Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Occurrence and distribution of multiple antibiotic-resistant Enterococcus and Lactobacillus spp. from Indian poultry: in vivo transferability of their erythromycin, tetracycline and vancomycin resistance

Occurrence and distribution of multiple antibiotic-resistant Enterococcus and Lactobacillus spp.... Ann Microbiol (2017) 67:395–404 DOI 10.1007/s13213-017-1270-6 ORIGINAL ARTICLE Occurrence and distribution of multiple antibiotic-resistant Enterococcus and Lactobacillus spp. from Indian poultry: in vivo transferability of their erythromycin, tetracycline and vancomycin resistance 1 1 1 Chandran Preethi & Surya Chandra Rao Thumu & Prakash M. Halami Received: 25 December 2016 /Accepted: 1 May 2017 /Published online: 19 May 2017 Springer-Verlag Berlin Heidelberg and the University of Milan 2017 Abstract The objective of this study was to determine the view, this study reports Indian poultry as a major source of occurrence and distribution of antibiotic resistant (AR) lactic high levels of AR bacteria contaminating the food chain and acid bacteria (LAB) in Indian poultry. LAB from poultry farm the environment. Thus, urgent and determined strategies are feces (n = 21) and samples from slaughter houses comprising needed to control the spread of multiple AR bacteria. chicken intestine (n = 46), raw meat (n = 23), and sanitary . . water (n = 4) were evaluated and compared with those from Keywords Antibiotic resistance Horizontal gene transfer . . organic chicken (OC) collected from nearby villages. Poultry Enterococcus Lactobacillus Screening studies showed 5–7 log units higher erythromycin (ER), tetracycline (TC) and vancomycin (VAN) resistant LAB from conventional poultry chicken (CC) compared to OC. Introduction Molecular characterization of isolated cultures (n = 32) with repetitive-PCR profiling and 16S rRNA gene sequencing re- Since the time of their discovery, antibiotics have played a vealed their taxonomical status as Enterococcus faecium decisive role in human health and life expectancy (Fraqueza (n =16), Enterococcus durans (n =2), Lactobacillus 2015). The spectacular success of antibiotics has led to the plantarum (n =10), Lactobacillus pentosus (n =1)and overuse/misuse of antibiotics in various sectors, such as clin- Lactobacillus salivarius (n = 3). The isolates were found to ical, veterinary, and even food production (Ammor et al. harbor erm(B), msr(C), msr(A/B), tet(M), tet(L) and tet(K) 2008). In intensively raised animals or birds, antibiotics are genes associated with Tn916 and Tn917 family transposons. administered to whole flocks rather than individuals (van den Expression studies through real-time PCR revealed antibiotic- Bogaard et al. 2001). Further, antibiotics may be continuously induced expression of the identified AR genes. In vitro and fed to animals such as broilers as antimicrobial growth pro- in vivo conjugational studies revealed transfer of ER and TC moters (Shryock and Richwine 2010). Such exploitation of R R resistant (ER and TC ) genes with transfer frequencies of antibiotics has created selective pressure for the emergence −7 −4 −1 10 and 10 transconjugants recipient , respectively. of relatively high amounts of resistant bacteria, raising con- Although no known VAN resistance (VAN ) genes were de- cerns over public health (van den Bogaard et al. 2001). tected, high phenotypic resistance was observed and was The use of antibiotics induces resistance not only in path- transferable to the recipient. From a public health point of ogenic bacteria but also in endogenous bacterial flora, includ- ing lactic acid bacteria (LAB) (Jacobsen et al. 2007). These Chandran Preethi and Surya Chandra Rao Thumu contributed equally to bacteria are ubiquitous in nature, and are found to be taxo- this work nomically diverse. They are found in large numbers in the gatrointestinal tract (GIT) of animals and humans, as well as * Prakash M. Halami in fermented dairy and vegetable foods (Thumu and Halami prakashalami@cftri.res.in 2012). With the detection of antibiotic resistance (AR) genes 1 in bacteria from food animals and the products derived from Microbiology and Fermentation Technology Department, them, the food chain has been considered as the main route of CSIR-Central Food Technological Research Institute, Mysore 570 020, India transmission of AR (Witte 2000). The spread of resistance 396 Ann Microbiol (2017) 67:395–404 genes from an animal-associated bacterium to human patho- (Pittsburgh, PA). The antibiotics—erythromycin (ER), gens is another potential danger that adds to its complexity. In tetracycline (TC), azithromycin (AZI), clarithromycin addition, the problem is exacerbated as LAB, which occur in (CLA), vancomycin (VAN), teicoplanin (TEI) and large numbers in the GIT of human and animals, are consid- rifampicin (RIF) as well as vancomycin/teicoplanin strips ered as reservoirs of AR genes (Jacobsen et al. 2007). (range 0–32 μg)—were purchased from Hi-Media As LAB are important microbes in meat fermentation, (Mumbai, India). Antibiotic stocks were prepared by there is concern with these bacteria that they carry AR genes dissolving in suitable solvent (water, methanol or in their genome. LAB are considered intrinsic/naturally chloroform) before use. LAB growth medium, de Man, resistant to several medically important antibiotics, and have Rogosa and Sharpe (MRS) agar and broth were the potential to acquire resistance to all antimicrobial drugs purchased from Hi-Media. available (Fraqueza 2015). In the case of well known AR genes, molecular techniques/methods will enable to correlate Screening for AR LAB genotype with the phenotypic resistance observed (Ammor et al. 2008). However, the situation can be complicated when Fresh fecal samples (n = 21) were obtained from five a phenotypically resistant strain is genotypically susceptible, poultry farms in and around Mysore district, Karnataka, which could be due to a novel/unknown resistance mecha- India, distributing broiler/conventionally raised poultry nism. Such resistance phenotypes can also emerge due to chickens (CC) and egg layers to different slaughter hous- cross resistance among antibiotics that are used in animal es. Further, samples comprising CC intestine (n = 46), husbandry and those that are used clinically for human chicken meat (n = 23), sanitary water (n =4)wereob- infections (Thumu and Halami 2012). Whatever the resistance tained from 50 slaughter houses. To juxtapose, fecal could be, the ultimate concern associated with LAB is their (n = 13) and intestinal samples (n = 9) were collected ability to carry functional AR genes with mobile genetic from organic chicken (OC) from neighboring villages. elements, and to disseminate/transfer these resistant traits to AR-LAB were isolated by plating the dilutions of 1 g or human pathogens in the human intestine. 1 ml of the above samples on MRS agar supplemented In terms of pathogenic bacteria, a World Health individually with antibiotics VAN, TC or ER at a concen- Organization report (WHO 2014) stated that this is no longer tration of 30, 8 and 4 μg/ml respectively. The concentra- a prediction, as there is now evidence proving the link be- tions of the antibiotics used were according to the cut off tween the use of antimicrobial agents in animals and the emer- described by the European Food Safety Authority (2012). gence of resistant bacteria in the food chain. However, studies Plates were incubated for 24–48 h at 37 °C. The viable concerning the prevalence of AR LAB from poultry, their count of LAB was recorded as CFU/g or CFU/ml sample. The colonies obtained were selected based on their colony distribution, and the extent of contamination, especially in developing countries like India, where un-authorized high morphology, purified, and subjected to taxonomic identi- amount of antibiotics are being used as growth promoters fication. Preliminary identification of LAB was accom- and for prophylactic purposes in poultry and animal husband- plished as per the schemes outlined in Bergey’s Manual ry, are negligible. In the present investigation, we conducted a of Systematic Bacteriology (Holtetal. 1994). Such con- systematic study to determine the incidence of AR LAB from firmed isolates were stored at −80 °C in 20% glycerol for poultry chicken, raw meat and water from slaughter houses. further use. Focusing on the well-known erythromycin and tetracycline R R resistance (ER and TC ) genes, we determined their distri- Determination of minimum inhibitory concentration bution and their association with transposons. Finally, we also demonstrated their functionality and transferability to patho- Minimum inhibitory concentration (MIC) values of clini- gens through in vitro and in vivo studies. cally important antibiotics were determined by broth dilu- tion method according to the CLSI (Clinical and Laboratory Standards Institute) guidelines (CLSI 2007). Material and methods MIC is defined as the lowest antibiotic concentration that will inhibit the visible growth of a microorganism after Fine chemicals and antibiotics overnight incubation. Taq DNA polymerase, 25 mM MgCl , and oligonucleotide Genomic DNA extraction, repetitive-PCR and 16S rDNA primers (Table 1) were procured from Sigma-Aldrich (St. amplification Louis, MO). dNTPs mix, lysozyme and proteinase-K were obtained from GeNei-Merck (Bangalore, India). Genomic DNA from selected LAB isolates was extracted as described by Mora et al. (2000). The AR-LAB were grouped DNA ladder (10 kb) was from MBI Fermentas Ann Microbiol (2017) 67:395–404 397 Table 1 Oligonucleotide primers used for detection of antibiotic resistance (AR) and transposon genes Gene Primer designation Primer sequence (5′ → 3′) Annealing temp Amplicon size Reference (°C) (bp) Macrolide resistant determinants erm(A) ErmA-FW TCTAAAAAGCATGTAAAAGAA 52 645 (Thumu and Halami 2012) ErmA-RV CTTCGATAGTTTATTAATATTAGT erm(B) ErmB-FW CATTTAACGACGAAACTGGC 55 405 (Thumu and Halami 2012) ErmB -RV GGAACATCTGTGGTATGGCG erm(C) ErmC-FW TCAAAACATAATATAGATAAA 52 642 (Thumu and Halami 2012) ErmC -RV GCTAATATTGTTTAAATCGTCAAT msr(C) MsrC -FW AAGGAATCCTTCTCTCTCCG 55 343 (Thumu and Halami 2012) MsrC -RV GTAAACAAAATCGTTCCCG msr(A/B) MsrA/B-FW GCAAATGGTGTAGGTAAGACAACT 52 399 (Thumu and Halami 2012) MsrA/B-RV ATCATGTGATGTAAACAAAAT Tetracycline resistant determinants RPP DI GAYACNCCNGGNCAYRTNGAYTT 45 1083 (Thumu and Halami 2012) DII GCCCARWANGGRTTNGGNGGNACYTC tet(M) DI GAYCANCCNGGNCAYRTNGAYTT 55 1513 (Thumu and Halami 2012) TetM-RV CACCGAGCAGGGATTTCTCCAC tet(S) TetS-FW ATCAAGATATTAAGGAC 55 573 (Thumu and Halami 2012) TetS-RV TTCTCTATGTGGTAATC tet(O) TetO-FW AATGAAGATTCCGACAATTT 55 781 (Thumu and Halami 2012) TetO-RV CTCATGCGTTGTAGTATTCCA tet(K) TetK-FW TTATGGTGGTTGTAGCTAGAAA 55 348 (Gevers et al. 2003) TetK-RV AAAGGGTTAGAAACTCTTGAAA tet(L) TetL-FW GTMGTTGCGCGCTATATTCC 55 696 (Gevers et al. 2003) TetL-RV GTGAAMGRWAGCCCACCTAA tet(W) TetW-FW GAGAGCCTGCTATATGCCAGC 57 168 (Thumu and Halami 2012) TetW-RV GGGCGTATCCACAATGTTAAC Vancomycin resistance determinants vanA vanA-FW GCTATTCAGCTGTACTC 50 783 (Dutka-Malen et al. 1995) vanA-RV CAGCGGCCATCATACGG vanB vanB-FW CATCGCCGTCCCCGAATTTCAAA 60 297 (Dutka-Malen et al. 1995) vanB-RV GATGCGGAAGATACCGTGGCT vanC vanC-FW GGTAT CAAGGAAACCTC 48 822 (Dutka-Malen et al. 1995) vanC-RV CTTCCGCCATCATAGCT vanA1 vanA1-FW ATACGATCAAGCGGTCAATC 53 972 This study vanA1-RV TACCGATACGTCATGCTCCT Nvan NvanF GTTTGGGGGTTGCTCAGAGG 58 1006 (Xu et al. 2010) NvanR TCACCCCTTTAACGCTAATACGATC Tn916-like and Tn917 transposon genes Int Int-FW GCGTGATTGTATCTCACT 50 1028 (Thumu and Halami 2012) Int-RV GACGCTCCTGTTGCTTCT xis Xis-FW AAGCAGACTGAGATTCCTA 45 194 (Cochetti et al. 2007) Xis-RV GCGTCCAATGTATCTATAA tnpA TnpA-FW ATGGCTATGAAAAGAAT 42 848 (Cochetti et al. 2007) TnpA-RV AAAAAAGCAATAAGTAAA tnpR TnpR-FW TTTTGGCTATGCTCGAGTG 48 670 (Cochetti et al. 2007) TnpR-RV ATTCTTTTCATAGCCAT N = A, C, G, T; R = A, G; W = A, T; Y = C, T; M = A, C; FW- forward primer; RV- reverse primer by repetitive-PCR (rep-PCR) using primer (GTG) as de- Aldrich), and were sequenced at the facility of Vimta scribed previously by Camu et al. (2007). The rep-PCR Labs (Hyderabad, India). banding profiles were evaluated using the Quantity One® software (Bio-Rad, Milan, Italy). Similarity of the profiles was evaluated by dice coefficient values, Genotypic detection of transposon and AR determinants and a phylogenetic tree was drawn on the basis of un- R R R weighted pair group method using arithmetic averages PCR was carried out for ER ,TC and VAN determinants (UPGMA). Representative cultures from each group along with efflux genes for macrolides [msr(C) and msr(A/B)] with similar banding patterns were considered for 16S and TC [tet(L) and tet(K)]. In addition, the isolates were also rDNA gene sequencing. The amplified PCR products tested for the presence of conjugative Tn916 and non- were purified using PCR purification kit (Sigma composite transposon Tn917 families. Details of PCR primer 398 Ann Microbiol (2017) 67:395–404 sequences, annealing temperatures and expected amplicon Verification of transconjugants sizes are given in Table 1. The transconjugants were identified by (GTG) PCR and plas- mid profiling. Phenotypic and genotypic resistance of the se- In vitro mating lected transconjugants was determined as described above. Conjugation frequency was calculated as the number of The ability of native LAB isolates to act as donors for AR transconjugant colonies per donor and/or recipient colonies. genes was assessed using the filter mating technique, as de- scribed by Gevers et al. (2003). Strain Enterococcus faecalis RNA isolation and qPCR analysis JH2-2 (obtained from CMAP Franz, Germany) was used as a plasmid-free recipient. Native strains resistant to clinically im- To study the functionality of the identified resistance genes, portant antibiotics like ER, TC, VAN, teicoplanin (TEI), and gene expression studies were performed using real time/q- susceptible to rifampicin (RIF), were subjected to mating with PCR assay. Briefly, DNA-free RNA was extracted from 6- to the recipient strain for the transfer of antimicrobial resistance. 8-h-old bacterial cells grown in MRS broth supplemented A 10:1 ratio of donor: recipient cells was used. with increasing concentration of respective antibiotics and Transconjugants growing on BHI agar supplemented with following the procedure described by Walther et al. (2008). TC, ER and RIF were selected. Each experiment was per- The quantified single stranded RNA was converted to cDNA formed in triplicate and frequency values are reported as the using a cDNA synthesis kit (Roche). The intensity of fluores- mean ± standard deviation (SD). cence at each cycle was captured using a Real Time System Machine (Bio-Rad, CFX96). Real-time-PCR (RT-PCR) quan- tification based on the normalized fold expression of target Experimental design for in vivo conjugation studies genes versus reference 16S rRNA gene was performed to study the functionality of AR genes. Details of primers used An in vivo study was prepared with 18 male Wistar rats aged for RT-PCR are given in Table 2. 6 weeks old, and 150–170 g in body weight, housed at the animal house facility of Central Food Technological Research Nucleotide accession numbers Institute, Mysore, India. All experimental protocols were ap- proved by the Institutional Animal Ethics Committee (IAEC The nucleotide sequences of 16S rDNA gene of the bacterial No. 341/14), CSIR-CFTRI, Mysore, India. The rats were di- isolates reported in this study were deposited in the GenBank vided into three groups with six rats each (n =6), onereceiv- database under accession numbers KJ961587, KJ961588, ing E. faecium M3G, the other with Lactobacillus plantarum KR703655, KR703656, and KU291387. The msr(C) frag- S11T. E. faecalis JH2-2 was used as recipient in both cases. A ment sequences identified in strains M3G and S11T are de- third group of animals receiving neither bacterial culture posited with accession numbers KT000004–KT000005, served as control throughout the experiment. respectively. At day zero, all rats except the control group received 1 ml 10 CFU/ml recipient strain E. faecalis JH2-2. The recipient strain was allowed to colonize the gut for 7 days. From day 8 Results to day 16, two groups (not the control group) received 1 ml 10 CFU/ml E. faecium M3G and L. plantarum S11T, respec- Analysis and identification of AR-LAB from poultry tively. Overnight grown bacterial cultures were centrifuged; samples pellets were washed twice with 5 ml physiological saline and administered by intubation. Appropriate dilutions of the collected samples were inoculated Fecal samples were collected every day (day 1–17) during onto MRS medium supplemented with antibiotics to estimate the course of the experiment. At the end of experiment, the the total number of LAB resistant to TC, ER and VAN. animals were sacrificed using diethyl ether, and intestinal sam- Numbers of AR LAB from samples of regular poultry (CC) ples from duodenum, ileum, caecum and colon were collect- were 5–7 log units higher compared to those from the wild ed. Samples of 1 g each were homogenized in 9 ml physio- type/OC (Fig. 1). From a total of 156 LAB cultures recovered logical saline followed by preparation of an eight-fold dilution from different samples resultant of CC, 32 cultures found series and plating on appropriate selective agar plates for enu- resistant to all the three antibiotics were selected for further meration of transconjugants, recipients and donors. molecular characterization. Classification of the isolated cul- Transconjugants were selected on BHI agar supplemented tures at their strain level was achieved through Rep-PCR anal- with RIF (50 μg/ml), TC (8 μg/ml) and ER (8 μg/ml) for ysis (Fig. 2) and 16S rRNA gene sequencing. The sequencing R R the selection of individual TC and ER colonies. of representative isolates from each group demonstrated the Ann Microbiol (2017) 67:395–404 399 Table 2 Primers used in real time-PCR Gene Primer Primer sequence (5′′→ 3′) Annealing Amplicon Reference designation temp (°C) size (bp) 16S 16S2-FW TCATCATGCCCCTTATGACC 55 156 This study 16S2-RV GCGATTACTAGCGATTCCG This study erm(B) erm(B)-FW TCACCGAACACTAG 55 138 (Jensen et al. 1999) GGTTGC erm(B)-RV GGAACATCTGTGGTATGGCG This study msr(C) msr(C)-FW ATCATTTAGGGTTTGCTCAG 54 205 (Werner et al. 2001) msr(C)-RV GTAAACAAAATCGTTCCCG This study tet(L) tet(L)-FW TCCCTGGAACAATGAGTGTC 53 196 This study tet(L)-RV GTGAACGAAAGCCC This study ACCTAA tet(M) tet(M)-FW GCAATTCTACTGATTTCTGC 50 186 This study tet(M)-RV CTGTTTGATTACAATTTCGG This study presence of 14 Lactobacillus and 18 enterococcal strains com- predominant in Enterococcus isolates, while detected only in prising species L. plantarum (n =10), L. salivarius (n =3), L. plantarum among Lactobacillus spp. With the incidence of L. pentosus (n =1), E. faecium (n = 16) and E. durans (n =2). phenotypic TC , tet(M) and tet(L) were the only resistant determinants detected among the isolates. Although most of the cultures showed significant VAN phenotypically, we Detection and localization of AR determinants could not detect even the most commonly found resistance and transposons genes such as van(A) and van(B). In addition, they also remained negative for Lac-type van operons [van(A, B, D, The MIC values are presented in Table 3 and the AR genes and M)] analyzed using degenerate primers. Besides the inci- detected are shown in Fig. 2. Among the ER genes analyzed, dence of these resistance determinants, LAB isolates erm(B) was the most abundant, followed by the efflux pump (E. faecium and L. plantarum) were found positive for int encoding genes msr(C) and msr(A/B). The msr genes were (integrase) (7%), and xis (excisionase) (28%) of Tn916 and tnpA (transposase) (9%), and tnpR (resolvase) (9%) of Tn917 class of transposons (Fig. 2). Inducible expression of AR genes in LAB The functionality of the identified ER and TC determinants was assessed by analyzing their expression profiles by employing real-time PCR. Among the isolates that displayed MICs of 4–128 μg/ml, inducible type of ER was observed among few isolates that displayed an increased expression of erm(B) when exposed to inducing concentrations of ER (0.5, 1, 4 and 8 μg/ml). However, isolates with a higher range of MICs (256–1024 μg/ml) did not show any change in erm(B) expression, indicating a constitutive type of ER ,as validated through classical disc diffusion test. Unlike erm(B), msr(C) gene expression levels were not affected by ER. Instead, when challenged with other macrolides, CLA was found to be a potent inducer of msr(C), and expression of the gene was dose dependent (Fig. 3). Similar expression studies were carried out Fig. 1 Antibiotic resistance bacterial profile in wild and poultry chicken with TC genes, where tet(M) was found to be induced with samples. OC-F organic chicken feces, OC-I organic chicken intestine, the concentrations ranging from 0.5 μg/ml to 8 μg/ml, while CC-F conventionally raised chicken feces, CC-I conventionally raised the tet(L) gene was found to be non-transcribed, hence non- chicken intestine, CC-M conventionally raised chicken meat, SHW slaughter house sanitary water functional. 