Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Reduced Tau protein expression is associated with frontotemporal degeneration with progranulin mutation

Reduced Tau protein expression is associated with frontotemporal degeneration with progranulin... Reduction of Tau protein expression was described in 2003 by Zhukareva et al. in a variant of frontotemporal lobar degeneration (FTLD) referred to as diagnosis of dementia lacking distinctive histopathology, then re-classified as FTLD with ubiquitin inclusions. However, the analysis of Tau expression in FTLD has not been reconsidered since then. Knowledge of the molecular basis of protein aggregates and genes that are mutated in the FTLD spectrum would enable to determine whether the “Tau-less” is a separate pathological entity or if it belongs to an existing subclass of FTLD. To address this question, we have analyzed Tau expression in the frontal brain areas from control, Alzheimer’s disease and FTLD cases, including FTLD- Tau (MAPT), FTLD-TDP (sporadic, FTLD-TDP- GRN,FTLD-TDP-C9ORF72) and sporadic FTLD-FUS, using western blot and 2D-DIGE (Two-Dimensional fluorescence Difference Gel Electrophoresis) approaches. Surprisingly, we found that most of the FTLD-TDP-GRN brains are characterized by a huge reduction of Tau protein expression without any decrease in Tau mRNA levels. Interestingly, only cases affected by point mutations, rather than cases with total deletion of one GRN allele, seem to be affected by this reduction of Tau protein expression. Moreover, proteomic analysis highlighted correlations between reduced Tau protein level, synaptic impairment and massive reactive astrogliosis in these FTLD-GRN cases. Consistent with a recent study, our data also bring new insights regarding the role of progranulin in neurodegeneration by suggesting its involvement in lysosome and synaptic regulation. Together, our results demonstrate a strong association between progranulin deficiency and reduction of Tau protein expression that could lead to severe neuronal and glial dysfunctions. Our study also indicates that this FTLD-TDP-GRN subgroup could be part as a distinct entity of FTLD classification. Keywords: Frontotemporal lobar degeneration, Tau protein, Progranulin, Synaptic impairment, Astrogliosis Introduction language. Depending on the first and prevailing symp- Frontotemporal Lobar Degeneration (FTLD) accounts toms, there are three different clinical subtypes in- for 10 to 20 % of all demented cases. With an onset cluding the behavioral variant FTLD (bvFTLD) and usually occurring between 45 and 64 years of age, two subtypes of primary progressive aphasia: progres- FTLD represents the second common cause of de- sive nonfluent aphasia (PNFA) and semantic dementia mentia in the presenile age group (<65 years of age) [2, 3]. In addition, movement disorder can also be [1]. FTLD is a clinical syndrome characterized by pro- observed in 10 to 15 % of FTLD cases (corticobasal gressive deterioration in behavior, personality and/or syndrome, parkinsonism and/or amytrophic lateral sclerosis (ALS)) [4]. Given this phenotype variability, * Correspondence: valerie.buee-scherrer@inserm.fr FTLD clinical diagnosis remains difficult and uneasy University of Lille, Inserm, CHU-Lille, F-59000 Lille, France to establish with certainty [5]. However, genetics has Université Artois, Faculté Jean Perrin, F-62307 Lens, France allowed for a better stratification of FTLD spectrum. Full list of author information is available at the end of the article © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 2 of 14 In fact, gene mutations also play an important role in With the progress in genetics and neuropathology of FTLD with 30 to 50 % of patients reporting a positive FTLD, the question of whether this reduction of Tau ex- family history of FTD and 10 to 15 % of patients cor- pression is seldom remains ill-defined. In this study, we responding to dominantly inherited form [6]. Firstly used western blot analysis to investigate human brain Tau described are the MAPT mutations [7]. Mutations in protein expression in Control, AD, FTLD-Tau, FTLD- the progranulin gene GRN were then found to be the TDP-GRN, FTLD-TDP-C9ORF72, sporadic FTLD-TDP most frequent mutations associated with FTLD [8, 9]. and sporadic FTLD-FUS brains. Remarkably, we demon- More recently, two studies demonstrated that ex- strated a huge reduction of all six human brain Tau panded hexanucleotide GGGGCC repeats in a non- isoforms only in a subset of FTLD-TDP brains with muta- coding region of the chromosome 9 open reading tion on the GRN gene. Thus, our data clearly suggest that frame 72 (C9ORF72) gene was responsible for a large these specific cases, referred to as FTLD-TDP-GRNlτ proportion of both familial FTLD and ALS [10, 11]. (lτ for low levels of Tau protein), could be part of the Less frequently mutations in the valosin containing current classification as a distinct entity with more protein (VCP) gene or charged multivesicular body severe synaptic dysfunction and astrogliosis. protein 2B (CHMP2B) gene are also found associated with FTLD [12, 13]. Materials and methods The definite diagnosis relies on neuropathological Frontal cortical brain tissues from Controls (n = 8), AD examination of the brain, the characteristics of these (n = 8), FTLD-Tau (n = 6), FTLD-TDP-GRN (n = 10), brain lesions and their molecular basis [14]. Indeed, FTLD-TDP-C9ORF72 (n = 10), sporadic FTLD-TDP (n =8) as many neurodegenerative diseases, FTLD are char- and sporadic FTLD-FUS (n =5) were provided from both acterized by the presence of protein aggregates in the Lille Neurobank and GIE NeuroCeb in Paris. The brain affected brain regions. However, in contrast to the banks fulfill criteria from the French Law on biological well-characterized nature of protein inclusions (Aβ resources including informed consent, ethics review plaques and neurofibrillary tangles) in Alzheimer’s committee and data protection (article L1243-4 du disease (AD), proteinaceous aggregates in FTLD can Code de la Santé publique, August 2007). be formed of different proteins [15]. Thus, approxi- matively 40 % of FTLD cases display aggregates made Biochemical analysis of abnormally and hyperphosphorylated Tau proteins Frontal grey matter necropsic tissues (around 100 mg) and constitute the FTLD-Tau subclass. However, most were homogenized in UTS buffer (Urea 8 M, Thiourea of FTLD brains are negative for Tau inclusions and 2 M, SDS 2 %) using a tissue grinder Potter-Elvehjem exhibit neuronal cytoplasmic and/or nuclear inclu- with a PTFE Pestle. The homogenate was further soni- sions immunoreactive for transactive response DNA cated on ice and spun at 7500 × g during 10 min to re- binding protein 43 (TDP-43) and constitute the move tissue debris. The supernatant was kept at −80 °C FTLD-TDP subclass [16, 17]. This latter is subdivided until use. Protein amount was determined by Bradford into sporadic FTLD-TDP, FTLD-TDP-GRN (patients with protein assay, subsequently diluted in NuPAGE® lithium mutations on GRN) and FTLD-TDP-C9ORF72 (patients dodecyl sulfate (LDS) 4× sample buffer (glycerol 40 %, with mutations on C9ORF72)[8–11]. To a lesser extent, LDS 4 %, Ficoll 400 4 %, Triethanolamine chloride another protein called FUS (Fused in Sarcoma protein) is 800 mM, phenol red 0.025 % and Coomassie G250 found in aggregates that are Tau and TDP-43 negative [18, 0.025 %, EDTA disodium 2 mM, pH 7.6) supplemented 19]. This subclass is thus named FTLD-FUS. Finally, in- with NuPAGE® sample reducing agents (Invitrogen) and clusions negative for Tau, TDP-43 or FUS are observed in loaded onto 4–12 % NuPAGE® Bis-Tris Novex Gels. Pro- rare cases of FTLD and associated with ubiquitin- teins were transferred on nitrocellulose membrane of proteasome system related proteins (FTLD-UPS) [20]. 0.45 μM porosity (GE Lifesciences) using liquid transfer Prior to the discovery of the main molecular actors of XCell II™ Blot Module, according to the manufacturer’s FTLD, studies described a partial or total loss of soluble or instructions (Invitrogen). After saturation for 30 min at physiological Tau protein expression in both grey and room temperature with TNT (Tris 15 mM, pH 8, NaCl white matter [21, 22]. This loss of Tau was originally 140 mM, Tween 0.05 %) added with 5 % skimmed milk found in a subset of dementia called DLDH for Dementia powder or 5 % BSA, membranes were rinsed three times Lacking Distinctive Histopathology (renamed later FTLD- 10 min with TNT and thereafter incubated with primary ni for FTLD with no inclusion) [23]. In 2006, most of and secondary horseradish peroxidase-coupled anti- these cases were reclassified as FTLD-U (presenting with bodies. All primary antibodies and dilutions are listed in ubiquitin positive inclusions) [24]. However, additional in- Table 1. The peroxidase activity was revealed using a vestigation with specific regards to this loss of Tau expres- chemiluminescence kit (ECL, GE Lifesciences) and an sion has not been reported since Zhukareva et al. in 2003. ImageQuant™ LAS4000 biomolecular imaging system Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 3 of 14 Table 1 Antibodies used in this study Name Abbreviation Epitope Origin Provider Dilution Reference Tau Anti-total Tau (N-ter) N-ter First 19 aa in amino-terminal region Rabbit Home-made 1/10 000 [70] Anti-total- Tau (Tau 5) Tau 5 Middle region of Tau (aa 218–225) Mouse Invitrogen 1/2 000 [71] Anti-total-Tau (C-ter) C-ter Last 15 aa in carboxy-terminal region Rabbit Home-made 1/10 000 [72] Synaptic proteins α-synuclein α-syn Aa 15–123 of rat synuclein-1 Mouse BD Labsciences 1/500 [73] Post-synaptic density 95 PSD-95 Human PSD-95 Rabbit Cell Signaling 1/1000 [74] Munc-18 Munc-18 Aa 577–594 of rat Munc-18 Rabbit Sigma 1/10 000 [75] Synaptophysine SYP Aa 221–313 of human SYP Mouse Santa Cruz 1/10 000 [76] Astrocytic proteins Glutamine synthetase GS Aa 250–350 of Human GS Rabbit Abcam 1/10 000 N/A Glial Fibrillary Acidic Protein GFAP Bovin GFAP FL Mouse Santa Cruz 1/1000 [77] Others β-actin Actin N-ter Mouse Sigma-Aldrich 1/10 000 N/A Neuron Specific Enolase NSE Aa 269–286 of Human NSE Rabbit Enzo Life Science 1/50 000 N/A Aconitase Bovine heart mitochondria Mouse Abcam 1/1000 [78] Histone H3 H3 C-terminus of human H3 Rabbit Millipore 1/10 000 [79] For each antibody, the full name, abbreviation, recognized sequence, origin, provider, dilution and literature reference are given. N/A Not Available (GE Lifesciences), according to the manufacturer’s in- fluorescent dye and used as internal standard in accord- structions. Quantifications were performed using ImageJ ance with the manufacturer’s instructions (GE Life- 1.46 software (NIH Software). sciences). Finally, the internal standard labeled with Cy2 and the samples labeled with either Cy3 or Cy5 were Sample preparation for two-dimensional differential gel pooled and the final volume was adjusted to 350 μLby electrophoresis (2D-DIGE) the addition of rehydration buffer [Urea 8 M, Thiourea Frozen UTS brain samples (a total of 1.5 mg of protein 2 M, CHAPS 2 %, Destreak reagent 1.1 % (GE Life- for each condition) was unfrozen on ice and proteins sciences), IPG buffer pH 3–11 1.2 % (GE Lifesciences), were precipitated using chloroform/methanol precipita- bromophenol blue 0.01 %]. Samples were prepared in tion [25]. The protein-dried pellet was resuspended in quadruplicate and loaded onto four independent IPG UTC buffer (Urea 8 M, Thiourea 2 M supplemented strips. Eighteen cm long linear pH gradient of 3–11 IPG with 4 % CHAPS) and kept at −80 °C until use. Protein strips (GE Lifesciences) were rehydrated overnight with concentration was measured using Quick-Start Bradford the samples in a rehydration cassette recovered with Dye Reagent (Bio-Rad) and sample quality was evaluated mineral oil. Excess or mineral oil was discarded and iso- by loading 15 μgofproteinsonto4–12 % NuPAGE® electrofocalisation was achieved using IPGphor isoelec- Bis-Tris Novex Gels and stained with Coomassie R-250 tric focusing apparatus (GE Lifesciences). A seven steps (Biorad). procedure was applied with the following conditions: 150 V for 1 h, 200 V for 5 h, 200 V to 500 V step gradi- 2D-DIGE ent for 2 h, 500 to 1000 V step gradient for 2 h, 1000 V The 2D-DIGE was performed as previously described to 4000 V gradient for 2 h, and finally 8000 V gradient [25]. Briefly, 50 μg of protein was covalently coupled for 2 h. Current was limited to 50 μA per strip. Strips with 400 pmol of cyanine dyes diluted in dimethylforma- were then equilibrated in equilibration buffer (Urea 6 M, mide, according to the manufacturer’s instructions SDS 2 %, Glycerol 30 %, Tris–HCl 50 mM, pH 8.6) with (CyDIGE, GE Lifesciences). Each sample was labeled successively 1 % DTT (dithiothreitol) and 4.7 % iodoace- with either Cy3 or Cy5 fluorescent dyes (GE Life- tamide for 15 min. Proteins were then separated in the sciences) and kept for 1 h at 4 °C in darkness. Cross- second dimension on 1 mm-thick 12 % SDS-PAGE gels labeling with either Cy3 or Cy5 dyes was performed in in an ETTAN DALTSix system (GE Lifesciences). Gels order to avoid a preferential coupling of one cyanine to were run at 2.5 W per gel overnight. Fluorescently la- a sample. A pool of both samples containing equal beled protein spots were visualized using a Typhon FLA amount of protein (50 μg in total) was labeled with Cy2 9500 imager (GE Lifesciences). Gels were scanned at Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 4 of 14 200 μm resolution and images were exported for further transcription kit. RT-qPCR analysis was performed analysis using SameSpots (TotalLab) software. using an Applied Biosystems Prism 7900 SYBR Green PCR Master Mix. The amplification conditions were Data analysis as follows: initial step of 10 min at 95 °C, followed by Spot detection and relative quantification of spot intensity 45 cycles of a 2-step PCR consisting of a 95 °C de- were analyzed using 2-DIGE analysis software package naturing step for 15 s followed by a 60 °C extension SameSpots (TotalLab). One-way ANOVA statistical test step for 25 s. Primers used were: Tau 5’UTR 5’ACAGCCA was applied and expression change was considered as sig- CCTTCTCCTCCTC3’ and 5’ GATCTTCCATCACTTCG nificant with an exact p-value below 0.05. Normalization AACTCC3’; Tau E11-12 5’ACCAGTTGACCTGAGCA across all gels was performed using the internal standard. AGG3’ and 5’ AGGGACGTGGGTGATATTGT3’ and RPLP0 5’GCAATGTTGCCAGTGTCTG3’ and 5’ GCC Preparative 2D gels TTGACCTTTTCAGCAA3’. Amplifications were carried In order to identify proteins of interest, two preparative out in triplicate and the relative expression of target genes 2D-gels with respectively 500 μg of brain protein of each was determined by the ΔΔC method [26]. condition were performed. After electrophoresis, gels were fixed in ethanol 30 %, orthophosphoric acid (OPA) Statistical analysis 2 % overnight. Following washing in OPA 2 %, gels were For western blot and RT-qPCR statistical analyses, the incubated 30 min in pre-coloration buffer (ethanol 18 %, non-parametric Mann–Whitney test or the Kruskall- OPA 2 % and ammonium sulfate 0.9 M) before Coomassie Wallis test were performed. All statistical analyses were blue staining (Brillant Blue G-250, Bio-Rad) for 48 h. performed using the GraphPad Prism 6 program (GraphPad Software) and statistical significance was set Trypsin digestion, mass spectrometry and protein at * p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. identification Spot labelling shown to be significantly different between Results two conditions after SameSpots analyses was manually ex- Neuropathology cised from preparative gels. Each separate spot was incu- Neuropathological assessment of all cases was per- bated in DTT 10 mM and alkylated (iodoacetamide formed in the departments of anatomo-pathology of 55 mM) before trypsin digestion (Promega) overnight at CHU-Lille and Hôpital Pitié-Salpêtrière. Detailed infor- 37 °C, according to the manufacturer’s instructions. Super- mation on pathology and demographic data are summa- natants, containing digested peptides, were dried using rized in Table 2. centrifuge vacuum (Concentrator 5301, Eppendorf) and resuspended in ultra-pure water supplemented with Reduction of Tau protein expression is observed in FTLD- trifluoroacetic acid (TFA) 0,1 %. The resulting peptide TDP brains associated with GRN gene mutation without mixture was spotted onto a MALDI plate with freshly dis- Tau mRNA decrease solved α-cyano-4-hydroxycinnaminic acid (10 mg/ml in Tau protein expression was studied in all cases. We first acetonitrile 50 %, TFA 0.1 %). Mass spectrometry was checked by western-blotting, if there was any Tau path- achieved with a MALDI-TOF-TOF Autoflex Speed ology in these brains, since it has been described in AD, (Bruker Daltonics). MS and MS/MS data were ana- and a subset of FTLD-TDP patients [27, 28]. Lack of lyzed with BioTools software and peptides sequences were phospho-Tau immunoreactivity was a condition to ex- analyzed with Mascot (http://www.matrixscience.com/). A clude Tau pathology and therefore any FTLD-Tau as mascot score above 61 was considered significant for pro- compared with FTLD-MAPT and AD (data not shown). tein identification. Thereafter, Tau expression was investigated by using antibodies targeting Tau protein independently of its mRNA extraction and quantitative real-time polymerase phosphorylation state to evaluate total Tau protein level. chain reaction (RT-qPCR) analysis These well-characterized antibodies either target the Total RNA was extracted from the tissue of the frontal amino-terminal (Tau N-ter), the median (Tau 5) or cortex and purified using the RNeasy Lipid Tissue Mini carboxy-terminal epitope of Tau (Tau C-ter). In adult Kit (Qiagen) following the manufacturer’s instructions. human brain, six Tau isoforms are expressed from For each RNA sample, integrity (RIN, RNA Integrity MAPT gene through alternative mRNA splicing [28]. Number) was assessed on 2100 bioanalyzer (Agilent These six Tau isoforms give rise to a unique biochemical Technologies, Waldbronn, Germany) using the RNA signature made of three bands (Fig. 1a, Control patients 6000 nano kit according to the manufacturer protocol. 