Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

PCR methods for the detection of biogenic amine-producing bacteria on wine

PCR methods for the detection of biogenic amine-producing bacteria on wine Ann Microbiol (2011) 61:159–166 DOI 10.1007/s13213-010-0068-6 REVIEW PCR methods for the detection of biogenic amine-producing bacteria on wine José M. Landete & Blanca de las Rivas & Angela Marcobal & Rosario Muñoz Received: 27 January 2010 /Accepted: 16 April 2010 /Published online: 12 June 2010 Springer-Verlag and the University of Milan 2010 Abstract Biogenic amines are low molecular weight Introduction organic bases frequently found in wine. Several toxicolog- ical problems resulting from the ingestion of wine contain- Biogenic amines are organic bases endowed with biological ing biogenic amines have been described. In wine, activity that are frequently found in wine. They are histamine, tyramine, and putrescine are mainly produced produced mainly as a consequence of the decarboxylation by the decarboxylation of the amino acid histidine, tyrosine, of amino acids. More than 25 different biogenic amines and ornithine, respectively, by lactic acid bacteria action. have been found in wines, with putrescine being the most The bacterial ability to decarboxylate amino acids is highly abundant (Ancín-Azpilicueta et al. 2008). variable, and therefore the detection of bacteria possessing High concentrations of biogenic amines can cause amino acid decarboxylase activity is important to prevent undesirable physiological effects in sensitive humans, biogenic amine accumulation in wine. Molecular methods especially when alcohol is present. More specifically, for the early and rapid detection of these producer bacteria histamine is known to cause headaches, low blood pressure, are becoming an alternative to traditional culture methods. heart palpitations, edema, vomiting, and diarrhea. Tyramine Moreover, quantitative PCR methods are useful to enumerate and phenylethylamine can produce hypertension through biogenic amine-producer bacteria on wine. Molecular the release of noradrenaline and norephedrine which are methods detect potential biogenic amine risk formation in vasoconstrictor substances. Putrescine and cadaverine, wine before the amine is produced. This review will cover the although not toxic themselves, aggravate the adverse effects molecular methods proposed in the literature for the detection of histamine as they interfere with the enzymes that of biogenic amine-producing bacteria in wine. These methods metabolize them (ten Brink et al. 1990). Some amines, could improve winemaking control in order to avoid biogenic such as putrescine, may already be present in grapes (Del amine production. Prete et al. 2009), whereas others can be formed and accumulated during winemaking (Ancín-Azpilicueta et al. . . . Keywords Histamine Tyramine Putrescine 2008). PCR methods Quantitative PCR The main factors affecting biogenic amine formation during vinification are the presence of free amino acid concentrations and the presence of microorganisms able to decarboxylate these amino acids. Amino acid concentration in grapes can be affected by fertilization treatments and, in This paper is part of the special issue “Wine microbiology and safety: From the vineyard to the bottle (Microsafetywine)”,19–20 November, wines, by winemaking practices such as time of maceration 2009, Martina Franca (Italy). with skins, addition of nutrients, and racking protocols : : : J. M. Landete B. de las Rivas A. Marcobal R. Muñoz (*) (Ancín-Azpilicueta et al. 2008). In addition to the presence Departamento de Microbiología, of the precursor amino acids, the concentration of biogenic Instituto de Fermentaciones Industriales, CSIC, amines in wines mainly depends on the presence and Juan de la Cierva 3, concentration of microorganisms possessing decarboxylase 28006 Madrid, Spain activity. The concentration of these microorganisms is e-mail: rmunoz@ifi.csic.es 160 Ann Microbiol (2011) 61:159–166 affected by physicochemical factors of wine such as pH, plasmid, suggesting a cause for the great variability of the temperature, or SO addition (Lonvaud-Funel, 2001). histamine production property among lactic acid bacteria (Lucas et al. 2005, 2008). The enzyme tyrosine decarboxylase (TDC) converts the Biogenic amine producing bacteria on wine amino acid tyrosine to the biogenic amine tyramine. It has been demonstrated that enterococcal tyrosine decarboxylase Several authors have implicated yeast and lactic acid is also able to decarboxylate phenylalanine, an amino acid bacteria as responsible for the formation of amines in wine. structurally related to tyrosine, originating the biogenic However, some of these data were complex and contradic- amine phenylethylamine (Marcobal et al. 2006a). Some tory. In a recent study, the biogenic amine production by authors have demonstrated the simultaneous production of 155 strains of lactic acid bacteria, 40 strains of acetic tyramine and phenylethylamine in lactic acid bacteria bacteria and 36 strains of yeast isolated from wine was isolated from wine (Landete et al. 2007b). Tyramine analysed (Landete et al. 2007a). Biogenic amine production production is not a general trait among lactic acid bacteria. was not observed by acetic bacteria and yeast; production In wines, Lactobacillus brevis tyramine-producing strains of histamine, tyramine, phenylethylamine and putrescine have been frequently isolated (Moreno-Arribas et al. 2000; was only found by lactic acid bacteria. These results Lucas et al. 2003); however, L. hilgardii (Landete et al. confirm previous results obtained by several authors 2007b)or Lactobacillus plantarum strains (Arena et al. indicating that lactic acid bacteria are the microorganisms 2007) are rarely found. responsible for histamine, tyramine, phenylethylamine and Putrescine is the most abundant biogenic amine found in putrescine production in wine (Lonvaud-Funel and Joyeux wine and is mainly produced by the decarboxylation of 1994; Le Jeune et al. 1995; Guerrini et al. 2002; Landete et ornithine. Putrescine production is a rare property among al. 2005). In these studies, several wine bacterial species wine O. oeni strains. Marcobal et al. (2004, 2006c) were capable of decarboxylating one or more amino acids, and identified a putrescine-producer O. oeni strain possessing it was observed that the bacterial ability to decarboxylate an ornithine decarboxylase (ODC) enzyme; more recently, amino acids was highly variable, this ability being strain- Izquierdo-Cañas et al. (2009) also found two wine strains dependent rather than being related to a specific species able to produce putrescine. The presence of an ornithine (Lonvaud-Funel, 2001). decarboxylase gene in these strains was confirmed by Histamine is the most important amine in food-borne molecular methods. It has also been reported that putrescine intoxications, due to its strong biological activity. The study of could be indirectly synthesized from arginine via two histamine in wine is of particular interest as the presence of pathways (Arena and Manca de Nadra 2001). Arginine alcohol and other amines promotes its adverse effects by can be converted to ornithine via the arginine deiminase inhibiting human detoxification systems (Ancín-Azpilicueta pathway and then ornithine is decarboxylated by the ODC et al. 2008). In order to prevent histamine synthesis, there is to form putrescine, or arginine is first decarboxylated by an great interest in identifying and characterizing the bacteria arginine decarboxylase to form agmatine which is in turn which are able to produce histamine in wine (Landete et al. converted into putrescine via the agmatine deiminase. 2008). The bacterial population in wine is a complex mixture of different species of lactic acid bacteria (Lactobacillus, Leuconostoc, Pediococcus and Oenococcus), with Oenococ- Detection of biogenic amine producing bacteria in wine cus oeni as the predominant species during and after malolactic fermentation. It has been reported that some 7O. During the last two decades, methods for the detection of oeni strains are responsible for histamine accumulation in biogenic amine-producing lactic acid bacteria isolated from wine (Le Jeune et al. 1995; Coton et al. 1998b; Guerrini et wine have been developed. Several detection methods are al. 2002; Lucas et al. 2008). Other studies, on the contrary, based on differential growth media signalling the increase did not find histamine production by O. oeni strains of the pH upon biogenic amine formation. From wine (Moreno-Arribas et al. 2003; Costantini et al. 2006, 2009). bacteria, Landete et al. (2005) described an improved plate Moreover, Landete et al. (2005) show that, in addition to O. assay by using a differential medium (H-MDAmod) oeni, Lactobacillus hilgardii, Lactobacillus mali, Leuconos- supplemented with natamycin. This medium incubated toc mesenteroides and Pediococcus parvulus could contrib- under anaerobic conditions constitutes an easy system to ute to the histamine synthesis in wine. It has also been detect, by a purple halo, histamine producer-bacteria in reported that some histamine-producer species, such as O. wines. For the detection of wine tyramine producer oeni and L. hilgardii, retain or lose this