH Research on body color change in red porgy (Pagrus and CH participated in the fish sampling and data analysis. YD participated pagrus) as a result of changes in light intensity has shown in its design and coordination and helped to draft the manuscript. All that red porgy tends to have bright body coloration beside authors read and approved the final manuscript. a white background with a high intensity of light (Pavlidis Funding et al. 2008). After observing body color change in ocellaris This work was supported by the Korea Institute of Planning and Evaluation clownfish (Amphiprion ocellaris)under 20–50, 600–850, for Technology in Food, Agriculture, Forestry (IPET) through Golden Seed and 2700–3500 lx conditions, specimens were found to Project, funded by Ministry of Oceans and Fisheries (MOF) (grant number 213008-05-4-SB510). have a bright color on their back and tail fins under low intensity light (Yasir and Qin 2009). These results indicate Availability of data and materials that the body color has adapted to the environment condi- Not applicable. tion, affected by the amount of light. These researches suggest that light intensity can affect body color. Compar- Ethics approval and consent to participate All experiments were conducted in compliance with both the Animal Care ing our research results, the bright light intensity is and Use Committee guidelines of the Jeju National University. thought to brighten up the body color because of the mel- anin concentrated due to increased expression of MCH Consent for publication mRNA, and melanin synthesis decreased due to reduced Not applicable. expression of POMC and MC1R mRNA. In our study on the melanin-related genes of the red Competing interests The authors declare that they have no competing interests. spotted grouper, POMC mRNA, MC1R mRNA, and MCH mRNA showed different gene expression patterns Author details under different light intensity conditions. The expression Marine Science Institute, Jeju National University, Jeju 695-965, Republic of Korea. CR Co., Ltd, Jeju 63333, South Korea. of ASIP mRNA was not affected by light intensity. It is thought that under controlled light intensity conditions, Received: 23 March 2020 Accepted: 27 October 2020 the expression of POMC mRNA and MC1R mRNA in- duces melanin synthesis. The concentration of MCH References mRNA was affected by light conditions. The low expres- Adachi K, Kato K, Wakamatsu K, Ito S, Ishimaru K, Hirata T, Osamu M, Kumai H. sion of ASIP mRNA is most likely due to the develop- The histological analysis, colorimetric evaluation, and chemical quantification ment of iridophores in the abdominal cavity as the of melanin content in ‘suntanned’fish. Pigment Cell Res. 2005;18:465–8. Amiya N, Amano M, Iigo M, Yamanome T, Takahashi A, Yamamori K. Interaction larvae grew. of orexin/hypocretin-like immunoreactive neurons with melanin- concentrating hormone and α-melanocyte-stimulating hormone neurons in brain of a pleuronectiform fish, barfin flounder. Fisheries Sci. 2008;74:1040–6. Conclusion Appelbaum S, Kamler E. Survival, growth, metabolism and behaviour of Clarias The aim of this study is the change in the body color and gariepinus (Burchell 1822) early stages under different light conditions. Aquacult Eng. 2000;22:269–87. melanin-related gene expression of red spotted grouper by Baker B, Levy A, Hall L, Lightman S. Cloning and expression of melanin- light intensity. Our results suggested that when light inten- concentrating hormone genes in the rainbow trout brain. sity goes stronger, MCH mRNA expressed higher, and Neuroendocrinology. 