Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Regulation of adductor muscle growth by the IGF-1/AKT pathway in the triploid Pacific oyster, Crassostrea gigas

Regulation of adductor muscle growth by the IGF-1/AKT pathway in the triploid Pacific oyster,... We investigated the insulin-like growth factor 1 (IGF-1)/AKT signaling pathway involved in muscle formation, growth, and movement in the adductor muscle of triploid Pacific oyster, Crassostrea gigas. Large and small triploid oysters (LTs and STs) cultured under identical conditions were screened, and the signaling pathways of individuals with superior growth were compared and analyzed. mRNA and protein expression levels of actin, troponin, tropomyosin, and myosin, proteins important in muscle formation, were higher in LTs compared with STs. Expression levels of IGF-1, IGF binding protein (IGFBP), and IGFBP complex acid-labile subunit were also higher in LTs compared with STs. Phosphorylationofthe IGF receptoraswellasthatofAKT was highinLTs.Inaddition, theexpressionofphospho- mammalian target of rapamycin and phospho-glycogen synthase kinase 3β was increased and the expression of Forkhead box O3 was decreased in LTs. Therefore, we suggested that the IGF-1/AKT signaling pathway affects the formation, growth, and movement of the adductor muscle in triploid oysters. Keywords: Triploid oyster, Adductor muscle, Muscle growth, Protein synthesis, Protein degradation Background muscles, which are regularly arranged, and non-striated The triploid Pacific oyster Crassostrea gigas was first muscles, including smooth muscle, which make up the reported by Stanley et al. (1981) and commercialized on vessels, respiratory system, and stomach. The adductor the West Coast of America in 1985 (Allen et al. 1989). muscle of the oyster is a typical striated muscle, which At present, it is produced by crossing diploid female and contracts and relaxes through the action of actomyosin tetraploid male hybrids (Guo et al. 1996), and this according to the cytosolic concentration of calcium. method is being applied to various oysters. Triploid oys- Actomyosin is composed of actin and myosin, and ters consume less energy during maturity because they troponin (T, C, I) and tropomyosin are required for their do not develop germ cells. As a result, growth is faster binding and formation (Kuo and Ehrlich 2015). There- because more energy can be used to grow somatic cells fore, in this study, the mechanism of the production and compared with diploid oysters (Allen and Downing activity of the adductor muscle, which is most closely 1986;Nell 2002; Nell and Perkins 2005). However, the related to oyster growth, was confirmed by evaluating signaling pathway responsible for this growth has not the expression of actin, troponin, and tropomyosin, yet been elucidated. which affect the formation of actomyosin. Activation of the adductor muscle, i.e., muscle activity, Muscles adapt and change according to functional needs is associated with oyster feeding behavior, which directly (Rennie et al. 2004). If there is a load, muscle mass affects oyster growth (Hopkins 1936). Muscles are di- increases. However, if there is no load or the muscle is not vided into striated muscles, such as skeletal and cardiac used, muscle mass will decrease. When muscle growth is active, the roles of growth hormone (GH) and insulin-like growth factor 1 (IGF-1) are important (Velloso 2008). GH * Correspondence: unichoi@pknu.ac.kr binds to the GH receptor (GHR) and regulates various Institute of Fisheries Sciences, Pukyong National University, Busan 46041, signals related to growth. GHR is ubiquitously expressed Republic of Korea Department of Marine Bio-Materials and Aquaculture, Pukyong National in various tissues to mediate the action of GH, and GH University, Busan 48513, Republic of Korea © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 2 of 10 increases the expression of IGF-1 in most tissues (Frick et al. 1998;D’Ercole et al. 1984; Gosteli-Peter et al. 1994; Jorgensen et al. 2006). Unlike GH and GHR, IGF-1 expression is stable and does not change significantly dur- ing the day (Buckway et al. 2001;Velloso 2008). Therefore, it can be used as a factor to measure muscle growth. Musclehypertrophyoccurs when therateofprotein synthesis exceeds the rate of protein degradation (Schiaffino et al. 2013). The IGF-1/protein kinase B (also known as AKT) signaling pathway, which is acti- vated upon IGF-1 recognition by the IGF receptor (IGF-1R), is the most representative mechanism of muscle mass increase. IGF-1 signaling promotes muscle growth via increased protein synthesis and inhibition of protein degradation (Schiaffino and Mammucari 2011). IGF-1/AKT signaling mediates protein degradation by modulation of muscle atrophy F-box (MAFbx), muscle ring finger 1 (MURF1), and microtubule-associated protein 1 light chain 3 (LC3) via Forkhead box O3 (FoxO) (Manning and Cantley 2007). IGF-1/AKT sig- naling also promotes protein synthesis via mammalian target of rapamycin (mTOR) and glycogen synthase kinase (GSK)-3β. Confirmation of the expression of each of these factors will confirm that the growth of triploid oysters is dependent on IGF-1/AKT signaling, as has been shown in mammals and other mollusks. In this study, we analyzed the IGF-1/AKT signaling pathway and its involvement in the growth of triploid oysters and confirmed the relationship between the ex- pression of actin and troponin, which are involved in muscle formation in the triploid oyster. Methods Sampling and identification of the triploid oyster Triploid oysters were collected at a farm in Taean- gun, Republic of Korea (latitude 36.903367, longitude 126.26489), in January and February of 2017. A total of 60 oysters were collected and separated into large and small triploid oysters (LTs and STs, respectively). Fig. 1 Morphological correlation of the triploid oyster, Crassostrea Since there is no standardized method for classifying gigas. a Soft tissue weight (STW) according to total weight (TW). b oysters, this study divided them according to the fol- Shell height according to shell length. c Shell width according to lowing criteria. LTs selected samples that meet the shell length. Large triploids (LTs), shaded areas inside the graph; three conditions as shown in Fig. 1. First, both STW small triploids (STs), hatched area inside the graph. n =60 and TW of oysters are higher than average. Second, both shell length and shell height of oysters are above average. Third, shell width and shell length of oysters ethanol, and stored at − 20 °C for more than 4 h. After areaboveaverage.Whenthe threeconditionswere removing the supernatant by centrifugation (3000 rpm, satisfied, they were classified as LTs and vice versa as 10 min), it was washed three times with phosphate- STs. The adductor muscle was isolated, and 0.5 g of buffered saline. Samples were stained with propidium each muscle was subdivided, frozen in liquid nitrogen, iodide for 30 min at room temperature and measured andstoredat − 70 °C. using a flow cytometer (BD Accuri C6, BD Biosciences, Triploidy was confirmed as described previously (Allen Franklin Lakes, NJ, USA). Ten diploid oysters were col- 1983) with minor modifications. Plasma was collected lected from the southern Korean sea for DNA verifica- from 10 of the collected samples, added to 0.7 mL tion compared with the triploid oyster. Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 3 of 10 cDNA synthesis and reverse-transcription polymerase subjected to gel electrophoresis using a 12% polyacryl- chain reaction (RT-PCR) amide gel and transferred to a polyvinylidene fluoride The adductor muscle (0.5 g, LTs n =3; STs n =3) was pul- membrane for immunoblotting. Membranes were blocked verized by adding 1 mL Trans-Zol UP (TransGen Biotech, with Tris-buffered saline containing 0.1% Tween-20 Beijing, China), and total RNA was extracted using Trans- (TBST) and 1% BSA at room temperature for at least 2 h. Zol UP according to the manufacturer’sinstructions. cDNA The membranes were then incubated with the primary was synthesized from 2 μg total RNA using the PrimeScript and secondary antibodies at room temperature for at least first strand cDNA synthesis kit (TaKaRa Bio, Otsu, Japan) 1 h, followed by detection with enhanced chemilumines- according to the manufacturer’s instructions. RT-PCR was cence western blotting reagents (Santa Cruz Biotechnol- performedusingEmeraldAmp GT PCRMasterMix ogy, Inc., Santa Cruz, CA, USA). Between each step, two (TaKaRa Bio). The primers (targeting elongation factor 1α, washes with TBST were performed. The following IGF-1, IGF-IR, IGF binding protein complex acid-labile primary antibodies and the anti-mouse secondary anti- subunit [IGF-ALS], actin, myosin, troponin T, troponin I, body were obtained from Santa Cruz Biotechnology, Inc., and tropomyosin) and reaction parameters (denaturation, and diluted 1:1000: IGF-1, IGF binding protein (IGF-BP)- 95 °C, 30 s; annealing, indicated temperature, 30 s; elong- 3, IGF-1R, phosphorylated (p)-IGF-1R, AKT, p-AKT, ation, 72°C,30s)usedfor RT-PCRare showninTable 1. mTOR, p-mTOR, FoxO, p-FoxO, GSK3β,p-GSK3β, Primers were designed based on the gene sequences of C. eukaryotic translation initiation factor 4E binding proteins gigas obtained from NCBI GenBank. The PCR products 1 (4EBP1), Ribosomal protein S6 kinase beta 1 (p70S6K1), were confirmed by 1% agarose gel electrophoresis. MAFbx, MURF1, LC3, eukaryotic translation initiation factor 2B (elF2B), nebulin, neural Wiskott–Aldrich syn- Protein purification and western blotting drome protein (N-WASP), peroxisome proliferator- Total protein extraction was performed by adding 1 mL activated receptor γ coactivator (PGC) 1α,troponinI, radioimmunoprecipitation buffer to 0.5 g adductor muscle troponin T, and F-actin antibodies. (LTs, n =3; STs, n = 3). The homogenized tissue was cen- trifuged (12,000 rpm, 10 min, 4 °C) and the supernatant Statistical analysis used. Protein quantification was performed using the RT-PCR and western blotting results were analyzed bicinchoninic acid assay, and bovine serum albumin using GeneTools software (version 4.03; Syngene, (BSA) was used as a standard. Proteins (2 μg/μL) were Cambridge, UK). Data are presented as means ± standard Table 1 Primer sequences for RT-PCR, amplicon size, PCR efficiencies, and GenBank accession numbers of the genes evaluated in this study. Primers were designed based on Crassostrea gigas sequences. F forward primer, R reverse primer, AT annealing temperature Gene Accession number Sequence (5′–3′) Amplicon size (bp) PCR cycle AT (°C) EF1α AB122066.1 (F) CCACTGGCCATCTCATTTAC 393 20 60 (R) TGTTGACACCAATGATGAGC IGF-1 XM_011417420.2 (F) ATGGTTTGCCCTGTCTTGAG 336 25 55 (R) AGATCCTTTCTTCTTGCGGC IGF-IR AJ535669.1 (F) TGAGGAGGGTGATGAGGATA 375 25 55 (R) ATTGCACTGTAGGGATTGGA IGF-ALS XM_011417921.2 (F) ATGTCCAAAACAATGCGTCT 359 25 55 (R) TCCAAAACGCGTAACTTTTC Actin-2 EKC31894.1 (F) TTTCGCCGGAGATGATGCCC 434 20 60 (R) TGGGGACAGTGTGGGTGACA Myosin EKC37566.1 (F) TTTGGCTGGTGAGGCACAGG 544 20 60 (R) TTTGCTGAGCTGGCGTTGGA Troponin T XM_020062462.1 (F) AGGAACGCGAGAAAGAACAA 375 20 60 (R) TGATCCTCTGGGACAGGAAG Troponin I XM_011455869.2 (F) CCACCCTGGAGGAAGAAGTC 187 20 60 (R) AAATTGCCACGGAAATCTGA Tropomyosin NM_001308906.1 (F) GCCATGAAAATGGAGAAGGA 381 20 60 (R) GGCGTTATTGAGGTTTTCCA Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 4 of 10 deviation and were analyzed using Statistical Package for Expression of muscle proteins according to triploid oyster Social Sciences, version 10.0 (SPSS, Inc., Chicago, IL, size USA). Statistical analysis was performed using Duncan’s The differences in mRNA and protein expression of multi-range test followed by one-way analysis of vari- actin, myosin, troponin, and tropomyosin, which are in- ance. p < 0.05 was considered to indicate statistical tegral in muscle formation, were examined. The mRNA significance. expression of actin, troponin, and tropomyosin was 1.43–2.22-fold higher in LTs than in STs (Fig. 3a), while the protein expression of actin, troponin T and I, and Results tropomyosin was 1.18–3.60-fold higher in LTs than in Growth characteristics and identification of triploid STs (Fig. 3b). Thus, the expression of mRNAs and pro- oysters teins responsible for muscle formation, contraction, and In total, 60 triploid oysters collected from Taean were relaxation varied depending on the size of the oyster. classified as LTs and STs depending on their size (shell length, SL; shell height, SH; shell width, SW) and weight Expression of IGF-1 according to triploid oyster size (total weight, TW; soft tissue weight, STW). The TW of The expression level of IGF-1 mRNA was three times the triploid oysters ranged from 55.34 to 277.75 g, with a higher in LTs than in STs (Fig. 4a). IGF-ALS, which mean of 125.40 ± 43.50 g. The STW ranged from 7.72 to binds IGF-1 and IGF-IR and initiates IGF-1 signaling, 30.87 g, with a mean of 16.55 ± 5.54 g (Fig. 1a). Fatness also showed high mRNA expression in LTs (Fig. 4a). ranged from 6.80 to 19.30%, with a mean of 13.34 ± IGF-1 protein expression, as well as that of IGF-BP 2.19%. The growth rate of SL/SH, ranged from 0.45 to and IGF-IR, was also higher in LTs compared with STs 0.88, while the growth rate of SW/SL, ranged from 2.20 (Fig. 4b). In particular, the level of p-IGF-IR was signifi- to 4.00 (Fig. 1b, c), with means of 0.63 ± 0.09 and 2.89 ± cantly increased in LTs compared with STs. To investi- 0.38, respectively. In this study, 10 individuals were se- gate the IGF-1/AKT signaling pathway involved in the lected as LTs or STs with a satisfactory combination of synthesis and degradation of muscle proteins, the levels STW/TW, SH/SL, and SW/SL and were used to analyze of AKT1 and p-AKT were assessed. The level of p-AKT the growth signals of muscles according to their size was 1.29-fold higher in LTs compared with STs. (Fig. 1, LTs, shaded areas inside the graph; STs, hatched areas inside the graph). Mechanism of protein synthesis Flow cytometry revealed that the average amount of The expression of mTOR, GSK3β, 4EBP1, and p70S6K1, DNA in diploid oysters, which were used as a control, was elements downstream of IGF-1/AKT signaling associated 245 ± 38.91, and the average amount of DNA in triploid with protein synthesis, were confirmed (Fig. 5a). Phos- oysters was 368 ± 23.23 (Fig. 2). The DNA content ratio of phorylation of mTOR was 1.46-fold higher in LTs com- diploid to triploid oysters was 1:1.5, confirming that the pared with STs. Consequently, the expression level of oysters used in this study were triploid. 4EBP1 was decreased and that of p70S6K1 increased. The Fig. 2 Flow cytometry analysis showing the DNA histograms (top graph) and scatter diagrams (bottom graph) of propidium iodide (red fluorescence, FL2-H)-labeled oysters. a, b Diploid oysters. c, d Triploid oysters. Diploid oysters were used as a control for the amount of DNA. FSC- H, forward side scatter-height; SSC-H, side scatter-height Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 5 of 10 Fig. 3 Expression of muscle-forming proteins according to triploid oyster size. a mRNA expression (n = 5). b Protein expression (n = 3). *p < 0.05 vs. LT. LT, large triploid; ST, small triploid; MFP, muscle-forming proteins expression of p-GSK3β was also 1.37-fold higher in LTs in increased levels of non-phosphorylated nebulin compared with STs. This increased protein synthesis oc- (Fig. 5c). The expression of N-WASP was 1.34-fold curred via inhibition of eIF2B expression. higher in LTs compared with STs. Mechanism of protein degradation PGC1α and troponin The expression of FoxO, an IGF-1/AKT downstream ef- The expression of troponin T and I and PGC1α was in- fector related to protein degradation, was increased creased 1.87-, 1.43-, and 1.57-fold in LTs compared with 2.64-fold in STs compared with LTs (Fig. 5b), in contrast STs, respectively (Figs. 3 and 5c). to mTOR and GSK3β. FoxO affects the function of MAFbx, MURF1, and LC3, and the expression of these Discussion proteins was decreased in LTs compared with STs. Triploid oysters have been reported to grow faster than MAFbx and MURF1 are important in the degradation of diploid oysters because they use the energy required for muscle proteins including myosin via proteasome- maturation for flesh obesity (Allen and Downing 1986; dependent ubiquitylation, and LC3 is involved in the Nell and Perkins 2005). However, oyster size differs to autophagy–lysosome pathway. some extent even under the same conditions. In this study, we used adductor muscles excised from triploid GSK3β and actin polymerization oysters to analyze this difference. Adductor muscle GSK3β increases the phosphorylation of nebulin. Non- (AM) plays an important role in the influx of food and phosphorylated nebulin has been shown to modulate N- communication with the external environment. Oysters WASP to promote elongation and nucleation of actin fila- limit oxygen exchange through shell closure at low tide. ments, thereby enhancing myofibril growth (Takano et al. AM plays an important role in regulating the opening 2010). Inhibition of GSK3β in the triploid oyster resulted and closing of these shells through translucent and white Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 6 of 10 Fig. 4 Expression of upstream proteins in the IGF-1/AKT signaling pathway according to triploid oyster size. a mRNA expression (n= 5). b Protein expression (n = 3). *p < 0.05 vs. LT. LT, large triploid; ST, small triploid; IRP, IGF-1 