1 to 3). Thus, western blot analysis highlighted signifi- One microgram of total RNA was reverse-transcribed cant decrease of all six Tau isoforms in eight FTLD-TDP using Applied Biosystems High Capactiy cDNA reverse brains compared to control, AD and other FTLD brains Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 5 of 14 Table 2 Demographic data on studied cases Genetic diagnosis Cases Neuropathology Age (yr) Sex PMD (hr) RIN (a.u) Fixed hemibrain (g) Genetic variant Controls 1 73 M 10 6,6 508 2 84 M 15,5 5,3 N/A 3 70 M 31 5,6 765 4 76 F 28 4,8 580 5 86 F N/A 5,1 540 6 79 M N/A 6,3 675 7 69 M 6 6,9 632 8 60 F 28 6,8 788 FTLD, sporadic 9 FTLD-TDP Type A 84 M 25 4,4 614 10 FTLD-TDP Type A 42 M 37 5,7 684 11 FTLD-TDP Type C 86 M 44 4,8 504 12 FTLD-TDP 67 F 22 6,3 495 13 FTLD-TDP Type C 68 M N/A 2,5 430 14 FTLD-TDP Type C 72 M 16 5,8 452 15 FTLD-TDP Type B 53 M 5 8 600 16 FTLD-TDP Type B 77 M 17 5,5 378 17 FTLD-FUS 35 M 64 5,5 N/A 18 FTLD-FUS 59 M 30 6,6 430 19 FTLD-FUS 44 M 11 5,7 504 20 FTLD-FUS 35 F 17 5,9 495 21 FTLD-FUS 54 M 18 4,8 424 FTLD, GRN 22 FTLD-TDP Type A 71 M 23 3 556 c.813_816del 23 FTLD-TDP Type A 69 F 39 3,8 370 c.1494_1498del 24 FTLD-TDP Type A 60 F N/A 3,7 200 c.1494_1498del 25 FTLD-TDP Type A 65 F N/A 5,9 N/A c.619dup 26 FTLD-TDP Type A 67 M 22 3,4 608 c.813_816del 27 FTLD-TDP Type A 69 M 18,5 7 166 c.1494_1498del 28 FTLD-TDP Type A 78 F 20 4 420 N/A 29 FTLD-TDP Type A 75 M 21 5,3 419 c.1157G > A 30 FTLD-TDP Type A 73 M 10 5,6 456 Complete deletion 31 FTLD-TDP Type A 86 F 5,5 6,8 388 Complete deletion FTLD, C9ORF72 32 FTLD-TDP 59 M 51 6,4 N/A 33 FTLD-TDP Type B 42 M 10 3,2 N/A 34 FTLD-TDP Type B 40 F 48 4,5 N/A 35 FTLD-TDP Type B 63 M 13 5,2 762 36 FTLD-TDP 90 M 40 4,4 N/A 37 FTLD-TDP 62 M N/A 5,1 541 38 FTLD-TDP Type B 69 M 8,5 4,4 N/A 39 FTLD-TDP Type B 65 M 20 5,3 400 40 FTLD-TDP Type B 62 F 5,5 7,6 258 41 FTLD-TDP Type B 59 M 8,5 6 438 Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 6 of 14 Table 2 Demographic data on studied cases (Continued) FTLD, MAPT 42 FTLD-Tau 48 F 44,5 6,1 N/A P301L 43 FTLD-Tau 54 F N/A 7,8 N/A S305S 44 FTLD-Tau 43 M 6 4,8 N/A P301L 45 FTLD-Tau 65 F 30,5 3,4 315 P301L 46 FTLD-Tau 66 M 30 5,9 N/A P301L 47 FTLD-Tau 85 F 21 5 360 P332S AD 48 AD 79 F 48 4,7 474 59 AD 73 F 26 4,7 460 50 AD 55 F N/A 4,8 416 51 AD 75 M 30 4,1 529 52 AD 74 M 10 3 N/A 53 AD 63 M 18 6,1 366 54 AD 61 M 23 7 414 55 AD 62 M 10 6 435 AD Alzheimer’s disease. C9ORF72, chromosome 9 open reading frame 72, FTLD FrontoTemporal Lobar Degeneration, GRN, progranulin, MAPT microtubule- associated protein tau, PMD postmortem delay, RIN RNA Integrity Number, sp, sporadic cases. a.u arbitrary unit, N/A Not Available (patients 22 to 29, Fig. 1a). Interestingly, this decrease is ob- expression. For this purpose, proteomes of FTLD-TDPτ served with all three Tau antibodies suggesting that Tau brains (n = 3, cases 14, 15 and 16) and FTLD-TDP- holoprotein isoform expression is impaired (Fig. 1a, com- GRNlτ (n = 3, cases 22, 24 and 25) were compared. Fol- pare patient 25 with patient 33). More interestingly, this re- lowing bioinformatics assisted analysis of 2D-DIGE gels duction of Tau protein expression is restricted to FTLD- (n = 4), 26 protein spots with significant differential level TDP brains associated with mutations on the GRN gene of expression between FTLD-TDP-GRNlτ and FTLD- (Fig. 1a and b) and not associated with other FTLD-related TDPτ brains were isolated for further identification gene mutations. Indeed, Tau proteinexpressioninFTLD- (Fig. 2a, b; Table 3). According to the mass spectrometry TDP-C9ORF72, sporadic FTLD-TDP or FTLD-FUS pa- analysis, 20 distinct proteins including 6 isovariants of tients is rather homogeneous from one patient to another the same protein were identified. Among the 20 proteins with each antibody (Fig. 1a). Consequently to these results, identified with a significant mascot score (>61), the GRN cases with reduced Tau protein levels were designated amount of seven proteins decreased while that of 13 in- as FTLD-TDP-GRNlτ and other FTLD-TDP cases with creased in FTLD-TDP-GRNlτ (Table 3). Eleven proteins conserved Tau protein expression as FTLD-TDPτ. which intensity varies belong to proteins involved in me- This reduced Tau protein level could result from a lower tabolism (Table 3). Stress-related protein HSP-70.1 and transcription of MAPT gene in these brains. However, RT- structural proteins such as Gelsolin and Neurofilament qPCR using primers targeting constitutively Tau mRNA light chain showed an increased expression (Table 3). A encoded sequences [5’ UTR and exons 11–12 (E11-12)] re- decrease of UCHL1 (spot 976, −1.3 fold change), a neur- vealed no significant decrease in total Tau mRNA level onal enzyme involved in ubiquitinated proteins process- whatever the neuropathological group considered ing, was also found (Table 3). Interestingly, decrease and (Additional file 1: Figure S1). Therefore, consistent modification in proteins involved in synaptic function with previous data published in 2001 [21], these data (STXB1, DPYL2 and GLNA gene product in spot 448, confirm a reduction in Tau protein expression that 481, 689 with −1.3, −1.3 and −1.2 fold change, respect- cannot be explained by a MAPT gene trancription ively) were observed suggesting a stronger synaptic im- modification. But more interestingly, herein we show pairment in the FTLD-TDP-GRNlτ group (Table 3). that this decrease in Tau protein expression is re- Regarding glial cells, a decrease in glutamine synthetase stricted to patients with GRN mutations. (GS; astrocytic enzyme involved in glutamate metabol- ism) was observed with a −1.2 fold change, whereas the FTLD-TDP-GRNlτ brains display more astrogliosis and highest fold change (+3.2) was related to four spots cor- neuronal dysfunction compared to other FTLD-TDPτ brains responding to GFAP (Table 3). Taken together, these Since Tau protein level is reduced but not mRNA, we in- data demonstrate a strong correlation between reduction vestigated if other proteins could be modified. We there- of Tau protein expression, astrocytic and synaptic dys- fore performed a quantitative proteomic analysis using functions. Therefore, these proteomic data highlight 2D-DIGE to evaluate any dysregulation of other protein quantitative dysregulation of protein expression other Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 7 of 14 Fig. 1 Reduction of Tau protein expression in FTLD brains. a Western blot analysis of soluble Tau protein expression in control, AD and FTLD brains using antibodies targeting total Tau independently of any post-translational modification (N-ter, Tau 5 and C-ter). Are shown representative data from FTLD-TDP-GRN (n = 10), FTLD-TDP-C9ORF72 (n = 10), sporadic FTLD-TDP (n = 8), sporadic FTLD-FUS (n = 5), AD (n = 8) and control brains (n = 8). b Total Tau levels were quantified and normalized to a pool containing same protein amount of each control used in this study. Both full-length and truncated Tau species were considered for the quantification. Actin was used as loading control. Results are expressed as means ± SEM. For statistical analysis the Kruskal-Wallis test was used (*p < 0.05, **p < 0.01; ***p < 0.001). SEM: standard error of the mean; kDa: kiloDalton than Tau proteins in the brain from patients with FTLD- in comparison with both control and other FTLD-TDP TDP bearing GRN mutations. cases (Fig. 3a, b). Noteworthy, GS was found to be dra- matically decreased (Fig. 3a, b). With regards to synaptic Proteomic results validation in brain samples highlight proteins, several synaptic markers were decreased in- specific dysregulation in FTLD-TDP-GRNlτ brains cluding α-synuclein and PSD-95 (Fig. 3a, b). These dys- To validate these proteomic results found in a subset of regulations found in FTLD-TDP-GRNlτ brains could be patients, we therefore undertook an analysis of dysregu- the reflect of a global proteome deterioration in these lated neuronal and astrocytic proteins in all brain sam- samples. We thus tested the level of several proteins ples (FTLD-TDP-GRNlτ, FTLD-TDPτ and control) using such as Neuronal Specific Enolase (NSE), Aconitase, western blot analysis. We first confirmed an increase in Histone H3 and Neurofilaments. Their levels remain HSP-70 protein level in FTLD-TDP-GRNlτ cases (Fig. 3a, unchanged among the different FTLD subclasses (Add- b). Very strikingly, we observed as in 2D-DIGE, an up- itional file 2: Figure S2). Finally, it is also worth noting surge in GFAP expression in FTLD-TDP-GRNlτ group that among FTLD patients we could not find any Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 8 of 14 Fig. 2 2D-DIGE analysis of FTLD-TDP-GRNlτ and FTLD-TDPτ cases. Analysis of 2D-DIGE gels was performed using TotalLab SameSpot software. a Overlay of 2D-DIGE images with the two possible combinations. In the upper panel, FTLD-TDP-GRNlτ pool is labeled with Cy3 (green) and FTLD-TDPτ brains with Cy5 (red). In the lower panel, FTLD-TDP-GRNlτ pool is labeled with Cy5 (red) and FTLD-TDPτ brains with Cy3 (green). In both combination, the internal standard is labeled with Cy2 (blue). b 2D-DIGE map of proteins which are deregulated in FTLD-TDP-GRNlτ samples compared to FTLD-TDPτ samples. Spots of interest (numbers) are listed and described in Table 3. kDa: kiloDalton; MW: molecular weight correlation between Tau protein decrease, macroscopic TDP-43, the main constituent of aggregates found in atrophy, post-mortem delay (PMD) and RNA Integrity FTLD-TDP-GRNlτ cases, is involved in RNA metabolism Number (RIN) (Table 2, Additional file 3: Figure S3a, b, and especially in mRNA transport and stability through c respectively). All these results provide further evidence 3’UTR binding of targeted transcripts (see [29–31] for re- that specific dysregulations affect FTLD-TDP-GRNlτ pa- view). Notably, a recent study showed that loss of TDP-43 tients such as dramatic synaptic impairment and massive function impairs microtubule-dependent transport of reactive astrogliosis. mRNA granules towards distal neuronal compartment [32]. Regarding axonal translation of Tau [33], loss of TDP-43 function may lead to deficient Tau protein trans- Discussion lation. Nevertheless, this hypothesis suggests specific For the first time since Zhukareva’s studies, our data pathophysiological process in FTLD-TDP-GRNlτ when clearly demonstrate that the reduced Tau protein ex- compared to other FTLD-TDP cases that do not display pression is restricted to FTLD-TDP brains with muta- change in Tau protein level. tions on GRN gene. Although several FTLD brains MicroRNAs (miRNAs) play a key role in both normal display a lower Tau protein level with Tau C-ter anti- aging and neurodegenerative diseases (see [34, 35] for body, the labelling obtained with N-ter and Tau 5 review). Interestingly, studies have reported that dif- shows a relative conservation of Tau protein expres- ferent miRNA are able to modulate Tau metabolism sion suggesting a preferential degradation of Tau at [36, 37]. Among them, miR-219 is particularly inter- the C-terminal part in these cases. In contrast, FTLD- esting since it modulates Tau protein translation with TDP-GRNlτ brains exhibit reduced Tau levels with all relatively low influence on total Tau mRNA level. Tau antibodies tested. Consistent with this study, it is worth noting that Consistent with previous studies, reduction of Tau TDP-43 is also involved in miRNA biogenesis [38], protein expression is unlikely to result from extensive suggesting that specific miRNA deregulation could neuronal loss as demonstrated by the preserved expres- lead to a reduction of Tau mRNA translation in sion of several specific neuronal proteins [21, 22]. More- FTLD-TDP-GRNlτ brains. Finally, emerging evidences over, we could not find any correlation between reduced indicate that Tau is physiologically released into Tau level and PMD, RIN or cortical atrophy. Finally, extracellular space through multiple mechanisms such downregulation of MAPT transcription does not appear as multivesicular body and ectosome secretion [39]. It to be responsible for this decrease in Tau since mRNA could therefore be interesting to evaluate Tau protein level remains unchanged in these FTLD-TDP-GRNlτ level in cerebrospinal fluid to see if an increase in brains. Therefore, reduction of Tau protein might rather Tau secretion participates to this reduction of Tau result from post-transcriptional dysregulations. protein expression. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 9 of 14 Table 3 Proteins differentially expressed between FTLD-TDP-GRNlτ and FTLD-TDPτ Spot n° Protein name Accession No. Gene name p-value Fold Theoretical Apparent Mascot % sequence change pI/MW pI/MW score coverage 308 Gelsolin P06396 GSN 0.001 +1.4 5.9/85 5.9/85 77 1.4 436 Neurofilament light polypeptide P07196 NEFL 4.57E-04 - 1.5 4.5/61.5 4.5/61.5 202 34.3 Metabolism related proteins 780 Glyceraldehyde-3-phosphate P04406 GAPDH 0.001 +1.3 8.6/36 8.4/36 63.5 21.2 dehydrogenase (2) 1040 Ferritin light subunit P02792 FTL 3.67E-06 +2.2 5.4/20 5.4/20 354.5 30.3 738 Fructose 1.6 biphosphate aldolase P04075 ALDOA 0.0037 +1.2 9.2/39.4 9.2/39.4 81 33.5 639 Alpha-enolase P06733 ENO1 1.57E-04 +1.9 7.7/47.1 7.7/47.1 178 44.5 1033 Phosphatidylethanolamine-binding P30086 PEBP1 0.007 +1.3 7.4/21 8.4/21 101 56.7 protein 1 956 Peroxiredoxin 6 P30041 PRDX6 1.94E-05 +1.9 6.3/25 7.0/25 147 52.2 523 Pyruvate Kinase M (2) P14618 PKM 0.019 +1.2 9.0/60 8.4/60 93.9 31.8 708 Phosphoglycerate kinase 1 P00558 PGK1 0.023 +1.2 9.2/45 9.2/45 95.2 29.5 770 N(G).N(G)-dimethylarginine O94760 DDAH1 4.36E-04 +1.3 5.5/31.1 5.8/43 121 44.6 dimethylaminohydrolase 1 838 Guanine nucleotide-binding P62873 GNB1 7.02E-05 - 1.6 5.6/37 5.6/37 117 42.9 protein 1 714 Creatine Kinase B P12277 CKB 0.004 - 1.2 5.2/42.6 5.6/42.6 206 54.9 Astrocytic related proteins 618 Glial fibrillary acidic protein (3) P14136 GFAP 2.43E-06 +3.2 5.3/49.8 5.5/49.8 287 56.4 689 Glutamine synthetase P15104 GLUL 0.003 - 1.2 6.5/42 7.2/42 69.4 16.4 Synaptic related proteins 476 Dihydropyrimidinase-related Q16555 DPYSL2 4.62E-04 - 1.3 5.9/62.3 6.6/62.3 274 50.1 protein 2 (2) 448 Syntaxin-binding protein 1 (2) P61764 STXB1 3.70E-04 - 1.3 6.5/67.5 7.6/60 138 22.6 Other 883 Annexin 5 P08758 ANXA5 1.75E-04 +1.5 4.8/35.9 4.8/35.9 188 45.6 976 Ubiquitin carboxyl-terminal P09936 UCHL1 0.003 - 1.3 5.2/25 5.2/25 85.8 47.1 hydrolase isoenzyme L1 430 Heat shock 70 kDa protein 1A P0DMV8 HSPA1A 0.002 +1.3 5.4/70 5.4/60 110 27.9 Data obtained from Samespot software are presented for each spot of interest: spot number, p-value, fold change (FTLD-TDP-GRNlτ vs FTLD-TDPτ), experimental molecular weight (MW) and isoelectric point (pI). According to mass spectrometry identification of each protein, table also gives: the protein full name, accession number, gene name, mascot score, sequence coverage (%), and the theoretical molecular weight (MW) and pI of the non-modified protein. A mascot score above 61 was considered as significant for protein identification. Difference between theoretical and experimental molecular weight or pI is underlined. Number of iso- variants for each protein spot is indicated with the protein name (see parenthesis) All FTLD-TDP-GRNlτ cases display mutation on the function [46]. All these data suggest a strong role of pro- GRN gene. It is well established that mutations on GRN granulin in neurodegenerative diseases but how can we gene induce haploinsufficiency with approximatively relate the reduction of Tau with GRN mutations? De- 50 % reduction in mRNA levels and 33 % in protein level pending on the mutation, we observed very distinct [8]. However, how progranulin haploinsuffiency leads to phenotype between cases. Indeed, cases affected by a neurodegeneration is still unclear, in part due to the lack total deletion of one GRN allele do not display any de- of progranulin-deficient models recapitulating FTLD crease in Tau expression whereas other point mutations hallmarks. Progranulin is a secreted protein widely are associated with a huge reduction of all six isoforms. expressed throughout the body that exerts numerous This result is remarkable and suggests for the first time functions during development, tumor proliferation and that different mutations can induce distinct phenotype inflammation (see [40, 41] for review). In adult brain, and not only haploinsufficiency. Indeed, homozygous de- progranulin is mostly found in neurons and activated letion of GRN does not lead to FTLD-TDP but to an- microglia [42] where it regulates neurite outgrowth [43], other disorder called Neuronal Ceroid Lipofuscinosis synapse biology [44], stress response [45] and lysosomal (NCL) which is characterized by lysosomal dysfunction Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 10 of 14 Fig. 3 Biochemical validation of 2D-DIGE results in control, FTLD-TDP-GRNlτ and FTLD-TDPτ brain samples. a Western blot analysis of synaptic [PSD-95, α-synuclein (α-syn), Munc-18 and Synaptophysin (SYP)], astrocytic [GFAP and Glutamine Synthetase (GS)], and stress (HSP-70) related protein level in control, FTLD-TDP-GRNlτ and FTLD-TDPτ brain samples. Representative data from FTLD-TDP-GRNlτ (n = 8), FTLD-TDPτ (n = 20) and control brains (n = 8) are presented. b Protein levels were quantified and normalized to a pool containing same protein amount of each control used in this study. Actin was used as loading control. Results are expressed as means ± SEM. For statistical analysis the Kruskal-Wallis test was used (*p < 0.05; **p < 0.01; ***p < 0,001; ****p < 0,0001). SEM: standard error of the mean [46]. Thus, a recent study has demonstrated that specific depression and long-term potentiation [60, 61]. Regarding granulins expression, resulting from progranulin extracellu- our results, it would not be surprising that decrease in lar cleavage, could have toxic effect [47]. These point muta- Tau protein expression leads to neuronal dysfunction. tions could lead to modified mRNA leading to the This hypothesis is strengthened by our 2D-DIGE production of toxic granulins. However, the lack of infor- analysis and biochemical validation, demonstrating that mation on the different granulins, and their functions are expression of several neuronal proteins is either up- or still unknown and the relationship with Tau metabolism, if down-regulated. Indeed, both pre- and post-synaptic any, remains to be experimentally established. proteins such as PSD-95, Munc-18, α-synuclein, synap- Reduction of Tau protein expression in FTLD-TDP- tophysin and syntaxin-binding protein 1 are highly re- GRNlτ brains is intriguing since Tau has essential duced in FTLD-TDP-GRNlτ brains in comparison to functions in neuron. Indeed, Tau protein is a micro- control and FTLD-TDPτ brains. It’s interesting to note tubule associated protein (MAP) which mainly distributes that a very recent study has described a link between into axons [48] and was originally described as a protein synaptic dysfunction and progranulin deficiency [62]. regulating the assembly and stabilization of microtubules Indeed, progranulin deficiency is able to induce synaptic [49, 50], therefore modulating axonal transport [51]. How- pruning through lysosome dysfunctions and comple- ever, recent studies have highlighted a role for Tau in ment activation. It could explain, in part, the dramatic synaptic [52, 53] and nuclear compartments [54, 55]. Al- synaptic loss we found in FTLD-TDP-GRNlτ brains, in though initial studies showed that tau-knockout mice de- whom progranulin levels are very low. Finally, regarding velop no evident pathology, probably through MAP1A downregulation of dihydropyriminidase-related protein 2 compensatory effect [56], recent studies have revealed sev- (DPYSL2), also called collapsin response mediator pro- eral pathological modifications in these knockout mice tein-2 (CRMP2), it should be noted that this protein serves suggesting that Tau is essential for neuronal activity [57], important functions in synaptic plasticity. Moreover, iron export [58], neurogenesis [59] and both long-term CRMP2 and Tau are both high-abundance microtubule- Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 11 of 14 associated proteins, and overlap in terms of functional help us to better characterize and understand this particu- regulation [63]. All these data demonstrate that synaptic lar subclass of FTLD-TDP. functions are impaired in these FTLD-TDP-GRNlτ brains. In parallel with these neuronal dysfunctions, an Additional files increase in GFAP expression is also observed in FTLD- TDP-GRNlτ brains. GFAP belongs to intermediate fila- Additional file 1: Figure S1. Preservation of Tau mRNA in FTLD-TDP- GRNlτ group. qPCR analysis was done on total Tau mRNA in control and ments and is expressed mostly in astrocytes. These glial FTLD brain samples. Both 5’UTR (Untranslated Region) and E11-12 (Exons cells are complex highly differentiated cells that perform 11–12) primers target regions present in all Tau transcripts. Data were numerous essential functions in central nervous system normalized to the mean value of control cases with Large Ribosomal Protein P0 (RPLP0) used as reference gene. Results are expressed as (CNS), such as synaptic function and plasticity and means ± SEM. For statistical analysis the Mann–Whitney test was used (ns non maintenance of the neuronal microenvironment homeo- significant), n =5–10/group. SEM: standard error of the mean. (TIF 176 kb) stasis [64]. Astrocytes respond to various forms of CNS Additional file 2: Figure S2. Conservation of several proteins among injury such as infections, ischemia or neurodegenerative the different FTLD subclasses. (a) Western blot analysis of NSE (Neuron Specific Enolase), Aconitase, Histone H3 and Heavy (NF-H) Neurofilaments diseases through a process referred to as reactive astro- protein level in control and FTLD-U brain samples. Are shown representa- gliosis and often characterized by an increase in GFAP tive data from FTLD-TDP-GRNlτ (n = 8), FTLD-TDP-C9ORF72 (n = 10), spor- expression [65]. Although a mild to moderate reactive adic FTLD-TDP (n = 8), sporadic FTLD-FUS (n = 5) and control brains (n = 8). (b) Protein levels were quantified and normalized to a pool astrogliosis represents a protective mechanism, severe containing same protein amount of each control used in this study. astrogliosis could lead to functional defects including Actin was used as loading control. Results are expressed as means ± alteration of astrocyte ability to control neuronal micro- SEM. For statistical analysis the Kruskal-Wallis test was used (ns non significant). SEM: standard error of the mean. (TIF 223 kb) environment homeostasis [66, 67]. Interestingly in Additional file 3: Figure S3. Reduction of Tau protein expression does FTLD-TDP-GRNlτ brains, a decrease in GS expression not result from greater post-mortem delay, aberrant RIN or cortical atro- has been found. This astrocytic enzyme that converts phy in FTLD-TDP-GRNlτ brains. (a) Fixed hemibrain weight, (b) post- glutamate into glutamine is frequently deregulated in mortem delay and (c) RIN (RNA Integrity Number) of FTLD-TDP-GRNlτ, FTLD-TDP-C9ORF72, sporadic FTLD-TDP, sporadic FTLD-FUS and control neurodegenerative diseases presenting with Tau modifi- brains. Results are expressed as means ± SEM. For statistical analysis the cation [68, 69]. Thus, our results indicate that decrease Kruskal-Wallis test was used (*p < 0.05; ns non significant). a.u arbitrary in GS may underlie glutamate homeostasis alteration, unit, SEM: standard error of the mean. (TIF 164 kb) leading to more severe failures in synaptic connectivity and transmission in FTLD-TDP-GRNlτ brains. However, Acknowledgments AP has received a PhD scholarship from University of Lille 2. This work was why it is limited to cases presenting with point muta- supported by LabEx DISTALZ, CNRS and France Alzheimer Association. We tions of GRN still remains unclear. Beside this, we also would like to thank the Lille Neurobank and GIE Neuroceb, Paris for providing found numerous deregulated proteins related to glyco- human brain tissues. We would also like to thank Raphaëlle Caillierez and Florent Sauve for their technical assistance. lytic metabolism suggesting a critical role for alterations in brain metabolism and energetics in neurodegenerative Authors’ contributions processes. Therefore, metabolism dysregulation could re- AP, LB, NS and VBS conceived and designed the experiments. AP performed flect a more severe pathological state in these brains. most of the biochemical and proteomic experiments. SE, FJFG, PP, HO and CM also participated to the biochemical and proteomic experiments. AP, SE, FJFG, PP, HO, AB, ILB, LB, NS and VBS analyzed the data. VA, AC andILB performed the molecular experiments. VD, CAM and CD contributed to the Conclusions neuropathological status. AP, LB, NS and VBS wrote the paper. All authors read and approved the final manuscript. To conclude, our data reveal that reduction in Tau protein expression is a specific feature of FTLD-TDP cases with Competing interests GRN mutation, suggesting that FTLD-TDP-GRNlτ cases The authors declare that they have no competing interests. could represent a distinct subclass in the current FTLD Author details classification. Moreover, proteomic results clearly demon- 1 2 University of Lille, Inserm, CHU-Lille, F-59000 Lille, France. Sorbonne strate that in addition to a decrease in Tau protein expres- Universités, UPMC Univ Paris 06, Hôpital Pitié-Salpêtrière, Paris, France. 3 4 INSERM UMRS_1127, Hôpital Pitié-Salpêtrière, Paris, France. CNRS sion, FTLD-TDP-GRNlτ cases also displayed astrocytic UMR_7225, Hôpital Pitié-Salpêtrière, Paris, France. AP-HP, Hôpital and synaptic dysfunctions explaining more severe physio- Pitié-Salpêtrière, Paris, France. ICM, Hôpital Pitié-Salpêtrière, Paris, France. 7 8 pathological processes. However, we are not currently able Université Artois, Faculté Jean Perrin, F-62307 Lens, France. Inserm UMRS1172 – Alzheimer & Tauopathies, Faculty of Medecine-Research Pole, to explain this particular feature in part due to the nature University of Lille, Place de Verdun, F-59045 Lille cedex, France. of samples, which are post-mortem tissues, and make these dynamic mechanisms investigation complex. If re- Received: 2 June 2016 Accepted: 10 July 2016 duced Tau level is a consequence or an actor of deregula- tions found in these brains remains to be determined and References will require development of both in vitro and in vivo 1. Rabinovici G, Miller B. Frontotemporal lobar degeneration: epidemiology, models. Finally, further proteomic investigations will also pathophysiology, diagnosis and management. CNS Drugs. 2010;24:375–98. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 12 of 14 2. Chare L, Hodges JR, Leyton CE, McGinley C, Tan RH, Kril JJ, Halliday GM. New 17. Arai T, Hasegawa M, Akiyama H, Ikeda K, Nonaka T, Mori H, Mann D, criteria for frontotemporal dementia syndromes: clinical and pathological Tsuchiya K, Yoshida M, Hashizume Y, Oda T. TDP-43 is a component of diagnostic implications. J Neurol Neurosurg Psychiatry. 2014;85:865–70. ubiquitin-positive tau-negative inclusions in frontotemporal lobar 3. Gorno-Tempini ML, Hillis AE, Weintraub S, Kertesz A, Mendez M, Cappa SF, degeneration and amyotrophic lateral sclerosis. Biochem Biophys Res Ogar JM, Rohrer JD, Black S, Boeve BF, Manes F, Dronkers NF, Commun. 2006;351:602–11. Vandenberghe R, Rascovsky K, Patterson K, Miller BL, Knopman DS, Hodges 18. Neumann M, Rademakers R, Roeber S, Baker M, Kretzschmar HA, MacKenzie JR, Mesulam MM, Grossman M. Classification of primary progressive aphasia IRA. A new subtype of frontotemporal lobar degeneration with FUS and its variants. Neurology. 2011;76:1006–14. pathology. Brain. 2009;132:2922–31. 4. Burrell JR, Kiernan MC, Vucic S, Hodges JR. Motor neuron dysfunction in 19. Urwin H, Josephs KA, Rohrer JD, MacKenzie IR, Neumann M, Authier A, frontotemporal dementia. Brain. 2011;134:2582–94. Seelaar H, Van Swieten JC, Brown JM, Johannsen P, Nielsen JE, Holm IE, 5. Neary D, Snowden JS, Gustafson L, Passant U, Stuss D, Black S, Freedman M, Dickson DW, Rademakers R, Graff-Radford NR, Parisi JE, Petersen RC, Kertesz A, Robert PH, Albert M, Boone K, Miller BL, Cummings J, Benson DF. Hatanpaa KJ, White CL, Weiner MF, Geser F, Van Deerlin VM, Trojanowski JQ, Frontotemporal lobar degeneration A consensus on clinical diagnostic Miller BL, Seeley WW, Van Der Zee J, Kumar-Singh S, Engelborghs S, De criteria. Neurology. 1998;51:1546–54. Deyn PP, Van Broeckhoven C, et al. FUS pathology defines the majority of 6. Seelaar H, Kamphorst W, Rosso SM, Azmani A, Masdjedi R, De Koning I, tau-and TDP-43-negative frontotemporal lobar degeneration. Acta Maat-Kievit JA, Anar B, Kaat LD, Breedveld GJ, Dooijes D, Rozemuller JM, Neuropathol. 2010;120:33–41. Bronner IF, Rizzu P, Van Swieten JC. Distinct genetic forms of 20. Holm IE, Isaacs AM, MacKenzie IRA. Absence of FUS-immunoreactive frontotemporal dementia. Neurology. 2008;71:1220–6. pathology in frontotemporal dementia linked to chromosome 3 (FTD-3) 7. Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, Pickering- caused by mutation in the CHMP2B gene. Acta Neuropathol. 2009;118:719–20. Brown S, Chakraverty S, Isaacs A, Grover A, Hackett J, Adamson J, Lincoln S, 21. Zhukareva V, Vogelsberg-Ragaglia V, Van Deerlin VM, Bruce J, Shuck T, Dickson D, Davies P, Petersen RC, Stevens M, de Graaff E, Wauters E, van Grossman M, Clark CM, Arnold SE, Masliah E, Galasko D, Trojanowski JQ, Lee Baren J, Hillebrand M, Joosse M, Kwon JM, Nowotny P, Che LK, Norton J, VM. Loss of brain tau defines novel sporadic and familial tauopathies with Morris JC, Reed L a, Trojanowski J, Basun H, et al. Association of missense frontotemporal dementia. Ann Neurol. 2001;49:165–75. and 5’-splice-site mutations in tau with the inherited dementia FTDP-17. 22. Zhukareva V, Sundarraj S, Mann D, Sjogren M, Blenow K, Clark CM, McKeel Nature. 1998;393:702–5. DW, Goate A, Lippa CF, Vonsattel J-P, Growdon JH, Trojanowski JQ, Lee VM- Y. Selective reduction of soluble tau proteins in sporadic and familial 8. Baker M, Mackenzie IR, Pickering-Brown SM, Gass J, Rademakers R, Lindholm frontotemporal dementias: an international follow-up study. Acta C, Snowden J, Adamson J, Sadovnick a D, Rollinson S, Cannon A, Dwosh E, Neuropathol. 