1995;61:67–76. Batty RS, Blaxter JHS, Richard JM. Light intensity and the feeding behavior of POMC and MC1R mRNAs expressed lower. However, herring, Clupea harengus. Mar Biol. 1990;107:383–8. ASIP mRNA expression did not changed. With these re- Boeuf G, Le Bail PY. Does light have an influence on fish growth? Aquaculture. sults, we suggest that MCH, POMC, and MC1R mRNAs 1999;177:129–52. Booth MA, Warner-Smith RJ, Allan GL, Glencross BD. Effects of dietary astaxanthin are affected by light intensity. Further research is needed to source and light manipulation on the skin colour of Australian snapper understand the relationship between melanin composition Pagrus auratus (Bloch & Schneider, 1801). Aquac Res. 2004;35:458–64. and gene expression in relation to the external environment Borski RJ, Hodson RG. Fish research and the institutional animal care and use committee. Ilar J. 2003;44:286–94. and body color change. Our study contributes valuable Cal L, Gómez-Marín C, Gómez-Skarmeta JL, Cerdá-Reverter JM, Kelsh RN, Rotllant baseline data that advances our knowledge of body color J. A Bac transgenic analysis of the asip1 locus reveals developmental stimulation under environmental conditions in the red mechanisms of dorso-ventral pigmentation in fish. In: The International Symposium on Genetics in Aquaculture XII. James HT, Shawn DC and Leigh spotted grouper. AB, eds. Santiago de Compostela, Spain. 2015; 122. Cal L, Suarez-Bregua P, Cerdá-Reverter JM, Braasch I, Rotllant J. Fish pigmentation Abbreviations and the melanocortin system. Comp Biochem Phys A. 2017;211:26–33. POMC: Pro-opiomelanocortin; MC1R: Melanocortin 1 receptor; ASIP: Agouti- Cerdá-Reverter JM, Agulleiro MJ, Guillot R, Sánchez E, Ceinos R, Rotllant J. Fish signaling protein; MCH: Melanin-concentrating hormone melanocortin system. Eur J Pharmacol. 2011;660:53–60. Choi et al. Fisheries and Aquatic Sciences (2020) 23:29 Page 9 of 9 Cerdá-Reverter JM, Haitina T, Schiöth HB, Peter RE. Gene structure of the goldfish Matsuda K. Recent advances in the regulation of feeding behavior by agouti-signaling protein: a putative role in the dorsal-ventral pigment pattern neuropeptides in fish. Ann Ny Acad Sci. 2009;1163:241–50. of fish. Endocrinology. 2005;146:1597–610. Mizusawa K, Yamamura Y, Kasagi S, Cerdá-Reverter JM, Takahashi A. Expression of Chauvet C. Etude de la croissance du mérou Epinephelus guaza (Linné, 1758) des genes for melanotropic peptides and their receptors for morphological color côtes tunisiennes. Aquat Living Resour. 1988;1:277–88. change in goldfish Carassius auratus. Gen Comp Endocr. 2018;264:138–50. Odiorne JM. Color changes. In: Brown ME, editor. The physiology of fishes, vol. 2. Cho HC, Kim JE, Kim HB, Baek HJ. Effects of water temperature change on the New York: Academic press; 1957. p. 387–401. hematological responses and plasma cortisol levels in growing of red Paripatananont T, Tangtrongpairoj J, Sailasuta A, Chansue N. Effect of astaxanthin spotted grouper, Epinephelus akaara. Dev Reprod. 2015;19:19–24. on the pigmentation of goldfish Carassius auratus. J World Aquacult Soc. Chung IY, Jeon JM, Song YH. Characterization of melanin-concentrating hormone 1999;30:454–60. from olive flounder (Paralichthys olivaceus). J. Life Sci. 2018;28:284–92. Park JM, Lee SH, Yun SM, Na HC, Han KH. Egg development and morphology of Cone RD. Studies on the physiological functions of the melanocortin system. larvae and juveniles of spotted knifejaw, Oplegnathus punctatus. Korean J Endocr Rev. 2006;27:736–49. Ichthyol. 