ability depending on bacteria, a Tyramine Production Medium (TPM) has also the culture conditions. Indeed, in these species, the gene been described (Landete et al. 2007b). In this medium, involved in histamine production is located on an unstable strains are considered tyramine producer when they develop Ann Microbiol (2011) 61:159–166 161 a clear zone below the grown cells due to the solubilisation To detect histamine-producing lactic acid bacteria, Le of tyrosine. Jeune et al. (1995) designed several oligonucleotide primers In addition to differential growth methods, enzymatic (CL1, CL2, JV16HC, and JV17HC) (Table 1) based on the methods specific for the detection of histamine-producing comparison of the nucleotide sequences of HDC-encoding bacteria have been described. These methods are based on genes (hdc) from Gram-positive bacteria. Primer sets the production of hydrogen peroxide by the action of an JV16HC/JV17HC, CL1/CL2, and CL1/JV17HC were oxidase enzyme on the histamine. An enzymatic method amplified by PCR internal fragments of 370, 150 or which allows the detection of histamine concentrations 500 pb, respectively, of the hdc gene. The JV16HC/ below 0.5 mg/L, and could be used in synthetic media and JV17HC primer set was shown to be suitable for the grape must and wines, was described by Landete et al. detection of all histamine-producing lactic acid bacteria (2004). Among the different chromatographic techniques analysed (Fig. 1a). The authors demonstrated that all strains recommended for identification of biogenic amine, thin identified as histamine producers gave a positive PCR layer chromatography (García-Moruno et al. 2005) and result. Moreover, strains which did not exhibit HDC high performance liquid chromatography have been the activity failed to give a signal in the PCR assay. Later, in most useful (Marcobal et al. 2006b; Ancín-Azpilicueta et order to reduce the time of these tests to determine the al. 2008). frequency and distribution of histamine-producing bacteria However, the detection of biogenic amine-producing in wines, Coton et al. (1998a) applied them directly in wine bacteria by conventional culture techniques is sometimes samples. They used CL1 and JV17, a slightly modified tedious and unreliable, exhibiting disadvantages such as version of JV17HC primer (Table 1), to analyse the lack of speed, appearance of false positive/negative presence of histamine-producing bacteria directly in wine results, low sensibility, requirements for costly and samples. Landete et al. (2005) found that some lactic acid sophisticated equipment, such as HPLC, or that only bacteria positive for histamine production were not amplified one biogenic amine is detected. Molecular methods for with JV16HC/JV17HC primers under the conditions origi- detection and identification of food-borne bacteria are nally described by Le Jeune et al. (1995). As only 56% of the becoming an alternative to traditional culture methods. O. oeni histamine-producing strains showed amplification Molecular methods are fast, reliable and culture-independent; for hdc, they modified the original CL1 primer sequence and they are an interesting alternative to solve the short- designed the CL1mod primer (Table 1). By using the comings of traditional methods. Moreover, molecular CL1mod/JV17HC primer set, all histamine-producing O. methods detect potential biogenic amine formation risk oeni strains were positive in the PCR test. Costantini et al. in wine before the amine is produced. Since during the last (2006) used the CL1/JV17HC primer set to study the decade several molecular methods have been described for potential to produce histamine in 133 lactic acid bacteria the unambiguous detection of bacteria capable of producing strains isolated from wines of different origins. Only one L. one or several biogenic amines, this review aims to provide hilgardii strain was positive. Since none of the O. oeni information about PCR methods proposed in the literature strains analysed gave a positive PCR response, Costantini et for the detection of biogenic amine-producing bacteria in al. (2006) designed a new primer set, PHDC1/PHDC2 wines. (Table 1) based specifically on the O. oeni hdc sequence. The new PCR results confirmed the preceding data; none of the O. oeni strains analysed was able to produce histamine. PCR detection of wine bacteria producing histamine Costantini et al. (2009) used the primer set PHDC1/PHDC2 with similar results for Oenococcus oeni commercial starter. Histamine in wine is produced by lactic acid bacteria during By using these primers, it was demonstrated that commercial the vinification process. Rapid detection of histamine- yeast starter preparations contained lactic acid bacteria producing bacteria is important for detecting and preventing contaminants carrying the hdc gene. These lactic acid microbial contamination and high levels of histamine. Since bacteria were identified as Lactobacillus parabuchneri and histamine is the decarboxylation product of histidine Lactobacillus rossiae. Recently, the primer set JV16HC and catalysed specifically by the enzyme histidine decarboxyl- JV17HC was used by Ruiz et al. (2010) to study the ase (HDC), it is possible to develop a molecular detection presence of the hdc gene in 8 O. oeni strains isolated from method that detects the presence of the gene encoding this tempranillo wine samples; however, none O. oeni strains enzyme. Pyruvoyl-dependent HDC are present in lactic acid analysed carried the hdc gene. The primer set JV16HC and bacteria involved in wine fermentation, such as O. oeni JV17HC was also used by Izquierdo-Cañas et al. (2009)to (Lonvaud-Funel and Joyeux 1994; Coton et al. 1998a, analyse the histamine production in 90 strains of O. oeni. 1998b; Lucas et al. 2008) and L. hilgardii (Lucas et al. Only two strains were able to produce histamine and the 2005). presence of hdc gene was confirmed on these strains. 162 Ann Microbiol (2011) 61:159–166 Table 1 Primers used for the Primers Sequence (5′→3′) Reference PCR or QPCR detection of wine bacteria-producing biogenic Histidine decarboxylase (hdc): amines CL1 CCWGGWAAWATWGGWAATGGWTA Le Jeune et al. (1995) CL2 GAWGCWGTWGTCATATTWATTTGWCC Le Jeune et al. (1995) JV16HC AGATGGTATTGTTTCTTATG Le Jeune et al. (1995) JV17HC AGACCATACACCATAACCTT Le Jeune et al. (1995) JV17 AGACCATACACCATAACCTTG Coton et al. (1998b) CL1mod CCAGGWAACATTGGTAATGGATA Landete et al. (2005) PHDC1 CCGTGCGGAAACAAAGAAT Costantini et al. (2006) PHDC2 CCAAACACCAGCATCTTCA Costantini et al. (2006) hdcAf ATGAAGCCAGGACAAGTTGG Lucas et al. (2008) hdcAr AATTGAGCCACCTGGAATTG Lucas et al. (2008) Tyrosine decarboxylase (tdc): P2-for GAYATIATIGGIATIGGIYTIGAYCARG Lucas and Lonvaud-Funel (2002) P1-rev CCRTARTCIGGIATIGCRAARTCIGTRTG Lucas and Lonvaud-Funel (2002) 41 CAYGTNGAYGCNGCNTAYGGNGG Marcobal et al. (2005) 42 AYRTANCCCATYTTRTGNGGRTC Marcobal et al. (2005) Pt3 TACACGTAGATGCTGCATATG Costantini et al. (2006) Pt4 ATGGTTGACTATGTTTTAAAAGAA Costantini et al. (2006) p0303 CCACTGCTGCATCTGTTTG Lucas et al. (2003) tdcf CAAATGGAAGAAGAAGTTGG Nannelli et al. (2008) tdcr GAACCATCAGCAACAATGTG Nannelli et al. (2008) Ornithine decarboxylase (odc): 3 GTNTTYAAYGCNGAYAARACNTAYTTYGT Marcobal et al. (2004) 16 TACRCARAATACTCCNGGNGGRTANGG Marcobal et al. (2004) 4 ATNGARTTNAGTTCRCAYTTYTCNGG Marcobal et al. (2004) 15 GGTAYTGTTYGAYCGGAAWAAWCAYAA Marcobal et al. (2004) AODC1 GMTCGTGAAATYAARCKG Costantini et al. (2006) AODC2 KGRGTTCMGCYGGRGTAT Costantini et al. (2006) odcf TGCACTTCCATATCCTCCAG Nannelli et al. (2008) odcr GAATTTCTGGAGCAAATCCA Nannelli et al. (2008) Agmatine deiminase (agdi): K = G or T; R = A or G; W = A or T; Y = C or T; S = C or G; agdif TGCCCGGTGAATTTGAA Nannelli et al. (2008) M=AorC;D=A,G,orT; agdir TTGCGCGGTTTAGCACC Nannelli et al. (2008) N = A, G, C, or T ac b 12 34 5 1 1 2 3456 odc hdc tdc Fig. 1 PCR detection of wine bacteria producing biogenic amines. a An and P1-rev from Lactobacillus brevis J2 (positive control) (1), L. internal DNA fragment of the histidine decarboxylase gene (hdc)was hilgardii 359 (negative control) (2), L. brevis 9 (3), L. brevis 14 (4) and amplified by primers JV16HC/JV17HC from Lactobacillus buchneri L. brevis 106 (5). c An internal DNA fragment of the ornithine ST2A (positive control) (1), Pediococcus pentosaceus 136 (negative decarboxylase (odc) from Oenococcus oeni RM83 (1) was amplified control) (2), Pediococcus parvulus 339 (3) P. pentosaceus 56 (4) P. with primers 3 and 16. A 1-Kb Plus ladder (Invitrogen) (a and b)ora parvulus 276 (5) Lactobacillus hilgardii 464 (6). b An internal fragment DNA marker (λ HindIII/EcoRI) (c) are included in the figures. The of the tyrosine decarboxylase gen (tdc) was amplified by primers p303 amplified decarboxylase fragments are indicated Ann Microbiol (2011) 61:159–166 163 PCR detection of wine bacteria producing tyramine alignment of ODC proteins. In addition, they designed and phenylethylamine two new primers, 4 and 15 (Table 3); these four primers could be combined resulting in four primer sets, 3/4, 15/16, Lactic acid bacteria involved in wine processing could 3/16, and 4/ 15. The method was useful for the detection of decarboxylate tyrosine to produce tyramine. Concerning putrescine-producing bacteria present in a wine bacterial tyrosine decarboxylases (TDC), only enzymes