related proteins opaque muscles. Oxygen is limited but oysters lower intra- and tropomyosin, which form muscles in LT and ST ad- cellular pH for survival and regulate the expression of car- ductor muscle, as well as the mRNA and protein expres- bohydrates, proteins, tRNA, ncRNA, and amino acid sion of IGF-1, differed significantly. In addition, the metabolism-related genes. Among them, dioxygenase, expression of IGF-ALS and IGF-BP, which increases the which corresponds to dietary changes in AM, is drastically half-life in combination with IGF-1 (Baxter et al. 1989), reduced and maintains cysteine homeostasis in food- was also higher in mRNA and protein. This finding restricted situations (Zhang et al. 2012; Chapman et al. confirmed that IGF-1 affects muscle growth in LTs. In 2011). AM is the main organ of oysters that perform these addition, the expression of cofactors required for the functions. Therefore, the formation and development of activity of IGF-1 in tissues was also increased, and the AM has a very important effect on the growth and diet of signaling pathway associated with IGF-1 was activated oysters. On the other hand, AM produces large amounts by increasing phosphorylation of IGF-1R. According to of melanin, and it is reported that the more melanin in Gricourt et al. (2003, 2006), an insulin-like system func- the shell, the higher the dry weight of oysters (Yu et al. tions when C. gigas growth is increased; in particular, 2017; Hao et al. 2015; Xiao yan et al. 2003). Melanin mRNA and protein levels of IGF-1 and insulin removes free radicals and reduces damage to AM, receptor-related receptors are increased. Our results which allows AM to open larger shells and filter out showed that the expression of IGF-1 was high in LTs more algae to speed up growth. We examined the ef- with a high growth rate, consistent with that previous fects of growth factors on muscle formation and activity study. The regression analysis of IGF-1/EF1α gene ex- in the adductor muscle and analyzed related signaling pression according to STW confirmed the significance pathways. (p <0.05).Thisisthefirst reportexplainingtheassoci- IGF-1 plays an important role in muscle growth in trip- ation between STW and IFG-1 gene expression in loid oysters. The expression of actin, myosin, troponin, triploid oysters. Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 7 of 10 Fig. 5 Expression of downstream proteins in the IGF-1/AKT signaling pathway according to triploid oyster size. a Expression of signaling factors related to protein synthesis. b Expression of signaling factors related to protein degradation. c Expression of signaling factors related to myofibrillogenesis. n= 3. *p < 0.05 vs. LT. LT, large triploid; ST, small triploid The size-dependent increase in p-AKT suggested the Furthermore, protein degradation is inhibited by inhib- possibility that IGF-1 signaling regulates protein synthe- ition of FoxO expression, which regulates MAFbx, sis and degradation of muscle via AKT. AKT activity has MURF1, and LC3, which induce protein degradation been reported to increase the activity of mTOR, which is (Stitt et al. 2004; Mammucari et al. 2007). The level of involved in protein synthesis, and to inhibit the activa- activated mTOR was higher, and the expression of tion of GSK3β, which is involved in muscle formation GSK3β and FoxO lower, in LTs than in STs. LTs appear (Glass 2010; Miyazaki and Esser 2009; Sandri 2008; to increase muscle protein content by promoting synthe- Manning and Cantley 2007; Sarbassov et al. 2005). sis and inhibiting degradation of proteins to a greater Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 8 of 10 Fig. 6 IGF-1/AKT signaling pathways in adductor muscle growth and formation in triploid Pacific oyster, Crassostrea gigas degree compared with STs. IGF-1/AKT signaling regu- dephosphorylating eIF2B (Frame and Cohen 2001). It also lates muscle growth in triploid oysters by promoting increases myofibrillogenesis via the regulation of nebulin. protein synthesis and inhibiting degradation. In mamma- In this study, we confirmed that GSK3β increases protein lian cells, PI3K/AKT signaling under hypoxic conditions synthesis in triploid oysters and increases myofibrillogen- has been reported to regulate glucose metabolism and esis via actin polymerization. In oysters such as C. angu- apoptosis (Kim et al. 2012; Parcellier et al. 2008; lata and C. gigas,GSK3β gene expression was reported to Alvarez-Tejado et al. 2001). Guevelou et al. (2013) also be high along with glycogen content in the adductor reported increased expression of AKT under hypoxic muscle at the time of gonad development (Zeng et al. conditions in the smooth muscle of C. gigas; however, 2013;Li et al. 2017). This stored energy is used for sexual AKT expression did not increase under hypoxic condi- maturity. However, in the case of triploid oysters, the tions in striated muscle. These results suggest that AKT, stored energy of the adductor muscle appears to be im- which is expressed in striated muscle of C. gigas,is portant for increasing oyster size through protein synthe- involved in metabolism related to the synthesis and deg- sis and muscle formation. radation of muscle protein rather than regulation of On the other hand, the expression of PGC1α, which glucose metabolism and apoptosis. regulates the expression of FoxO and promotes protein GSK3β, which is involved in protein synthesis, increases degradation, was also higher in LTs compared with STs. phosphorylation of nebulin, which results in inhibition of This influenced the expression of troponin, another fac- actin polymerization (Takano et al. 2010). In the case of tor that acts on PGC1α (Vescovo et al. 2005). Striated adductor muscle, oyster size affects both muscle formation muscle contracts and relaxes by the action of myosin via protein synthesis and degradation and muscle move- and actomyosin, a complex of actin–troponin–tropomy- 2+ ment via muscle relaxation. Inhibition of GSK3β by phos- osin, and Ca (Clark et al. 2002; Geeves and Holmes phorylation of AKT inhibited the phosphorylation of 1999; Gordon et al. 2000; Kuo and Ehrlich 2015). Tropo- 2+ nebulin, which in turn binds to N-WASP and contributes nin acts as a site for Ca to bind actomyosin. Therefore, to muscular movement (Rommel et al. 2001). The expres- we suggested that the expression of LT was higher than sion of nebulin and N-WASP was higher in LTs compared that in ST, as well as muscle formation of muscle with STs. In particular, the expression of N-WASP was protein. 13-fold higher in LTs than in STs. This result confirms Taken together, these results indicate that growth of that the IGF-1/AKT/GSK3β/N-WASP signaling pathway the adductor muscle of triploid oysters occurs by pro- influences the formation of adductor muscle and the con- moting the formation of muscle proteins through the trol of movement in triploid oysters. GSK3β deactivated IGF-1/AKT signaling pathway and inhibiting degrad- by IGF-1 increases glycogen synthesis by dephosphorylat- ation. GSK3β and PGC1α also affect muscle formation ing glycogen synthase and increases protein synthesis by and movement (Fig. 6). Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 9 of 10 In this study, it was examined how various factors af- Buckway CK, Guevara-Aguirre J, Pratt KL, Burren CP, Rosenfeld RG. The IGF-I generation test revisited: a marker of GH sensitivity. J Clin Endocrinol Metab. fecting muscle growth, formation, and movement of the 2001;86:5176–83. adductor muscle of triploid oysters vary with oyster size. Chapman RW, Mancia A, Beal M, Veloso A, Rathburn C, Blair A, Holland AF, Warr Our results will improve our understanding of muscle GW, Didinato G, Sokolova IM, Wirth EF, Duffy E, Sanger D. The transcriptomic responses of the eastern oyster, Crassostrea virginica, to environmental growth, formation, and movement of triploid oysters via conditions. Mol Ecol. 2011;20:1431–49. IGF-1/AKT signaling. We also confirmed that the ad- Clark KA, McElhinny AS, Beckerle MC, Gregorio CC. Striated muscle ductor muscle of the triploid oyster affects the size of cytoarchitecture: an intricate web of form and function. Annu Rev Cell Dev Biol. 2002;18:637–706. the oyster. The results of this study will be important for D’Ercole AJ, Stiles AD, Underwood LE. Tissue concentrations of somatomedin C: further studies investigating muscle growth of triploid further evidence for multiple sites of synthesis and paracrine or autocrine oysters and marine mollusks. mechanisms of action. Proc Natl Acad Sci USA. 1984;81:935–9. Frame S, Cohen P. GSK3 takes centre stage more than 20 years after its discovery. Biochem J. 2001;359:1–16. Conclusions Frick GP, Tai LR, Baumbach WR, Goodman HM. Tissue distribution, turnover, and Through the IGF-1/AKT signaling pathway, increased glycosylation of the long and short growth hormone receptor isoforms in rat tissues. Endocrinol. 