400 Ann Microbiol (2017) 67:395–404 Fig. 2 Unweighted pair group method using arithmetic averages were identified based on 16S rRNA gene sequencing. The respective (UPGMA)-based cluster analysis for antibiotic resistant (AR) lactic acid source of isolation and the AR determinants of each culture are shown: bacteria (LAB) from commercial chicken sources, on the basis of dice F feces, I intestine, M meat, W slaughter house water coefficient values of banding obtained by repetitive-PCR. The cultures Table 3 AR lactic acid bacteria (LAB) with their range of minimum inhibitory concentration (MIC) for respective antibiotics Antibiotics MIC range Antibiotic resistant lactic acid bacteria (μg/ml) Lactobacillus Lactobacillus Lactobacillus Enterococcus faecium Enterococcus salivarius (n =3) plantarum (n =10) pentosus (n =1) (n =16) durans (n =2) Vancomycin 32–128 0 0 0 3 0 4–16 0 2 0 9 2 256–1024 3 8 1 4 0 Teicoplanin 4–16 0 0 0 4 0 32–128 3 3 0 9 2 256–1024 7 1 3 0 Erythromycin 4–16 2 3 1 11 1 32–128 1 5 0 4 1 256–1024 0 2 0 1 0 Tetracycline 4–16 2 4 1 7 1 32–128 1 5 0 8 1 256–1024 0 1 0 1 0 Ann Microbiol (2017) 67:395–404 401 Fig. 4 In vivo count of the recipient Enterococcus faecalis JH2-2 (open diamonds), donors (closed diamonds), transconjugants isolated for tetra- cycline (closed triangles) and erythromycin resistance (open circles), Fig. 3 Effect of clarithromycin (CLA) on the expression of MS efflux with (a) E. faecium M3G or (b) L. plantarum S11T as donor cultures gene msr(C) in (a) Enterococcus faecium and (b) Lactobacillus plantarum, analyzed by real-time PCR recipient for E. faecium M3G and L. plantarum S11T, respec- tively. The distribution of recipient, donors, and transconjugants In vitro and in vivo conjugal transfer of AR in all the four intestinal segments was relatively similar. In the upper segments—duodenum and ileum—the bacterial count was In vitro conjugation performed with two representative isolates below the detection limit. In the lower intestinal segment—colon (E. faecium M3G and L. plantarum S11T) demonstrated the and caecum—the concentration of recipient was higher than that transfer of AR to the recipient strain, E. faecalis JH2-2 with of donors, and these in turn were higher than the transconjugants −6 −6 frequencies of 8 × 10 and2.75×10 transconjugants/donor, (as also in the fecal sample), which were up to an average of −7 −7 2 and 6.72 × 10 and 2.16 × 10 transconjugants/recipient, re- 6.2 × 10 CFU/g sample. spectively, on plates supplemented with ER, TC and RIF. Based on the results obtained by means of in vitro conjugational studies, Characterization of transconjugants the isolates were further subjected to in vivo conjugal transfer using an Albino Wistar rat model system. The recipient strain Analyzed through Rep-PCR using (GTG) primer, was administered as a single dose on day 0, colonized the gut of transconjugants exhibited a similar banding pattern as the recip- 6 R the rodents at a stable count of 10 CFU/g, as determined through ient culture. The conjugation transfer frequencies, ER and TC fecal analysis throughout the experimental period (Fig. 4). The genes detected, and MIC values among the transconjugants are number of donors during the initial dose was found to be given in Table 4. In the case of glycopeptide resistance, 70% of 10 CFU/g, but further increased and remained at a stable count transconjugants derived from the donor E. faecium M3G exhib- of 10 CFU/g feces in subsequent dosing. Transconjugants were ited the resistance phenotype, and the others were found to be observed in fecal samples from the 3rd day after the introduction sensitive. However, all representative transconjugants derived of donors, and increased slightly in counts towards the end of the from the donor L. plantarum S11T showed resistance to the experiment (Fig. 4). No growth was observed from the fecal antibiotics vancomycin and teicoplanin. When the samples of control rats on selective plates for transconjugants. transconjugants were analyzed for the functionality of the trans- The development in the number of transconjugants for both the ferred resistance genes, erm(B) was found to be non-inducible, donors was comparable, and reached a count of 10 CFU/g feces. while inducible concentrations of TC could increase the expres- The number of transconjugants derived from E. faecium M3G sion levels of tet(M). Transconjugants with tet(M) alone or tet(M) donor selected for ER was slightly, but significantly (P < 0.005), and tet(L) showed higher levels of resistance to TC, while those higher than the TC transconjugants, and showed a count of with only the tet(L) gene were detected with low level resistance. 10 CFU/g feces (Fig. 4a). The frequency of conjugation was In addition, transconjugants with tet(M) gene were resistant to −4 −5 observed to be 1.70 × 10 and2.01× 10 transconjugants/ VAN, while tet(M) negative strains remained sensitive. 402 Ann Microbiol (2017) 67:395–404 Table 4 MIC, AR determinants, and transposon profiles of donor, recipient and transconjugants Species MIC (μg/ml) Antibiotic resistant determinants Transposon Tn916 Tn917 VAN TEI ER TC RIF msr(C) msr(A/B) erm(B) tet(M) tet(L) Int xis tnpA tnpR E. faecium M3G >256 >256 256 128 4 + + + + + − ++ + Transconjugants(8) >256 >256 16 128 >50 −− ++ + − ++ + Transconjugants(6) 128 64 16 128 >50 −− ++ + − ++ + Transconjugants(6) <2 <2 8 16 >50 −− + − + − + −− L. plantarum S11T >1024 512 64 128 <2 + + + + + + + −− Transconjugants(4) 1024 512 16 64 >50 −− ++ + + + −− Transconjugants(16) 512 512 8 32 >50 −− ++ − ++ −− E. faecalis JH2-2 <2 <2 <2 <2 >80 − − − − − −−− − VAN = vancomycin; TEI = teicoplanin; ER = erythromycin; TC = tetracycline; RIF = Rifampicin; + presence; − absence Discussion of AR-LAB counts among CC and OC samples, the overall microflora among these two groups were found to be differ- Among the several countries that use antibiotics, India stands ent. Despite the isolation of certain low level AR in the top five countries using antibiotics in animal production, Lactobacillus strains from OC, none of these cultures were with 3% of its global share in 2010 (Van Boeckel et al. 2015). capable of proliferating under the cultural conditions of those In addition, it has been speculated that, in the next 15 years, isolated from CC samples. In addition, no AR enterococci antibiotic use in chicken in India will increase to 143% (Van were detected from OC samples. These findings are supported Boeckel et al. 2015). This extensive use/misuse of antibiotics by the previous work of Sapkota et al. (2011), where the tran- has led to the development and spread of AR in commensal sition of poultry farms from conventional to organic (by re- microorganisms (Aquilanti et al. 2007). Nevertheless, the food moval of antibiotic use) has lowered the prevalence of resis- chain has been recognized as one of the key routes in spread- tant and multi drug resistance (MDR) enterococci. ing of antimicrobial resistant microbes from animals to Considering the resistance determinants among the isolated humans (Fraqueza 2015). AR LAB cultures, the erm(B) is the most prevalent, with an In the current study, the prevalence of AR LAB was found inducible or constitutive macrolide-lincosamide-streptogramin to be significantly higher in isolates obtained from CC sam- B(MLS ) resistant phenotype, which is common worldwide. ples compared to OC. Previous studies have shown that LAB Most of the erm(B) isolates are tetracycline resistant, which re- are usually low in numbers in raw meat compared to the sults from the insertion of erm(B) into the Tn916 conjugative fermented meat products, where they flourish (Hammes and transposon, which commonly carries the tet(M) gene (Thumu Knauf 1994). However, it is intimidating to observe the higher and Halami 2012). This was clearly evident in our study, where percentage of AR-LAB counts in fresh meat and sanitary wa- most of the isolates were positive for erm(B), tet(M) and int and ter samples from the slaughter houses. Although we could xis genes of Tn916 family transposons. In addition to these ER identify Lactobacillus spp., the overall LAB counts in all the and TC determinants, we frequently encountered the presence samples were represented by enterococcal species (E. faecium of efflux pump encoding genes msr(C) and msr(A/B) in the and E. durans). These results are in agreement with previous majority of the isolates. Studies conducted on msr(C) expression reports where multiple drug resistant enterococci were the showed that it could confer resistance to macrolides and most predominant from poultry and meat products (Hayes streptogramin antibiotics when cloned in Staphylococcus aureus et al. 2003, 2004; van den Bogaard et al. 2002). Thus, entero- and not in its host species of Enterococcus (Reynolds and Cove cocci can be used as sentinels for monitoring resistance devel- 2005). However, through relative real-time PCR studies, we opment due to usage of antibiotics in animal and poultry pro- found msr(C) induction with CLA, which was unusual. From duction (Hayes et al. 2004). these results, and those of the previous study (Thumu and Halami The overuse of antibiotics creates a selective pressure on 2014), we assumed that novel resistance mechanisms prevail in the indigenous microflora, resulting in overgrowth or preva- these LAB, which represent an additional complication. lence of AR strains, and creates disturbances or alteration in Among the two genetic determinants, tet(W) and tet(L), the gastrointestinal (GI)/indigenous microflora (Sullivan et al. detected in the 37 selected TC isolates, only tet(W) was 2001). In the present investigation, with the observed disparity found to be functional. However, tet(L) was found alone in Ann Microbiol (2017) 67:395–404 403 most of the isolates that showed higher levels of phenotypic lower level resistance than those that carried both the genes. In resistance to tetracycline. These results indicate the presence terms of VAN , although we could not establish genetic evi- of additional tet genes apart from those that have been consid- dence or a biochemical mechanism, a significant observation ered in the present investigation. made was its transfer of phenotypic resistance in both in vitro Among the VAN determinants, vanA, B or C are the most and in vivo conjugational studies. We also observed through common resistance genes detected, and especially among en- conjugational studies that VAN coexisted with the tet(M) terococci (Xu et al. 2010). Despite the occurrence of high level gene, where transconjugants that were sensitive to VAN were VAN in our isolates, we could not detect either of these also devoid of tet(M). These observations are in accordance to R R genes. Similar observations were made in recent years by previous reports where VAN was found coexisting with TC other researchers, who reported the absence of these common (Zhou et al. 2012). Along the transmission of resistance genes, VAN genes (Novotna et al. 2012;Gudetaet al. 2014). the conjugal transfer of transposons is another aspect that im- Although AR is an added advantage to LAB, their ability to plies that LAB of poultry origin are potential candidates for communicate with other bacteria with the aid of conjugative AR dissemination. Although we could not analyze the AR plasmids or mobile genetic elements is a major disadvantage transfer from LAB to indigenous Escherichia coli strains, or threat as they are involved in the spread of AR (Zhou et al. the later transfer of AR should be kept in mind since these 2012). The conjugation ability of LAB to transfer AR genes is isolates (L. fermentum, L. plantarum, E. faecium and usually assessed through several in vitro and in vivo methods E. durans) are found to be better survivors in the animal in- (Schjørring and Krogfelt 2010). Several observations argue testine (Schjørring and Krogfelt 2010). that in vitro conjugation cannot be extrapolated to in vivo conditions (Schjørring and Krogfelt 2010). This is evident as few studies failed to observe the conjugal transfer of AR genes Conclusion in vivo that are readily transferred under in vitro conditions. However, in the present investigation, we did observe that the Our study showed that high levels of AR LAB exist in chicken transfer frequency was much higher in animals compared to feces, meat and water from slaughter houses, indicating con- filter mating experiments, which is in agreement with previous tamination of the food chain and environment. The prevalence studies (Dahl et al. 2007;Feldet al. 2008). Among the in vivo of these AR bacteria is due predominantly to the irregular/ experiments, the antibiotic-treated mice with conventional uncontrolled use of antibiotics in Indian poultry as food addi- bacterial flora and intact immune system were found to have tives, for therapy, and for control of bacterial infections. As the added advantage of mimicking the human GI track better pointed out in this study, these bacteria are capable of trans- compared to germ-free animals (Schjørring and Krogfelt ferring the resistance determinants to other bacteria, including 2010). Although our experiments were carried out in such a pathogens, which is a major threat. As many developed coun- conventional model, we followed the worst scenario, in which tries encourage the discontinuation of antibiotic usage in farm the mice were not fed with antibiotics during the in vivo con- animals, developing countries like India ignore the conse- jugational trials. Thus, the higher frequency of in vivo transfer quences of the rapid dissemination of AR in food chain. could be due to the colonizing ability of the poultry isolates Thus, urgent and determined action needs to be brought that was observed in our results. These observations imply through national/international regulatory surveillance of anti- that LAB originating from poultry can be regarded as potential microbial use among food animals to limit the spread of AR. candidates as reservoirs, and play a decisive role in the dis- semination of AR in the food chain. Acknowledgments The authors wish to thank Prof. Ram In addition to the above observations, our in vivo conjuga- Rajasekharan, Director, CSIR- CFTRI, Mysore for providing the neces- sary facilities to carry out the work. The authors also acknowledge Indian tion results revealed the type of functional resistance determi- Council of Medical Research (ICMR), New Delhi for funding. nants transferred among bacteria. Among the transconjugants verified for ER transfer, most of the transconjugants were Compliance with ethical standards positive for erm(B) and negative for the msr(C) gene. These results imply that msr(C) is associated either with the chromo- Conflict of interest The authors declare no conflicts of interest. some or with high molecular weight plasmids, as was also evidenced in our previous studies (Thumu and Halami 2014). These results, along with the real-time PCR data, re- R References vealed that the high level ER among poultry LAB isolates is from msr(C) genes. Hence, any instance of msr(C) transfer to Ammor MS, Flórez AB, Van Hoek AHAM, de los Reyes-Gavilán CG, pathogens would have major medical consequences. Similar Aarts HJM, Margolles A (2008) Molecular characterization of in- to ER, the TC gene tet(M) was found to confer higher resis- trinsic and acquired antibiotic resistance in lactic acid bacteria and tance, as the transconjugants that acquired only tet(L) showed bifidobacteria. J Mol Microbiol Biotechnol 14:6–15 404 Ann Microbiol (2017) 67:395–404 Aquilanti L, Silvestri G, Zannini A, Osimani A, Santarelli S, Clementi F Mora D, Fortina MG, Parini C, Daffonchio D, Manachini PL (2000) (2007) Phenotypic, genotypic and technological characterization of Genomic sub-populations within the species Pediococcus predominant lactic acid bacteria in pecorino cheese from central acidilactici detected by multi locus typing analysis: relationships Italy. J Appl Microbiol 103:948–960 between pediocin AcH/PA-1 producing and nonproducing strains. Camu N, De Winter T, Verbrugghe K, Cleenwerck I, Vandamme P, Microbiol 146:2027–2038 Takrama JF, Vancanneyt M, De Vuyst L (2007) Dynamics and bio- Novotna G, Hill C, Vincent K, Liu C, Hong H (2012) A novel membrane diversity of populations of lactic acid bacteria and acetic acid bacte- protein vanJ conferring resistance to teicoplanin. Antimicrob Agents ria involved in spontaneous heap fermentation of cocoa beans in Chemother 56:1784–1796 Ghana. Appl Environ Microbiol 73:1809–1824 Reynolds E, Cove JH (2005) Enhanced resistance to erythromycin is Clinical and Laboratory Standards Institute (2007) Performance standards conferred by the enterococcal msrCdeterminant in Staphylococcus for antimicrobial susceptibility testing; Seventeenth information aureus. J Antimicrob Chemother 55:260–264 supplement, CLSI document M100-S17, Clinical and Laboratory Sapkota AR, Hulet RM, Zhang G, McDermott P, Kinney EL, Schwab KJ, Standards Institute, Wayne, PA Joseph SW (2011) Lower prevalence of antibiotic-resistant entero- Cochetti I, Tili E, Vecchi M, Manzin A, Mingoia M, Varaldo PE, cocci on US conventional poultry farms that transitioned to organic Montanari MP (2007) New Tn916-related elements causing practices. Environ Health Perspect 119:1622–1628 erm(B)-mediated erythromycin resistance in tetracycline- Schjørring S, Krogfelt KA (2010) Assessment of bacterial antibiotic re- susceptible pneumococci. J Antimicrob Chemother 60:127–131 sistance transfer in the gut. Int J Microbiol 20:1–10 Dahl KH, Mater DD, Flores MJ, Johnsen PJ, Midtvedt T, Corthier G, Shryock TR, Richwine A (2010) The interface between veterinary and Sundsfjord A (2007) Transfer of plasmid and chromosomal glyco- human antibiotic use. Ann N Y Acad Sci 1213:92–105 peptide resistance determinants occurs more readily in the digestive Sullivan A, Edlund C, Nord CE (2001) Effect of antimicrobial agents on tract of mice than in vitro and exconjugants can persist stably in vivo the ecological balance of human microflora. Lancet Infect Dis 1: in the absence of glycopeptide selection. J Antimicrob Chemother 101–114 59:478–486 Thumu SCR, Halami PM (2012) Presence of erythromycin and tetracy- Dutka-Malen S, Evers S, Courvalin P (1995) Detection of glycopeptide cline resistance genes in lactic acid bacteria from fermented foods of resistance genotypes and identification to the species level of clini- Indian origin. Antonie van Leeuwenhoek 102:541–551 cally relevant enterococci by PCR. J Clin Microbiol 33:24–27 Thumu SCR, Halami PM (2014) Phenotypic expression and molecular European Food Safety Authority (2012) Guidance on the assessment of characterization of erythromycin resistance in Enterococcus spp iso- bacterial susceptibility to antimicrobials of human and veterinary lated from naturally fermented food. J Appl Microbiol 116:689–699 importance. EFSA J 10(6):2740 Van Boeckel TP, Brower C, Gilbert M, Grenfell BT, Levin SA, Robinson Feld L, Schjørring S, Hammer K, Licht TR, Danielsen M, Krogfelt K, TP, Teillant A, Laxminarayan R (2015) Global trends in antimicro- Wilcks A (2008) Selective pressure affects transfer and establish- bial