using collection. For the detection of putrescine-producer wine pyridoxal phosphate as a cofactor have been described. lactic acid bacteria, Costantini et al. (2006) designed two It has been demonstrated that enterococcal TDC is also new primers, AODC1 and AODC2 (Table 1), based on the able to decarboxylate phenylalanine, an amino acid odc nucleotide sequences from Lactobacillus strain 30a and structurally related to tyrosine, originating the biogenic O. oeni RM83. Costantini et al. (2009) by using primers amine phenylethylamine (Marcobal et al. 2006a). Landete 16 and AODC1 reported that none of the bacteria analysed et al. (2007b) demonstrated that phenylethylamine carried the odc gene. Recently, the primer set 3/16 was production is always associated with tyramine production used by Ruiz et al. (2010)toanalyse forthe presence of in lactic acid bacteria. Therefore, the oligonucleotide odc gene in O. oeni strains. They found that none of the O. primers described for the detection of the tdc gene, are oeni strains analysed carried the odc gene. Izquierdo- also useful for the detection of phenylethylamine-producing Cañas et al. (2009) analysed putrescine production in 90 bacteria. strains of O. oeni; only two strains were able to produce In wine, tyramine-producer bacteria belong mainly putrescine and the presence of odc gene was confirmed by to the genera Lactobacillus and Enterococcus. Lucas primer set 3/16. and Lonvaud-Funel (2002) designed a degenerate primer set P2- for/P1-rev (Table 1)todetect tdc gene fragments in L. brevis strains. Marcobaletal. (2005)usedthe Simultaneous PCR detection of wine bacteria producing P2-for/P1-rev primer set in a multiplex PCR assay useful biogenic amines for the detection of the tyramine-producer bacteria present in a wine bacterial collection. Costantini et al. The multiplex PCR assay provides a technique that could (2006) also used the P2-for/P1-rev primer set to amplify be successfully used for the routine detection of strains that the tdc gene from 133 strains isolated from wine and must. are potential producers of histamine, tyramine/phenylethyl- They also designed a new primer set, Pt3/Pt4 (Table 1), amine and putrescine in wine. All target genes can be basedonthe L. brevis and Enterococcus faecalis tdc detected at one time in the same PCR assay. Therefore, the nucleotide sequences. The results obtained with both sets multiplex PCR assays reduce reagent quantities and labour of primers were the same. Only four positive strains were costs. Several multiplex PCR assays, based on primers found, all belonging to the L. brevis species. Later, similar targeting amino acid decarboxylase gene sequences, results were obtained with the primer set Pt3/Pt4 by have been developed (Marcobal et al. 2005;Delas Rivas Costantinietal. (2009)as only L. brevis strains were et al. 2005, 2006; Coton and Coton 2005). As histamine, found carrying the tdc gene. P1-rev primer was used in tyramine and putrescine are the main biogenic amines combination with p0303 primer (Table 1,Fig. 1b)to found in wine, a multiplex PCR assay for the detection of analysebyPCR thepresenceofthe tdc gene in 150 lactic histamine-, tyramine- and putrescine-producing lactic acid bacteria strains isolated from wine (Landete et al. acid bacteria was developed by Marcobal et al. (2005). 2007b). All the 32 strains that gave a positive PCR They selected three primer sets, JV16HC/ JV17HC, P1- amplification were tyramine producers in tyramine pro- rev/P2-for, and 3/16 (Table 1), for the detection of the hdc, duction media (TPM), and the tyramine produced was tdc and odc genes, respectively. Under the optimised quantified by HPLC. conditions, the assay yielded DNA fragments of 367-, 924-, and 1,446-bp DNA of hdc, tdc,and odc genes, respectively (Fig. 2). For multiplex PCR, conditions were PCR detection of wine bacteria producing putrescine as described for the uniplex reaction except that the relative concentration of the primers was optimised by Ornithine decarboxylase (ODC) is a PLP-dependent en- checking on increasing or decreasing primer concentra- zyme which catalyses the conversion of ornithine to tion. When the DNA of several target organisms was putrescine. Marcobal et al. (2004) reported the identifica- included in the same reaction, two or three corresponding tion of an ornithine decarboxylase gene (odc)inthe amplicons of different sizes were observed. This assay putrescine-producing O. oeni RM83 strain by using the was useful for the detection of biogenic amine-producing 3/16 primer set (Table 1, Fig. 1c). These primers were bacteria present in a wine bacterial collection (Marcobal et al. 2005). designed based on two conserved domains from an 164 Ann Microbiol (2011) 61:159–166 bacteria at any stage of winemaking. Lucas et al. (2008) applied this method to 264 wines collected in wineries during malolactic fermentation and found that almost all the wines were contaminated by histamine-producing lactic acid bacteria, exceeding 10 CFU per ml in 70% of the samples. The results shown by Lucas et al. (2008) suggest that the risk odc of histamine production exists in almost all wines and is tdc important when the population of histamine-producing bacteria exceeds 10 cells per ml. Nannelli et al. (2008) developed a QPCR method that hdc allows the enumeration of lactic acid bacteria-producing tyramine in wines. Primers tdcf and tdcr (Table 1) used for Fig. 2 Simultaneous PCR amplification of wine bacteria producing QPCR were designed based on conserved regions of tdc histamine, tyramine and putrescine. A multiplex PCR assay was used genes available in databanks. This primer set amplifies a to amplify DNA fragments from a sample containing histamine- and 103-bp internal region of tdc, and under optimal QPCR putrescine-producer Lactobacillus 30a and the tyramine-producer Lactobacillus brevis CECT 5354 (1). A negative sample without conditions allowed amplification of a PCR product with a biogenic amine producer bacteria is also shown (2). A DNA marker (λ melting temperature of 82.0±0.5°C. The presence of HindIII/EcoRI) is included on the right. The amplified decarboxylase tyramine-producing lactic acid bacteria was investigated in fragments are indicated 102 wine samples by this QPCR method. The population of lactic acid bacteria carrying the tdc gene remained quite Quantitative PCR detection of wine bacteria producing low (<10 cells/ml). Nannelli et al. (2008) also observed biogenic amines that only wines containing more than 10 tyramine- producing cells/ml contained tyramine concentrations Quantitative PCR (QPCR) has also been used to detect and above 1 mg/l. count biogenic amine-producing lactic acid bacteria in food Nannelli et al. (2008) also developed QPCR methods for (Fernández et al. 2006;Ladero et al. 2008; Torriani et al. the enumeration of lactic acid bacteria-producing putrescine 2008). QPCR methods offer several advantages, for example in wines. Primers used for QPCR were designed in they determine the population of bacteria-producing biogenic conserved regions of odc and agdi genes identified after amines, they are less time-consuming than regular PCR, they the alignment of nucleotide sequences available in data- allow a continuous monitoring of the PCR amplification banks. The odcf and odcr primers (Table 1) were designed process, they can be used at any point in the manufacturing from an alignment of genes coding for the well- process, and a large number of samples can be processed characterised ODCs (O. oeni RM83 and Lactobacillus sp. simultaneously. However, QPCR assays possess several 30a) among other ODC sequences. This primer set shortcomings such as not discriminating between live and amplifies a 127-bp odc internal region which under optimal dead cells nor between functional genes and pseudogenes. QPCR conditions allowed amplification of a PCR product A method based on QPCR was developed by Lucas et al. with a melting temperature of 81.0±0.5°C. In addition, (2008) to detect and count histamine-producing lactic acid primers agdif and agdir (Table 1) were designed from the bacteria in wine. Primers hdcAf and hdcAr (Table 1) were alignment of agmatine deiminase proteins including those designed on the basis of the sequences of hdcA genes from L. brevis and Pediococcus pentosaceus. This primer available from databases. This primer set amplifies an set amplifies a 90-bp internal region of agdi which under 84-bp internal region of hdc gene. Optimal QPCR optimal QPCR conditions allowed amplification of a PCR conditions allowed amplification of a PCR product with a product with a melting temperature of 85.0±0.5°C. Nan- melting temperature of 80.5±0.5°C. This method makes it nelli et al. (2008) described that the level of putrescine possible to detect just one histamine-producing bacteria per correlated well with the population of lactic acid bacteria ml of wine, even in the presence of polyphenols or of a carrying the odc gene; in contrast, no correspondence was large excess of yeasts in the wine. Although the method denoted with the populations of lactic acid bacteria carrying was based on a standard curve made with L. hilgardii DNA, the agdi gene. it is assumed that it could be efficient to enumerate histamine-producing O. oeni cells. The threshold values obtained with