1998;139:2824–30. protein synthesis (mTOR/4EBP1 and p70S6K1; GSK3β/ Geeves MA, Holmes KC. Structural mechanism of muscle contraction. Annu Rev elF2B), inhibition of protein degradation (FoxO/MAFbx, Biochem. 1999;68:687–728. MURF1, LC3), and activation of muscle-forming pro- Glass DJ. PI3 kinase regulation of skeletal muscle hypertrophy and atrophy. Curr Top Microbiol Immunol. 2010;346:267–78. teins (PGC1α/troponin; GSK3β/N-WASP) occur in the Gordon AM, Homsher E, Regnier M. Regulation of contraction in striated muscle. adductor muscle of triploid oysters. All of these pro- Physiol Rev. 2000;80:853–924. cesses affect the growth of triploid oysters, and activa- Gosteli-Peter M, Winterhalter KH, Schmid C, Froesch ER, Zapf J. Expression and regulation of insulin-like growth factor-I (IGF-I) and IGF-binding protein tion of IGF-1/AKT signaling results in a larger size of messenger ribonucleic acid levels in tissues of hypophysectomized rats the triploid oyster, C. gigas. infused with IGF-I and growth hormone. Endocrinol. 1994;135:2558–67. Gricourt L, Bonnec G, Boujard D, Mathieu M, Kellner K. Insulin-like system and Authors’ contributions growth regulation in the Pacific oyster Crassostrea gigas: hrIGF-1 effect on YHC contributed to the conceptualization, writing–review and editing, protein synthesis of mantle edge cells and expression of an homologous supervision, project administration, and funding acquisition. EYK contributed insulin receptor-related receptor. Gen Comp Endocrinol. 2003;134:44–56. to the investigation, data analysis, and writing–original draft preparation. Gricourt L, Mathieu M, Kellner K. An insulin-like system involved in the control of Both authors read and approved the final manuscript. Pacific oyster Crassostrea gigas reproduction: hrIGF-1 effect on germinal cell proliferation and maturation associated with expression of an homologous Funding insulin receptor-related receptor. Aquaculture. 2006;251:85–98. This research was supported by the Basic Science Research Program through Guevelou E, Huvet A, Sussarellu R, Milan M, Guo X, Li L, Zhang G, Quillien V, the National Research Foundation of Korea (NRF) funded by the Ministry of Daniel J, Quere C, Boudry P, Corporeau C. Regulation of a truncated isoform Education (NRF-2016R1D1A1B03934914). of AMP-activated protein kinase alpha (AMPKalpha) in response to hypoxia in the muscle of Pacific oyster Crassostrea gigas. J Comp Physiol B. 2013;183: Availability of data and materials 597–611. All data sets generated during and/or analyzed during the current study are Guo X, DeBrosse GA, Allen SK. All-triploid Pacific oysters (Crassostrea gigas Thunberg) available from the authors on reasonable request. produced by mating tetraploids and diploids. Aquaculture. 1996;142:149–61. Hao S, Hou X, Wei L, Li J, Li Z, Wang X. Extraction and identification of the Ethics approval and consent to participate pigment in the adductor muscle scar of pacific oyster Crassostrea gigas. PLoS Not applicable ONE. 2015;10:e0142439. Hopkins AE. Activity of the adductor muscle in oysters. Physiol Zool. 1936;9: Consent for publication 498–507. Not applicable Jorgensen JOL, Jessen N, Pedersen SB, Vestergaard E, Gormsen L, Lund SA, Billestrup N. GH receptor signaling in skeletal muscle and adipose tissue in human subjects following exposure to an intravenous GH bolus. Am J Competing interests Physiol Endocrinol Metabol. 2006;291:E899–905. The authors declare that they have no competing interests. Kim TR, Cho EW, Paik SG, Kim IG. Hypoxia-induced SM22alpha in A549 cells activates the IGF1R/PI3K/Akt pathway, conferring cellular resistance against Received: 21 May 2019 Accepted: 20 August 2019 chemo- and radiation therapy. FEBS Lett. 2012;586:303–9. Kuo IY, Ehrlich BE. Signaling in muscle contraction. Cold Spring Harbor perspectives in biology. 2015;7:a006023. References Li B, Meng J, Li L, Liu S, Wang T, Zhang G. Identification and functional Allen SK. Flow cytometry: Assaying experimental polyploid fish and shellfish. characterization of the glycogen synthesis related gene glycogenin in Pacific Aquaculture. 1983;33:317–28. oysters (Crassostrea gigas). J Agric Food Chem. 2017;65:7764–73. Allen SK, Chew KK, Downing SL, Program WSG. Hatchery manual for producing Mammucari C, Milan G, Romanello V, Masiero E, Rudolf R, Del Piccolo P, Burden triploid oysters. Seattle: University of Washington Press; 1989. p. 27. SJ, Di Lisi R, Sandri C, Zhao J, Goldberg AL, Schiaffino S, Sandri M. FoxO3 Allen SK, Downing SL. Performance of triploid Pacific oysters, Crassostrea gigas controls autophagy in skeletal muscle in vivo. Cell Metabol. 2007;6:458–71. (Thunberg). I. Survival, growth, glycogen content, and sexual maturation in Manning BD, Cantley LC. AKT/PKB signaling: navigating downstream. Cell. 2007; yearlings. J Exp Mar Biol Ecol. 1986;102:197–208. 129:1261–74. Alvarez-Tejado M, Naranjo-Suarez S, Jiménez C, Carrera AC, Landázuri MO, del Miyazaki M, Esser KA. Cellular mechanisms regulating protein synthesis and Peso L. Hypoxia induces the activation of the Phosphatidylinositol 3-Kinase/ skeletal muscle hypertrophy in animals. J Appli Physiol. 2009;106:1367–73. Akt cell survival pathway in PC12 cells: protective role in apoptosis. J Biol Chem. 2001;276:22368–74. Nell JA. Farming triploid oysters. Aquaculture. 2002;210:69–88. Baxter RC, Martin JL, Beniac VA. High molecular weight insulin-like growth factor Nell JA, Perkins B. Studies on triploid oysters in Australia: farming potential of binding protein complex. Purification and properties of the acid-labile triploid Pacific oysters, Crassostrea gigas (Thunberg), in Port Stephens, New subunit from human serum. J Biologic Chem. 1989;264:11843-11848. South Wales, Australia. Aquacul Res. 2005;36:530–6. Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 10 of 10 Parcellier A, Tintignac LA, Zhuravleva E, Hemmings BA. PKB and the mitochondria: AKTing on apoptosis. Cell Signal. 2008;20:21–30. Rennie MJ, Wackerhage H, Spangenburg EE, Booth FW. Control of the size of the human muscle mass. Annu Rev Physiol. 2004;66:799–828. Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN, Yancopoulos GD, Glass DJ. Mediation of IGF-1-induced skeletal myotube hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways. Nat. Cell Biol. 2001;3: 1009–13. Sandri M. Signaling in muscle atrophy and hypertrophy. Physiology. 2008;23: 160–70. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science. 2005;307:1098–101. Schiaffino S, Dyar KA, Ciciliot S, Blaauw B, Sandri M. Mechanisms regulating skeletal muscle growth and atrophy. FEBS J. 2013;280:4294–314. Schiaffino S, Mammucari C. Regulation of skeletal muscle growth by the IGF1- Akt/PKB pathway: insights from genetic models. Skeletal Muscle. 2011;1:4. Stanley JG, Allen SK Jr, Hidu H. Polyploidy induced in the American oyster, Crassostrea virginica, with cytochalasin B. Aquaculture. 1981;23:1–10. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M, Yancopoulos GD, Glass DJ. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell. 2004;14:395–403. Takano K, Watanabe-Takano H, Suetsugu S, Kurita S, Tsujita K, Kimura S, Karatsu T, Takenawa T, Endo T. Nebulin and N-WASP cooperate to cause IGF-1-induced sarcomeric actin filament formation. Science. 2010;330:1536–40. Velloso CP. Regulation of muscle mass by growth hormone and IGF-I. Br J Pharmacol. 2008;154:557–68. Vescovo G, Ravara B, Gobbo V, Angelini A, Dalla Libera L. Skeletal muscle fibres synthesis in heart failure: role of PGC-1alpha, calcineurin and GH. Int J Cardiol. 2005;104:298–306. Xiao yan LI, Liu ZH, Cai RX. A study on scavenging activity of melanin to hydroxyl free radicals. J Sichuan Univ. 2003;40:1132–6. Yu W, He C, Cai Z, Xu F, Wei L, Chen J, Jiang Q, Wei N, Li Z, Guo W, Wang X. A Preliminary study on the pattern, the physiological bases and the molecular mechanism of the adductor muscle scar pigmentation in pacific oyster Crassostrea gigas. Front Physiol. 2017;8:699. Zeng Z, Ni J, Ke C. Expression of glycogen synthase (GYS) and glycogen synthase kinase 3beta (GSK3beta) of the Fujian oyster, Crassostrea angulata, in relation to glycogen content in gonad development. Com Biochem Physiol B. 2013; 166:203–14. Zhang G, et al. The oyster genome reveals stress adaptation and complexity of shell formation. Nature. 2012;490:49–54. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Fisheries and Aquatic Sciences Springer Journals

Regulation of adductor muscle growth by the IGF-1/AKT pathway in the triploid Pacific oyster, Crassostrea gigas

Fisheries and Aquatic Sciences , Volume 22 (1) – Sep 6, 2019

Loading next page...