use in food animals. Proc Natl Acad Sci USA 112:5649–5654 ment of a Lactobacillus plantarum resistance plasmid in the gastro- intestinal environment. J Antimicrob Chemother 61:845–852 van den Bogaard AE, London N, Driessen C, Stobberingh EE (2001) Fraqueza MJ (2015) Antibiotic resistance of lactic acid bacteria isolated Antibiotic resistance of faecal Escherichia coli in poultry poultry from dry-fermented sausages. Int J Food Microbiol 212:76–88 farmers and poultry slaughterers. J Antimicrob Chemother 47: Gevers D, Huys G, Swings J (2003) In vitro conjugal transfer of tetracy- 763–771 cline resistance from Lactobacillus isolates to other gram-positive van den Bogaard AE, Willems R, London N, Top J, Stobberingh EE bacteria. FEMS Microbiol Lett 225:125–130 (2001) Antibiotic resistance of faecal Enterococci in poultry, poultry Gudeta DD, Moodley A, Bortolaia V, Guardabassi L (2014) vanO a new farmers, and poultry slaughterers. J Antimicrob Chemother 49:497– glycopeptide resistance operon in environmental Rhodococcus equi isolates. Antimicrob Agents Chemother 58:1768–1770 Walther C, Rossano A, Thomann A, Perreten V (2008) Antibiotic resis- Hammes WP, Knauf HJ (1994) Starters in processing of meat products. tance in Lactococcus species from bovine milk: presence of a mu- Meat Sci 36:155–168 tated multidrug transporter mdt(a) gene in susceptible Lactococcus Hayes JR, English LL, Carter PJ, Proescholdt T, Lee KY, Wagner DD, garvieae strains. Vet Microbiol 131:348–357 White DG (2003) Prevalence and antimicrobial resistance of Werner G, Hildebrandt B, Witte W (2001) The newly described msr(C) Enterococcus species isolated from retail meats. Appl Environ gene is not equally distributed among all the isolates of Microbiol 69:7153–7160 Enterococcus faecium. Antimicrob Agents Chemother 45:3672– Hayes JR, English LL, Carr LE, Wagner DD, Joseph SW (2004) Multiple-antibiotic resistance of Enterococcus spp isolated from WHO (2014) Antimicrobial resistance: global report on surveillance. commercial poultry production environments. Appl Environ World Health Organization, Geneva, Switzerland 978 92 4 156474 Microbiol 70:6005–6011 8, p 232 Holt JG, Kreig NR, Sneath PHA, Stanley JT, Williams ST (1994) Witte W (2000) Selective pressure by antibiotic use in livestock. Int J Bergey’s manual of determinative bacteriology. Williams and Antimicrob Agents 16:19–24 Wilkins, Baltimore, pp 559–564 Xu X, Lin D, Yan G, Ye X, Wu S, Guo Y, Zhu D, Hu F, Zhang Y, Wang F, Jacobsen L, Wilcks A, Hammer K, Huys G, Gevers D, Andersen SR Jacoby GA, Wang M (2010) vanM a new glycopeptide resistance (2007) Horizontal gene transfer of tet(M) and erm(B) resistant plas- gene cluster found in Enterococcus faecium. Antimicrob Agents mids from food strains of Lactobacillus plantarum to Enterococcus Chemother 54:4643–4647 faecalis JH2-2 in the gastrointestinal tract of gnobiotic rats. FEMS Zhou N, Zhang JX, Fan MT, Wang J, Guo G, Wei XY (2012) Antibiotic Microbiol Ecol 59:158–166 resistance of lactic acid bacteria isolated from Chinese yogurts. J Jensen LB, Frimodt-Moller N, Aarestrup FM (1999) Presence of erm Dairy Sci 95:4775–4783 gene classes in gram-positive bacteria of animal and human origin in Denmark. FEMS Microbiol Lett 170:151–158 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

Occurrence and distribution of multiple antibiotic-resistant Enterococcus and Lactobacillus spp. from Indian poultry: in vivo transferability of their erythromycin, tetracycline and vancomycin resistance

Download PDF
10 pages

Loading next page...
 
/lp/springer-journals/occurrence-and-distribution-of-multiple-antibiotic-resistant-FnklyaTzl1

References (29)

Publisher
Springer Journals
Copyright
Copyright © 2017 by Springer-Verlag Berlin Heidelberg and the University of Milan
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Mycology; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/s13213-017-1270-6
Publisher site
See Article on Publisher Site

Abstract

Ann Microbiol (2017) 67:395–404 DOI 10.1007/s13213-017-1270-6 ORIGINAL ARTICLE Occurrence and distribution of multiple antibiotic-resistant Enterococcus and Lactobacillus spp. from Indian poultry: in vivo transferability of their erythromycin, tetracycline and vancomycin resistance 1 1 1 Chandran Preethi & Surya Chandra Rao Thumu & Prakash M. Halami Received: 25 December 2016 /Accepted: 1 May 2017 /Published online: 19 May 2017 Springer-Verlag Berlin Heidelberg and the University of Milan 2017 Abstract The objective of this study was to determine the view, this study reports Indian poultry as a major source of occurrence and distribution of antibiotic resistant (AR) lactic high levels of AR bacteria contaminating the food chain and acid bacteria (LAB) in Indian poultry. LAB from poultry farm the environment. Thus, urgent and determined strategies are feces (n = 21) and samples from slaughter houses comprising needed to control the spread of multiple AR bacteria. chicken intestine (n = 46), raw meat (n = 23), and sanitary . . water (n = 4) were evaluated and compared with those from Keywords Antibiotic resistance Horizontal gene transfer . . organic chicken (OC) collected from nearby villages. Poultry Enterococcus Lactobacillus Screening studies showed 5–7 log units higher erythromycin (ER), tetracycline (TC) and vancomycin (VAN) resistant LAB from conventional poultry chicken (CC) compared to OC. Introduction Molecular characterization of isolated cultures (n = 32) with repetitive-PCR profiling and 16S rRNA gene sequencing re- Since the time of their discovery, antibiotics have played a vealed their taxonomical status as Enterococcus faecium decisive role in human health and life expectancy (Fraqueza (n =16), Enterococcus durans (n =2), Lactobacillus 2015). The spectacular success of antibiotics has led to the plantarum (n =10), Lactobacillus pentosus (n =1)and overuse/misuse of antibiotics in various sectors, such as clin- Lactobacillus salivarius (n = 3). The isolates were found to ical, veterinary, and even food production (Ammor et al. harbor erm(B), msr(C), msr(A/B), tet(M), tet(L) and tet(K) 2008). In intensively raised animals or birds, antibiotics are genes associated with Tn916 and Tn917 family transposons. administered to whole flocks rather than individuals (van den Expression studies through real-time PCR revealed antibiotic- Bogaard et al. 2001). Further, antibiotics may be continuously induced expression of the identified AR genes. In vitro and fed to animals such as broilers as antimicrobial growth pro- in vivo conjugational studies revealed transfer of ER and TC moters (Shryock and Richwine 2010). Such exploitation of R R resistant (ER and TC ) genes with transfer frequencies of antibiotics has created selective pressure for the emergence −7 −4 −1 10 and 10 transconjugants recipient , respectively. of relatively high amounts of resistant bacteria, raising con- Although no known VAN resistance (VAN ) genes were de- cerns over public health (van den Bogaard et al. 2001). tected, high phenotypic resistance was observed and was The use of antibiotics induces resistance not only in path- transferable to the recipient. From a public health point of ogenic bacteria but also in endogenous bacterial flora, includ- ing lactic acid bacteria (LAB) (Jacobsen et al. 2007). These Chandran Preethi and Surya Chandra Rao Thumu contributed equally to bacteria are ubiquitous in nature, and are found to be taxo- this work nomically diverse. They are found in large numbers in the gatrointestinal tract (GIT) of animals and humans, as well as * Prakash M. Halami in fermented dairy and vegetable foods (Thumu and Halami prakashalami@cftri.res.in 2012). With the detection of antibiotic resistance (AR) genes 1 in bacteria from food animals and the products derived from Microbiology and Fermentation Technology Department, them, the food chain has been considered as the main route of CSIR-Central Food Technological Research Institute, Mysore 570 020, India transmission of AR (Witte 2000). The spread of resistance 396 Ann Microbiol (2017) 67:395–404 genes from an animal-associated bacterium to human patho- (Pittsburgh, PA). The antibiotics—erythromycin (ER), gens is another potential danger that adds to its complexity. In tetracycline (TC), azithromycin (AZI), clarithromycin addition, the problem is exacerbated as LAB, which occur in (CLA), vancomycin (VAN), teicoplanin (TEI) and large numbers in the GIT of human and animals, are consid- rifampicin (RIF) as well as vancomycin/teicoplanin strips ered as reservoirs of AR genes (Jacobsen et al. 2007). (range 0–32 μg)—were purchased from Hi-Media As LAB are important microbes in meat fermentation, (Mumbai, India). Antibiotic stocks were prepared by there is concern with these bacteria that they carry AR genes dissolving in suitable solvent (water, methanol or in their genome. LAB are considered intrinsic/naturally chloroform) before use. LAB growth medium, de Man, resistant to several medically important antibiotics, and have Rogosa and Sharpe (MRS) agar and broth were the potential to acquire resistance to all antimicrobial drugs purchased from Hi-Media. available (Fraqueza 2015). In the case of well known AR genes, molecular techniques/methods will enable to correlate Screening for AR LAB genotype with the phenotypic resistance observed (Ammor et al. 2008). However, the situation can be complicated when Fresh fecal samples (n = 21) were obtained from five a phenotypically resistant strain is genotypically susceptible, poultry farms in and around Mysore district, Karnataka, which could be due to a novel/unknown resistance mecha- India, distributing broiler/conventionally raised poultry nism. Such resistance phenotypes can also emerge due to chickens (CC) and egg layers to different slaughter hous- cross resistance among antibiotics that are used in animal es. Further, samples comprising CC intestine (n = 46), husbandry and those that are used clinically for human chicken meat (n = 23), sanitary water (n =4)wereob- infections (Thumu and Halami 2012). Whatever the resistance tained from 50 slaughter houses. To juxtapose, fecal could be, the ultimate concern associated with LAB is their (n = 13) and intestinal samples (n = 9) were collected ability to carry functional AR genes with mobile genetic from organic chicken (OC) from neighboring villages. elements, and to disseminate/transfer these resistant traits to AR-LAB were isolated by plating the dilutions of 1 g or human pathogens in the human intestine. 