standard samples correlated well with Conclusions populations of histamine-producing lactic acid bacteria in the range of 1 to 10 CFU/ml. Therefore, this method could Although amino acid decarboxylases are not widely be employed to count histamine-producing lactic acid distributed among bacteria, some species of wine bacteria Ann Microbiol (2011) 61:159–166 165 producing biogenic amines. FEMS Microbiol Lett 244:272– are capable of decarboxylating one or more amino acids. The ability of microorganisms to decarboxylate amino acids De las Rivas B, Marcobal A, Carrascosa A, Muñoz R (2006) PCR is highly variable. It depends not only on the species but detection of food bacteria producing the biogenic amines histamine, also on the strain and the environmental conditions. tyramine, putrescine and cadaverine. J Food Prot 69:2509–2514 Del Prete V, Costantini A, Cecchini F, Morassut M, García-Moruno E Molecular techniques offer fast, easy, and reliable methods (2009) Occurrence of biogenic amines in wine: the role of grapes. for analysing wine samples (at any step in the elaboration Food Chem 112:474–481 process) for the presence of biogenic amine-producing Fernández M, del Rio B, Linares DM, Martín MC, Álvarez MA bacteria. PCR assays provide methods that can be success- (2006) Real-time polymerase chain reaction for quantitative detection of histamine producing bacteria: use in cheese fully used for the routine detection of bacterial strains production. J Dairy Sci 89:3763–3769 potentially producers of histamine, tyramine and putrescine García-Moruno E, Carrascosa A, Muñoz R (2005) A rapid and in wine. These are highly specific methods, and their results inexpensive method for the determination of biogenic amines are easy to interpret as compared to other conventional from bacterial cultures by thin-layer chromatography. J Food Prot 68:625–629 methods. Analysis of wines by QPCR methods reveals the Guerrini S, Mangani S, Granchi L, Vincenzini M (2002) Biogenic population of bacteria able to produce biogenic amine in a amine production by Oenococcus oeni. Curr Microbiol 44:374– specific wine. Determination of biogenic amine-producing lactic acid bacteria in wine by PCR methods is a useful Izquierdo-Cañas PM, Gómes Alonso S, Ruiz Pérez P, Seseña Prieto S, García Romero E, Palop Herreros MLL (2009) Biogenic amine approach for predicting the risk of biogenic amine production by Oenococcus oeni isolates from malolactic fermen- accumulation. However, it cannot indicate the final con- tation of Tempranillo wine. J Food Prot 72:907–910 centration of biogenic amine that will appear in wine. Ladero V, Linares DM, Fernández M, Alvarez MA (2008) Real time quantitative PCR detection of histamine-producing lactic acid Acknowledgments This work was supported by grants RM2008- bacteria in cheese: relation with histamine content. Food Res Int 00002 (Instituto Nacional de Investigación Agraria y Alimentaría), 41:1015–1019 AGL2008-01052, Consolider INGENIO 2010 CSD2007-00063 FUN- Landete JM, Ferrer S, Pardo I (2004) Improved enzymatic method for C-FOOD (Comisión Interministerial de Ciencia y Tecnología), and the rapid determination of histamine in wine. Food Addit Contam S-0505/AGR/000153 and S2009/AGR-1469 (ALIBIRD) (Comunidad 21:1149–1154 de Madrid). Landete JM, Ferrer S, Pardo I (2005) Which are the lactic acid bacteria responsible for histamine production in wine? J Appl Microbiol 99:580–586 Landete JM, Ferrer S, Pardo I (2007a) Biogenic amine production by References lactic acid bacteria, acetic bacteria and yeast isolated from wine. Food Control 18:1569–1574 Landete JM, Pardo I, Ferrer S (2007b) Tyramine and phenylethyl- Ancín-Azpilicueta C, González-Marco A, Jiménez-Moreno N (2008) amine production among lactic acid bacteria isolated from wine. Current knowledge about the presence of amines in wine. Crit Int J Food Microbiol 115:364–368 Rev Food Sci Nutr 48:257–275 Landete JM, de las Rivas B, Marcobal A, Muñoz R (2008) Updated Arena ME, Manca de Nadra MC (2001) Biogenic amine production molecular knowledge about histamine biosynthesis by bacteria. by Lactobacillus. J Appl Microbiol 90:158–162 Crit Rev Food Sci Nutr 48:697–714 Arena ME, Fiocco D, Manca de Nadra MC, Pardo I, Spano G (2007) Le Jeune C, Lonvaud-Funel A, Ten Brink H, Hofstra van der Vossen Characterization of a Lactobacillus plantarum strain able to JMBM (1995) Development of a detection system for histidine produce tyramine and partial cloning of a putative tyrosine decarboxylating lactic acid bacteria on DNA probes, PCR and decarboxylase gene. Curr Microbiol 55:205–210 activity test. J Appl Bacteriol 78:316–326 Costantini A, Cersosimo M, del Prete V, Garcia-Moruno E (2006) Lonvaud-Funel A (2001) Biogenic amines in wines: role of lactic acid Production of biogenic amine by lactic acid bacteria, screening bacteria. FEMS Microbiol Lett 199:9–13 by PCR, thin layer chromatography, and high-performance liquid Lonvaud-Funel A, Joyeux A (1994) Histamine production by wine chromatography of strains isolated from wine and must. J Food lactic acid bacteria: isolation of a histamine-producing strain of Prot 69:391–396 Leuconostoc oenos. J Appl Bacteriol 77:401–407 Costantini A, Vaudano E, del Petre V, Danei M, Garcia-Moruno E Lucas P, Lonvaud-Funel A (2002) Purification and partial gene (2009) Biogenic amine production by contaminating bacteria sequence of the tyrosine decarboxylase of Lactobacillus brevis found in starter preparations used in winemaking. J Agric Food IOEB 9809. FEMS Microbiol Lett 211:85–89 Chem 57:10664–10669 Lucas P, Landete J, Coton M, Coton E, Lonvaud-Funel A (2003) The Coton E, Coton M (2005) Multiplex PCR for colony direct detection tyrosine decarboxylase operon of Lactobacillus brevis IOEB of gram positive histamine- and tyramine-producing bacteria. J 9809: characterization and conservation in tyramine-producing Microbiol Methods 63:296–304 bacteria. FEMS Microbiol Lett 229:65–71 Coton E, Rollan G, Bertrand A, Lonvaud-Funel A (1998a) Histamine Lucas P, Wolken WAM, Claisse O, Lolkema JS, Lonvaud-Funel A producing lactic acid bacteria in wines: early detection, frequency (2005) Histamine-producing pathway encoded on an unstable and distribution. Am J Enol Vitic 49:199–204 plasmid in Lactobacillus hilgardii 0006. Appl Environ Microbiol Coton E, Rollan GC, Lonvaud-Funel A (1998b) Histidine decarbox- 71:1417–1424 ylase of Leuconostoc oenos 9204: purification, kinetic properties, cloning and nucleotide sequence of the hdc gene. J Appl Lucas P, Claisse O, Lonvaud-Funel A (2008) High frequency of Microbiol 84:143–151 histamine-producing bacteria in the enological environment and De las Rivas B, Marcobal A, Muñoz R (2005) Improved multiplex- instability of the histidine decarboxylase production phenotype. PCR method for the simultaneous detection of food bacteria Appl Environ Microbiol 74:811–817 166 Ann Microbiol (2011) 61:159–166 Marcobal A, de las Rivas B, Moreno-Arribas MV, Muñoz R (2004) producing lactic acid bacteria from wine. J Appl Microbiol Identification of the ornithine decarboxylase gene in the 88:584–593 putrescine-producer Oenococcus oeni BIFI-83. FEMS Microbiol Moreno-Arribas MV, Polo MC, Jorganes F, Muñoz R (2003) Screening Lett 239:213–220 of biogenic amine production by lactic acid bacteria isolated from Marcobal A, de las Rivas B, Moreno-Arribas MV, Muñoz R (2005) grape must and wine. Int J Food Microbiol 84:117–123 Multiplex PCR method for the simultaneous detection of Nannelli F, Claisse O, Gindreau E, de Revel G, Lonvaud-Funel A, histamine-, tyramine-, and putrescine-producing lactic acid Lucas P (2008) Determination of lactic acid bacteria producing bacteria in foods. J Food Prot 68:874–878 biogenic amines in wine by quantitative PCR methods. Lett Appl Marcobal A, de las Rivas B, Muñoz R (2006a) First genetic Microbiol 47:594–599 characterization of a bacterial beta-phenylethylalanine biosynthetic Ruiz P, Izquierdo PM, Seseña S, Palop MLL (2010) Selection of enzyme in Enterococcus faecium RM58. FEMS Microbiol Lett autochthonous Oenococcus oeni strains according to their 258:144–149 oenological properties and vinification results. Int J Food Microbiol Marcobal A, de las Rivas B, Muñoz R (2006b) Methods for the 137:230–235 detection of bacteria producing biogenic amines on foods: a Ten Brink B, Damink C, Joosten HMLJ, Huis In’t Veld JHJ (1990) survey. J Verbr Lebensm 1:187–196 Ocurrence and formation of biologically active amines in foods. Marcobal A, de las Rivas B, Moreno-Arribas MV, Muñoz R (2006c) Int J Food Microbiol 11:73–84 Evidence for horizontal gene transfer as origin of putrescine Torriani S, Gatto S, Sembeni S, Tofalo R, Suzzi G, Belletti N, Gardini F, production in Oenococcus oeni RM83. Appl Environ Microbiol Bover-Cid S (2008) Rapid detection and quantification of tyrosine 72:7954–7958 decarboxylase gene (tdc) and its expression in Gram-positive Moreno-Arribas V, Torlois S, Joyeux A, Bertrand A, Lonvaud-Funel bacteria associated with fermented foods using PCR-based A (2000) Isolation, properties and behaviour of tyramine methods. J Food Prot 71:93–101 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

PCR methods for the detection of biogenic amine-producing bacteria on wine

Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/pcr-methods-for-the-detection-of-biogenic-amine-producing-bacteria-on-Q4Dg74Z97f