 
/lp/springer-journals/regulation-of-adductor-muscle-growth-by-the-igf-1-akt-pathway-in-the-u6OCOf7gDc
Publisher
Springer Journals
Copyright
Copyright © 2019 by The Author(s)
Subject
Life Sciences; Fish & Wildlife Biology & Management; Marine & Freshwater Sciences; Zoology; Animal Ecology
eISSN
2234-1757
DOI
10.1186/s41240-019-0134-3
Publisher site
See Article on Publisher Site

Abstract

We investigated the insulin-like growth factor 1 (IGF-1)/AKT signaling pathway involved in muscle formation, growth, and movement in the adductor muscle of triploid Pacific oyster, Crassostrea gigas. Large and small triploid oysters (LTs and STs) cultured under identical conditions were screened, and the signaling pathways of individuals with superior growth were compared and analyzed. mRNA and protein expression levels of actin, troponin, tropomyosin, and myosin, proteins important in muscle formation, were higher in LTs compared with STs. Expression levels of IGF-1, IGF binding protein (IGFBP), and IGFBP complex acid-labile subunit were also higher in LTs compared with STs. Phosphorylationofthe IGF receptoraswellasthatofAKT was highinLTs.Inaddition, theexpressionofphospho- mammalian target of rapamycin and phospho-glycogen synthase kinase 3β was increased and the expression of Forkhead box O3 was decreased in LTs. Therefore, we suggested that the IGF-1/AKT signaling pathway affects the formation, growth, and movement of the adductor muscle in triploid oysters. Keywords: Triploid oyster, Adductor muscle, Muscle growth, Protein synthesis, Protein degradation Background muscles, which are regularly arranged, and non-striated The triploid Pacific oyster Crassostrea gigas was first muscles, including smooth muscle, which make up the reported by Stanley et al. (1981) and commercialized on vessels, respiratory system, and stomach. The adductor the West Coast of America in 1985 (Allen et al. 1989). muscle of the oyster is a typical striated muscle, which At present, it is produced by crossing diploid female and contracts and relaxes through the action of actomyosin tetraploid male hybrids (Guo et al. 1996), and this according to the cytosolic concentration of calcium. method is being applied to various oysters. Triploid oys- Actomyosin is composed of actin and myosin, and ters consume less energy during maturity because they troponin (T, C, I) and tropomyosin are required for their do not develop germ cells. As a result, growth is faster binding and formation (Kuo and Ehrlich 2015). There- because more energy can be used to grow somatic cells fore, in this study, the mechanism of the production and compared with diploid oysters (Allen and Downing activity of the adductor muscle, which is most closely 1986;Nell 2002; Nell and Perkins 2005). However, the related to oyster growth, was confirmed by evaluating signaling pathway responsible for this growth has not the expression of actin, troponin, and tropomyosin, yet been elucidated. which affect the formation of actomyosin. Activation of the adductor muscle, i.e., muscle activity, Muscles adapt and change according to functional needs is associated with oyster feeding behavior, which directly (Rennie et al. 2004). If there is a load, muscle mass affects oyster growth (Hopkins 1936). Muscles are di- increases. However, if there is no load or the muscle is not vided into striated muscles, such as skeletal and cardiac used, muscle mass will decrease. When muscle growth is active, the roles of growth hormone (GH) and insulin-like growth factor 1 (IGF-1) are important (Velloso 2008). GH * Correspondence: unichoi@pknu.ac.kr binds to the GH receptor (GHR) and regulates various Institute of Fisheries Sciences, Pukyong National University, Busan 46041, signals related to growth. GHR is ubiquitously expressed Republic of Korea Department of Marine Bio-Materials and Aquaculture, Pukyong National in various tissues to mediate the action of GH, and GH University, Busan 48513, Republic of Korea © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 2 of 10 increases the expression of IGF-1 in most tissues (Frick et al. 1998;D’Ercole et al. 1984; Gosteli-Peter et al. 1994; Jorgensen et al. 2006). Unlike GH and GHR, IGF-1 expression is stable and does not change significantly dur- ing the day (Buckway et al. 2001;Velloso 2008). Therefore, it can be used as a factor to measure muscle growth. Musclehypertrophyoccurs when therateofprotein synthesis exceeds the rate of protein degradation (Schiaffino et al. 2013). The IGF-1/protein kinase B (also known as AKT) signaling pathway, which is acti- vated upon IGF-1 recognition by the IGF receptor (IGF-1R), is the most representative mechanism of muscle mass increase. IGF-1 signaling promotes muscle growth via increased protein synthesis and inhibition of protein degradation (Schiaffino and Mammucari 2011). IGF-1/AKT signaling mediates protein degradation by modulation of muscle atrophy F-box (MAFbx), muscle ring finger 1 (MURF1), and microtubule-associated protein 1 light chain 3 (LC3) via Forkhead box O3 (FoxO) (Manning and Cantley 2007). IGF-1/AKT sig- naling also promotes protein synthesis via mammalian target of rapamycin (mTOR) and glycogen synthase kinase (GSK)-3β. Confirmation of the expression of each of these factors will confirm that the growth of triploid oysters is dependent on IGF-1/AKT signaling, as has been shown in mammals and other mollusks. In this study, we analyzed the IGF-1/AKT signaling pathway and its involvement in the growth of triploid oysters and confirmed the relationship between the ex- pression of actin and troponin, which are involved in muscle formation in the triploid oyster. Methods Sampling and identification of the triploid oyster Triploid oysters were collected at a farm in Taean- gun, Republic of Korea (latitude 36.903367, longitude 126.26489), in January and February of 2017. A total of 60 oysters were collected and separated into large and small triploid oysters (LTs and STs, respectively). Fig. 1 Morphological correlation of the triploid oyster, Crassostrea Since there is no standardized method for classifying gigas. a Soft tissue weight (STW) according to total weight (TW). b oysters, this study divided them according to the fol- Shell height according to shell length. c Shell width according to lowing criteria. LTs selected samples that meet the shell length. Large triploids (LTs), shaded areas inside the graph; three conditions as shown in Fig. 1. First, both STW small triploids (STs), hatched area inside the graph. n =60 and TW of oysters are higher than average. Second, both shell length and shell height of oysters are above average. Third, shell width and shell length of oysters ethanol, and stored at − 20 °C for more than 4 h. After areaboveaverage.Whenthe threeconditionswere removing the supernatant by centrifugation (3000 rpm, satisfied, they were classified as LTs and vice versa as 10 min), it was washed three times with phosphate- STs. The adductor muscle was isolated, and 0.5 g of buffered saline. Samples were stained with propidium each muscle was subdivided, frozen in liquid nitrogen, iodide for 30 min at room temperature and measured andstoredat − 70 °C. using a flow cytometer (BD Accuri C6, BD Biosciences, Triploidy was confirmed as described previously (Allen Franklin Lakes, NJ, USA). Ten diploid oysters were col- 1983) with minor modifications. Plasma was collected lected from the southern Korean sea for DNA verifica- from 10 of the collected samples, added to 0.7 mL tion compared with the triploid oyster. Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 3 of 10 cDNA synthesis and reverse-transcription polymerase subjected to gel electrophoresis using a 12% polyacryl- chain reaction (RT-PCR) amide gel and transferred to a polyvinylidene fluoride The adductor muscle (0.5 g, LTs n =3; STs n =3) was pul- membrane for immunoblotting. Membranes were blocked verized by adding 1 mL Trans-Zol UP (TransGen Biotech, with Tris-buffered saline containing 0.1% Tween-20 Beijing, China), and total RNA was extracted using Trans- (TBST) and 1% BSA at room temperature for at least 2 h. Zol UP according to the manufacturer’sinstructions. cDNA The membranes were then incubated with the primary was synthesized from 2 μg total RNA using the PrimeScript and secondary antibodies at room temperature for at least first strand cDNA synthesis kit (TaKaRa Bio, Otsu, Japan) 1 h, followed by detection with enhanced chemilumines- according to the manufacturer’s instructions. RT-PCR was cence western blotting reagents (Santa Cruz Biotechnol- performedusingEmeraldAmp GT PCRMasterMix ogy, Inc., Santa Cruz, CA, USA). Between each step, two (TaKaRa Bio). The primers (targeting elongation factor 1α, washes with TBST were performed. The following IGF-1, IGF-IR, IGF binding protein complex acid-labile primary antibodies and the anti-mouse secondary anti- subunit [IGF-ALS], actin, myosin, troponin T, troponin I, body were obtained from Santa Cruz Biotechnology, Inc., and tropomyosin) and reaction parameters (denaturation, and diluted 1:1000: IGF-1, IGF binding protein (IGF-BP)- 95 °C, 30 s; annealing, indicated temperature, 30 s; elong- 3, IGF-1R, phosphorylated (p)-IGF-1R, AKT, p-AKT, ation, 72°C,30s)usedfor RT-PCRare showninTable 1. mTOR, p-mTOR, FoxO, p-FoxO, GSK3β,p-GSK3β, Primers were designed based on the gene sequences of C. eukaryotic translation initiation factor 4E binding proteins gigas obtained from NCBI GenBank. The PCR products 1 (4EBP1), Ribosomal protein S6 kinase beta 1 (p70S6K1), were confirmed by 1% agarose gel electrophoresis. MAFbx, MURF1, LC3, eukaryotic translation initiation factor 2B (elF2B), nebulin, neural Wiskott–Aldrich syn- Protein purification and western blotting drome protein (N-WASP), peroxisome proliferator- Total protein extraction was performed by adding 1 mL activated receptor γ coactivator (PGC) 1α,troponinI, radioimmunoprecipitation buffer to 0.5 g adductor muscle troponin T, and F-actin antibodies. (LTs, n =3; STs, n = 3). The homogenized tissue was cen- trifuged (12,000 rpm, 10 min, 4 °C) and the supernatant Statistical analysis used. Protein quantification was performed using the RT-PCR and western blotting results were analyzed bicinchoninic acid assay, and bovine serum albumin using GeneTools software (version 4.03; Syngene, (BSA) was used as a standard. Proteins (2 μg/μL) were Cambridge, UK). Data are presented as means ± standard Table 1 Primer sequences for RT-PCR, amplicon size, PCR efficiencies, and GenBank accession numbers of the genes evaluated in this study. Primers were designed based on Crassostrea gigas sequences. F forward primer, R reverse primer, AT annealing temperature Gene Accession number Sequence (5′–3′) Amplicon size (bp) PCR cycle AT (°C) EF1α AB122066.1 (F) CCACTGGCCATCTCATTTAC 393 20 60 (R) TGTTGACACCAATGATGAGC IGF-1 XM_011417420.2 (F) ATGGTTTGCCCTGTCTTGAG 336 25 55 (R) AGATCCTTTCTTCTTGCGGC IGF-IR AJ535669.1 (F) TGAGGAGGGTGATGAGGATA 375 25 55 (R) ATTGCACTGTAGGGATTGGA IGF-ALS XM_011417921.2 (F) ATGTCCAAAACAATGCGTCT 359 25 55 (R) TCCAAAACGCGTAACTTTTC Actin-2 EKC31894.1 (F) TTTCGCCGGAGATGATGCCC 434 20 60 (R) TGGGGACAGTGTGGGTGACA Myosin EKC37566.1 (F) TTTGGCTGGTGAGGCACAGG 544 20 60 (R) TTTGCTGAGCTGGCGTTGGA Troponin T XM_020062462.1 (F) AGGAACGCGAGAAAGAACAA 375 20 60 (R) TGATCCTCTGGGACAGGAAG Troponin I XM_011455869.2 (F) CCACCCTGGAGGAAGAAGTC 187 20 60 (R) AAATTGCCACGGAAATCTGA Tropomyosin NM_001308906.1 (F) GCCATGAAAATGGAGAAGGA 381 20 60 (R) GGCGTTATTGAGGTTTTCCA Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 4 of 10 deviation and were analyzed using Statistical Package for Expression of muscle proteins according to triploid oyster Social Sciences, version 10.0 (SPSS, Inc., Chicago, IL, size USA). Statistical analysis was performed using Duncan’s The differences in mRNA and protein expression of multi-range test followed by one-way analysis of vari- actin, myosin, troponin, and tropomyosin, which are in- ance. p < 0.05 was considered to indicate statistical tegral in muscle formation, were examined. The mRNA significance. expression of actin, troponin, and tropomyosin was 1.43–2.22-fold higher in LTs than in STs (Fig. 3a), while the protein expression of actin, troponin T and I, and Results tropomyosin was 1.18–3.60-fold higher in LTs than in Growth characteristics and identification of triploid STs (Fig. 3b). Thus, the expression of mRNAs and pro- oysters teins responsible for muscle formation, contraction, and In total, 60 triploid oysters collected from Taean were relaxation varied depending on the size of the oyster. classified as LTs and STs depending on their size (shell length, SL; shell height, SH; shell width, SW) and weight Expression of IGF-1 according to triploid oyster size (total weight, TW; soft tissue weight, STW). The TW of The expression level of IGF-1 mRNA was three times the triploid oysters ranged from 55.34 to 277.75 g, with a higher in LTs than in STs (Fig. 4a). IGF-ALS, which mean of 125.40 ± 43.50 g. The STW ranged from 7.72 to binds IGF-1 and IGF-IR and initiates IGF-1 signaling, 30.87 g, with a mean of 16.55 ± 5.54 g (Fig. 1a). Fatness also showed high mRNA expression in LTs (Fig. 4a). ranged from 6.80 to 19.30%, with a mean of 13.34 ± IGF-1 protein expression, as well as that of IGF-BP 2.19%. The growth rate of SL/SH, ranged from 0.45 to and IGF-IR, was also higher in LTs compared with STs 0.88, while the growth rate of SW/SL, ranged from 2.20 (Fig. 4b). In particular, the level of p-IGF-IR was signifi- to 4.00 (Fig. 1b, c), with means of 0.63 ± 0.09 and 2.89 ± cantly increased in LTs compared with STs. To investi- 0.38, respectively. In this study, 10 individuals were se- gate the IGF-1/AKT signaling pathway involved in the lected as LTs or STs with a satisfactory combination of synthesis and degradation of muscle proteins, the levels STW/TW, SH/SL, and SW/SL and were used to analyze of AKT1 and p-AKT were assessed. The level of p-AKT the growth signals of muscles according to their size was 1.29-fold higher in LTs compared with STs. (Fig. 1, LTs, shaded areas inside the graph; STs, hatched areas inside the graph). Mechanism of protein synthesis Flow cytometry revealed that the average amount of The expression of mTOR, GSK3β, 4EBP1, and p70S6K1, DNA in diploid oysters, which were used as a control, was elements downstream of IGF-1/AKT signaling associated 245 ± 38.91, and the average amount of DNA in triploid with protein synthesis, were confirmed (Fig. 5a). Phos- oysters was 368 ± 23.23 (Fig. 2). The DNA content ratio of phorylation of mTOR was 1.46-fold higher in LTs com- diploid to triploid oysters was 1:1.5, confirming that the pared with STs. Consequently, the expression level of oysters used in this study were triploid. 4EBP1 was decreased and that of p70S6K1 increased. The Fig. 2 Flow cytometry analysis showing the DNA histograms (top graph) and scatter diagrams (bottom graph) of propidium iodide (red fluorescence, FL2-H)-labeled oysters. a, b Diploid oysters. c, d Triploid oysters. Diploid oysters were used as a control for the amount of DNA. FSC- H, forward side scatter-height; SSC-H, side scatter-height Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 5 of 10 Fig. 3 Expression of muscle-forming proteins according to triploid oyster size. a mRNA expression (n = 5). b Protein expression (n = 3). *p < 0.05 vs. LT. LT, large triploid; ST, small triploid; MFP, muscle-forming proteins expression of p-GSK3β was also 1.37-fold higher in LTs in increased levels of non-phosphorylated nebulin compared with STs. This increased protein synthesis oc- (Fig. 5c). The expression of N-WASP was 1.34-fold curred via inhibition of eIF2B expression. higher in LTs compared with STs. Mechanism of protein degradation PGC1α and troponin The expression of FoxO, an IGF-1/AKT downstream ef- The expression of troponin T and I and PGC1α was in- fector related to protein degradation, was increased creased 1.87-, 1.43-, and 1.57-fold in LTs compared with 2.64-fold in STs compared with LTs (Fig. 5b), in contrast STs, respectively (Figs. 3 and 5c). to mTOR and GSK3β. FoxO affects the function of MAFbx, MURF1, and LC3, and the expression of these Discussion proteins was decreased in LTs compared with STs. Triploid oysters have been reported to grow faster than MAFbx and MURF1 are important in the degradation of diploid oysters because they use the energy required for muscle proteins including myosin via proteasome- maturation for flesh obesity (Allen and Downing 1986; dependent ubiquitylation, and LC3 is involved in the Nell and Perkins 2005). However, oyster size differs to autophagy–lysosome pathway. some extent even under the same conditions. In this study, we used adductor muscles excised from triploid GSK3β and actin polymerization oysters to analyze this difference. Adductor muscle GSK3β increases the phosphorylation of nebulin. Non- (AM) plays an important role in the influx of food and phosphorylated nebulin has been shown to modulate N- communication with the external environment. Oysters WASP to promote elongation and nucleation of actin fila- limit oxygen exchange through shell closure at low tide. ments, thereby enhancing myofibril growth (Takano et al. AM plays an important role in regulating the opening 2010). Inhibition of GSK3β in the triploid oyster resulted and closing of these shells through translucent and white Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 6 of 10 Fig. 4 Expression of upstream proteins in the IGF-1/AKT signaling pathway according to triploid