1 ml of the above samples on MRS agar supplemented In terms of pathogenic bacteria, a World Health individually with antibiotics VAN, TC or ER at a concen- Organization report (WHO 2014) stated that this is no longer tration of 30, 8 and 4 μg/ml respectively. The concentra- a prediction, as there is now evidence proving the link be- tions of the antibiotics used were according to the cut off tween the use of antimicrobial agents in animals and the emer- described by the European Food Safety Authority (2012). gence of resistant bacteria in the food chain. However, studies Plates were incubated for 24–48 h at 37 °C. The viable concerning the prevalence of AR LAB from poultry, their count of LAB was recorded as CFU/g or CFU/ml sample. The colonies obtained were selected based on their colony distribution, and the extent of contamination, especially in developing countries like India, where un-authorized high morphology, purified, and subjected to taxonomic identi- amount of antibiotics are being used as growth promoters fication. Preliminary identification of LAB was accom- and for prophylactic purposes in poultry and animal husband- plished as per the schemes outlined in Bergey’s Manual ry, are negligible. In the present investigation, we conducted a of Systematic Bacteriology (Holtetal. 1994). Such con- systematic study to determine the incidence of AR LAB from firmed isolates were stored at −80 °C in 20% glycerol for poultry chicken, raw meat and water from slaughter houses. further use. Focusing on the well-known erythromycin and tetracycline R R resistance (ER and TC ) genes, we determined their distri- Determination of minimum inhibitory concentration bution and their association with transposons. Finally, we also demonstrated their functionality and transferability to patho- Minimum inhibitory concentration (MIC) values of clini- gens through in vitro and in vivo studies. cally important antibiotics were determined by broth dilu- tion method according to the CLSI (Clinical and Laboratory Standards Institute) guidelines (CLSI 2007). Material and methods MIC is defined as the lowest antibiotic concentration that will inhibit the visible growth of a microorganism after Fine chemicals and antibiotics overnight incubation. Taq DNA polymerase, 25 mM MgCl , and oligonucleotide Genomic DNA extraction, repetitive-PCR and 16S rDNA primers (Table 1) were procured from Sigma-Aldrich (St. amplification Louis, MO). dNTPs mix, lysozyme and proteinase-K were obtained from GeNei-Merck (Bangalore, India). Genomic DNA from selected LAB isolates was extracted as described by Mora et al. (2000). The AR-LAB were grouped DNA ladder (10 kb) was from MBI Fermentas Ann Microbiol (2017) 67:395–404 397 Table 1 Oligonucleotide primers used for detection of antibiotic resistance (AR) and transposon genes Gene Primer designation Primer sequence (5′ → 3′) Annealing temp Amplicon size Reference (°C) (bp) Macrolide resistant determinants erm(A) ErmA-FW TCTAAAAAGCATGTAAAAGAA 52 645 (Thumu and Halami 2012) ErmA-RV CTTCGATAGTTTATTAATATTAGT erm(B) ErmB-FW CATTTAACGACGAAACTGGC 55 405 (Thumu and Halami 2012) ErmB -RV GGAACATCTGTGGTATGGCG erm(C) ErmC-FW TCAAAACATAATATAGATAAA 52 642 (Thumu and Halami 2012) ErmC -RV GCTAATATTGTTTAAATCGTCAAT msr(C) MsrC -FW AAGGAATCCTTCTCTCTCCG 55 343 (Thumu and Halami 2012) MsrC -RV GTAAACAAAATCGTTCCCG msr(A/B) MsrA/B-FW GCAAATGGTGTAGGTAAGACAACT 52 399 (Thumu and Halami 2012) MsrA/B-RV ATCATGTGATGTAAACAAAAT Tetracycline resistant determinants RPP DI GAYACNCCNGGNCAYRTNGAYTT 45 1083 (Thumu and Halami 2012) DII GCCCARWANGGRTTNGGNGGNACYTC tet(M) DI GAYCANCCNGGNCAYRTNGAYTT 55 1513 (Thumu and Halami 2012) TetM-RV CACCGAGCAGGGATTTCTCCAC tet(S) TetS-FW ATCAAGATATTAAGGAC 55 573 (Thumu and Halami 2012) TetS-RV TTCTCTATGTGGTAATC tet(O) TetO-FW AATGAAGATTCCGACAATTT 55 781 (Thumu and Halami 2012) TetO-RV CTCATGCGTTGTAGTATTCCA tet(K) TetK-FW TTATGGTGGTTGTAGCTAGAAA 55 348 (Gevers et al. 2003) TetK-RV AAAGGGTTAGAAACTCTTGAAA tet(L) TetL-FW GTMGTTGCGCGCTATATTCC 55 696 (Gevers et al. 2003) TetL-RV GTGAAMGRWAGCCCACCTAA tet(W) TetW-FW GAGAGCCTGCTATATGCCAGC 57 168 (Thumu and Halami 2012) TetW-RV GGGCGTATCCACAATGTTAAC Vancomycin resistance determinants vanA vanA-FW GCTATTCAGCTGTACTC 50 783 (Dutka-Malen et al. 1995) vanA-RV CAGCGGCCATCATACGG vanB vanB-FW CATCGCCGTCCCCGAATTTCAAA 60 297 (Dutka-Malen et al. 1995) vanB-RV GATGCGGAAGATACCGTGGCT vanC vanC-FW GGTAT CAAGGAAACCTC 48 822 (Dutka-Malen et al. 1995) vanC-RV CTTCCGCCATCATAGCT vanA1 vanA1-FW ATACGATCAAGCGGTCAATC 53 972 This study vanA1-RV TACCGATACGTCATGCTCCT Nvan NvanF GTTTGGGGGTTGCTCAGAGG 58 1006 (Xu et al. 2010) NvanR TCACCCCTTTAACGCTAATACGATC Tn916-like and Tn917 transposon genes Int Int-FW GCGTGATTGTATCTCACT 50 1028 (Thumu and Halami 2012) Int-RV GACGCTCCTGTTGCTTCT xis Xis-FW AAGCAGACTGAGATTCCTA 45 194 (Cochetti et al. 2007) Xis-RV GCGTCCAATGTATCTATAA tnpA TnpA-FW ATGGCTATGAAAAGAAT 42 848 (Cochetti et al. 2007) TnpA-RV AAAAAAGCAATAAGTAAA tnpR TnpR-FW TTTTGGCTATGCTCGAGTG 48 670 (Cochetti et al. 2007) TnpR-RV ATTCTTTTCATAGCCAT N = A, C, G, T; R = A, G; W = A, T; Y = C, T; M = A, C; FW- forward primer; RV- reverse primer by repetitive-PCR (rep-PCR) using primer (GTG) as de- Aldrich), and were sequenced at the facility of Vimta scribed previously by Camu et al. (2007). The rep-PCR Labs (Hyderabad, India). banding profiles were evaluated using the Quantity One® software (Bio-Rad, Milan, Italy). Similarity of the profiles was evaluated by dice coefficient values, Genotypic detection of transposon and AR determinants and a phylogenetic tree was drawn on the basis of un- R R R weighted pair group method using arithmetic averages PCR was carried out for ER ,TC and VAN determinants (UPGMA). Representative cultures from each group along with efflux genes for macrolides [msr(C) and msr(A/B)] with similar banding patterns were considered for 16S and TC [tet(L) and tet(K)]. In addition, the isolates were also rDNA gene sequencing. The amplified PCR products tested for the presence of conjugative Tn916 and non- were purified using PCR purification kit (Sigma composite transposon Tn917 families. Details of PCR primer 398 Ann Microbiol (2017) 67:395–404 sequences, annealing temperatures and expected amplicon Verification of transconjugants sizes are given in Table 1. The transconjugants were identified by (GTG) PCR and plas- mid profiling. Phenotypic and genotypic resistance of the se- In vitro mating lected transconjugants was determined as described above. Conjugation frequency was calculated as the number of The ability of native LAB isolates to act as donors for AR transconjugant colonies per donor and/or recipient colonies. genes was assessed using the filter mating technique, as de- scribed by Gevers et al. (2003). Strain Enterococcus faecalis RNA isolation and qPCR analysis JH2-2 (obtained from CMAP Franz, Germany) was used as a plasmid-free recipient. Native strains resistant to clinically im- To study the functionality of the identified resistance genes, portant antibiotics like ER, TC, VAN, teicoplanin (TEI), and gene expression studies were performed using real time/q- susceptible to rifampicin (RIF), were subjected to mating with PCR assay. Briefly, DNA-free RNA was extracted from 6- to the recipient strain for the transfer of antimicrobial resistance. 8-h-old bacterial cells grown in MRS broth supplemented A 10:1 ratio of donor: recipient cells was used. with increasing concentration of respective antibiotics and Transconjugants growing on BHI agar supplemented with following the procedure described by Walther et al. (2008). TC, ER and RIF were selected. Each experiment was per- The quantified single stranded RNA was converted to cDNA formed in triplicate and frequency values are reported as the using a cDNA synthesis kit (Roche). The intensity of fluores- mean ± standard deviation (SD). cence at each cycle was captured using a Real Time System Machine (Bio-Rad, CFX96). Real-time-PCR (RT-PCR) quan- tification based on the normalized fold expression of target Experimental design for in vivo conjugation studies genes versus reference 16S rRNA gene was performed to study the functionality of AR genes. Details of primers used An in vivo study was prepared with 18 male Wistar rats aged for RT-PCR are given in Table 2. 