References (41)

Publisher
Springer Journals
Copyright
Copyright © 2010 by Springer-Verlag and the University of Milan
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Mycology; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/s13213-010-0068-6
Publisher site
See Article on Publisher Site

Abstract

Ann Microbiol (2011) 61:159–166 DOI 10.1007/s13213-010-0068-6 REVIEW PCR methods for the detection of biogenic amine-producing bacteria on wine José M. Landete & Blanca de las Rivas & Angela Marcobal & Rosario Muñoz Received: 27 January 2010 /Accepted: 16 April 2010 /Published online: 12 June 2010 Springer-Verlag and the University of Milan 2010 Abstract Biogenic amines are low molecular weight Introduction organic bases frequently found in wine. Several toxicolog- ical problems resulting from the ingestion of wine contain- Biogenic amines are organic bases endowed with biological ing biogenic amines have been described. In wine, activity that are frequently found in wine. They are histamine, tyramine, and putrescine are mainly produced produced mainly as a consequence of the decarboxylation by the decarboxylation of the amino acid histidine, tyrosine, of amino acids. More than 25 different biogenic amines and ornithine, respectively, by lactic acid bacteria action. have been found in wines, with putrescine being the most The bacterial ability to decarboxylate amino acids is highly abundant (Ancín-Azpilicueta et al. 2008). variable, and therefore the detection of bacteria possessing High concentrations of biogenic amines can cause amino acid decarboxylase activity is important to prevent undesirable physiological effects in sensitive humans, biogenic amine accumulation in wine. Molecular methods especially when alcohol is present. More specifically, for the early and rapid detection of these producer bacteria histamine is known to cause headaches, low blood pressure, are becoming an alternative to traditional culture methods. heart palpitations, edema, vomiting, and diarrhea. Tyramine Moreover, quantitative PCR methods are useful to enumerate and phenylethylamine can produce hypertension through biogenic amine-producer bacteria on wine. Molecular the release of noradrenaline and norephedrine which are methods detect potential biogenic amine risk formation in vasoconstrictor substances. Putrescine and cadaverine, wine before the amine is produced. This review will cover the although not toxic themselves, aggravate the adverse effects molecular methods proposed in the literature for the detection of histamine as they interfere with the enzymes that of biogenic amine-producing bacteria in wine. These methods metabolize them (ten Brink et al. 1990). Some amines, could improve winemaking control in order to avoid biogenic such as putrescine, may already be present in grapes (Del amine production. Prete et al. 2009), whereas others can be formed and accumulated during winemaking (Ancín-Azpilicueta et al. . . . Keywords Histamine Tyramine Putrescine 2008). PCR methods Quantitative PCR The main factors affecting biogenic amine formation during vinification are the presence of free amino acid concentrations and the presence of microorganisms able to decarboxylate these amino acids. Amino acid concentration in grapes can be affected by fertilization treatments and, in This paper is part of the special issue “Wine microbiology and safety: From the vineyard to the bottle (Microsafetywine)”,19–20 November, wines, by winemaking practices such as time of maceration 2009, Martina Franca (Italy). with skins, addition of nutrients, and racking protocols : : : J. M. Landete B. de las Rivas A. Marcobal R. Muñoz (*) (Ancín-Azpilicueta et al. 2008). In addition to the presence Departamento de Microbiología, of the precursor amino acids, the concentration of biogenic Instituto de Fermentaciones Industriales, CSIC, amines in wines mainly depends on the presence and Juan de la Cierva 3, concentration of microorganisms possessing decarboxylase 28006 Madrid, Spain activity. The concentration of these microorganisms is e-mail: rmunoz@ifi.csic.es 160 Ann Microbiol (2011) 61:159–166 affected by physicochemical factors of wine such as pH, plasmid, suggesting a cause for the great variability of the temperature, or SO addition (Lonvaud-Funel, 2001). histamine production property among lactic acid bacteria (Lucas et al. 2005, 2008). The enzyme tyrosine decarboxylase (TDC) converts the Biogenic amine producing bacteria on wine amino acid tyrosine to the biogenic amine tyramine. It has been demonstrated that enterococcal tyrosine decarboxylase Several authors have implicated yeast and lactic acid is also able to decarboxylate phenylalanine, an amino acid bacteria as responsible for the formation of amines in wine. structurally related to tyrosine, originating the biogenic However, some of these data were complex and contradic- amine phenylethylamine (Marcobal et al. 2006a). Some tory. In a recent study, the biogenic amine production by authors have demonstrated the simultaneous production of 155 strains of lactic acid bacteria, 40 strains of acetic tyramine and phenylethylamine in lactic acid bacteria bacteria and 36 strains of yeast isolated from wine was isolated from wine (Landete et al. 2007b). Tyramine analysed (Landete et al. 2007a). Biogenic amine production production is not a general trait among lactic acid bacteria. was not observed by acetic bacteria and yeast; production In wines, Lactobacillus brevis tyramine-producing strains of histamine, tyramine, phenylethylamine and putrescine have been frequently isolated (Moreno-Arribas et al. 2000; was only found by lactic acid bacteria. These results Lucas et al. 2003); however, L. hilgardii (Landete et al. confirm previous results obtained by several authors 2007b)or Lactobacillus plantarum strains (Arena et al. indicating that lactic acid bacteria are the microorganisms 2007) are rarely found. responsible for histamine, tyramine, phenylethylamine and Putrescine is the most abundant biogenic amine found in putrescine production in wine (Lonvaud-Funel and Joyeux wine and is mainly produced by the decarboxylation of 1994; Le Jeune et al. 1995; Guerrini et al. 2002; Landete et ornithine. Putrescine production is a rare property among al. 2005). In these studies, several wine bacterial species wine O. oeni strains. Marcobal et al. (2004, 2006c) were capable of decarboxylating one or more amino acids, and identified a putrescine-producer O. oeni strain possessing it was observed that the bacterial ability to decarboxylate an ornithine decarboxylase (ODC) enzyme; more recently, amino acids was highly variable, this ability being strain- Izquierdo-Cañas et al. (2009) also found two wine strains dependent rather than being related to a specific species able to produce putrescine. The presence of an ornithine (Lonvaud-Funel, 2001). decarboxylase gene in these strains was confirmed by Histamine is the most important amine in food-borne molecular methods. It has also been reported that putrescine intoxications, due to its strong biological activity. The study of could be indirectly synthesized from arginine via two histamine in wine is of particular interest as the presence of pathways (Arena and Manca de Nadra 2001). Arginine alcohol and other amines promotes its adverse effects by can be converted to ornithine via the arginine deiminase inhibiting human detoxification systems (Ancín-Azpilicueta pathway and then ornithine is decarboxylated by the ODC et al. 2008). In order to prevent histamine synthesis, there is to form putrescine, or arginine is first decarboxylated by an great interest in identifying and characterizing the bacteria arginine decarboxylase to form agmatine which is in turn which are able to produce histamine in wine (Landete et al. converted into putrescine via the agmatine deiminase. 2008). The bacterial population in wine is a complex mixture of different species of lactic acid bacteria (Lactobacillus, Leuconostoc, Pediococcus and Oenococcus), with Oenococ- Detection of biogenic amine producing bacteria in wine cus oeni as the predominant species during and after malolactic fermentation. It has been reported that some 7O. During the last two decades, methods for the detection of oeni strains are responsible for histamine accumulation in biogenic amine-producing lactic acid bacteria isolated from wine (Le Jeune et al. 1995; Coton et al. 1998b; Guerrini et wine have been developed. Several detection methods are al. 2002; Lucas et al. 2008). Other studies, on the contrary, based on differential growth media signalling the increase did not find histamine production by O. oeni strains of the pH upon biogenic amine formation. From wine (Moreno-Arribas et al. 2003; Costantini et al. 2006, 2009). bacteria, Landete et al. (2005) described an improved plate Moreover, Landete et al. (2005) show that, in addition to O. assay by using a differential medium (H-MDAmod) oeni, Lactobacillus hilgardii, Lactobacillus mali, Leuconos- supplemented with natamycin. This medium incubated toc mesenteroides and Pediococcus parvulus could contrib- under anaerobic conditions constitutes an easy system to ute to the histamine synthesis in wine. It has also been detect, by a purple halo, histamine producer-bacteria in reported that some