oyster size. a mRNA expression (n= 5). b Protein expression (n = 3). *p < 0.05 vs. LT. LT, large triploid; ST, small triploid; IRP, IGF-1 related proteins opaque muscles. Oxygen is limited but oysters lower intra- and tropomyosin, which form muscles in LT and ST ad- cellular pH for survival and regulate the expression of car- ductor muscle, as well as the mRNA and protein expres- bohydrates, proteins, tRNA, ncRNA, and amino acid sion of IGF-1, differed significantly. In addition, the metabolism-related genes. Among them, dioxygenase, expression of IGF-ALS and IGF-BP, which increases the which corresponds to dietary changes in AM, is drastically half-life in combination with IGF-1 (Baxter et al. 1989), reduced and maintains cysteine homeostasis in food- was also higher in mRNA and protein. This finding restricted situations (Zhang et al. 2012; Chapman et al. confirmed that IGF-1 affects muscle growth in LTs. In 2011). AM is the main organ of oysters that perform these addition, the expression of cofactors required for the functions. Therefore, the formation and development of activity of IGF-1 in tissues was also increased, and the AM has a very important effect on the growth and diet of signaling pathway associated with IGF-1 was activated oysters. On the other hand, AM produces large amounts by increasing phosphorylation of IGF-1R. According to of melanin, and it is reported that the more melanin in Gricourt et al. (2003, 2006), an insulin-like system func- the shell, the higher the dry weight of oysters (Yu et al. tions when C. gigas growth is increased; in particular, 2017; Hao et al. 2015; Xiao yan et al. 2003). Melanin mRNA and protein levels of IGF-1 and insulin removes free radicals and reduces damage to AM, receptor-related receptors are increased. Our results which allows AM to open larger shells and filter out showed that the expression of IGF-1 was high in LTs more algae to speed up growth. We examined the ef- with a high growth rate, consistent with that previous fects of growth factors on muscle formation and activity study. The regression analysis of IGF-1/EF1α gene ex- in the adductor muscle and analyzed related signaling pression according to STW confirmed the significance pathways. (p <0.05).Thisisthefirst reportexplainingtheassoci- IGF-1 plays an important role in muscle growth in trip- ation between STW and IFG-1 gene expression in loid oysters. The expression of actin, myosin, troponin, triploid oysters. Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 7 of 10 Fig. 5 Expression of downstream proteins in the IGF-1/AKT signaling pathway according to triploid oyster size. a Expression of signaling factors related to protein synthesis. b Expression of signaling factors related to protein degradation. c Expression of signaling factors related to myofibrillogenesis. n= 3. *p < 0.05 vs. LT. LT, large triploid; ST, small triploid The size-dependent increase in p-AKT suggested the Furthermore, protein degradation is inhibited by inhib- possibility that IGF-1 signaling regulates protein synthe- ition of FoxO expression, which regulates MAFbx, sis and degradation of muscle via AKT. AKT activity has MURF1, and LC3, which induce protein degradation been reported to increase the activity of mTOR, which is (Stitt et al. 2004; Mammucari et al. 2007). The level of involved in protein synthesis, and to inhibit the activa- activated mTOR was higher, and the expression of tion of GSK3β, which is involved in muscle formation GSK3β and FoxO lower, in LTs than in STs. LTs appear (Glass 2010; Miyazaki and Esser 2009; Sandri 2008; to increase muscle protein content by promoting synthe- Manning and Cantley 2007; Sarbassov et al. 2005). sis and inhibiting degradation of proteins to a greater Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 8 of 10 Fig. 6 IGF-1/AKT signaling pathways in adductor muscle growth and formation in triploid Pacific oyster, Crassostrea gigas degree compared with STs. IGF-1/AKT signaling regu- dephosphorylating eIF2B (Frame and Cohen 2001). It also lates muscle growth in triploid oysters by promoting increases myofibrillogenesis via the regulation of nebulin. protein synthesis and inhibiting degradation. In mamma- In this study, we confirmed that GSK3β increases protein lian cells, PI3K/AKT signaling under hypoxic conditions synthesis in triploid oysters and increases myofibrillogen- has been reported to regulate glucose metabolism and esis via actin polymerization. In oysters such as C. angu- apoptosis (Kim et al. 2012; Parcellier et al. 2008; lata and C. gigas,GSK3β gene expression was reported to Alvarez-Tejado et al. 2001). Guevelou et al. (2013) also be high along with glycogen content in the adductor reported increased expression of AKT under hypoxic muscle at the time of gonad development (Zeng et al. conditions in the smooth muscle of C. gigas; however, 2013;Li et al. 2017). This stored energy is used for sexual AKT expression did not increase under hypoxic condi- maturity. However, in the case of triploid oysters, the tions in striated muscle. These results suggest that AKT, stored energy of the adductor muscle appears to be im- which is expressed in striated muscle of C. gigas,is portant for increasing oyster size through protein synthe- involved in metabolism related to the synthesis and deg- sis and muscle formation. radation of muscle protein rather than regulation of On the other hand, the expression of PGC1α, which glucose metabolism and apoptosis. regulates the expression of FoxO and promotes protein GSK3β, which is involved in protein synthesis, increases degradation, was also higher in LTs compared with STs. phosphorylation of nebulin, which results in inhibition of This influenced the expression of troponin, another fac- actin polymerization (Takano et al. 2010). In the case of tor that acts on PGC1α (Vescovo et al. 2005). Striated adductor muscle, oyster size affects both muscle formation muscle contracts and relaxes by the action of myosin via protein synthesis and degradation and muscle move- and actomyosin, a complex of actin–troponin–tropomy- 2+ ment via muscle relaxation. Inhibition of GSK3β by phos- osin, and Ca (Clark et al. 2002; Geeves and Holmes phorylation of AKT inhibited the phosphorylation of 1999; Gordon et al. 2000; Kuo and Ehrlich 2015). Tropo- 2+ nebulin, which in turn binds to N-WASP and contributes nin acts as a site for Ca to bind actomyosin. Therefore, to muscular movement (Rommel et al. 2001). The expres- we suggested that the expression of LT was higher than sion of nebulin and N-WASP was higher in LTs compared that in ST, as well as muscle formation of muscle with STs. In particular, the expression of N-WASP was protein. 13-fold higher in LTs than in STs. This result confirms Taken together, these results indicate that growth of that the IGF-1/AKT/GSK3β/N-WASP signaling pathway the adductor muscle of triploid oysters occurs by pro- influences the formation of adductor muscle and the con- moting the formation of muscle proteins through the trol of movement in triploid oysters. GSK3β deactivated IGF-1/AKT signaling pathway and inhibiting degrad- by IGF-1 increases glycogen synthesis by dephosphorylat- ation. GSK3β and PGC1α also affect muscle formation ing glycogen synthase and increases protein synthesis by and movement (Fig. 6). Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 9 of 10 In this study, it was examined how various factors af- Buckway CK, Guevara-Aguirre J, Pratt KL, Burren CP, Rosenfeld RG. The IGF-I generation test revisited: a marker of GH sensitivity. J Clin Endocrinol Metab. fecting muscle growth, formation, and movement of the 2001;86:5176–83. adductor muscle of triploid oysters vary with oyster size. Chapman RW, Mancia A, Beal M, Veloso A, Rathburn C, Blair A, Holland AF, Warr Our results will improve our understanding of muscle GW, Didinato G, Sokolova IM, Wirth EF, Duffy E, Sanger D. The transcriptomic responses of the eastern oyster, Crassostrea virginica, to environmental growth, formation, and movement of triploid oysters via conditions. Mol Ecol. 2011;20:1431–49. IGF-1/AKT signaling. We also confirmed that the ad- Clark KA, McElhinny AS, Beckerle MC, Gregorio CC. Striated muscle ductor muscle of the triploid oyster affects the size of cytoarchitecture: an intricate web of form and function. Annu Rev Cell Dev Biol. 2002;18:637–706. the oyster. The results of this study will be important for D’Ercole AJ, Stiles AD, Underwood LE. Tissue concentrations of somatomedin C: further studies investigating muscle growth of triploid further evidence for multiple sites of synthesis and paracrine or autocrine oysters and marine mollusks. mechanisms of action. Proc Natl Acad Sci USA. 1984;81:935–9. Frame S, Cohen P. GSK3 takes centre stage more than 20 years after its discovery. Biochem J. 2001;359:1–16. Conclusions Frick GP, Tai LR, Baumbach WR, Goodman HM. Tissue distribution, turnover, and Through the IGF-1/AKT signaling pathway, increased glycosylation of the long and short growth hormone receptor isoforms in rat tissues. Endocrinol. 