2003;105:469–76. Neary D, Melquist S, Richardson A, Dickson D, Berger Z, Eriksen J, Robinson T, Zehr C, Dickey C a, Crook R, McGowan E, Mann D, Boeve B, Feldman H, 23. Mackenzie IRA, Neumann M, Bigio EH, Cairns NJ, Alafuzoff I, Kril J, Kovacs Hutton M. Mutations in progranulin cause tau-negative frontotemporal GG, Ghetti B, Halliday G, Holm IE, Ince PG, Kamphorst W, Revesz T, dementia linked to chromosome 17. Nature. 2006;442:916–9. Rozemuller AJM, Kumar-Singh S, Akiyama H, Baborie A, Spina S, Dickson 9. Cruts M, Gijselinck I, van der Zee J, Engelborghs S, Wils H, Pirici D, DW, Trojanowski JQ, Mann DMA. Nomenclature for neuropathologic Rademakers R, Vandenberghe R, Dermaut B, Martin JJ, van Duijn C, Peeters subtypes of frontotemporal lobar degeneration: Consensus K, Sciot R, Santens P, De Pooter T, Mattheijssens M, Van den Broeck M, Cuijt recommendations. Acta Neuropathol. 2009;117:15–8. I, Vennekens K, De Deyn PP, Kumar-Singh S, Van Broeckhoven C. Null 24. Mackenzie IRA, Shi J, Shaw CL, DuPlessis D, Neary D, Snowden JS, Mann mutations in progranulin cause ubiquitin-positive frontotemporal dementia DMA. Dementia lacking distinctive histology (DLDH) revisited. Acta linked to chromosome 17q21. Nature. 2006;442:920–4. Neuropathol. 2006;112:551–9. 10. DeJesus-Hernandez M, Mackenzie IR, Boeve BF, Boxer AL, Baker M, 25. Fernandez-Gomez F-J, Jumeau F, Derisbourg M, Burnouf S, Tran H, Rutherford NJ, Nicholson AM, Finch N a, Flynn H, Adamson J, Kouri N, Eddarkaoui S, Obriot H, Dutoit-Lefevre V, Deramecourt V, Mitchell V, Lefranc Wojtas A, Sengdy P, Hsiung G-YR, Karydas A, Seeley WW, Josephs, Coppola D, Hamdane M, Blum D, Buée L, Buée-Scherrer V, Sergeant N. Consensus G, Geschwind DH, Wszolek ZK, Feldman H, Knopman DS, Petersen RC, Miller brain-derived protein, extraction protocol for the study of human and BL, Dickson DW, Boylan KB, Graff-Radford NR, Rademakers R. Expanded murine brain proteome using both 2D-DIGE and mini 2DE immunoblotting. GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes J Vis Exp. 2014;3:1–8. chromosome 9p-linked FTD and ALS. Neuron. 2011;72:245–56. 26. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using 11. Renton AE, Majounie E, Waite A, Simón-Sánchez J, Rollinson S, Gibbs JR, real-time quantitative PCR and the 2^(−ΔΔCT) method. Methods. 2001;25:402–8. Schymick JC, Laaksovirta H, van Swieten JC, Myllykangas L, Kalimo H, Paetau 27. Behrouzi R, Liu X, Wu D, Robinson AC, Tanaguchi-Watanabe S, Rollinson S, A, Abramzon Y, Remes AM, Kaganovich A, Scholz SW, Duckworth J, Ding J, Shi J, Tian J, Hamdalla HHM, Ealing J, Richardson A, Jones M, Pickering- Harmer DW, Hernandez DG, Johnson JO, Mok K, Ryten M, Trabzuni D, Brown S, Davidson YS, Strong MJ, Hasegawa M, Snowden JS, Mann DMA. Guerreiro RJ, Orrell RW, Neal J, Murray A, Pearson J, Jansen IE, et al. A Pathological tau deposition in Motor Neurone Disease and frontotemporal hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome lobar degeneration associated with TDP-43 proteinopathy. Acta 9p21-linked ALS-FTD. Neuron. 2011;72:257–68. Neuropathol Commun. 2016;4:33. 12. Watts GDJ, Wymer J, Kovach MJ, Mehta SG, Mumm S, Darvish D, Pestronk A, 28. Buée L, Bussière T, Buée-Scherrer V, Delacourte A, Hof PR. Tau protein Whyte MP, Kimonis VE. Inclusion body myopathy associated with Paget isoforms, phosphorylation and role in neurodegenerative disorders. Brain disease of bone and frontotemporal dementia is caused by mutant valosin- Res Brain Res Rev. 2000;33:95–130. containing protein. Nat Genet. 2004;36:377–81. 29. Lagier-Tourenne C, Polymenidou M, Cleveland DW. TDP-43 and FUS/TLS: 13. Skibinski G, Parkinson NJ, Brown JM, Chakrabarti L, Lloyd SL, Hummerich H, emerging roles in RNA processing and neurodegeneration. Hum Mol Genet. Nielsen JE, Hodges JR, Spillantini MG, Thusgaard T, Brandner S, Brun A, 2010;19:R46–64. Rossor MN, Gade A, Johannsen P, Sørensen SA, Gydesen S, Fisher EM, 30. Chen-plotkin AS, Lee VM, Trojanowski JQ. TAR DNA-binding protein 43 in Collinge J. Mutations in the endosomal ESCRTIII-complex subunit CHMP2B neurodegenerative disease. Nat Rev Neurol. 2010;6:211–20. in frontotemporal dementia. Nat Genet. 2005;37:806–8. 31. Lee EB, Lee VM-Y, Trojanowski JQ. Gains or losses: molecular mechanisms of 14. Cairns NJ, Bigio EH, Mackenzie IRA, Schneider JA, Paulo UDS, Paulo S, TDP43-mediated neurodegeneration. Nat Rev Neurosci. 2012;13:38–50. Halliday G, Escourolle LDN, Salpêtrière HD. La, Lowe JS: Neuropathological 32. Alami NH, Smith RB, Carrasco MA, Williams LA, Winborn CS, Han SSW, diagnostic and nosologic criteria for FTLD : consensus of the Consortium for Kiskinis E, Winborn B, Freibaum BD, Kanagaraj A, Clare AJ, Badders NM, FLTD. Acta Neuropathol. 2010;114:5–22. Bilican B, Chaum E, Chandran S, Shaw CE, Eggan KC, Maniatis T, Taylor JP. 15. Rademakers R, Neumann M, Mackenzie IR. Advances in understanding the Axonal transport of TDP-43 mRNA granules is impaired by ALS-causing molecular basis of frontotemporal dementia. Nat Rev Neurol. 2012;8:423–34. mutations. Neuron. 2014;81:536–43. 16. Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, 33. Aronov S, Aranda G, Behar L, Ginzburg I. Axonal tau mRNA localization Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, Miller BL, Masliah E, coincides with tau protein in living neuronal cells and depends on axonal Mackenzie IR, Feldman H, Feiden W, Kretzschmar H a, Trojanowski JQ, Lee targeting signal. J Neurosci. 2001;21:6577–87. VM-Y. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and 34. Piscopo P, Albani D, Castellano AE, Forloni G, Confaloni A. Frontotemporal amyotrophic lateral sclerosis. Science. 2006;314:130–3. Lobar Degeneration and MicroRNAs. Front Aging Neurosci. 2016;8:1–7. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 13 of 14 35. Gascon E, Gao FB. Cause or effect: Misregulation of microRNA pathways in Tau in neuronal DNA and RNA protection in vivo under physiological and neurodegeneration. Front Neurosci. 2012;6:1–10. hyperthermic conditions. Front Cell Neurosci. 2014;8:84. 36. Smith PY, Hernandez-Rapp J, Jolivette F, Lecours C, Bisht K, Goupil C, Dorval 56. Harada A, Oguchi K, Okabe S, Kuno J, Terada S, Ohshima T, Sato-Yoshitake V, Parsi S, Morin F, Planel E, Bennett DA, Fernandez-Gomez F-J, Sergeant N, R, Takei Y, Noda T, Hirokawa N. Altered microtubule organization in small- Buée L, Tremblay M-È, Calon F. Hébert SS: miR-132/212 deficiency impairs calibre axons of mice lacking tau protein. Nature. 1994;369:488–91. tau metabolism and promotes pathological aggregation in vivo. Hum Mol 57. Lei P, Ayton S, Moon S, Zhang Q, Volitakis I, Finkelstein DI, Bush AI. Motor Genet. 2015;24:6721–35. and cognitive deficits in aged tau knockout mice in two background strains. Mol Neurodegener. 2014;9:29. 37. Santa-Maria I, Alaniz ME, Renwick N, Cela C, Fulga TA, Van Vactor D, Tuschl T, Clark LN, Shelanski ML, McCabe BD, Crary JF. Dysregulation of microRNA- 58. Lei P, Ayton S, Finkelstein DI, Spoerri L, Ciccotosto GD, Wright DK, Wong BXW, 219 promotes neurodegeneration through post-transcriptional regulation of Adlard P a, Cherny R a, Lam LQ, Roberts BR, Volitakis I, Egan GF, McLean C a, tau. J Clin Invest. 2015;125:681–6. Cappai R, Duce J a, Bush AI. Tau deficiency induces parkinsonism with 38. Kawahara Y, Mieda-Sato A. TDP-43 promotes microRNA biogenesis as a dementia by impairing APP-mediated iron export. Nat Med. 2012;18:291–5. component of the Drosha and Dicer complexes. Proc Natl Acad Sci U S A. 59. Fuster-Matanzo A, Llorens-Martín M, Jurado-Arjona J, Avila J, Hernández F. 2012;109:3347–52. Tau protein and adult hippocampal neurogenesis. Front Neurosci. 2012;6:1–6. 39. Dujardin S, Begard S, Caillierez R, Lachaud C, Delattre L, Carrier S, Loyens A, 60. Ahmed T, Van der Jeugd A, Blum D, Galas MC, D’Hooge R, Buee L, Balschun Galas MC, Bousset L, Melki R, Auregan G, Hantraye P, Brouillet E, Buee L, D. Cognition and hippocampal synaptic plasticity in mice with a Colin M. Ectosomes: A new mechanism for non-exosomal secretion of Tau homozygous tau deletion. Neurobiol Aging. 2014;35:2474–8. protein. PLoS ONE. 2014;9:28–31. 61. Kimura T, Whitcomb DJ, Jo J, Regan P, Piers T, Heo S, Brown C, Hashikawa T, 40. Petkau TL, Leavitt BR. Progranulin in neurodegenerative disease. Trends Murayama M, Seok H, Sotiropoulos I, Kim E, Collingridge GL, Takashima A, Neurosci. 2014;37:388–98. Cho K. B PTRS: Depression in the hippocampus Microtubule-associated 41. Cenik B, Sephton CF, Cenik BK, Herz J, Yu G. Progranulin: A proteolytically protein tau is essential for long-term depression in the hippocampus. Philos processed protein at the crossroads of inflammation and Trans R Soc Lond B Biol Sci. 2014;369:1633. neurodegeneration. J Biol Chem. 2012;287:32298–306. 62. Lui H, Zhang J, Makinson SR, Paz JT, Barres BA, Huang EJ, Lui H, Zhang J, 42. Petkau TL, Neal SJ, Orban PC, MacDonald JL, Hill a M, Lu G, Feldman HH, Makinson SR, Cahill MK, Kelley KW, Huang H. Progranulin deficiency Mackenzie IR a, Leavitt BR. Progranulin expression in the developing and promotes circuit-specific synaptic pruning by microglia via complement adult murine brain. J Comp Neurol. 2010;518:3931–47. activation. Cell. 2016;165:921–35. 43. Gass J, Lee WC, Cook C, Finch N, Stetler C, Jansen-West K, Lewis J, 63. Hensley K, Kursula P. Collapsin Response Mediator Protein-2 (CRMP2) is a Link CD, Rademakers R, Nykjær A, Petrucelli L. Progranulin regulates plausible etiological factor and potential therapeutic target in Alzheimer’s neuronal outgrowth independent of sortilin. Mol Neurodegener. disease: Comparison and contrast with microtubule-associated protein tau. J 2012;7:33. Alzheimer’s Dis. 2016;53:1–14. 64. Nedergaard M, Ransom B, Goldman SA. New roles for astrocytes: Redefining 44. Tapia L, Milnerwood A, Guo A, Mills F, Yoshida E, Vasuta C, Mackenzie IR, the functional architecture of the brain. Trends Neurosci. 2003;26:523–30. Raymond L, Cynader M, Jia W, Bamji SX. Progranulin deficiency decreases gross neural connectivity but enhances transmission at individual synapses. 65. Sofroniew MV. Molecular dissection of reactive astrogliosis and glial scar J Neurosci. 2011;31:11126–32. formation. Trends Neurosci. 2009;32:638–47. 45. Almeida S, Zhang Z, Coppola G, Mao W, Futai K, Karydas A, Geschwind MD, 66. Seifert G, Schilling K, Steinhäuser C. Astrocyte dysfunction in neurological Tartaglia MC, Gao F, Gianni D, Sena-Esteves M, Geschwind DH, Miller BL, disorders: a molecular perspective. Nat Rev Neurosci. 2006;7:194–206. Farese RV, Gao FB. Induced pluripotent stem cell models of progranulin- 67. Sofroniew MV, Vinters HV. Astrocytes: Biology and pathology. Acta deficient frontotemporal dementia uncover specific reversible neuronal Neuropathol. 2010;119:7–35. defects. Cell Rep. 2012;2:789–98. 68. Kulijewicz-Nawrot M, Syková E, Chvátal A, Verkhratsky A, Rodríguez JJ. 46. Smith KR, Damiano J, Franceschetti S, Carpenter S, Canafoglia L, Morbin M, Astrocytes and glutamate homoeostasis in Alzheimer’s disease: a decrease Rossi G, Pareyson D, Mole SE, Staropoli JF, Sims KB, Lewis J, Lin WL, Dickson in glutamine synthetase, but not in glutamate transporter-1, in the DW, Dahl HH, Bahlo M, Berkovic SF. Strikingly different clinicopathological prefrontal cortex. ASN Neuro. 2013;5:273–82. phenotypes determined by progranulin-mutation dosage. Am J Hum Genet. 69. Hege Nilsen L, Rae C, Ittner LM, Götz J, Sonnewald U. Glutamate 2012;90:1102–7. metabolism is impaired in transgenic mice with tau hyperphosphorylation. J 47. Salazar D a, Butler VJ, Argouarch a R, Hsu T-Y, Mason A, Nakamura A, Cereb Blood Flow Metab. 2013;33:684–91. McCurdy H, Cox D, Ng R, Pan G, Seeley WW, Miller BL, Kao a W. The 70. Sergeant N, Sablonnière B, Schraen-Maschke S, Ghestem A, Maurage C a, progranulin cleavage products, granulins, exacerbate TDP-43 toxicity and Wattez A, Vermersch P, Delacourte A. Dysregulation of human brain increase TDP-43 levels. J Neurosci. 2015;35:9315–28. microtubule-associated tau mRNA maturation in myotonic dystrophy type 48. Binder LI, Frankfurter A, Rebhun LI. The distribution of tau in the 1. Hum Mol Genet. 2001;10:2143–55. mammalian central nervous system. J Cell Biol. 1985;101:1371–8. 71. Derisbourg M, Leghay C, Chiappetta G, Fernandez-Gomez F-J, Laurent C, 49. Drechsel DN, Hyman a a, Cobb MH, Kirschner MW. Modulation of the Demeyer D, Carrier S, Buée-Scherrer V, Blum D, Vinh J, Sergeant N, Verdier Y, dynamic instability of tubulin assembly by the microtubule-associated Buée L, Hamdane M. Role of the Tau N-terminal region in microtubule protein tau. Mol Biol Cell. 1992;3:1141–54. stabilization revealed by new endogenous truncated forms. Sci Rep. 2015;5:9659. 50. Weingarten MD, Lockwood AH, Hwo SY, Kirschner MW. A protein factor 72. Flament S, Delacourte A, Hemon B, Defossez A. Characterization of two essential for microtubule assembly. Proc Natl Acad Sci U S A. 1975;72:1858–62. pathological Tau protein variants in Alzheimer brain cortices. J Neurol Sci. 51. Dixit R, Ross JL, Goldman YE, Holzbaur ELF. Differential regulation of Dynein 1989;92:133–41. and Kinesin motor proteins by Tau. Science. 2010;319:1086–9. 73. Liu Y, Fallon L, Lashuel H a, Liu Z, Lansbury PT. The UCH-L1 gene encodes 52. Ittner LM, Ke YD, Delerue F, Bi M, Gladbach A, van Eersel J, Wölfing H, two opposing enzymatic activities that affect alpha-synuclein degradation Chieng BC, Christie MJ, Napier I a, Eckert A, Staufenbiel M, Hardeman E, and Parkinson’s disease susceptibility. Cell. 2002;111:209–18. Götz J. Dendritic function of tau mediates amyloid-beta toxicity in 74. Du C-P, Tan R, Hou X-Y. Fyn kinases play a critical role in neuronal apoptosis Alzheimer’s disease mouse models. Cell. 2010;142:387–97. induced by oxygen and glucose deprivation or amyloid-β peptide 53. Mondragon-Rodriguez S, Trillaud-Doppia E, Dudilot A, Bourgeois C, Lauzon treatment. CNS Neurosci Ther. 2012;18:754–61. M, Leclerc N, Boehm J. Interaction of endogenous tau protein with synaptic 75. Hata Y, Slaughter CA, Südhof TC. Synaptic vesicle fusion complex contains proteins is regulated by N-methyl-D-aspartate receptor-dependent tau unc-18 homologue bound to syntaxin. Nature. 1993;366:347–51. phosphorylation. J Biol Chem. 2012;287:32040–53. 76. Andrieux A, Salin PA, Vernet M, Kujala P, Baratier J, Gory-Fauré S, Bosc C, Pointu 54. Sultan A, Nesslany F, Violet M, Bégard S, Loyens A, Talahari S, Mansuroglu Z, H, Proietto D, Schweitzer A, Denarier E, Klumperman J, Job D. The suppression Marzin D, Sergeant N, Humez S, Colin M, Bonnefoy E, Buée L, Galas MC. of brain cold-stable microtubules in mice induces synaptic defects associated Nuclear Tau, a key player in neuronal DNA protection. J Biol Chem. 2011;286: with neuroleptic-sensitive behavioral disorders. Genes Dev. 2002;16:2350–64. 4566–75. 77. Wang YF, Sun MY, Hou Q, Parpura V. Hyposmolality differentially and 55. Violet M, Delattre L, Tardivel M, Sultan A, Chauderlier A, Caillierez R, Talahari spatiotemporally modulates levels of glutamine synthetase and serine S, Nesslany F, Lefebvre B, Bonnefoy E, Buée L, Galas M-C. A major role for racemase in rat supraoptic nucleus. Glia. 2013;61:529–38. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 14 of 14 78. Johnson MA, Vidoni S, Durigon R, Pearce SF, Rorbach J, He J, Brea-Calvo G, Minczuk M, Reyes A, Holt IJ, Spinazzola A. Amino acid starvation has opposite effects on mitochondrial and cytosolic protein synthesis. PLoS ONE. 2014;9:4. 79. Jin Y, Elalaf H, Watanabe M, Tamaki S, Hineno S, Matsunaga K, Woltjen K, Kobayashi Y, Nagata S, Ikeya M, Kato T, Okamoto T, Matsuda S, Toguchida J. Mutant idh1 dysregulates the differentiation of mesenchymal stem cells in association with gene-specific histone modifications to cartilage- and bone- related genes. PLoS ONE. 2015;10:1–15. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Acta Neuropathologica Communications Springer Journals

Reduced Tau protein expression is associated with frontotemporal degeneration with progranulin mutation

Download PDF
14 pages

Loading next page...
 
/lp/springer-journals/reduced-tau-protein-expression-is-associated-with-frontotemporal-wB0YSk20tV

References (79)

Publisher
Springer Journals
Copyright
Copyright © 2016 by The Author(s).