6 weeks old, and 150–170 g in body weight, housed at the animal house facility of Central Food Technological Research Nucleotide accession numbers Institute, Mysore, India. All experimental protocols were ap- proved by the Institutional Animal Ethics Committee (IAEC The nucleotide sequences of 16S rDNA gene of the bacterial No. 341/14), CSIR-CFTRI, Mysore, India. The rats were di- isolates reported in this study were deposited in the GenBank vided into three groups with six rats each (n =6), onereceiv- database under accession numbers KJ961587, KJ961588, ing E. faecium M3G, the other with Lactobacillus plantarum KR703655, KR703656, and KU291387. The msr(C) frag- S11T. E. faecalis JH2-2 was used as recipient in both cases. A ment sequences identified in strains M3G and S11T are de- third group of animals receiving neither bacterial culture posited with accession numbers KT000004–KT000005, served as control throughout the experiment. respectively. At day zero, all rats except the control group received 1 ml 10 CFU/ml recipient strain E. faecalis JH2-2. The recipient strain was allowed to colonize the gut for 7 days. From day 8 Results to day 16, two groups (not the control group) received 1 ml 10 CFU/ml E. faecium M3G and L. plantarum S11T, respec- Analysis and identification of AR-LAB from poultry tively. Overnight grown bacterial cultures were centrifuged; samples pellets were washed twice with 5 ml physiological saline and administered by intubation. Appropriate dilutions of the collected samples were inoculated Fecal samples were collected every day (day 1–17) during onto MRS medium supplemented with antibiotics to estimate the course of the experiment. At the end of experiment, the the total number of LAB resistant to TC, ER and VAN. animals were sacrificed using diethyl ether, and intestinal sam- Numbers of AR LAB from samples of regular poultry (CC) ples from duodenum, ileum, caecum and colon were collect- were 5–7 log units higher compared to those from the wild ed. Samples of 1 g each were homogenized in 9 ml physio- type/OC (Fig. 1). From a total of 156 LAB cultures recovered logical saline followed by preparation of an eight-fold dilution from different samples resultant of CC, 32 cultures found series and plating on appropriate selective agar plates for enu- resistant to all the three antibiotics were selected for further meration of transconjugants, recipients and donors. molecular characterization. Classification of the isolated cul- Transconjugants were selected on BHI agar supplemented tures at their strain level was achieved through Rep-PCR anal- with RIF (50 μg/ml), TC (8 μg/ml) and ER (8 μg/ml) for ysis (Fig. 2) and 16S rRNA gene sequencing. The sequencing R R the selection of individual TC and ER colonies. of representative isolates from each group demonstrated the Ann Microbiol (2017) 67:395–404 399 Table 2 Primers used in real time-PCR Gene Primer Primer sequence (5′′→ 3′) Annealing Amplicon Reference designation temp (°C) size (bp) 16S 16S2-FW TCATCATGCCCCTTATGACC 55 156 This study 16S2-RV GCGATTACTAGCGATTCCG This study erm(B) erm(B)-FW TCACCGAACACTAG 55 138 (Jensen et al. 1999) GGTTGC erm(B)-RV GGAACATCTGTGGTATGGCG This study msr(C) msr(C)-FW ATCATTTAGGGTTTGCTCAG 54 205 (Werner et al. 2001) msr(C)-RV GTAAACAAAATCGTTCCCG This study tet(L) tet(L)-FW TCCCTGGAACAATGAGTGTC 53 196 This study tet(L)-RV GTGAACGAAAGCCC This study ACCTAA tet(M) tet(M)-FW GCAATTCTACTGATTTCTGC 50 186 This study tet(M)-RV CTGTTTGATTACAATTTCGG This study presence of 14 Lactobacillus and 18 enterococcal strains com- predominant in Enterococcus isolates, while detected only in prising species L. plantarum (n =10), L. salivarius (n =3), L. plantarum among Lactobacillus spp. With the incidence of L. pentosus (n =1), E. faecium (n = 16) and E. durans (n =2). phenotypic TC , tet(M) and tet(L) were the only resistant determinants detected among the isolates. Although most of the cultures showed significant VAN phenotypically, we Detection and localization of AR determinants could not detect even the most commonly found resistance and transposons genes such as van(A) and van(B). In addition, they also remained negative for Lac-type van operons [van(A, B, D, The MIC values are presented in Table 3 and the AR genes and M)] analyzed using degenerate primers. Besides the inci- detected are shown in Fig. 2. Among the ER genes analyzed, dence of these resistance determinants, LAB isolates erm(B) was the most abundant, followed by the efflux pump (E. faecium and L. plantarum) were found positive for int encoding genes msr(C) and msr(A/B). The msr genes were (integrase) (7%), and xis (excisionase) (28%) of Tn916 and tnpA (transposase) (9%), and tnpR (resolvase) (9%) of Tn917 class of transposons (Fig. 2). Inducible expression of AR genes in LAB The functionality of the identified ER and TC determinants was assessed by analyzing their expression profiles by employing real-time PCR. Among the isolates that displayed MICs of 4–128 μg/ml, inducible type of ER was observed among few isolates that displayed an increased expression of erm(B) when exposed to inducing concentrations of ER (0.5, 1, 4 and 8 μg/ml). However, isolates with a higher range of MICs (256–1024 μg/ml) did not show any change in erm(B) expression, indicating a constitutive type of ER ,as validated through classical disc diffusion test. Unlike erm(B), msr(C) gene expression levels were not affected by ER. Instead, when challenged with other macrolides, CLA was found to be a potent inducer of msr(C), and expression of the gene was dose dependent (Fig. 3). Similar expression studies were carried out Fig. 1 Antibiotic resistance bacterial profile in wild and poultry chicken with TC genes, where tet(M) was found to be induced with samples. OC-F organic chicken feces, OC-I organic chicken intestine, the concentrations ranging from 0.5 μg/ml to 8 μg/ml, while CC-F conventionally raised chicken feces, CC-I conventionally raised the tet(L) gene was found to be non-transcribed, hence non- chicken intestine, CC-M conventionally raised chicken meat, SHW slaughter house sanitary water functional. 400 Ann Microbiol (2017) 67:395–404 Fig. 2 Unweighted pair group method using arithmetic averages were identified based on 16S rRNA gene sequencing. The respective (UPGMA)-based cluster analysis for antibiotic resistant (AR) lactic acid source of isolation and the AR determinants of each culture are shown: bacteria (LAB) from commercial chicken sources, on the basis of dice F feces, I intestine, M meat, W slaughter house water coefficient values of banding obtained by repetitive-PCR. The cultures Table 3 AR lactic acid bacteria (LAB) with their range of minimum inhibitory concentration (MIC) for respective antibiotics Antibiotics MIC range Antibiotic resistant lactic acid bacteria (μg/ml) Lactobacillus Lactobacillus Lactobacillus Enterococcus faecium Enterococcus salivarius (n =3) plantarum (n =10) pentosus (n =1) (n =16) durans (n =2) Vancomycin 32–128 0 0 0 3 0 4–16 0 2 0 9 2 256–1024 3 8 1 4 0 Teicoplanin 4–16 0 0 0 4 0 32–128 3 3 0 9 2 256–1024 7 1 3 0 Erythromycin 4–16 2 3 1 11 1 32–128 1 5 0 4 1 256–1024 0 2 0 1 0 Tetracycline 4–16 2 4 1 7 1 32–128 1 5 0 8 1 256–1024 0 1 0 1 0 Ann Microbiol (2017) 67:395–404 401 Fig. 4 In vivo count of the recipient Enterococcus faecalis JH2-2 (open diamonds), donors (closed diamonds), transconjugants isolated for tetra- cycline (closed triangles) and erythromycin resistance (open circles), Fig. 3 Effect of clarithromycin (CLA) on the expression of MS efflux with (a) E. faecium M3G or (b) L. plantarum S11T as donor cultures gene msr(C) in (a) Enterococcus faecium and (b) Lactobacillus plantarum, analyzed by real-time PCR recipient for E. faecium M3G and L. plantarum S11T, respec- tively. The distribution of recipient, donors, and transconjugants In vitro and in vivo conjugal transfer of AR in all the four intestinal segments was relatively similar. In the upper segments—duodenum and ileum—the bacterial count was In vitro conjugation performed with two representative isolates below the detection limit. In the lower intestinal segment—colon (E. faecium M3G and L. plantarum S11T) demonstrated the and caecum—the concentration of recipient was higher than that transfer of AR to the recipient strain, E. faecalis JH2-2 with of donors, and these in turn were higher than the transconjugants −6 −6 frequencies of 8 × 10 and2.75×10 transconjugants/donor, (as also in the fecal sample), which were up to an average of −7 −7 2 and 6.72 × 10 and 2.16 × 10 transconjugants/recipient, re- 6.2 × 10 CFU/g sample. spectively, on plates supplemented with ER, TC and RIF. Based on the results obtained by means of in vitro conjugational studies, Characterization of transconjugants the isolates were further subjected to in vivo conjugal transfer using an Albino Wistar rat model system. The recipient strain Analyzed through Rep-PCR using (GTG) primer, was administered as a single dose on day 0, colonized the gut of transconjugants exhibited a similar banding pattern as the recip- 6 R the rodents at a stable count of 10 CFU/g, as determined through ient culture. The conjugation transfer frequencies, ER and TC fecal analysis throughout the experimental period (Fig. 4). The genes detected, and MIC values among the transconjugants are number of donors during the initial dose was found to be given in Table 4. In the case of glycopeptide resistance, 70% of 10 CFU/g, but further increased and remained at a stable count transconjugants derived from the donor E. faecium M3G exhib- of 10 CFU/g feces in subsequent dosing. Transconjugants were ited the resistance phenotype, and the others were found to be observed in fecal samples from the 3rd day after the introduction sensitive. However, all representative transconjugants derived of donors, and increased slightly in counts towards the end of the from the donor L. plantarum S11T showed resistance to the experiment (Fig. 4). No growth was observed from the fecal antibiotics vancomycin and teicoplanin. When the samples of control rats on selective plates for transconjugants. transconjugants were analyzed for the functionality of the trans- The development in the number of transconjugants for both the ferred resistance genes, erm(B) was found to be non-inducible, donors was comparable, and reached a count of 10 CFU/g feces. while inducible concentrations of TC could increase the expres- The number of transconjugants derived from E. faecium M3G sion levels of tet(M). Transconjugants with tet(M) alone or tet(M) donor selected for ER was slightly, but significantly (P < 0.005), and tet(L) showed higher levels of resistance to TC, while those higher than the TC transconjugants, and showed a count of with only the tet(L) gene were detected with low level resistance. 10 CFU/g feces (Fig. 4a). The frequency of conjugation was In addition, transconjugants with tet(M) gene were resistant to −4 −5 observed to be 1.70 × 10 and2.01× 10 transconjugants/ VAN, while tet(M) negative strains remained sensitive. 