1998;139:2824–30. protein synthesis (mTOR/4EBP1 and p70S6K1; GSK3β/ Geeves MA, Holmes KC. Structural mechanism of muscle contraction. Annu Rev elF2B), inhibition of protein degradation (FoxO/MAFbx, Biochem. 1999;68:687–728. MURF1, LC3), and activation of muscle-forming pro- Glass DJ. PI3 kinase regulation of skeletal muscle hypertrophy and atrophy. Curr Top Microbiol Immunol. 2010;346:267–78. teins (PGC1α/troponin; GSK3β/N-WASP) occur in the Gordon AM, Homsher E, Regnier M. Regulation of contraction in striated muscle. adductor muscle of triploid oysters. All of these pro- Physiol Rev. 2000;80:853–924. cesses affect the growth of triploid oysters, and activa- Gosteli-Peter M, Winterhalter KH, Schmid C, Froesch ER, Zapf J. Expression and regulation of insulin-like growth factor-I (IGF-I) and IGF-binding protein tion of IGF-1/AKT signaling results in a larger size of messenger ribonucleic acid levels in tissues of hypophysectomized rats the triploid oyster, C. gigas. infused with IGF-I and growth hormone. Endocrinol. 1994;135:2558–67. Gricourt L, Bonnec G, Boujard D, Mathieu M, Kellner K. Insulin-like system and Authors’ contributions growth regulation in the Pacific oyster Crassostrea gigas: hrIGF-1 effect on YHC contributed to the conceptualization, writing–review and editing, protein synthesis of mantle edge cells and expression of an homologous supervision, project administration, and funding acquisition. EYK contributed insulin receptor-related receptor. Gen Comp Endocrinol. 2003;134:44–56. to the investigation, data analysis, and writing–original draft preparation. Gricourt L, Mathieu M, Kellner K. An insulin-like system involved in the control of Both authors read and approved the final manuscript. Pacific oyster Crassostrea gigas reproduction: hrIGF-1 effect on germinal cell proliferation and maturation associated with expression of an homologous Funding insulin receptor-related receptor. Aquaculture. 2006;251:85–98. This research was supported by the Basic Science Research Program through Guevelou E, Huvet A, Sussarellu R, Milan M, Guo X, Li L, Zhang G, Quillien V, the National Research Foundation of Korea (NRF) funded by the Ministry of Daniel J, Quere C, Boudry P, Corporeau C. Regulation of a truncated isoform Education (NRF-2016R1D1A1B03934914). of AMP-activated protein kinase alpha (AMPKalpha) in response to hypoxia in the muscle of Pacific oyster Crassostrea gigas. J Comp Physiol B. 2013;183: Availability of data and materials 597–611. All data sets generated during and/or analyzed during the current study are Guo X, DeBrosse GA, Allen SK. All-triploid Pacific oysters (Crassostrea gigas Thunberg) available from the authors on reasonable request. produced by mating tetraploids and diploids. Aquaculture. 1996;142:149–61. Hao S, Hou X, Wei L, Li J, Li Z, Wang X. Extraction and identification of the Ethics approval and consent to participate pigment in the adductor muscle scar of pacific oyster Crassostrea gigas. PLoS Not applicable ONE. 2015;10:e0142439. Hopkins AE. Activity of the adductor muscle in oysters. Physiol Zool. 1936;9: Consent for publication 498–507. Not applicable Jorgensen JOL, Jessen N, Pedersen SB, Vestergaard E, Gormsen L, Lund SA, Billestrup N. GH receptor signaling in skeletal muscle and adipose tissue in human subjects following exposure to an intravenous GH bolus. Am J Competing interests Physiol Endocrinol Metabol. 2006;291:E899–905. The authors declare that they have no competing interests. Kim TR, Cho EW, Paik SG, Kim IG. Hypoxia-induced SM22alpha in A549 cells activates the IGF1R/PI3K/Akt pathway, conferring cellular resistance against Received: 21 May 2019 Accepted: 20 August 2019 chemo- and radiation therapy. FEBS Lett. 2012;586:303–9. Kuo IY, Ehrlich BE. Signaling in muscle contraction. Cold Spring Harbor perspectives in biology. 2015;7:a006023. References Li B, Meng J, Li L, Liu S, Wang T, Zhang G. Identification and functional Allen SK. Flow cytometry: Assaying experimental polyploid fish and shellfish. characterization of the glycogen synthesis related gene glycogenin in Pacific Aquaculture. 1983;33:317–28. oysters (Crassostrea gigas). J Agric Food Chem. 2017;65:7764–73. Allen SK, Chew KK, Downing SL, Program WSG. Hatchery manual for producing Mammucari C, Milan G, Romanello V, Masiero E, Rudolf R, Del Piccolo P, Burden triploid oysters. Seattle: University of Washington Press; 1989. p. 27. SJ, Di Lisi R, Sandri C, Zhao J, Goldberg AL, Schiaffino S, Sandri M. FoxO3 Allen SK, Downing SL. Performance of triploid Pacific oysters, Crassostrea gigas controls autophagy in skeletal muscle in vivo. Cell Metabol. 2007;6:458–71. (Thunberg). I. Survival, growth, glycogen content, and sexual maturation in Manning BD, Cantley LC. AKT/PKB signaling: navigating downstream. Cell. 2007; yearlings. J Exp Mar Biol Ecol. 1986;102:197–208. 129:1261–74. Alvarez-Tejado M, Naranjo-Suarez S, Jiménez C, Carrera AC, Landázuri MO, del Miyazaki M, Esser KA. Cellular mechanisms regulating protein synthesis and Peso L. Hypoxia induces the activation of the Phosphatidylinositol 3-Kinase/ skeletal muscle hypertrophy in animals. J Appli Physiol. 2009;106:1367–73. Akt cell survival pathway in PC12 cells: protective role in apoptosis. J Biol Chem. 2001;276:22368–74. Nell JA. Farming triploid oysters. Aquaculture. 2002;210:69–88. Baxter RC, Martin JL, Beniac VA. High molecular weight insulin-like growth factor Nell JA, Perkins B. Studies on triploid oysters in Australia: farming potential of binding protein complex. Purification and properties of the acid-labile triploid Pacific oysters, Crassostrea gigas (Thunberg), in Port Stephens, New subunit from human serum. J Biologic Chem. 1989;264:11843-11848. South Wales, Australia. Aquacul Res. 2005;36:530–6. Kim and Choi Fisheries and Aquatic Sciences (2019) 22:19 Page 10 of 10 Parcellier A, Tintignac LA, Zhuravleva E, Hemmings BA. PKB and the mitochondria: AKTing on apoptosis. Cell Signal. 2008;20:21–30. Rennie MJ, Wackerhage H, Spangenburg EE, Booth FW. Control of the size of the human muscle mass. Annu Rev Physiol. 2004;66:799–828. Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN, Yancopoulos GD, Glass DJ. Mediation of IGF-1-induced skeletal myotube hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways. Nat. Cell Biol. 2001;3: 1009–13. Sandri M. Signaling in muscle atrophy and hypertrophy. Physiology. 2008;23: 160–70. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science. 2005;307:1098–101. Schiaffino S, Dyar KA, Ciciliot S, Blaauw B, Sandri M. Mechanisms regulating skeletal muscle growth and atrophy. FEBS J. 2013;280:4294–314. Schiaffino S, Mammucari C. Regulation of skeletal muscle growth by the IGF1- Akt/PKB pathway: insights from genetic models. Skeletal Muscle. 2011;1:4. Stanley JG, Allen SK Jr, Hidu H. Polyploidy induced in the American oyster, Crassostrea virginica, with cytochalasin B. Aquaculture. 1981;23:1–10. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M, Yancopoulos GD, Glass DJ. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell. 2004;14:395–403. Takano K, Watanabe-Takano H, Suetsugu S, Kurita S, Tsujita K, Kimura S, Karatsu T, Takenawa T, Endo T. Nebulin and N-WASP cooperate to cause IGF-1-induced sarcomeric actin filament formation. Science. 2010;330:1536–40. Velloso CP. Regulation of muscle mass by growth hormone and IGF-I. Br J Pharmacol. 2008;154:557–68. Vescovo G, Ravara B, Gobbo V, Angelini A, Dalla Libera L. Skeletal muscle fibres synthesis in heart failure: role of PGC-1alpha, calcineurin and GH. Int J Cardiol. 2005;104:298–306. Xiao yan LI, Liu ZH, Cai RX. A study on scavenging activity of melanin to hydroxyl free radicals. J Sichuan Univ. 2003;40:1132–6. Yu W, He C, Cai Z, Xu F, Wei L, Chen J, Jiang Q, Wei N, Li Z, Guo W, Wang X. A Preliminary study on the pattern, the physiological bases and the molecular mechanism of the adductor muscle scar pigmentation in pacific oyster Crassostrea gigas. Front Physiol. 2017;8:699. Zeng Z, Ni J, Ke C. Expression of glycogen synthase (GYS) and glycogen synthase kinase 3beta (GSK3beta) of the Fujian oyster, Crassostrea angulata, in relation to glycogen content in gonad development. Com Biochem Physiol B. 2013; 166:203–14. Zhang G, et al. The oyster genome reveals stress adaptation and complexity of shell formation. Nature. 2012;490:49–54. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Journal

Fisheries and Aquatic SciencesSpringer Journals

Published: Sep 6, 2019

References