Subject
Biomedicine; Neurosciences; Pathology; Neurology
eISSN
2051-5960
DOI
10.1186/s40478-016-0345-0
pmid
27435172
Publisher site
See Article on Publisher Site

Abstract

Reduction of Tau protein expression was described in 2003 by Zhukareva et al. in a variant of frontotemporal lobar degeneration (FTLD) referred to as diagnosis of dementia lacking distinctive histopathology, then re-classified as FTLD with ubiquitin inclusions. However, the analysis of Tau expression in FTLD has not been reconsidered since then. Knowledge of the molecular basis of protein aggregates and genes that are mutated in the FTLD spectrum would enable to determine whether the “Tau-less” is a separate pathological entity or if it belongs to an existing subclass of FTLD. To address this question, we have analyzed Tau expression in the frontal brain areas from control, Alzheimer’s disease and FTLD cases, including FTLD- Tau (MAPT), FTLD-TDP (sporadic, FTLD-TDP- GRN,FTLD-TDP-C9ORF72) and sporadic FTLD-FUS, using western blot and 2D-DIGE (Two-Dimensional fluorescence Difference Gel Electrophoresis) approaches. Surprisingly, we found that most of the FTLD-TDP-GRN brains are characterized by a huge reduction of Tau protein expression without any decrease in Tau mRNA levels. Interestingly, only cases affected by point mutations, rather than cases with total deletion of one GRN allele, seem to be affected by this reduction of Tau protein expression. Moreover, proteomic analysis highlighted correlations between reduced Tau protein level, synaptic impairment and massive reactive astrogliosis in these FTLD-GRN cases. Consistent with a recent study, our data also bring new insights regarding the role of progranulin in neurodegeneration by suggesting its involvement in lysosome and synaptic regulation. Together, our results demonstrate a strong association between progranulin deficiency and reduction of Tau protein expression that could lead to severe neuronal and glial dysfunctions. Our study also indicates that this FTLD-TDP-GRN subgroup could be part as a distinct entity of FTLD classification. Keywords: Frontotemporal lobar degeneration, Tau protein, Progranulin, Synaptic impairment, Astrogliosis Introduction language. Depending on the first and prevailing symp- Frontotemporal Lobar Degeneration (FTLD) accounts toms, there are three different clinical subtypes in- for 10 to 20 % of all demented cases. With an onset cluding the behavioral variant FTLD (bvFTLD) and usually occurring between 45 and 64 years of age, two subtypes of primary progressive aphasia: progres- FTLD represents the second common cause of de- sive nonfluent aphasia (PNFA) and semantic dementia mentia in the presenile age group (<65 years of age) [2, 3]. In addition, movement disorder can also be [1]. FTLD is a clinical syndrome characterized by pro- observed in 10 to 15 % of FTLD cases (corticobasal gressive deterioration in behavior, personality and/or syndrome, parkinsonism and/or amytrophic lateral sclerosis (ALS)) [4]. Given this phenotype variability, * Correspondence: valerie.buee-scherrer@inserm.fr FTLD clinical diagnosis remains difficult and uneasy University of Lille, Inserm, CHU-Lille, F-59000 Lille, France to establish with certainty [5]. However, genetics has Université Artois, Faculté Jean Perrin, F-62307 Lens, France allowed for a better stratification of FTLD spectrum. Full list of author information is available at the end of the article © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 2 of 14 In fact, gene mutations also play an important role in With the progress in genetics and neuropathology of FTLD with 30 to 50 % of patients reporting a positive FTLD, the question of whether this reduction of Tau ex- family history of FTD and 10 to 15 % of patients cor- pression is seldom remains ill-defined. In this study, we responding to dominantly inherited form [6]. Firstly used western blot analysis to investigate human brain Tau described are the MAPT mutations [7]. Mutations in protein expression in Control, AD, FTLD-Tau, FTLD- the progranulin gene GRN were then found to be the TDP-GRN, FTLD-TDP-C9ORF72, sporadic FTLD-TDP most frequent mutations associated with FTLD [8, 9]. and sporadic FTLD-FUS brains. Remarkably, we demon- More recently, two studies demonstrated that ex- strated a huge reduction of all six human brain Tau panded hexanucleotide GGGGCC repeats in a non- isoforms only in a subset of FTLD-TDP brains with muta- coding region of the chromosome 9 open reading tion on the GRN gene. Thus, our data clearly suggest that frame 72 (C9ORF72) gene was responsible for a large these specific cases, referred to as FTLD-TDP-GRNlτ proportion of both familial FTLD and ALS [10, 11]. (lτ for low levels of Tau protein), could be part of the Less frequently mutations in the valosin containing current classification as a distinct entity with more protein (VCP) gene or charged multivesicular body severe synaptic dysfunction and astrogliosis. protein 2B (CHMP2B) gene are also found associated with FTLD [12, 13]. Materials and methods The definite diagnosis relies on neuropathological Frontal cortical brain tissues from Controls (n = 8), AD examination of the brain, the characteristics of these (n = 8), FTLD-Tau (n = 6), FTLD-TDP-GRN (n = 10), brain lesions and their molecular basis [14]. Indeed, FTLD-TDP-C9ORF72 (n = 10), sporadic FTLD-TDP (n =8) as many neurodegenerative diseases, FTLD are char- and sporadic FTLD-FUS (n =5) were provided from both acterized by the presence of protein aggregates in the Lille Neurobank and GIE NeuroCeb in Paris. The brain affected brain regions. However, in contrast to the banks fulfill criteria from the French Law on biological well-characterized nature of protein inclusions (Aβ resources including informed consent, ethics review plaques and neurofibrillary tangles) in Alzheimer’s committee and data protection (article L1243-4 du disease (AD), proteinaceous aggregates in FTLD can Code de la Santé publique, August 2007). be formed of different proteins [15]. Thus, approxi- matively 40 % of FTLD cases display aggregates made Biochemical analysis of abnormally and hyperphosphorylated Tau proteins Frontal grey matter necropsic tissues (around 100 mg) and constitute the FTLD-Tau subclass. However, most were homogenized in UTS buffer (Urea 8 M, Thiourea of FTLD brains are negative for Tau inclusions and 2 M, SDS 2 %) using a tissue grinder Potter-Elvehjem exhibit neuronal cytoplasmic and/or nuclear inclu- with a PTFE Pestle. The homogenate was further soni- sions immunoreactive for transactive response DNA cated on ice and spun at 7500 × g during 10 min to re- binding protein 43 (TDP-43) and constitute the move tissue debris. The supernatant was kept at −80 °C FTLD-TDP subclass [16, 17]. This latter is subdivided until use. Protein amount was determined by Bradford into sporadic FTLD-TDP, FTLD-TDP-GRN (patients with protein assay, subsequently diluted in NuPAGE® lithium mutations on GRN) and FTLD-TDP-C9ORF72 (patients dodecyl sulfate (LDS) 4× sample buffer (glycerol 40 %, with mutations on C9ORF72)[8–11]. To a lesser extent, LDS 4 %, Ficoll 400 4 %, Triethanolamine chloride another protein called FUS (Fused in Sarcoma protein) is 800 mM, phenol red 0.025 % and Coomassie G250 found in aggregates that are Tau and TDP-43 negative [18, 0.025 %, EDTA disodium 2 mM, pH 7.6) supplemented 19]. This subclass is thus named FTLD-FUS. Finally, in- with NuPAGE® sample reducing agents (Invitrogen) and clusions negative for Tau, TDP-43 or FUS are observed in loaded onto 4–12 % NuPAGE® Bis-Tris Novex Gels. Pro- rare cases of FTLD and associated with ubiquitin- teins were transferred on nitrocellulose membrane of proteasome system related proteins (FTLD-UPS) [20]. 0.45 μM porosity (GE Lifesciences) using liquid transfer Prior to the discovery of the main molecular actors of XCell II™ Blot Module, according to the manufacturer’s FTLD, studies described a partial or total loss of soluble or instructions (Invitrogen). After saturation for 30 min at physiological Tau protein expression in both grey and room temperature with TNT (Tris 15 mM, pH 8, NaCl white matter [21, 22]. This loss of Tau was originally 140 mM, Tween 0.05 %) added with 5 % skimmed milk found in a subset of dementia called DLDH for Dementia powder or 5 % BSA, membranes were rinsed three times Lacking Distinctive Histopathology (renamed later FTLD- 10 min with TNT and thereafter incubated with primary ni for FTLD with no inclusion) [23]. In 2006, most of and secondary horseradish peroxidase-coupled anti- these cases were reclassified as FTLD-U (presenting with bodies. All primary antibodies and dilutions are listed in ubiquitin positive inclusions) [24]. However, additional in- Table 1. The peroxidase activity was revealed using a vestigation with specific regards to this loss of Tau expres- chemiluminescence kit (ECL, GE Lifesciences) and an sion has not been reported since Zhukareva et al. in 2003. ImageQuant™ LAS4000 biomolecular imaging system Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 3 of 14 Table 1 Antibodies used in this study Name Abbreviation Epitope Origin Provider Dilution Reference Tau Anti-total Tau (N-ter) N-ter First 19 aa in amino-terminal region Rabbit Home-made 1/10 000 [70] Anti-total- Tau (Tau 5) Tau 5 Middle region of Tau (aa 218–225) Mouse Invitrogen 1/2 000 [71] Anti-total-Tau (C-ter) C-ter Last 15 aa in carboxy-terminal region Rabbit Home-made 1/10 000 [72] Synaptic proteins α-synuclein α-syn Aa 15–123 of rat synuclein-1 Mouse BD Labsciences 1/500 [73] Post-synaptic density 95 PSD-95 Human PSD-95 Rabbit Cell Signaling 1/1000 [74] Munc-18 Munc-18 Aa 577–594 of rat Munc-18 Rabbit Sigma 1/10 000 [75] Synaptophysine SYP Aa 221–313 of human SYP Mouse Santa Cruz 1/10 000 [76] Astrocytic proteins Glutamine synthetase GS Aa 250–350 of Human GS Rabbit Abcam 1/10 000 N/A Glial Fibrillary Acidic Protein GFAP Bovin GFAP FL Mouse Santa Cruz 1/1000 [77] Others β-actin Actin N-ter Mouse Sigma-Aldrich 1/10 000 N/A Neuron Specific Enolase NSE Aa 269–286 of Human NSE Rabbit Enzo Life Science 1/50 000 N/A Aconitase Bovine heart mitochondria Mouse Abcam 1/1000 [78] Histone H3 H3 C-terminus of human H3 Rabbit Millipore 1/10 000 [79] For each antibody, the full name, abbreviation, recognized sequence, origin, provider, dilution and literature reference are given. N/A Not Available (GE Lifesciences), according to the manufacturer’s in- fluorescent dye and used as internal standard in accord- structions. Quantifications were performed using ImageJ ance with the manufacturer’s instructions (GE Life- 1.46 software (NIH Software). sciences). Finally, the internal standard labeled with Cy2 and the samples labeled with either Cy3 or Cy5 were Sample preparation for two-dimensional differential gel pooled and the final volume was adjusted to 350 μLby electrophoresis (2D-DIGE) the addition of rehydration buffer [Urea 8 M, Thiourea Frozen UTS brain samples (a total of 1.5 mg of protein 2 M, CHAPS 2 %, Destreak reagent 1.1 % (GE Life- for each condition) was unfrozen on ice and proteins sciences), IPG buffer pH 3–11 1.2 % (GE Lifesciences), were precipitated using chloroform/methanol precipita- bromophenol blue 0.01 %]. Samples were prepared in tion [25]. The protein-dried pellet was resuspended in quadruplicate and loaded onto four independent IPG UTC buffer (Urea 8 M, Thiourea 2 M supplemented strips. Eighteen cm long linear pH gradient of 3–11 IPG with 4 % CHAPS) and kept at −80 °C until use. Protein strips (GE Lifesciences) were rehydrated overnight with concentration was measured using Quick-Start Bradford the samples in a rehydration cassette recovered with Dye Reagent (Bio-Rad) and sample quality was evaluated mineral oil. Excess or mineral oil was discarded and iso- by loading 15 μgofproteinsonto4–12 % NuPAGE® electrofocalisation was achieved using IPGphor isoelec- Bis-Tris Novex Gels and stained with Coomassie R-250 tric focusing apparatus (GE Lifesciences). A seven steps (Biorad). procedure was applied with the following conditions: 150 V for 1 h, 200 V for 5 h, 200 V to 500 V step gradi- 2D-DIGE ent for 2 h, 500 to 1000 V step gradient for 2 h, 1000 V The 2D-DIGE was performed as previously described to 4000 V gradient for 2 h, and finally 8000 V gradient [25]. Briefly, 50 μg of protein was covalently coupled for 2 h. Current was limited to 50 μA per strip. Strips with 400 pmol of cyanine dyes diluted in dimethylforma- were then equilibrated in equilibration buffer (Urea 6 M, mide, according to the manufacturer’s instructions SDS 2 %, Glycerol 30 %, Tris–HCl 50 mM, pH 8.6) with (CyDIGE, GE Lifesciences). Each sample was labeled successively 1 % DTT (dithiothreitol) and 4.7 % iodoace- with either Cy3 or Cy5 fluorescent dyes (GE Life- tamide for 15 min. Proteins were then separated in the sciences) and kept for 1 h at 4 °C in darkness. Cross- second dimension on 1 mm-thick 12 % SDS-PAGE gels labeling with either Cy3 or Cy5 dyes was performed in in an ETTAN DALTSix system (GE Lifesciences). Gels order to avoid a preferential coupling of one cyanine to were run at 2.5 W per gel overnight. Fluorescently la- a sample. A pool of both samples containing equal beled protein spots were visualized using a Typhon FLA amount of protein (50 μg in total) was labeled with Cy2 9500 imager (GE Lifesciences). Gels were scanned at Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 4 of 14 200 μm resolution and images were exported for further transcription kit. RT-qPCR analysis was performed analysis using SameSpots (TotalLab) software. using an Applied Biosystems Prism 7900 SYBR Green PCR Master Mix. The amplification conditions were Data analysis as follows: initial step of 10 min at 95 °C, followed by Spot detection and relative quantification of spot intensity 45 cycles of a 2-step PCR consisting of a 95 °C de- were analyzed using 2-DIGE analysis software package naturing step for 15 s followed by a 60 °C extension SameSpots (TotalLab). One-way ANOVA statistical test step for 25 s. Primers used were: Tau 5’UTR 5’ACAGCCA was applied and expression change was considered as sig- CCTTCTCCTCCTC3’ and 5’ GATCTTCCATCACTTCG nificant with an exact p-value below 0.05. Normalization AACTCC3’; Tau E11-12 5’ACCAGTTGACCTGAGCA across all gels was performed using the internal standard. AGG3’ and 5’ AGGGACGTGGGTGATATTGT3’ and RPLP0 5’GCAATGTTGCCAGTGTCTG3’ and 5’ GCC Preparative 2D gels TTGACCTTTTCAGCAA3’. Amplifications were carried In order to identify proteins of interest, two preparative out in triplicate and the relative expression of target genes 2D-gels with respectively 500 μg of brain protein of each was determined by the ΔΔC method [26]. condition were performed. After electrophoresis, gels were fixed in ethanol 30 %, orthophosphoric acid (OPA) Statistical analysis 2 % overnight. Following washing in OPA 2 %, gels were For western blot and RT-qPCR statistical analyses, the incubated 30 min in pre-coloration buffer (ethanol 18 %, non-parametric Mann–Whitney test or the Kruskall- OPA 2 % and ammonium sulfate 0.9 M) before Coomassie Wallis test were performed. All statistical analyses were blue staining (Brillant Blue G-250, Bio-Rad) for 48 h. performed using the GraphPad Prism 6 program (GraphPad Software) and statistical significance was set Trypsin digestion, mass spectrometry and protein at * p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. identification Spot labelling shown to be significantly different between Results two conditions after SameSpots analyses was manually ex- Neuropathology cised from preparative gels. Each separate spot was incu- Neuropathological assessment of all cases was per- bated in DTT 10 mM and alkylated (iodoacetamide formed in the departments of anatomo-pathology of 55 mM) before trypsin digestion (Promega) overnight at CHU-Lille and Hôpital Pitié-Salpêtrière. Detailed infor- 37 °C, according to the manufacturer’s instructions. Super- mation on pathology and demographic data are summa- natants, containing digested peptides, were dried using rized in Table 2. centrifuge vacuum (Concentrator 5301, Eppendorf) and resuspended in ultra-pure water supplemented with Reduction of Tau protein expression is observed in FTLD- trifluoroacetic acid (TFA) 0,1 %. The resulting peptide TDP brains associated with GRN gene mutation without mixture was spotted onto a MALDI plate with freshly dis- Tau mRNA decrease solved α-cyano-4-hydroxycinnaminic acid (10 mg/ml in Tau protein expression was studied in all cases. We first acetonitrile 50 %, TFA 0.1 %). Mass spectrometry was checked by western-blotting, if there was any Tau path- achieved with a MALDI-TOF-TOF Autoflex Speed ology in these brains, since it has been described in AD, (Bruker Daltonics). MS and MS/MS data were ana- and a subset of FTLD-TDP patients [27, 28]. Lack of lyzed with BioTools software and peptides sequences were phospho-Tau immunoreactivity was a condition to ex- analyzed with Mascot (http://www.matrixscience.com/). A clude Tau pathology and therefore any FTLD-Tau as mascot score above 61 was considered significant for pro- compared with FTLD-MAPT and AD (data not shown). tein identification. Thereafter, Tau expression was investigated by using antibodies targeting Tau protein independently of its mRNA extraction and quantitative real-time polymerase phosphorylation state to evaluate total Tau protein level. chain reaction (RT-qPCR) analysis These well-characterized antibodies either target the Total RNA was extracted from the tissue of the frontal amino-terminal (Tau N-ter), the median (Tau 5) or cortex and purified using the RNeasy Lipid Tissue Mini carboxy-terminal epitope of Tau (Tau C-ter). In adult Kit (Qiagen) following the manufacturer’s instructions. human brain, six Tau isoforms are expressed from For each RNA sample, integrity (RIN, RNA Integrity MAPT gene through alternative mRNA splicing [28]. Number) was assessed on 2100 bioanalyzer (Agilent These six Tau isoforms give rise to a unique biochemical Technologies, Waldbronn, Germany) using the RNA signature made of three bands (Fig. 1a, Control patients 6000 nano kit according to the manufacturer protocol. 