2015;27:71–7. Costin GE, Hearing VJ. Human skin pigmentation: melanocytes modulate skin Pavlidis M, Karkana M, Fanouraki E, Papandroulakis N. Environmental control of color in response to stress. Faseb J. 2007;21:976–94. skin colour in the red porgy, Pagrus pagrus. Aquac Res. 2008;39:837–49. Diniz GB, Bittencourt JC. The melanin-concentrating hormone (MCH) system: a Petrell RJ, Ang KP. Effects of pellet contrast and light intensity on salmonid tale of two peptides. Front Neurosci-Switz. 2019;13:1280. feeding behaviours. Aquacult Eng. 2001;25:175–86. Ducrest AL, Keller L, Roulin A. Pleiotropy in the melanocortin system, coloration Reichard M, Jurajda P, Ondračková M. The effect of light intensity on the drift of and behavioural syndromes. Trends Ecol Evol. 2008;23:502–10. young-of-the-year cyprinid fishes. J Fish Biol. 2002;61:1063–6. Duncan DB. Multiple range and multiple F tests. Biometrics. 1955;11:1–42. Richmond HE, Hrabik TR, Mensinger AF. Light intensity, prey detection and foraging Fujii R. Coloration and chromatophores. In: Evans DH, editor. The physiology of mechanisms of age 0 year yellow perch. J Fish Biol. 2004;65:195–205. fishes. Boca Raton: CRC Press; 1993. p. 535–62. Rimmer MA, Glamuzina B. A review of grouper (Family Serranidae : Subfamily Fujii R. The regulation of motile activity in fish chromatophores. Pigm Cell Res. Epinephelinae) aquaculture from a sustainability science perspective. Rev 2000;13:300–19. Aquacult. 2019;11:58–87. Fujimoto M, Arimoto T, Morishita F, Naitoh T. The background adaptation of the Seiji M, Shimao K, Birbeck MSC, Fitzpatrick TB. Subcellular localization of melanin flatfish, Paralichthys olivaceus. Physiol Behav. 1991;50:185–8. biosynthesis. Ann Ny Acad Sci. 1963;100:497–533. Han D, Xie S, Lei W, Zhu X, Yang Y. Effect of light intensity on growth, survival Sköld HN, Aspengren S, Wallin M. Rapid color change in fish and amphibians– and skin color of juvenile Chinese longsnout catfish (Leiocassis longirostris function, regulation, and emerging applications. Pigm Cell Melanoma R. Günther). Aquaculture. 2005;248:299–306. 2013;26:29–38. Hanlon R. Cephalopod dynamic camouflage. Curr Biol. 2007;17:400–4. Song YB, Oh SR, Seo JP, Ji BG, Lim BS, Lee YD, Kim HB. Larval development and Hur SW, Lee CH, Lee SH, Kim BH, Kim HB, Baek HJ, Lee YD. Characterization of rearing of longtooth grouper Epinephelus bruneus in Jeju Island, Korea. J cholecystokinin-producing cells and mucus-secreting goblet cells in the World Aquacult Soc. 2005;36:209–16. blacktip grouper, Epinephelus fasciatus. Tissue Cell. 2013;45:153–7. Sulaimon SS, Kitchell BE. The biology of melanocytes. Vet Dermatol. 2003;14:57–65. Ju SH, Cho GB, Sohn JW. Understanding melanocortin-4 receptor control of neuronal Suzuki H. Evolutionary and phylogeographic views on Mc1r and Asip variation in circuits: toward novel therapeutics for obesity syndrome. Pharmacol Res. 2018;129:10–9. mammals. Genes Genet Syst. 2013;88:155–64. Kalinowski CT, Robaina LE, Fernandez-Palacios H, Schuchardt D, Izquierdo MS. Suzuki I, Im S, Tada A, Barsh G, Hearing V, Scott C, Akcali C, Davis MB, Abdel- Effect of different carotenoid sources and their dietary levels on red porgy Malek Z. Participation of the melanocortin-1 receptor in the UV control of (Pagrus pagrus) growth and skin colour. Aquaculture. 