histamine-producer species, such as O. wines. For the detection of wine tyramine producer oeni and L. hilgardii, retain or lose this ability depending on bacteria, a Tyramine Production Medium (TPM) has also the culture conditions. Indeed, in these species, the gene been described (Landete et al. 2007b). In this medium, involved in histamine production is located on an unstable strains are considered tyramine producer when they develop Ann Microbiol (2011) 61:159–166 161 a clear zone below the grown cells due to the solubilisation To detect histamine-producing lactic acid bacteria, Le of tyrosine. Jeune et al. (1995) designed several oligonucleotide primers In addition to differential growth methods, enzymatic (CL1, CL2, JV16HC, and JV17HC) (Table 1) based on the methods specific for the detection of histamine-producing comparison of the nucleotide sequences of HDC-encoding bacteria have been described. These methods are based on genes (hdc) from Gram-positive bacteria. Primer sets the production of hydrogen peroxide by the action of an JV16HC/JV17HC, CL1/CL2, and CL1/JV17HC were oxidase enzyme on the histamine. An enzymatic method amplified by PCR internal fragments of 370, 150 or which allows the detection of histamine concentrations 500 pb, respectively, of the hdc gene. The JV16HC/ below 0.5 mg/L, and could be used in synthetic media and JV17HC primer set was shown to be suitable for the grape must and wines, was described by Landete et al. detection of all histamine-producing lactic acid bacteria (2004). Among the different chromatographic techniques analysed (Fig. 1a). The authors demonstrated that all strains recommended for identification of biogenic amine, thin identified as histamine producers gave a positive PCR layer chromatography (García-Moruno et al. 2005) and result. Moreover, strains which did not exhibit HDC high performance liquid chromatography have been the activity failed to give a signal in the PCR assay. Later, in most useful (Marcobal et al. 2006b; Ancín-Azpilicueta et order to reduce the time of these tests to determine the al. 2008). frequency and distribution of histamine-producing bacteria However, the detection of biogenic amine-producing in wines, Coton et al. (1998a) applied them directly in wine bacteria by conventional culture techniques is sometimes samples. They used CL1 and JV17, a slightly modified tedious and unreliable, exhibiting disadvantages such as version of JV17HC primer (Table 1), to analyse the lack of speed, appearance of false positive/negative presence of histamine-producing bacteria directly in wine results, low sensibility, requirements for costly and samples. Landete et al. (2005) found that some lactic acid sophisticated equipment, such as HPLC, or that only bacteria positive for histamine production were not amplified one biogenic amine is detected. Molecular methods for with JV16HC/JV17HC primers under the conditions origi- detection and identification of food-borne bacteria are nally described by Le Jeune et al. (1995). As only 56% of the becoming an alternative to traditional culture methods. O. oeni histamine-producing strains showed amplification Molecular methods are fast, reliable and culture-independent; for hdc, they modified the original CL1 primer sequence and they are an interesting alternative to solve the short- designed the CL1mod primer (Table 1). By using the comings of traditional methods. Moreover, molecular CL1mod/JV17HC primer set, all histamine-producing O. methods detect potential biogenic amine formation risk oeni strains were positive in the PCR test. Costantini et al. in wine before the amine is produced. Since during the last (2006) used the CL1/JV17HC primer set to study the decade several molecular methods have been described for potential to produce histamine in 133 lactic acid bacteria the unambiguous detection of bacteria capable of producing strains isolated from wines of different origins. Only one L. one or several biogenic amines, this review aims to provide hilgardii strain was positive. Since none of the O. oeni information about PCR methods proposed in the literature strains analysed gave a positive PCR response, Costantini et for the detection of biogenic amine-producing bacteria in al. (2006) designed a new primer set, PHDC1/PHDC2 wines. (Table 1) based specifically on the O. oeni hdc sequence. The new PCR results confirmed the preceding data; none of the O. oeni strains analysed was able to produce histamine. PCR detection of wine bacteria producing histamine Costantini et al. (2009) used the primer set PHDC1/PHDC2 with similar results for Oenococcus oeni commercial starter. Histamine in wine is produced by lactic acid bacteria during By using these primers, it was demonstrated that commercial the vinification process. Rapid detection of histamine- yeast starter preparations contained lactic acid bacteria producing bacteria is important for detecting and preventing contaminants carrying the hdc gene. These lactic acid microbial contamination and high levels of histamine. Since bacteria were identified as Lactobacillus parabuchneri and histamine is the decarboxylation product of histidine Lactobacillus rossiae. Recently, the primer set JV16HC and catalysed specifically by the enzyme histidine decarboxyl- JV17HC was used by Ruiz et al. (2010) to study the ase (HDC), it is possible to develop a molecular detection presence of the hdc gene in 8 O. oeni strains isolated from method that detects the presence of the gene encoding this tempranillo wine samples; however, none O. oeni strains enzyme. Pyruvoyl-dependent HDC are present in lactic acid analysed carried the hdc gene. The primer set JV16HC and bacteria involved in wine fermentation, such as O. oeni JV17HC was also used by Izquierdo-Cañas et al. (2009)to (Lonvaud-Funel and Joyeux 1994; Coton et al. 1998a, analyse the histamine production in 90 strains of O. oeni. 1998b; Lucas et al. 2008) and L. hilgardii (Lucas et al. Only two strains were able to produce histamine and the 2005). presence of hdc gene was confirmed on these strains. 162 Ann Microbiol (2011) 61:159–166 Table 1 Primers used for the Primers Sequence (5′→3′) Reference PCR or QPCR detection of wine bacteria-producing biogenic Histidine decarboxylase (hdc): amines CL1 CCWGGWAAWATWGGWAATGGWTA Le Jeune et al. (1995) CL2 GAWGCWGTWGTCATATTWATTTGWCC Le Jeune et al. (1995) JV16HC AGATGGTATTGTTTCTTATG Le Jeune et al. (1995) JV17HC AGACCATACACCATAACCTT Le Jeune et al. (1995) JV17 AGACCATACACCATAACCTTG Coton et al. (1998b) CL1mod CCAGGWAACATTGGTAATGGATA Landete et al. (2005) PHDC1 CCGTGCGGAAACAAAGAAT Costantini et al. (2006) PHDC2 CCAAACACCAGCATCTTCA Costantini et al. (2006) hdcAf ATGAAGCCAGGACAAGTTGG Lucas et al. (2008) hdcAr AATTGAGCCACCTGGAATTG Lucas et al. (2008) Tyrosine decarboxylase (tdc): P2-for GAYATIATIGGIATIGGIYTIGAYCARG Lucas and Lonvaud-Funel (2002) P1-rev CCRTARTCIGGIATIGCRAARTCIGTRTG Lucas and Lonvaud-Funel (2002) 41 CAYGTNGAYGCNGCNTAYGGNGG Marcobal et al. (2005) 42 AYRTANCCCATYTTRTGNGGRTC Marcobal et al. (2005) Pt3 TACACGTAGATGCTGCATATG Costantini et al. (2006) Pt4 ATGGTTGACTATGTTTTAAAAGAA Costantini et al. (2006) p0303 CCACTGCTGCATCTGTTTG Lucas et al. (2003) tdcf CAAATGGAAGAAGAAGTTGG Nannelli et al. (2008) tdcr GAACCATCAGCAACAATGTG Nannelli et al. (2008) Ornithine decarboxylase (odc): 3 GTNTTYAAYGCNGAYAARACNTAYTTYGT Marcobal et al. (2004) 16 TACRCARAATACTCCNGGNGGRTANGG Marcobal et al. (2004) 4 ATNGARTTNAGTTCRCAYTTYTCNGG Marcobal et al. (2004) 15 GGTAYTGTTYGAYCGGAAWAAWCAYAA Marcobal et al. (2004) AODC1 GMTCGTGAAATYAARCKG Costantini et al. (2006) AODC2 KGRGTTCMGCYGGRGTAT Costantini et al. (2006) odcf TGCACTTCCATATCCTCCAG Nannelli et al. (2008) odcr GAATTTCTGGAGCAAATCCA Nannelli et al. (2008) Agmatine deiminase (agdi): K = G or T; R = A or G; W = A or T; Y = C or T; S = C or G; agdif TGCCCGGTGAATTTGAA Nannelli et al. (2008) M=AorC;D=A,G,orT; agdir TTGCGCGGTTTAGCACC Nannelli et al. (2008) N = A, G, C, or T ac b 12 34 5 1 1 2 3456 odc hdc tdc Fig. 1 PCR detection of wine bacteria producing biogenic amines. a An and P1-rev from Lactobacillus brevis J2 (positive control) (1), L. internal DNA fragment of the histidine decarboxylase gene (hdc)was hilgardii 359 (negative control) (2), L. brevis 9 (3), L. brevis 14 (4) and amplified by primers JV16HC/JV17HC from Lactobacillus buchneri L. brevis 106 (5). c An internal DNA fragment of the ornithine ST2A (positive control) (1), Pediococcus pentosaceus 136 (negative decarboxylase (odc) from Oenococcus oeni RM83 (1) was amplified control) (2), Pediococcus parvulus 339 (3) P. pentosaceus 56 (4) P. with primers 3 and 16. A 1-Kb Plus ladder (Invitrogen) (a and b)ora parvulus 276 (5) Lactobacillus hilgardii 464 (6). b An internal fragment DNA marker (λ HindIII/EcoRI) (c) are included in the figures. The of the tyrosine decarboxylase gen (tdc) was amplified by primers p303 amplified decarboxylase fragments are indicated Ann Microbiol (2011) 61:159–166 163 PCR detection of wine bacteria producing tyramine alignment of ODC proteins. In addition, they designed and phenylethylamine two new primers, 4 and 15 (Table 3); these four primers could be combined resulting in four primer sets, 3/4, 15/16, Lactic acid bacteria involved in wine processing could 3/16, and 4/ 15. The method was useful for the detection of decarboxylate tyrosine to produce