1 to 3). Thus, western blot analysis highlighted signifi- One microgram of total RNA was reverse-transcribed cant decrease of all six Tau isoforms in eight FTLD-TDP using Applied Biosystems High Capactiy cDNA reverse brains compared to control, AD and other FTLD brains Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 5 of 14 Table 2 Demographic data on studied cases Genetic diagnosis Cases Neuropathology Age (yr) Sex PMD (hr) RIN (a.u) Fixed hemibrain (g) Genetic variant Controls 1 73 M 10 6,6 508 2 84 M 15,5 5,3 N/A 3 70 M 31 5,6 765 4 76 F 28 4,8 580 5 86 F N/A 5,1 540 6 79 M N/A 6,3 675 7 69 M 6 6,9 632 8 60 F 28 6,8 788 FTLD, sporadic 9 FTLD-TDP Type A 84 M 25 4,4 614 10 FTLD-TDP Type A 42 M 37 5,7 684 11 FTLD-TDP Type C 86 M 44 4,8 504 12 FTLD-TDP 67 F 22 6,3 495 13 FTLD-TDP Type C 68 M N/A 2,5 430 14 FTLD-TDP Type C 72 M 16 5,8 452 15 FTLD-TDP Type B 53 M 5 8 600 16 FTLD-TDP Type B 77 M 17 5,5 378 17 FTLD-FUS 35 M 64 5,5 N/A 18 FTLD-FUS 59 M 30 6,6 430 19 FTLD-FUS 44 M 11 5,7 504 20 FTLD-FUS 35 F 17 5,9 495 21 FTLD-FUS 54 M 18 4,8 424 FTLD, GRN 22 FTLD-TDP Type A 71 M 23 3 556 c.813_816del 23 FTLD-TDP Type A 69 F 39 3,8 370 c.1494_1498del 24 FTLD-TDP Type A 60 F N/A 3,7 200 c.1494_1498del 25 FTLD-TDP Type A 65 F N/A 5,9 N/A c.619dup 26 FTLD-TDP Type A 67 M 22 3,4 608 c.813_816del 27 FTLD-TDP Type A 69 M 18,5 7 166 c.1494_1498del 28 FTLD-TDP Type A 78 F 20 4 420 N/A 29 FTLD-TDP Type A 75 M 21 5,3 419 c.1157G > A 30 FTLD-TDP Type A 73 M 10 5,6 456 Complete deletion 31 FTLD-TDP Type A 86 F 5,5 6,8 388 Complete deletion FTLD, C9ORF72 32 FTLD-TDP 59 M 51 6,4 N/A 33 FTLD-TDP Type B 42 M 10 3,2 N/A 34 FTLD-TDP Type B 40 F 48 4,5 N/A 35 FTLD-TDP Type B 63 M 13 5,2 762 36 FTLD-TDP 90 M 40 4,4 N/A 37 FTLD-TDP 62 M N/A 5,1 541 38 FTLD-TDP Type B 69 M 8,5 4,4 N/A 39 FTLD-TDP Type B 65 M 20 5,3 400 40 FTLD-TDP Type B 62 F 5,5 7,6 258 41 FTLD-TDP Type B 59 M 8,5 6 438 Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 6 of 14 Table 2 Demographic data on studied cases (Continued) FTLD, MAPT 42 FTLD-Tau 48 F 44,5 6,1 N/A P301L 43 FTLD-Tau 54 F N/A 7,8 N/A S305S 44 FTLD-Tau 43 M 6 4,8 N/A P301L 45 FTLD-Tau 65 F 30,5 3,4 315 P301L 46 FTLD-Tau 66 M 30 5,9 N/A P301L 47 FTLD-Tau 85 F 21 5 360 P332S AD 48 AD 79 F 48 4,7 474 59 AD 73 F 26 4,7 460 50 AD 55 F N/A 4,8 416 51 AD 75 M 30 4,1 529 52 AD 74 M 10 3 N/A 53 AD 63 M 18 6,1 366 54 AD 61 M 23 7 414 55 AD 62 M 10 6 435 AD Alzheimer’s disease. C9ORF72, chromosome 9 open reading frame 72, FTLD FrontoTemporal Lobar Degeneration, GRN, progranulin, MAPT microtubule- associated protein tau, PMD postmortem delay, RIN RNA Integrity Number, sp, sporadic cases. a.u arbitrary unit, N/A Not Available (patients 22 to 29, Fig. 1a). Interestingly, this decrease is ob- expression. For this purpose, proteomes of FTLD-TDPτ served with all three Tau antibodies suggesting that Tau brains (n = 3, cases 14, 15 and 16) and FTLD-TDP- holoprotein isoform expression is impaired (Fig. 1a, com- GRNlτ (n = 3, cases 22, 24 and 25) were compared. Fol- pare patient 25 with patient 33). More interestingly, this re- lowing bioinformatics assisted analysis of 2D-DIGE gels duction of Tau protein expression is restricted to FTLD- (n = 4), 26 protein spots with significant differential level TDP brains associated with mutations on the GRN gene of expression between FTLD-TDP-GRNlτ and FTLD- (Fig. 1a and b) and not associated with other FTLD-related TDPτ brains were isolated for further identification gene mutations. Indeed, Tau proteinexpressioninFTLD- (Fig. 2a, b; Table 3). According to the mass spectrometry TDP-C9ORF72, sporadic FTLD-TDP or FTLD-FUS pa- analysis, 20 distinct proteins including 6 isovariants of tients is rather homogeneous from one patient to another the same protein were identified. Among the 20 proteins with each antibody (Fig. 1a). Consequently to these results, identified with a significant mascot score (>61), the GRN cases with reduced Tau protein levels were designated amount of seven proteins decreased while that of 13 in- as FTLD-TDP-GRNlτ and other FTLD-TDP cases with creased in FTLD-TDP-GRNlτ (Table 3). Eleven proteins conserved Tau protein expression as FTLD-TDPτ. which intensity varies belong to proteins involved in me- This reduced Tau protein level could result from a lower tabolism (Table 3). Stress-related protein HSP-70.1 and transcription of MAPT gene in these brains. However, RT- structural proteins such as Gelsolin and Neurofilament qPCR using primers targeting constitutively Tau mRNA light chain showed an increased expression (Table 3). A encoded sequences [5’ UTR and exons 11–12 (E11-12)] re- decrease of UCHL1 (spot 976, −1.3 fold change), a neur- vealed no significant decrease in total Tau mRNA level onal enzyme involved in ubiquitinated proteins process- whatever the neuropathological group considered ing, was also found (Table 3). Interestingly, decrease and (Additional file 1: Figure S1). Therefore, consistent modification in proteins involved in synaptic function with previous data published in 2001 [21], these data (STXB1, DPYL2 and GLNA gene product in spot 448, confirm a reduction in Tau protein expression that 481, 689 with −1.3, −1.3 and −1.2 fold change, respect- cannot be explained by a MAPT gene trancription ively) were observed suggesting a stronger synaptic im- modification. But more interestingly, herein we show pairment in the FTLD-TDP-GRNlτ group (Table 3). that this decrease in Tau protein expression is re- Regarding glial cells, a decrease in glutamine synthetase stricted to patients with GRN mutations. (GS; astrocytic enzyme involved in glutamate metabol- ism) was observed with a −1.2 fold change, whereas the FTLD-TDP-GRNlτ brains display more astrogliosis and highest fold change (+3.2) was related to four spots cor- neuronal dysfunction compared to other FTLD-TDPτ brains responding to GFAP (Table 3). Taken together, these Since Tau protein level is reduced but not mRNA, we in- data demonstrate a strong correlation between reduction vestigated if other proteins could be modified. We there- of Tau protein expression, astrocytic and synaptic dys- fore performed a quantitative proteomic analysis using functions. Therefore, these proteomic data highlight 2D-DIGE to evaluate any dysregulation of other protein quantitative dysregulation of protein expression other Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 7 of 14 Fig. 1 Reduction of Tau protein expression in FTLD brains. a Western blot analysis of soluble Tau protein expression in control, AD and FTLD brains using antibodies targeting total Tau independently of any post-translational modification (N-ter, Tau 5 and C-ter). Are shown representative data from FTLD-TDP-GRN (n = 10), FTLD-TDP-C9ORF72 (n = 10), sporadic FTLD-TDP (n = 8), sporadic FTLD-FUS (n = 5), AD (n = 8) and control brains (n = 8). b Total Tau levels were quantified and normalized to a pool containing same protein amount of each control used in this study. Both full-length and truncated Tau species were considered for the quantification. Actin was used as loading control. Results are expressed as means ± SEM. For statistical analysis the Kruskal-Wallis test was used (*p < 0.05, **p < 0.01; ***p < 0.001). SEM: standard error of the mean; kDa: kiloDalton than Tau proteins in the brain from patients with FTLD- in comparison with both control and other FTLD-TDP TDP bearing GRN mutations. cases (Fig. 3a, b). Noteworthy, GS was found to be dra- matically decreased (Fig. 3a, b). With regards to synaptic Proteomic results validation in brain samples highlight proteins, several synaptic markers were decreased in- specific dysregulation in FTLD-TDP-GRNlτ brains cluding α-synuclein and PSD-95 (Fig. 3a, b). These dys- To validate these proteomic results found in a subset of regulations found in FTLD-TDP-GRNlτ brains could be patients, we therefore undertook an analysis of dysregu- the reflect of a global proteome deterioration in these lated neuronal and astrocytic proteins in all brain sam- samples. We thus tested the level of several proteins ples (FTLD-TDP-GRNlτ, FTLD-TDPτ and control) using such as Neuronal Specific Enolase (NSE), Aconitase, western blot analysis. We first confirmed an increase in Histone H3 and Neurofilaments. Their levels remain HSP-70 protein level in FTLD-TDP-GRNlτ cases (Fig. 3a, unchanged among the different FTLD subclasses (Add- b). Very strikingly, we observed as in 2D-DIGE, an up- itional file 2: Figure S2). Finally, it is also worth noting surge in GFAP expression in FTLD-TDP-GRNlτ group that among FTLD patients we could not find any Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 8 of 14 Fig. 2 2D-DIGE analysis of FTLD-TDP-GRNlτ and FTLD-TDPτ cases. Analysis of 2D-DIGE gels was performed using TotalLab SameSpot software. a Overlay of 2D-DIGE images with the two possible combinations. In the upper panel, FTLD-TDP-GRNlτ pool is labeled with Cy3 (green) and FTLD-TDPτ brains with Cy5 (red). In the lower panel, FTLD-TDP-GRNlτ pool is labeled with Cy5 (red) and FTLD-TDPτ brains with Cy3 (green). In both combination, the internal standard is labeled with Cy2 (blue). b 2D-DIGE map of proteins which are deregulated in FTLD-TDP-GRNlτ samples compared to FTLD-TDPτ samples. Spots of interest (numbers) are listed and described in Table 3. kDa: kiloDalton; MW: molecular weight correlation between Tau protein decrease, macroscopic TDP-43, the main constituent of aggregates found in atrophy, post-mortem delay (PMD) and RNA Integrity FTLD-TDP-GRNlτ cases, is involved in RNA metabolism Number (RIN) (Table 2, Additional file 3: Figure S3a, b, and especially in mRNA transport and stability through c respectively). All these results provide further evidence 3’UTR binding of targeted transcripts (see [29–31] for re- that specific dysregulations affect FTLD-TDP-GRNlτ pa- view). Notably, a recent study showed that loss of TDP-43 tients such as dramatic synaptic impairment and massive function impairs microtubule-dependent transport of reactive astrogliosis. mRNA granules towards distal neuronal compartment [32]. Regarding axonal translation of Tau [33], loss of TDP-43 function may lead to deficient Tau protein trans- Discussion lation. Nevertheless, this hypothesis suggests specific For the first time since Zhukareva’s studies, our data pathophysiological process in FTLD-TDP-GRNlτ when clearly demonstrate that the reduced Tau protein ex- compared to other FTLD-TDP cases that do not display pression is restricted to FTLD-TDP brains with muta- change in Tau protein level. tions on GRN gene. Although several FTLD brains MicroRNAs (miRNAs) play a key role in both normal display a lower Tau protein level with Tau C-ter anti- aging and neurodegenerative diseases (see [34, 35] for body, the labelling obtained with N-ter and Tau 5 review). Interestingly, studies have reported that dif- shows a relative conservation of Tau protein expres- ferent miRNA are able to modulate Tau metabolism sion suggesting a preferential degradation of Tau at [36, 37]. Among them, miR-219 is particularly inter- the C-terminal part in these cases. In contrast, FTLD- esting since it modulates Tau protein translation with TDP-GRNlτ brains exhibit reduced Tau levels with all relatively low influence on total Tau mRNA level. Tau antibodies tested. Consistent with this study, it is worth noting that Consistent with previous studies, reduction of Tau TDP-43 is also involved in miRNA biogenesis [38], protein expression is unlikely to result from extensive suggesting that specific miRNA deregulation could neuronal loss as demonstrated by the preserved expres- lead to a reduction of Tau mRNA translation in sion of several specific neuronal proteins [21, 22]. More- FTLD-TDP-GRNlτ brains. Finally, emerging evidences over, we could not find any correlation between reduced indicate that Tau is physiologically released into Tau level and PMD, RIN or cortical atrophy. Finally, extracellular space through multiple mechanisms such downregulation of MAPT transcription does not appear as multivesicular body and ectosome secretion [39]. It to be responsible for this decrease in Tau since mRNA could therefore be interesting to evaluate Tau protein level remains unchanged in these FTLD-TDP-GRNlτ level in cerebrospinal fluid to see if an increase in brains. Therefore, reduction of Tau protein might rather Tau secretion participates to this reduction of Tau result from post-transcriptional dysregulations. protein expression. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 9 of 14 Table 3 Proteins differentially expressed between FTLD-TDP-GRNlτ and FTLD-TDPτ Spot n° Protein name Accession No. Gene name p-value Fold Theoretical Apparent Mascot % sequence change pI/MW pI/MW score coverage 308 Gelsolin P06396 GSN 0.001 +1.4 5.9/85 5.9/85 77 1.4 436 Neurofilament light polypeptide P07196 NEFL 4.57E-04 - 1.5 4.5/61.5 4.5/61.5 202 34.3 Metabolism related proteins 780 Glyceraldehyde-3-phosphate P04406 GAPDH 0.001 +1.3 8.6/36 8.4/36 63.5 21.2 dehydrogenase (2) 1040 Ferritin light subunit P02792 FTL 3.67E-06 +2.2 5.4/20 5.4/20 354.5 30.3 738 Fructose 1.6 biphosphate aldolase P04075 ALDOA 0.0037 +1.2 9.2/39.4 9.2/39.4 81 33.5 639 Alpha-enolase P06733 ENO1 1.57E-04 +1.9 7.7/47.1 7.7/47.1 178 44.5 1033 Phosphatidylethanolamine-binding P30086 PEBP1 0.007 +1.3 7.4/21 8.4/21 101 56.7 protein 1 956 Peroxiredoxin 6 P30041 PRDX6 1.94E-05 +1.9 6.3/25 7.0/25 147 52.2 523 Pyruvate Kinase M (2) P14618 PKM 0.019 +1.2 9.0/60 8.4/60 93.9 31.8 708 Phosphoglycerate kinase 1 P00558 PGK1 0.023 +1.2 9.2/45 9.2/45 95.2 29.5 770 N(G).N(G)-dimethylarginine O94760 DDAH1 4.36E-04 +1.3 5.5/31.1 5.8/43 121 44.6 dimethylaminohydrolase 1 838 Guanine nucleotide-binding P62873 GNB1 7.02E-05 - 1.6 5.6/37 5.6/37 117 42.9 protein 1 714 Creatine Kinase B P12277 CKB 0.004 - 1.2 5.2/42.6 5.6/42.6 206 54.9 Astrocytic related proteins 618 Glial fibrillary acidic protein (3) P14136 GFAP 2.43E-06 +3.2 5.3/49.8 5.5/49.8 287 56.4 689 Glutamine synthetase P15104 GLUL 0.003 - 1.2 6.5/42 7.2/42 69.4 16.4 Synaptic related proteins 476 Dihydropyrimidinase-related Q16555 DPYSL2 4.62E-04 - 1.3 5.9/62.3 6.6/62.3 274 50.1 protein 2 (2) 448 Syntaxin-binding protein 1 (2) P61764 STXB1 3.70E-04 - 1.3 6.5/67.5 7.6/60 138 22.6 Other 883 Annexin 5 P08758 ANXA5 1.75E-04 +1.5 4.8/35.9 4.8/35.9 188 45.6 976 Ubiquitin carboxyl-terminal P09936 UCHL1 0.003 - 1.3 5.2/25 5.2/25 85.8 47.1 hydrolase isoenzyme L1 430 Heat shock 70 kDa protein 1A P0DMV8 HSPA1A 0.002 +1.3 5.4/70 5.4/60 110 27.9 Data obtained from Samespot software are presented for each spot of interest: spot number, p-value, fold change (FTLD-TDP-GRNlτ vs FTLD-TDPτ), experimental molecular weight (MW) and isoelectric point (pI). According to mass spectrometry identification of each protein, table also gives: the protein full name, accession number, gene name, mascot score, sequence coverage (%), and the theoretical molecular weight (MW) and pI of the non-modified protein. A mascot score above 61 was considered as significant for protein identification. Difference between theoretical and experimental molecular weight or pI is underlined. Number of iso- variants for each protein spot is indicated with the protein name (see parenthesis) All FTLD-TDP-GRNlτ cases display mutation on the function [46]. All these data suggest a strong role of pro- GRN gene. It is well established that mutations on GRN granulin in neurodegenerative diseases but how can we gene induce haploinsufficiency with approximatively relate the reduction of Tau with GRN mutations? De- 50 % reduction in mRNA levels and 33 % in protein level pending on the mutation, we observed very distinct [8]. However, how progranulin haploinsuffiency leads to phenotype between cases. Indeed, cases affected by a neurodegeneration is still unclear, in part due to the lack total deletion of one GRN allele do not display any de- of progranulin-deficient models recapitulating FTLD crease in Tau expression whereas other point mutations hallmarks. Progranulin is a secreted protein widely are associated with a huge reduction of all six isoforms. expressed throughout the body that exerts numerous This result is remarkable and suggests for the first time functions during development, tumor proliferation and that different mutations can induce distinct phenotype inflammation (see [40, 41] for review). In adult brain, and not only haploinsufficiency. Indeed, homozygous de- progranulin is mostly found in neurons and activated letion of GRN does not lead to FTLD-TDP but to an- microglia [42] where it regulates neurite outgrowth [43], other disorder called Neuronal Ceroid Lipofuscinosis synapse biology [44], stress response [45] and lysosomal (NCL) which is characterized by lysosomal dysfunction Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 10 of 14 Fig. 3 Biochemical validation of 2D-DIGE results in control, FTLD-TDP-GRNlτ and FTLD-TDPτ brain samples. a Western blot analysis of synaptic [PSD-95, α-synuclein (α-syn), Munc-18 and Synaptophysin (SYP)], astrocytic [GFAP and Glutamine Synthetase (GS)], and stress (HSP-70) related protein level in control, FTLD-TDP-GRNlτ and FTLD-TDPτ brain samples. Representative data from FTLD-TDP-GRNlτ (n = 8), FTLD-TDPτ (n = 20) and control brains (n = 8) are presented. b Protein levels were quantified and normalized to a pool containing same protein amount of each control used in this study. Actin was used as loading control. Results are expressed as means ± SEM. For statistical analysis the Kruskal-Wallis test was used (*p < 0.05; **p < 0.01; ***p < 0,001; ****p < 0,0001). SEM: standard error of the mean [46]. Thus, a recent study has demonstrated that specific depression and long-term potentiation [60, 61]. Regarding granulins expression, resulting from progranulin extracellu- our results, it would not be surprising that decrease in lar cleavage, could have toxic effect [47]. These point muta- Tau protein expression leads to neuronal dysfunction. tions could lead to modified mRNA leading to the This hypothesis is strengthened by our 2D-DIGE production of toxic granulins. However, the lack of infor- analysis and biochemical validation, demonstrating that mation on the different granulins, and their functions are expression of several neuronal proteins is either up- or still unknown and the relationship with Tau metabolism, if down-regulated. Indeed, both pre- and post-synaptic any, remains to be experimentally established. proteins such as PSD-95, Munc-18, α-synuclein, synap- Reduction of Tau protein expression in FTLD-TDP- tophysin and syntaxin-binding protein 1 are highly re- GRNlτ brains is intriguing since Tau has essential duced in FTLD-TDP-GRNlτ brains in comparison to functions in neuron. Indeed, Tau protein is a micro- control and FTLD-TDPτ brains. It’s interesting to note tubule associated protein (MAP) which mainly distributes that a very recent study has described a link between into axons [48] and was originally described as a protein synaptic dysfunction and progranulin deficiency [62]. regulating the assembly and stabilization of microtubules Indeed, progranulin deficiency is able to induce synaptic [49, 50], therefore modulating axonal transport [51]. How- pruning through lysosome dysfunctions and comple- ever, recent studies have highlighted a role for Tau in ment activation. It could explain, in part, the dramatic synaptic [52, 53] and nuclear compartments [54, 55]. Al- synaptic loss we found in FTLD-TDP-GRNlτ brains, in though initial studies showed that tau-knockout mice de- whom progranulin levels are very low. Finally, regarding velop no evident pathology, probably through MAP1A downregulation of dihydropyriminidase-related protein 2 compensatory effect [56], recent studies have revealed sev- (DPYSL2), also called collapsin response mediator pro- eral pathological modifications in these knockout mice tein-2 (CRMP2), it should be noted that this protein serves suggesting that Tau is essential for neuronal activity [57], important functions in synaptic plasticity. Moreover, iron export [58], neurogenesis [59] and both long-term CRMP2 and Tau are both high-abundance microtubule- Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 11 of 14 associated proteins, and overlap in terms of functional help us to better characterize and understand this particu- regulation [63]. All these data demonstrate that synaptic lar subclass of FTLD-TDP. functions are impaired in these FTLD-TDP-GRNlτ brains. In parallel with these neuronal dysfunctions, an Additional files increase in GFAP expression is also observed in FTLD- TDP-GRNlτ brains. GFAP belongs to intermediate fila- Additional file 1: Figure S1. Preservation of Tau mRNA in FTLD-TDP- GRNlτ group. qPCR analysis was done on total Tau mRNA in control and ments and is expressed mostly in astrocytes. These glial FTLD brain samples. Both 5’UTR (Untranslated Region) and E11-12 (Exons cells are complex highly differentiated cells that perform 11–12) primers target regions present in all Tau transcripts. Data were numerous essential functions in central nervous system normalized to the mean value of control cases with Large Ribosomal Protein P0 (RPLP0) used as reference gene. Results are expressed as (CNS), such as synaptic function and plasticity and means ± SEM. For statistical analysis the Mann–Whitney test was used (ns non maintenance of the neuronal microenvironment homeo- significant), n =5–10/group. SEM: standard error of the mean. (TIF 176 kb) stasis [64]. Astrocytes respond to various forms of CNS Additional file 2: Figure S2. Conservation of several proteins among injury such as infections, ischemia or neurodegenerative the different FTLD subclasses. (a) Western blot analysis of NSE (Neuron Specific Enolase), Aconitase, Histone H3 and Heavy (NF-H) Neurofilaments diseases through a process referred to as reactive astro- protein level in control and FTLD-U brain samples. Are shown representa- gliosis and often characterized by an increase in GFAP tive data from FTLD-TDP-GRNlτ (n = 8), FTLD-TDP-C9ORF72 (n = 10), spor- expression [65]. Although a mild to moderate reactive adic FTLD-TDP (n = 8), sporadic FTLD-FUS (n = 5) and control brains (n = 8). (b) Protein levels were quantified and normalized to a pool astrogliosis represents a protective mechanism, severe containing same protein amount of each control used in this study. astrogliosis could lead to functional defects including Actin was used as loading control. Results are expressed as means ± alteration of astrocyte ability to control neuronal micro- SEM. For statistical analysis the Kruskal-Wallis test was used (ns non significant). SEM: standard error of the mean. (TIF 223 kb) environment homeostasis [66, 67]. Interestingly in Additional file 3: Figure S3. Reduction of Tau protein expression does FTLD-TDP-GRNlτ brains, a decrease in GS expression not result from greater post-mortem delay, aberrant RIN or cortical atro- has been found. This astrocytic enzyme that converts phy in FTLD-TDP-GRNlτ brains. (a) Fixed hemibrain weight, (b) post- glutamate into glutamine is frequently deregulated in mortem delay and (c) RIN (RNA Integrity Number) of FTLD-TDP-GRNlτ, FTLD-TDP-C9ORF72, sporadic FTLD-TDP, sporadic FTLD-FUS and control neurodegenerative diseases presenting with Tau modifi- brains. Results are expressed as means ± SEM. For statistical analysis the cation [68, 69]. Thus, our results indicate that decrease Kruskal-Wallis test was used (*p < 0.05; ns non significant). a.u arbitrary in GS may underlie glutamate homeostasis alteration, unit, SEM: standard error of the mean. (TIF 164 kb) leading to more severe failures in synaptic connectivity and transmission in FTLD-TDP-GRNlτ brains. However, Acknowledgments AP has received a PhD scholarship from University of Lille 2. This work was why it is limited to cases presenting with point muta- supported by LabEx DISTALZ, CNRS and France Alzheimer Association. We tions of GRN still remains unclear. Beside this, we also would like to thank the Lille Neurobank and GIE Neuroceb, Paris for providing found numerous deregulated proteins related to glyco- human brain tissues. We would also like to thank Raphaëlle Caillierez and Florent Sauve for their technical assistance. lytic metabolism suggesting a critical role for alterations in brain metabolism and energetics in neurodegenerative Authors’ contributions processes. Therefore, metabolism dysregulation could re- AP, LB, NS and VBS conceived and designed the experiments. AP performed flect a more severe pathological state in these brains. most of the biochemical and proteomic experiments. SE, FJFG, PP, HO and CM also participated to the biochemical and proteomic experiments. AP, SE, FJFG, PP, HO, AB, ILB, LB, NS and VBS analyzed the data. VA, AC andILB performed the molecular experiments. VD, CAM and CD contributed to the Conclusions neuropathological status. AP, LB, NS and VBS wrote the paper. All authors read and approved the final manuscript. To conclude, our data reveal that reduction in Tau protein expression is a specific feature of FTLD-TDP cases with Competing interests GRN mutation, suggesting that FTLD-TDP-GRNlτ cases The authors declare that they have no competing interests. could represent a distinct subclass in the current FTLD Author details classification. Moreover, proteomic results clearly demon- 1 2 University of Lille, Inserm, CHU-Lille, F-59000 Lille, France. Sorbonne strate that in addition to a decrease in Tau protein expres- Universités, UPMC Univ Paris 06, Hôpital Pitié-Salpêtrière, Paris, France. 3 4 INSERM UMRS_1127, Hôpital Pitié-Salpêtrière, Paris, France. CNRS sion, FTLD-TDP-GRNlτ cases also displayed astrocytic UMR_7225, Hôpital Pitié-Salpêtrière, Paris, France. AP-HP, Hôpital and synaptic dysfunctions explaining more severe physio- Pitié-Salpêtrière, Paris, France. ICM, Hôpital Pitié-Salpêtrière, Paris, France. 7 8 pathological processes. However, we are not currently able Université Artois, Faculté Jean Perrin, F-62307 Lens, France. Inserm UMRS1172 – Alzheimer & Tauopathies, Faculty of Medecine-Research Pole, to explain this particular feature in part due to the nature University of Lille, Place de Verdun, F-59045 Lille cedex, France. of samples, which are post-mortem tissues, and make these dynamic mechanisms investigation complex. If re- Received: 2 June 2016 Accepted: 10 July 2016 duced Tau level is a consequence or an actor of deregula- tions found in these brains remains to be determined and References will require development of both in vitro and in vivo 1. Rabinovici G, Miller B. Frontotemporal lobar degeneration: epidemiology, models. Finally, further proteomic investigations will also pathophysiology, diagnosis and management. CNS Drugs. 2010;24:375–98. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 12 of 14 2. Chare L, Hodges JR, Leyton CE, McGinley C, Tan RH, Kril JJ, Halliday GM. New 17. Arai T, Hasegawa M, Akiyama H, Ikeda K, Nonaka T, Mori H, Mann D, criteria for frontotemporal dementia syndromes: clinical and pathological Tsuchiya K, Yoshida M, Hashizume Y, Oda T. TDP-43 is a component of diagnostic implications. J Neurol Neurosurg Psychiatry. 2014;85:865–70. ubiquitin-positive tau-negative inclusions in frontotemporal lobar 3. Gorno-Tempini ML, Hillis AE, Weintraub S, Kertesz A, Mendez M, Cappa SF, degeneration and amyotrophic lateral sclerosis. Biochem Biophys Res Ogar JM, Rohrer JD, Black S, Boeve BF, Manes F, Dronkers NF, Commun. 2006;351:602–11. Vandenberghe R, Rascovsky K, Patterson K, Miller BL, Knopman DS, Hodges 18. Neumann M, Rademakers R, Roeber S, Baker M, Kretzschmar HA, MacKenzie JR, Mesulam MM, Grossman M. Classification of primary progressive aphasia IRA. A new subtype of frontotemporal lobar degeneration with FUS and its variants. Neurology. 2011;76:1006–14. pathology. Brain. 2009;132:2922–31. 4. Burrell JR, Kiernan MC, Vucic S, Hodges JR. Motor neuron dysfunction in 19. Urwin H, Josephs KA, Rohrer JD, MacKenzie IR, Neumann M, Authier A, frontotemporal dementia. Brain. 2011;134:2582–94. Seelaar H, Van Swieten JC, Brown JM, Johannsen P, Nielsen JE, Holm IE, 5. Neary D, Snowden JS, Gustafson L, Passant U, Stuss D, Black S, Freedman M, Dickson DW, Rademakers R, Graff-Radford NR, Parisi JE, Petersen RC, Kertesz A, Robert PH, Albert M, Boone K, Miller BL, Cummings J, Benson DF. Hatanpaa KJ, White CL, Weiner MF, Geser F, Van Deerlin VM, Trojanowski JQ, Frontotemporal lobar degeneration A consensus on clinical diagnostic Miller BL, Seeley WW, Van Der Zee J, Kumar-Singh S, Engelborghs S, De criteria. Neurology. 1998;51:1546–54. Deyn PP, Van Broeckhoven C, et al. FUS pathology defines the majority of 6. Seelaar H, Kamphorst W, Rosso SM, Azmani A, Masdjedi R, De Koning I, tau-and TDP-43-negative frontotemporal lobar degeneration. Acta Maat-Kievit JA, Anar B, Kaat LD, Breedveld GJ, Dooijes D, Rozemuller JM, Neuropathol. 2010;120:33–41. Bronner IF, Rizzu P, Van Swieten JC. Distinct genetic forms of 20. Holm IE, Isaacs AM, MacKenzie IRA. Absence of FUS-immunoreactive frontotemporal dementia. Neurology. 2008;71:1220–6. pathology in frontotemporal dementia linked to chromosome 3 (FTD-3) 7. Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, Pickering- caused by mutation in the CHMP2B gene. Acta Neuropathol. 2009;118:719–20. Brown S, Chakraverty S, Isaacs A, Grover A, Hackett J, Adamson J, Lincoln S, 21. Zhukareva V, Vogelsberg-Ragaglia V, Van Deerlin VM, Bruce J, Shuck T, Dickson D, Davies P, Petersen RC, Stevens M, de Graaff E, Wauters E, van Grossman M, Clark CM, Arnold SE, Masliah E, Galasko D, Trojanowski JQ, Lee Baren J, Hillebrand M, Joosse M, Kwon JM, Nowotny P, Che LK, Norton J, VM. Loss of brain tau defines novel sporadic and familial tauopathies with Morris JC, Reed L a, Trojanowski J, Basun H, et al. Association of missense frontotemporal dementia. Ann Neurol. 2001;49:165–75. and 5’-splice-site mutations in tau with the inherited dementia FTDP-17. 22. Zhukareva V, Sundarraj S, Mann D, Sjogren M, Blenow K, Clark CM, McKeel Nature. 1998;393:702–5. DW, Goate A, Lippa CF, Vonsattel J-P, Growdon JH, Trojanowski JQ, Lee VM- Y. Selective reduction of soluble tau proteins in sporadic and familial 8. Baker M, Mackenzie IR, Pickering-Brown SM, Gass J, Rademakers R, Lindholm frontotemporal dementias: an international follow-up study. Acta C, Snowden J, Adamson J, Sadovnick a D, Rollinson S, Cannon A, Dwosh E, Neuropathol. 