2005;244:223–31. pigmentation. In: J Invest Derm Sym P. 1994;4:29–34. Kasagi S, Mizusawa K, Takahashi A. The effects of chromatic lights on body color and Takahashi A, Tsuchiya K, Yamanome T, Amano M, Yasuda A, Yamamori K, gene expressions of melanin-concentrating hormone and proopiomelanocortin Kawauchi H. Possible involvement of melanin-concentrating hormone in in goldfish (Carassius auratus). Gen Comp Endocr. 2020;285:113266. food intake in a teleost fish, barfin flounder. Peptides. 2004;25:1613–22. Kim SH, Lee CH, Song YB, Hur SW, Kim HB, Lee YD. Ultrastructure of late Wang YJ, Chien YH, Pan CH. Effects of dietary supplementation of carotenoids on spermatids and spermatozoa during spermiogenesis in longtooth grouper survival, growth, pigmentation, and antioxidant capacity of characins, Epinephelus bruneus from Jeju, Korea. Tissue Cell. 2013;45:261–8. Hyphessobrycon callistus. Aquaculture. 2006;261:641–8. Kittilsen S, Schjolden J, Beitnes-Johansen I, Shaw JC, Pottinger TG, Sørensen C, Yamanome T, Amano M, Takahashi A. White background reduces the occurrence Braastad BO, Bakken M, Øverli Ø. Melanin-based skin spots reflect stress of staining, activates melanin-concentrating hormone and promotes somatic responsiveness in salmonid fish. Horm Behav. 2009;56:292–8. growth in barfin flounder. Aquaculture. 2005;244:323–9. Klein M. 2018. Get average color of image. Retrieved from https://matkl.github.io/ Yamashita YT, Aritaki M, Kurita Y, Tanaka M. Early growth and development of average-color/ on Jun 20. reciprocal hybrids of the starry flounder Platichthys stellatus and stone Kobayashi T, Urabe K, Winder A, Jiménez-Cervantes C, Imokawa G, Brewington T, flounder Kareius bicoloratus. J Fish Biol. 2014;84:1503–18. Solano F, García-Borrón JC, Hearing VJ. Tyrosinase related protein 1 (TRP1) Yasir I, Qin JG. Effect of light intensity on color performance of false clownfish, functions as a DHICA oxidase in melanin biosynthesis. Embo J. 1994;13:5818–25. Amphiprion ocellaris Cuvier. J World Aquacult Soc. 2009;40:337–50. Kohno H, Diani S, Supriatna A. Morphological development of larval and juvenile grouper, Epinephelus fuscoguttatus. Jpn J Ichthyol. 1993;40:307–16. Publisher’sNote Kondo T, Hearing VJ. Update on the regulation of mammalian melanocyte Springer Nature remains neutral with regard to jurisdictional claims in function and skin pigmentation. Expert Rev Dermatol. 2011;6:97–108. published maps and institutional affiliations. Korner A, Pawelek J. Mammalian tyrosinase catalyzes three reactions in the biosynthesis of melanin. Science. 1982;217:1163–5. Lee CH, Hur SW, Kim BH, Soyano K, Lee YD. Induced maturation and fertilized egg production of the red-spotted grouper, Epinephelus akaara, using adaptive physiology of photoperiod and water temperature. Aquac Res. 2020;00:1–7. Lee CH, Hur SW, Na OS, Baek HJ, Noh CH, Han SH, Lee YD. Induction of primary male in juvenile red spotted grouper Epinephelus akaara by immersion of 17α-methyltestosterone. Dev Reprod. 2014;18:127. Lee JS, Britt LL, Cook MA, Wade TH, Berejikian BA, Goetz FW. Effect of light intensity and feed density on feeding behaviour, growth and survival of larval sablefish Anoplopoma fimbria. Aquac Res. 2017;48:4438–48. Liu Y, Mou Z, Xu G, Li Y, Wang C. The effect of light intensity on the growth of Brachymystax lenok (Pallas, 1773). Aquac Res. 2012;43:1838–44. Luchiari AC, De Morais-Freire FA, Koskela J, Pirhonen J. Light intensity preference of juvenile pikeperch Sander lucioperca (L.). Aquac Res. 2006;37:1572–7.

Journal

Fisheries and Aquatic SciencesSpringer Journals

Published: Dec 3, 2020

There are no references for this article.