tyramine. Concerning putrescine-producing bacteria present in a wine bacterial tyrosine decarboxylases (TDC), only enzymes using collection. For the detection of putrescine-producer wine pyridoxal phosphate as a cofactor have been described. lactic acid bacteria, Costantini et al. (2006) designed two It has been demonstrated that enterococcal TDC is also new primers, AODC1 and AODC2 (Table 1), based on the able to decarboxylate phenylalanine, an amino acid odc nucleotide sequences from Lactobacillus strain 30a and structurally related to tyrosine, originating the biogenic O. oeni RM83. Costantini et al. (2009) by using primers amine phenylethylamine (Marcobal et al. 2006a). Landete 16 and AODC1 reported that none of the bacteria analysed et al. (2007b) demonstrated that phenylethylamine carried the odc gene. Recently, the primer set 3/16 was production is always associated with tyramine production used by Ruiz et al. (2010)toanalyse forthe presence of in lactic acid bacteria. Therefore, the oligonucleotide odc gene in O. oeni strains. They found that none of the O. primers described for the detection of the tdc gene, are oeni strains analysed carried the odc gene. Izquierdo- also useful for the detection of phenylethylamine-producing Cañas et al. (2009) analysed putrescine production in 90 bacteria. strains of O. oeni; only two strains were able to produce In wine, tyramine-producer bacteria belong mainly putrescine and the presence of odc gene was confirmed by to the genera Lactobacillus and Enterococcus. Lucas primer set 3/16. and Lonvaud-Funel (2002) designed a degenerate primer set P2- for/P1-rev (Table 1)todetect tdc gene fragments in L. brevis strains. Marcobaletal. (2005)usedthe Simultaneous PCR detection of wine bacteria producing P2-for/P1-rev primer set in a multiplex PCR assay useful biogenic amines for the detection of the tyramine-producer bacteria present in a wine bacterial collection. Costantini et al. The multiplex PCR assay provides a technique that could (2006) also used the P2-for/P1-rev primer set to amplify be successfully used for the routine detection of strains that the tdc gene from 133 strains isolated from wine and must. are potential producers of histamine, tyramine/phenylethyl- They also designed a new primer set, Pt3/Pt4 (Table 1), amine and putrescine in wine. All target genes can be basedonthe L. brevis and Enterococcus faecalis tdc detected at one time in the same PCR assay. Therefore, the nucleotide sequences. The results obtained with both sets multiplex PCR assays reduce reagent quantities and labour of primers were the same. Only four positive strains were costs. Several multiplex PCR assays, based on primers found, all belonging to the L. brevis species. Later, similar targeting amino acid decarboxylase gene sequences, results were obtained with the primer set Pt3/Pt4 by have been developed (Marcobal et al. 2005;Delas Rivas Costantinietal. (2009)as only L. brevis strains were et al. 2005, 2006; Coton and Coton 2005). As histamine, found carrying the tdc gene. P1-rev primer was used in tyramine and putrescine are the main biogenic amines combination with p0303 primer (Table 1,Fig. 1b)to found in wine, a multiplex PCR assay for the detection of analysebyPCR thepresenceofthe tdc gene in 150 lactic histamine-, tyramine- and putrescine-producing lactic acid bacteria strains isolated from wine (Landete et al. acid bacteria was developed by Marcobal et al. (2005). 2007b). All the 32 strains that gave a positive PCR They selected three primer sets, JV16HC/ JV17HC, P1- amplification were tyramine producers in tyramine pro- rev/P2-for, and 3/16 (Table 1), for the detection of the hdc, duction media (TPM), and the tyramine produced was tdc and odc genes, respectively. Under the optimised quantified by HPLC. conditions, the assay yielded DNA fragments of 367-, 924-, and 1,446-bp DNA of hdc, tdc,and odc genes, respectively (Fig. 2). For multiplex PCR, conditions were PCR detection of wine bacteria producing putrescine as described for the uniplex reaction except that the relative concentration of the primers was optimised by Ornithine decarboxylase (ODC) is a PLP-dependent en- checking on increasing or decreasing primer concentra- zyme which catalyses the conversion of ornithine to tion. When the DNA of several target organisms was putrescine. Marcobal et al. (2004) reported the identifica- included in the same reaction, two or three corresponding tion of an ornithine decarboxylase gene (odc)inthe amplicons of different sizes were observed. This assay putrescine-producing O. oeni RM83 strain by using the was useful for the detection of biogenic amine-producing 3/16 primer set (Table 1, Fig. 1c). These primers were bacteria present in a wine bacterial collection (Marcobal et al. 2005). designed based on two conserved domains from an 164 Ann Microbiol (2011) 61:159–166 bacteria at any stage of winemaking. Lucas et al. (2008) applied this method to 264 wines collected in wineries during malolactic fermentation and found that almost all the wines were contaminated by histamine-producing lactic acid bacteria, exceeding 10 CFU per ml in 70% of the samples. The results shown by Lucas et al. (2008) suggest that the risk odc of histamine production exists in almost all wines and is tdc important when the population of histamine-producing bacteria exceeds 10 cells per ml. Nannelli et al. (2008) developed a QPCR method that hdc allows the enumeration of lactic acid bacteria-producing tyramine in wines. Primers tdcf and tdcr (Table 1) used for Fig. 2 Simultaneous PCR amplification of wine bacteria producing QPCR were designed based on conserved regions of tdc histamine, tyramine and putrescine. A multiplex PCR assay was used genes available in databanks. This primer set amplifies a to amplify DNA fragments from a sample containing histamine- and 103-bp internal region of tdc, and under optimal QPCR putrescine-producer Lactobacillus 30a and the tyramine-producer Lactobacillus brevis CECT 5354 (1). A negative sample without conditions allowed amplification of a PCR product with a biogenic amine producer bacteria is also shown (2). A DNA marker (λ melting temperature of 82.0±0.5°C. The presence of HindIII/EcoRI) is included on the right. The amplified decarboxylase tyramine-producing lactic acid bacteria was investigated in fragments are indicated 102 wine samples by this QPCR method. The population of lactic acid bacteria carrying the tdc gene remained quite Quantitative PCR detection of wine bacteria producing low (<10 cells/ml). Nannelli et al. (2008) also observed biogenic amines that only wines containing more than 10 tyramine- producing cells/ml contained tyramine concentrations Quantitative PCR (QPCR) has also been used to detect and above 1 mg/l. count biogenic amine-producing lactic acid bacteria in food Nannelli et al. (2008) also developed QPCR methods for (Fernández et al. 2006;Ladero et al. 2008; Torriani et al. the enumeration of lactic acid bacteria-producing putrescine 2008). QPCR methods offer several advantages, for example in wines. Primers used for QPCR were designed in they determine the population of bacteria-producing biogenic conserved regions of odc and agdi genes identified after amines, they are less time-consuming than regular PCR, they the alignment of nucleotide sequences available in data- allow a continuous monitoring of the PCR amplification banks. The odcf and odcr primers (Table 1) were designed process, they can be used at any point in the manufacturing from an alignment of genes coding for the well- process, and a large number of samples can be processed characterised ODCs (O. oeni RM83 and Lactobacillus sp. simultaneously. However, QPCR assays possess several 30a) among other ODC sequences. This primer set shortcomings such as not discriminating between live and amplifies a 127-bp odc internal region which under optimal dead cells nor between functional genes and pseudogenes. QPCR conditions allowed amplification of a PCR product A method based on QPCR was developed by Lucas et al. with a melting temperature of 81.0±0.5°C. In addition, (2008) to detect and count histamine-producing lactic acid primers agdif and agdir (Table 1) were designed from the bacteria in wine. Primers hdcAf and hdcAr (Table 1) were alignment of agmatine deiminase proteins including those designed on the basis of the sequences of hdcA genes from L. brevis and Pediococcus pentosaceus. This primer available from databases. This primer set amplifies an set amplifies a 90-bp internal region of agdi which under 84-bp internal region of hdc gene. Optimal QPCR optimal QPCR conditions allowed amplification of a PCR conditions allowed amplification of a PCR product with a product with a melting temperature of 85.0±0.5°C. Nan- melting temperature of 80.5±0.5°C. This method makes it nelli et al. (2008) described that the level of putrescine possible to detect just one histamine-producing bacteria per correlated well with the population of lactic acid bacteria ml of wine, even in the presence of polyphenols or of a carrying the odc gene; in contrast, no correspondence was large excess of yeasts in the wine. Although the method denoted with the populations of lactic acid bacteria carrying was based on a standard curve made with L. hilgardii DNA, the agdi gene. it