2003;105:469–76. Neary D, Melquist S, Richardson A, Dickson D, Berger Z, Eriksen J, Robinson T, Zehr C, Dickey C a, Crook R, McGowan E, Mann D, Boeve B, Feldman H, 23. Mackenzie IRA, Neumann M, Bigio EH, Cairns NJ, Alafuzoff I, Kril J, Kovacs Hutton M. Mutations in progranulin cause tau-negative frontotemporal GG, Ghetti B, Halliday G, Holm IE, Ince PG, Kamphorst W, Revesz T, dementia linked to chromosome 17. Nature. 2006;442:916–9. Rozemuller AJM, Kumar-Singh S, Akiyama H, Baborie A, Spina S, Dickson 9. Cruts M, Gijselinck I, van der Zee J, Engelborghs S, Wils H, Pirici D, DW, Trojanowski JQ, Mann DMA. Nomenclature for neuropathologic Rademakers R, Vandenberghe R, Dermaut B, Martin JJ, van Duijn C, Peeters subtypes of frontotemporal lobar degeneration: Consensus K, Sciot R, Santens P, De Pooter T, Mattheijssens M, Van den Broeck M, Cuijt recommendations. Acta Neuropathol. 2009;117:15–8. I, Vennekens K, De Deyn PP, Kumar-Singh S, Van Broeckhoven C. Null 24. Mackenzie IRA, Shi J, Shaw CL, DuPlessis D, Neary D, Snowden JS, Mann mutations in progranulin cause ubiquitin-positive frontotemporal dementia DMA. Dementia lacking distinctive histology (DLDH) revisited. Acta linked to chromosome 17q21. Nature. 2006;442:920–4. Neuropathol. 2006;112:551–9. 10. DeJesus-Hernandez M, Mackenzie IR, Boeve BF, Boxer AL, Baker M, 25. Fernandez-Gomez F-J, Jumeau F, Derisbourg M, Burnouf S, Tran H, Rutherford NJ, Nicholson AM, Finch N a, Flynn H, Adamson J, Kouri N, Eddarkaoui S, Obriot H, Dutoit-Lefevre V, Deramecourt V, Mitchell V, Lefranc Wojtas A, Sengdy P, Hsiung G-YR, Karydas A, Seeley WW, Josephs, Coppola D, Hamdane M, Blum D, Buée L, Buée-Scherrer V, Sergeant N. Consensus G, Geschwind DH, Wszolek ZK, Feldman H, Knopman DS, Petersen RC, Miller brain-derived protein, extraction protocol for the study of human and BL, Dickson DW, Boylan KB, Graff-Radford NR, Rademakers R. Expanded murine brain proteome using both 2D-DIGE and mini 2DE immunoblotting. GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes J Vis Exp. 2014;3:1–8. chromosome 9p-linked FTD and ALS. Neuron. 2011;72:245–56. 26. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using 11. Renton AE, Majounie E, Waite A, Simón-Sánchez J, Rollinson S, Gibbs JR, real-time quantitative PCR and the 2^(−ΔΔCT) method. Methods. 2001;25:402–8. Schymick JC, Laaksovirta H, van Swieten JC, Myllykangas L, Kalimo H, Paetau 27. Behrouzi R, Liu X, Wu D, Robinson AC, Tanaguchi-Watanabe S, Rollinson S, A, Abramzon Y, Remes AM, Kaganovich A, Scholz SW, Duckworth J, Ding J, Shi J, Tian J, Hamdalla HHM, Ealing J, Richardson A, Jones M, Pickering- Harmer DW, Hernandez DG, Johnson JO, Mok K, Ryten M, Trabzuni D, Brown S, Davidson YS, Strong MJ, Hasegawa M, Snowden JS, Mann DMA. Guerreiro RJ, Orrell RW, Neal J, Murray A, Pearson J, Jansen IE, et al. A Pathological tau deposition in Motor Neurone Disease and frontotemporal hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome lobar degeneration associated with TDP-43 proteinopathy. Acta 9p21-linked ALS-FTD. Neuron. 2011;72:257–68. Neuropathol Commun. 2016;4:33. 12. Watts GDJ, Wymer J, Kovach MJ, Mehta SG, Mumm S, Darvish D, Pestronk A, 28. Buée L, Bussière T, Buée-Scherrer V, Delacourte A, Hof PR. Tau protein Whyte MP, Kimonis VE. Inclusion body myopathy associated with Paget isoforms, phosphorylation and role in neurodegenerative disorders. Brain disease of bone and frontotemporal dementia is caused by mutant valosin- Res Brain Res Rev. 2000;33:95–130. containing protein. Nat Genet. 2004;36:377–81. 29. Lagier-Tourenne C, Polymenidou M, Cleveland DW. TDP-43 and FUS/TLS: 13. Skibinski G, Parkinson NJ, Brown JM, Chakrabarti L, Lloyd SL, Hummerich H, emerging roles in RNA processing and neurodegeneration. Hum Mol Genet. Nielsen JE, Hodges JR, Spillantini MG, Thusgaard T, Brandner S, Brun A, 2010;19:R46–64. Rossor MN, Gade A, Johannsen P, Sørensen SA, Gydesen S, Fisher EM, 30. Chen-plotkin AS, Lee VM, Trojanowski JQ. TAR DNA-binding protein 43 in Collinge J. Mutations in the endosomal ESCRTIII-complex subunit CHMP2B neurodegenerative disease. Nat Rev Neurol. 2010;6:211–20. in frontotemporal dementia. Nat Genet. 2005;37:806–8. 31. Lee EB, Lee VM-Y, Trojanowski JQ. Gains or losses: molecular mechanisms of 14. Cairns NJ, Bigio EH, Mackenzie IRA, Schneider JA, Paulo UDS, Paulo S, TDP43-mediated neurodegeneration. Nat Rev Neurosci. 2012;13:38–50. Halliday G, Escourolle LDN, Salpêtrière HD. La, Lowe JS: Neuropathological 32. Alami NH, Smith RB, Carrasco MA, Williams LA, Winborn CS, Han SSW, diagnostic and nosologic criteria for FTLD : consensus of the Consortium for Kiskinis E, Winborn B, Freibaum BD, Kanagaraj A, Clare AJ, Badders NM, FLTD. Acta Neuropathol. 2010;114:5–22. Bilican B, Chaum E, Chandran S, Shaw CE, Eggan KC, Maniatis T, Taylor JP. 15. Rademakers R, Neumann M, Mackenzie IR. Advances in understanding the Axonal transport of TDP-43 mRNA granules is impaired by ALS-causing molecular basis of frontotemporal dementia. Nat Rev Neurol. 2012;8:423–34. mutations. Neuron. 2014;81:536–43. 16. Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, 33. Aronov S, Aranda G, Behar L, Ginzburg I. Axonal tau mRNA localization Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, Miller BL, Masliah E, coincides with tau protein in living neuronal cells and depends on axonal Mackenzie IR, Feldman H, Feiden W, Kretzschmar H a, Trojanowski JQ, Lee targeting signal. J Neurosci. 2001;21:6577–87. VM-Y. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and 34. Piscopo P, Albani D, Castellano AE, Forloni G, Confaloni A. Frontotemporal amyotrophic lateral sclerosis. Science. 2006;314:130–3. Lobar Degeneration and MicroRNAs. Front Aging Neurosci. 2016;8:1–7. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 13 of 14 35. Gascon E, Gao FB. Cause or effect: Misregulation of microRNA pathways in Tau in neuronal DNA and RNA protection in vivo under physiological and neurodegeneration. Front Neurosci. 2012;6:1–10. hyperthermic conditions. Front Cell Neurosci. 2014;8:84. 36. Smith PY, Hernandez-Rapp J, Jolivette F, Lecours C, Bisht K, Goupil C, Dorval 56. Harada A, Oguchi K, Okabe S, Kuno J, Terada S, Ohshima T, Sato-Yoshitake V, Parsi S, Morin F, Planel E, Bennett DA, Fernandez-Gomez F-J, Sergeant N, R, Takei Y, Noda T, Hirokawa N. Altered microtubule organization in small- Buée L, Tremblay M-È, Calon F. Hébert SS: miR-132/212 deficiency impairs calibre axons of mice lacking tau protein. Nature. 1994;369:488–91. tau metabolism and promotes pathological aggregation in vivo. Hum Mol 57. Lei P, Ayton S, Moon S, Zhang Q, Volitakis I, Finkelstein DI, Bush AI. Motor Genet. 2015;24:6721–35. and cognitive deficits in aged tau knockout mice in two background strains. Mol Neurodegener. 2014;9:29. 37. Santa-Maria I, Alaniz ME, Renwick N, Cela C, Fulga TA, Van Vactor D, Tuschl T, Clark LN, Shelanski ML, McCabe BD, Crary JF. Dysregulation of microRNA- 58. Lei P, Ayton S, Finkelstein DI, Spoerri L, Ciccotosto GD, Wright DK, Wong BXW, 219 promotes neurodegeneration through post-transcriptional regulation of Adlard P a, Cherny R a, Lam LQ, Roberts BR, Volitakis I, Egan GF, McLean C a, tau. J Clin Invest. 2015;125:681–6. Cappai R, Duce J a, Bush AI. Tau deficiency induces parkinsonism with 38. Kawahara Y, Mieda-Sato A. TDP-43 promotes microRNA biogenesis as a dementia by impairing APP-mediated iron export. Nat Med. 2012;18:291–5. component of the Drosha and Dicer complexes. Proc Natl Acad Sci U S A. 59. Fuster-Matanzo A, Llorens-Martín M, Jurado-Arjona J, Avila J, Hernández F. 2012;109:3347–52. Tau protein and adult hippocampal neurogenesis. Front Neurosci. 2012;6:1–6. 39. Dujardin S, Begard S, Caillierez R, Lachaud C, Delattre L, Carrier S, Loyens A, 60. Ahmed T, Van der Jeugd A, Blum D, Galas MC, D’Hooge R, Buee L, Balschun Galas MC, Bousset L, Melki R, Auregan G, Hantraye P, Brouillet E, Buee L, D. Cognition and hippocampal synaptic plasticity in mice with a Colin M. Ectosomes: A new mechanism for non-exosomal secretion of Tau homozygous tau deletion. Neurobiol Aging. 2014;35:2474–8. protein. PLoS ONE. 2014;9:28–31. 61. Kimura T, Whitcomb DJ, Jo J, Regan P, Piers T, Heo S, Brown C, Hashikawa T, 40. Petkau TL, Leavitt BR. Progranulin in neurodegenerative disease. Trends Murayama M, Seok H, Sotiropoulos I, Kim E, Collingridge GL, Takashima A, Neurosci. 2014;37:388–98. Cho K. B PTRS: Depression in the hippocampus Microtubule-associated 41. Cenik B, Sephton CF, Cenik BK, Herz J, Yu G. Progranulin: A proteolytically protein tau is essential for long-term depression in the hippocampus. Philos processed protein at the crossroads of inflammation and Trans R Soc Lond B Biol Sci. 2014;369:1633. neurodegeneration. J Biol Chem. 2012;287:32298–306. 62. Lui H, Zhang J, Makinson SR, Paz JT, Barres BA, Huang EJ, Lui H, Zhang J, 42. Petkau TL, Neal SJ, Orban PC, MacDonald JL, Hill a M, Lu G, Feldman HH, Makinson SR, Cahill MK, Kelley KW, Huang H. Progranulin deficiency Mackenzie IR a, Leavitt BR. Progranulin expression in the developing and promotes circuit-specific synaptic pruning by microglia via complement adult murine brain. J Comp Neurol. 2010;518:3931–47. activation. Cell. 2016;165:921–35. 43. Gass J, Lee WC, Cook C, Finch N, Stetler C, Jansen-West K, Lewis J, 63. Hensley K, Kursula P. Collapsin Response Mediator Protein-2 (CRMP2) is a Link CD, Rademakers R, Nykjær A, Petrucelli L. Progranulin regulates plausible etiological factor and potential therapeutic target in Alzheimer’s neuronal outgrowth independent of sortilin. Mol Neurodegener. disease: Comparison and contrast with microtubule-associated protein tau. J 2012;7:33. Alzheimer’s Dis. 2016;53:1–14. 64. Nedergaard M, Ransom B, Goldman SA. New roles for astrocytes: Redefining 44. Tapia L, Milnerwood A, Guo A, Mills F, Yoshida E, Vasuta C, Mackenzie IR, the functional architecture of the brain. Trends Neurosci. 2003;26:523–30. Raymond L, Cynader M, Jia W, Bamji SX. Progranulin deficiency decreases gross neural connectivity but enhances transmission at individual synapses. 65. Sofroniew MV. Molecular dissection of reactive astrogliosis and glial scar J Neurosci. 2011;31:11126–32. formation. Trends Neurosci. 2009;32:638–47. 45. Almeida S, Zhang Z, Coppola G, Mao W, Futai K, Karydas A, Geschwind MD, 66. Seifert G, Schilling K, Steinhäuser C. Astrocyte dysfunction in neurological Tartaglia MC, Gao F, Gianni D, Sena-Esteves M, Geschwind DH, Miller BL, disorders: a molecular perspective. Nat Rev Neurosci. 2006;7:194–206. Farese RV, Gao FB. Induced pluripotent stem cell models of progranulin- 67. Sofroniew MV, Vinters HV. Astrocytes: Biology and pathology. Acta deficient frontotemporal dementia uncover specific reversible neuronal Neuropathol. 2010;119:7–35. defects. Cell Rep. 2012;2:789–98. 68. Kulijewicz-Nawrot M, Syková E, Chvátal A, Verkhratsky A, Rodríguez JJ. 46. Smith KR, Damiano J, Franceschetti S, Carpenter S, Canafoglia L, Morbin M, Astrocytes and glutamate homoeostasis in Alzheimer’s disease: a decrease Rossi G, Pareyson D, Mole SE, Staropoli JF, Sims KB, Lewis J, Lin WL, Dickson in glutamine synthetase, but not in glutamate transporter-1, in the DW, Dahl HH, Bahlo M, Berkovic SF. Strikingly different clinicopathological prefrontal cortex. ASN Neuro. 2013;5:273–82. phenotypes determined by progranulin-mutation dosage. Am J Hum Genet. 69. Hege Nilsen L, Rae C, Ittner LM, Götz J, Sonnewald U. Glutamate 2012;90:1102–7. metabolism is impaired in transgenic mice with tau hyperphosphorylation. J 47. Salazar D a, Butler VJ, Argouarch a R, Hsu T-Y, Mason A, Nakamura A, Cereb Blood Flow Metab. 2013;33:684–91. McCurdy H, Cox D, Ng R, Pan G, Seeley WW, Miller BL, Kao a W. The 70. Sergeant N, Sablonnière B, Schraen-Maschke S, Ghestem A, Maurage C a, progranulin cleavage products, granulins, exacerbate TDP-43 toxicity and Wattez A, Vermersch P, Delacourte A. Dysregulation of human brain increase TDP-43 levels. J Neurosci. 2015;35:9315–28. microtubule-associated tau mRNA maturation in myotonic dystrophy type 48. Binder LI, Frankfurter A, Rebhun LI. The distribution of tau in the 1. Hum Mol Genet. 2001;10:2143–55. mammalian central nervous system. J Cell Biol. 1985;101:1371–8. 71. Derisbourg M, Leghay C, Chiappetta G, Fernandez-Gomez F-J, Laurent C, 49. Drechsel DN, Hyman a a, Cobb MH, Kirschner MW. Modulation of the Demeyer D, Carrier S, Buée-Scherrer V, Blum D, Vinh J, Sergeant N, Verdier Y, dynamic instability of tubulin assembly by the microtubule-associated Buée L, Hamdane M. Role of the Tau N-terminal region in microtubule protein tau. Mol Biol Cell. 1992;3:1141–54. stabilization revealed by new endogenous truncated forms. Sci Rep. 2015;5:9659. 50. Weingarten MD, Lockwood AH, Hwo SY, Kirschner MW. A protein factor 72. Flament S, Delacourte A, Hemon B, Defossez A. Characterization of two essential for microtubule assembly. Proc Natl Acad Sci U S A. 1975;72:1858–62. pathological Tau protein variants in Alzheimer brain cortices. J Neurol Sci. 51. Dixit R, Ross JL, Goldman YE, Holzbaur ELF. Differential regulation of Dynein 1989;92:133–41. and Kinesin motor proteins by Tau. Science. 2010;319:1086–9. 73. Liu Y, Fallon L, Lashuel H a, Liu Z, Lansbury PT. The UCH-L1 gene encodes 52. Ittner LM, Ke YD, Delerue F, Bi M, Gladbach A, van Eersel J, Wölfing H, two opposing enzymatic activities that affect alpha-synuclein degradation Chieng BC, Christie MJ, Napier I a, Eckert A, Staufenbiel M, Hardeman E, and Parkinson’s disease susceptibility. Cell. 2002;111:209–18. Götz J. Dendritic function of tau mediates amyloid-beta toxicity in 74. Du C-P, Tan R, Hou X-Y. Fyn kinases play a critical role in neuronal apoptosis Alzheimer’s disease mouse models. Cell. 2010;142:387–97. induced by oxygen and glucose deprivation or amyloid-β peptide 53. Mondragon-Rodriguez S, Trillaud-Doppia E, Dudilot A, Bourgeois C, Lauzon treatment. CNS Neurosci Ther. 2012;18:754–61. M, Leclerc N, Boehm J. Interaction of endogenous tau protein with synaptic 75. Hata Y, Slaughter CA, Südhof TC. Synaptic vesicle fusion complex contains proteins is regulated by N-methyl-D-aspartate receptor-dependent tau unc-18 homologue bound to syntaxin. Nature. 1993;366:347–51. phosphorylation. J Biol Chem. 2012;287:32040–53. 76. Andrieux A, Salin PA, Vernet M, Kujala P, Baratier J, Gory-Fauré S, Bosc C, Pointu 54. Sultan A, Nesslany F, Violet M, Bégard S, Loyens A, Talahari S, Mansuroglu Z, H, Proietto D, Schweitzer A, Denarier E, Klumperman J, Job D. The suppression Marzin D, Sergeant N, Humez S, Colin M, Bonnefoy E, Buée L, Galas MC. of brain cold-stable microtubules in mice induces synaptic defects associated Nuclear Tau, a key player in neuronal DNA protection. J Biol Chem. 2011;286: with neuroleptic-sensitive behavioral disorders. Genes Dev. 2002;16:2350–64. 4566–75. 77. Wang YF, Sun MY, Hou Q, Parpura V. Hyposmolality differentially and 55. Violet M, Delattre L, Tardivel M, Sultan A, Chauderlier A, Caillierez R, Talahari spatiotemporally modulates levels of glutamine synthetase and serine S, Nesslany F, Lefebvre B, Bonnefoy E, Buée L, Galas M-C. A major role for racemase in rat supraoptic nucleus. Glia. 2013;61:529–38. Papegaey et al. Acta Neuropathologica Communications (2016) 4:74 Page 14 of 14 78. Johnson MA, Vidoni S, Durigon R, Pearce SF, Rorbach J, He J, Brea-Calvo G, Minczuk M, Reyes A, Holt IJ, Spinazzola A. Amino acid starvation has opposite effects on mitochondrial and cytosolic protein synthesis. PLoS ONE. 2014;9:4. 79. Jin Y, Elalaf H, Watanabe M, Tamaki S, Hineno S, Matsunaga K, Woltjen K, Kobayashi Y, Nagata S, Ikeya M, Kato T, Okamoto T, Matsuda S, Toguchida J. Mutant idh1 dysregulates the differentiation of mesenchymal stem cells in association with gene-specific histone modifications to cartilage- and bone- related genes. PLoS ONE. 2015;10:1–15. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit

Journal

Acta Neuropathologica Communications – Springer Journals

Published: Jul 19, 2016

There are no references for this article.