is assumed that it could be efficient to enumerate histamine-producing O. oeni cells. The threshold values obtained with standard samples correlated well with Conclusions populations of histamine-producing lactic acid bacteria in the range of 1 to 10 CFU/ml. Therefore, this method could Although amino acid decarboxylases are not widely be employed to count histamine-producing lactic acid distributed among bacteria, some species of wine bacteria Ann Microbiol (2011) 61:159–166 165 producing biogenic amines. FEMS Microbiol Lett 244:272– are capable of decarboxylating one or more amino acids. The ability of microorganisms to decarboxylate amino acids De las Rivas B, Marcobal A, Carrascosa A, Muñoz R (2006) PCR is highly variable. It depends not only on the species but detection of food bacteria producing the biogenic amines histamine, also on the strain and the environmental conditions. tyramine, putrescine and cadaverine. J Food Prot 69:2509–2514 Del Prete V, Costantini A, Cecchini F, Morassut M, García-Moruno E Molecular techniques offer fast, easy, and reliable methods (2009) Occurrence of biogenic amines in wine: the role of grapes. for analysing wine samples (at any step in the elaboration Food Chem 112:474–481 process) for the presence of biogenic amine-producing Fernández M, del Rio B, Linares DM, Martín MC, Álvarez MA bacteria. PCR assays provide methods that can be success- (2006) Real-time polymerase chain reaction for quantitative detection of histamine producing bacteria: use in cheese fully used for the routine detection of bacterial strains production. J Dairy Sci 89:3763–3769 potentially producers of histamine, tyramine and putrescine García-Moruno E, Carrascosa A, Muñoz R (2005) A rapid and in wine. These are highly specific methods, and their results inexpensive method for the determination of biogenic amines are easy to interpret as compared to other conventional from bacterial cultures by thin-layer chromatography. J Food Prot 68:625–629 methods. Analysis of wines by QPCR methods reveals the Guerrini S, Mangani S, Granchi L, Vincenzini M (2002) Biogenic population of bacteria able to produce biogenic amine in a amine production by Oenococcus oeni. Curr Microbiol 44:374– specific wine. Determination of biogenic amine-producing lactic acid bacteria in wine by PCR methods is a useful Izquierdo-Cañas PM, Gómes Alonso S, Ruiz Pérez P, Seseña Prieto S, García Romero E, Palop Herreros MLL (2009) Biogenic amine approach for predicting the risk of biogenic amine production by Oenococcus oeni isolates from malolactic fermen- accumulation. However, it cannot indicate the final con- tation of Tempranillo wine. J Food Prot 72:907–910 centration of biogenic amine that will appear in wine. Ladero V, Linares DM, Fernández M, Alvarez MA (2008) Real time quantitative PCR detection of histamine-producing lactic acid Acknowledgments This work was supported by grants RM2008- bacteria in cheese: relation with histamine content. Food Res Int 00002 (Instituto Nacional de Investigación Agraria y Alimentaría), 41:1015–1019 AGL2008-01052, Consolider INGENIO 2010 CSD2007-00063 FUN- Landete JM, Ferrer S, Pardo I (2004) Improved enzymatic method for C-FOOD (Comisión Interministerial de Ciencia y Tecnología), and the rapid determination of histamine in wine. Food Addit Contam S-0505/AGR/000153 and S2009/AGR-1469 (ALIBIRD) (Comunidad 21:1149–1154 de Madrid). Landete JM, Ferrer S, Pardo I (2005) Which are the lactic acid bacteria responsible for histamine production in wine? J Appl Microbiol 99:580–586 Landete JM, Ferrer S, Pardo I (2007a) Biogenic amine production by References lactic acid bacteria, acetic bacteria and yeast isolated from wine. Food Control 18:1569–1574 Landete JM, Pardo I, Ferrer S (2007b) Tyramine and phenylethyl- Ancín-Azpilicueta C, González-Marco A, Jiménez-Moreno N (2008) amine production among lactic acid bacteria isolated from wine. Current knowledge about the presence of amines in wine. Crit Int J Food Microbiol 115:364–368 Rev Food Sci Nutr 48:257–275 Landete JM, de las Rivas B, Marcobal A, Muñoz R (2008) Updated Arena ME, Manca de Nadra MC (2001) Biogenic amine production molecular knowledge about histamine biosynthesis by bacteria. by Lactobacillus. J Appl Microbiol 90:158–162 Crit Rev Food Sci Nutr 48:697–714 Arena ME, Fiocco D, Manca de Nadra MC, Pardo I, Spano G (2007) Le Jeune C, Lonvaud-Funel A, Ten Brink H, Hofstra van der Vossen Characterization of a Lactobacillus plantarum strain able to JMBM (1995) Development of a detection system for histidine produce tyramine and partial cloning of a putative tyrosine decarboxylating lactic acid bacteria on DNA probes, PCR and decarboxylase gene. Curr Microbiol 55:205–210 activity test. J Appl Bacteriol 78:316–326 Costantini A, Cersosimo M, del Prete V, Garcia-Moruno E (2006) Lonvaud-Funel A (2001) Biogenic amines in wines: role of lactic acid Production of biogenic amine by lactic acid bacteria, screening bacteria. FEMS Microbiol Lett 199:9–13 by PCR, thin layer chromatography, and high-performance liquid Lonvaud-Funel A, Joyeux A (1994) Histamine production by wine chromatography of strains isolated from wine and must. J Food lactic acid bacteria: isolation of a histamine-producing strain of Prot 69:391–396 Leuconostoc oenos. J Appl Bacteriol 77:401–407 Costantini A, Vaudano E, del Petre V, Danei M, Garcia-Moruno E Lucas P, Lonvaud-Funel A (2002) Purification and partial gene (2009) Biogenic amine production by contaminating bacteria sequence of the tyrosine decarboxylase of Lactobacillus brevis found in starter preparations used in winemaking. J Agric Food IOEB 9809. FEMS Microbiol Lett 211:85–89 Chem 57:10664–10669 Lucas P, Landete J, Coton M, Coton E, Lonvaud-Funel A (2003) The Coton E, Coton M (2005) Multiplex PCR for colony direct detection tyrosine decarboxylase operon of Lactobacillus brevis IOEB of gram positive histamine- and tyramine-producing bacteria. J 9809: characterization and conservation in tyramine-producing Microbiol Methods 63:296–304 bacteria. FEMS Microbiol Lett 229:65–71 Coton E, Rollan G, Bertrand A, Lonvaud-Funel A (1998a) Histamine Lucas P, Wolken WAM, Claisse O, Lolkema JS, Lonvaud-Funel A producing lactic acid bacteria in wines: early detection, frequency (2005) Histamine-producing pathway encoded on an unstable and distribution. Am J Enol Vitic 49:199–204 plasmid in Lactobacillus hilgardii 0006. Appl Environ Microbiol Coton E, Rollan GC, Lonvaud-Funel A (1998b) Histidine decarbox- 71:1417–1424 ylase of Leuconostoc oenos 9204: purification, kinetic properties, cloning and nucleotide sequence of the hdc gene. J Appl Lucas P, Claisse O, Lonvaud-Funel A (2008) High frequency of Microbiol 84:143–151 histamine-producing bacteria in the enological environment and De las Rivas B, Marcobal A, Muñoz R (2005) Improved multiplex- instability of the histidine decarboxylase production phenotype. PCR method for the simultaneous detection of food bacteria Appl Environ Microbiol 74:811–817 166 Ann Microbiol (2011) 61:159–166 Marcobal A, de las Rivas B, Moreno-Arribas MV, Muñoz R (2004) producing lactic acid bacteria from wine. J Appl Microbiol Identification of the ornithine decarboxylase gene in the 88:584–593 putrescine-producer Oenococcus oeni BIFI-83. FEMS Microbiol Moreno-Arribas MV, Polo MC, Jorganes F, Muñoz R (2003) Screening Lett 239:213–220 of biogenic amine production by lactic acid bacteria isolated from Marcobal A, de las Rivas B, Moreno-Arribas MV, Muñoz R (2005) grape must and wine. Int J Food Microbiol 84:117–123 Multiplex PCR method for the simultaneous detection of Nannelli F, Claisse O, Gindreau E, de Revel G, Lonvaud-Funel A, histamine-, tyramine-, and putrescine-producing lactic acid Lucas P (2008) Determination of lactic acid bacteria producing bacteria in foods. J Food Prot 68:874–878 biogenic amines in wine by quantitative PCR methods. Lett Appl Marcobal A, de las Rivas B, Muñoz R (2006a) First genetic Microbiol 47:594–599 characterization of a bacterial beta-phenylethylalanine biosynthetic Ruiz P, Izquierdo PM, Seseña S, Palop MLL (2010) Selection of enzyme in Enterococcus faecium RM58. FEMS Microbiol Lett autochthonous Oenococcus oeni strains according to their 258:144–149 oenological properties and vinification results. Int J Food Microbiol Marcobal A, de las Rivas B, Muñoz R (2006b) Methods for the 137:230–235 detection of bacteria producing biogenic amines on foods: a Ten Brink B, Damink C, Joosten HMLJ, Huis In’t Veld JHJ (1990) survey. J Verbr Lebensm 1:187–196 Ocurrence and formation of biologically active amines in foods. Marcobal A, de las Rivas B, Moreno-Arribas MV, Muñoz R (2006c) Int J Food Microbiol 11:73–84 Evidence for horizontal gene transfer as origin of putrescine Torriani S, Gatto S, Sembeni S, Tofalo R, Suzzi G, Belletti N, Gardini F, production in Oenococcus oeni RM83. Appl Environ Microbiol Bover-Cid S (2008) Rapid detection and quantification of tyrosine 72:7954–7958 decarboxylase gene (tdc) and its expression in Gram-positive Moreno-Arribas V, Torlois S, Joyeux A, Bertrand A, Lonvaud-Funel bacteria associated with fermented foods using PCR-based A (2000) Isolation, properties and behaviour of tyramine methods. J Food Prot 71:93–101

Journal

Annals of Microbiology – Springer Journals

Published: Jun 12, 2010

There are no references for this article.