402 Ann Microbiol (2017) 67:395–404 Table 4 MIC, AR determinants, and transposon profiles of donor, recipient and transconjugants Species MIC (μg/ml) Antibiotic resistant determinants Transposon Tn916 Tn917 VAN TEI ER TC RIF msr(C) msr(A/B) erm(B) tet(M) tet(L) Int xis tnpA tnpR E. faecium M3G >256 >256 256 128 4 + + + + + − ++ + Transconjugants(8) >256 >256 16 128 >50 −− ++ + − ++ + Transconjugants(6) 128 64 16 128 >50 −− ++ + − ++ + Transconjugants(6) <2 <2 8 16 >50 −− + − + − + −− L. plantarum S11T >1024 512 64 128 <2 + + + + + + + −− Transconjugants(4) 1024 512 16 64 >50 −− ++ + + + −− Transconjugants(16) 512 512 8 32 >50 −− ++ − ++ −− E. faecalis JH2-2 <2 <2 <2 <2 >80 − − − − − −−− − VAN = vancomycin; TEI = teicoplanin; ER = erythromycin; TC = tetracycline; RIF = Rifampicin; + presence; − absence Discussion of AR-LAB counts among CC and OC samples, the overall microflora among these two groups were found to be differ- Among the several countries that use antibiotics, India stands ent. Despite the isolation of certain low level AR in the top five countries using antibiotics in animal production, Lactobacillus strains from OC, none of these cultures were with 3% of its global share in 2010 (Van Boeckel et al. 2015). capable of proliferating under the cultural conditions of those In addition, it has been speculated that, in the next 15 years, isolated from CC samples. In addition, no AR enterococci antibiotic use in chicken in India will increase to 143% (Van were detected from OC samples. These findings are supported Boeckel et al. 2015). This extensive use/misuse of antibiotics by the previous work of Sapkota et al. (2011), where the tran- has led to the development and spread of AR in commensal sition of poultry farms from conventional to organic (by re- microorganisms (Aquilanti et al. 2007). Nevertheless, the food moval of antibiotic use) has lowered the prevalence of resis- chain has been recognized as one of the key routes in spread- tant and multi drug resistance (MDR) enterococci. ing of antimicrobial resistant microbes from animals to Considering the resistance determinants among the isolated humans (Fraqueza 2015). AR LAB cultures, the erm(B) is the most prevalent, with an In the current study, the prevalence of AR LAB was found inducible or constitutive macrolide-lincosamide-streptogramin to be significantly higher in isolates obtained from CC sam- B(MLS ) resistant phenotype, which is common worldwide. ples compared to OC. Previous studies have shown that LAB Most of the erm(B) isolates are tetracycline resistant, which re- are usually low in numbers in raw meat compared to the sults from the insertion of erm(B) into the Tn916 conjugative fermented meat products, where they flourish (Hammes and transposon, which commonly carries the tet(M) gene (Thumu Knauf 1994). However, it is intimidating to observe the higher and Halami 2012). This was clearly evident in our study, where percentage of AR-LAB counts in fresh meat and sanitary wa- most of the isolates were positive for erm(B), tet(M) and int and ter samples from the slaughter houses. Although we could xis genes of Tn916 family transposons. In addition to these ER identify Lactobacillus spp., the overall LAB counts in all the and TC determinants, we frequently encountered the presence samples were represented by enterococcal species (E. faecium of efflux pump encoding genes msr(C) and msr(A/B) in the and E. durans). These results are in agreement with previous majority of the isolates. Studies conducted on msr(C) expression reports where multiple drug resistant enterococci were the showed that it could confer resistance to macrolides and most predominant from poultry and meat products (Hayes streptogramin antibiotics when cloned in Staphylococcus aureus et al. 2003, 2004; van den Bogaard et al. 2002). Thus, entero- and not in its host species of Enterococcus (Reynolds and Cove cocci can be used as sentinels for monitoring resistance devel- 2005). However, through relative real-time PCR studies, we opment due to usage of antibiotics in animal and poultry pro- found msr(C) induction with CLA, which was unusual. From duction (Hayes et al. 2004). these results, and those of the previous study (Thumu and Halami The overuse of antibiotics creates a selective pressure on 2014), we assumed that novel resistance mechanisms prevail in the indigenous microflora, resulting in overgrowth or preva- these LAB, which represent an additional complication. lence of AR strains, and creates disturbances or alteration in Among the two genetic determinants, tet(W) and tet(L), the gastrointestinal (GI)/indigenous microflora (Sullivan et al. detected in the 37 selected TC isolates, only tet(W) was 2001). In the present investigation, with the observed disparity found to be functional. However, tet(L) was found alone in Ann Microbiol (2017) 67:395–404 403 most of the isolates that showed higher levels of phenotypic lower level resistance than those that carried both the genes. In resistance to tetracycline. These results indicate the presence terms of VAN , although we could not establish genetic evi- of additional tet genes apart from those that have been consid- dence or a biochemical mechanism, a significant observation ered in the present investigation. made was its transfer of phenotypic resistance in both in vitro Among the VAN determinants, vanA, B or C are the most and in vivo conjugational studies. We also observed through common resistance genes detected, and especially among en- conjugational studies that VAN coexisted with the tet(M) terococci (Xu et al. 2010). Despite the occurrence of high level gene, where transconjugants that were sensitive to VAN were VAN in our isolates, we could not detect either of these also devoid of tet(M). These observations are in accordance to R R genes. Similar observations were made in recent years by previous reports where VAN was found coexisting with TC other researchers, who reported the absence of these common (Zhou et al. 2012). Along the transmission of resistance genes, VAN genes (Novotna et al. 2012;Gudetaet al. 2014). the conjugal transfer of transposons is another aspect that im- Although AR is an added advantage to LAB, their ability to plies that LAB of poultry origin are potential candidates for communicate with other bacteria with the aid of conjugative AR dissemination. Although we could not analyze the AR plasmids or mobile genetic elements is a major disadvantage transfer from LAB to indigenous Escherichia coli strains, or threat as they are involved in the spread of AR (Zhou et al. the later transfer of AR should be kept in mind since these 2012). The conjugation ability of LAB to transfer AR genes is isolates (L. fermentum, L. plantarum, E. faecium and usually assessed through several in vitro and in vivo methods E. durans) are found to be better survivors in the animal in- (Schjørring and Krogfelt 2010). Several observations argue testine (Schjørring and Krogfelt 2010). that in vitro conjugation cannot be extrapolated to in vivo conditions (Schjørring and Krogfelt 2010). This is evident as few studies failed to observe the conjugal transfer of AR genes Conclusion in vivo that are readily transferred under in vitro conditions. However, in the present investigation, we did observe that the Our study showed that high levels of AR LAB exist in chicken transfer frequency was much higher in animals compared to feces, meat and water from slaughter houses, indicating con- filter mating experiments, which is in agreement with previous tamination of the food chain and environment. The prevalence studies (Dahl et al. 2007;Feldet al. 2008). Among the in vivo of these AR bacteria is due predominantly to the irregular/ experiments, the antibiotic-treated mice with conventional uncontrolled use of antibiotics in Indian poultry as food addi- bacterial flora and intact immune system were found to have tives, for therapy, and for control of bacterial infections. As the added advantage of mimicking the human GI track better pointed out in this study, these bacteria are capable of trans- compared to germ-free animals (Schjørring and Krogfelt ferring the resistance determinants to other bacteria, including 2010). Although our experiments were carried out in such a pathogens, which is a major threat. As many developed coun- conventional model, we followed the worst scenario, in which tries encourage the discontinuation of antibiotic usage in farm the mice were not fed with antibiotics during the in vivo con- animals, developing countries like India ignore the conse- jugational trials. Thus, the higher frequency of in vivo transfer quences of the rapid dissemination of AR in food chain. could be due to the colonizing ability of the poultry isolates Thus, urgent and determined action needs to be brought that was observed in our results. These observations imply through national/international regulatory surveillance of anti- that LAB originating from poultry can be regarded as potential microbial use among food animals to limit the spread of AR. candidates as reservoirs, and play a decisive role in the dis- semination of AR in the food chain. Acknowledgments The authors wish to thank Prof. Ram In addition to the above observations, our in vivo conjuga- Rajasekharan, Director, CSIR- CFTRI, Mysore for providing the neces- sary facilities to carry out the work. The authors also acknowledge Indian tion results revealed the type of functional resistance determi- Council of Medical Research (ICMR), New Delhi for funding. nants transferred among bacteria. Among the transconjugants verified for ER transfer, most of the transconjugants were Compliance with ethical standards positive for erm(B) and negative for the msr(C) gene. These results imply that msr(C) is associated either with the chromo- Conflict of interest The authors declare no conflicts of interest. some or with high molecular weight plasmids, as was also evidenced in our previous studies (Thumu and Halami 2014). These results, along with the real-time PCR data, re- R References vealed that the high level ER among poultry LAB isolates is from msr(C) genes. Hence, any instance of msr(C) transfer to Ammor MS, Flórez AB, Van Hoek AHAM, de los Reyes-Gavilán CG, pathogens would have major medical consequences. Similar Aarts HJM, Margolles A (2008) Molecular characterization of in- to ER, the TC gene tet(M) was found to confer higher resis- trinsic and acquired antibiotic resistance in lactic acid bacteria and tance, as the transconjugants that acquired only tet(L) showed bifidobacteria. J Mol Microbiol Biotechnol 14:6–15 404 Ann Microbiol (2017) 67:395–404 Aquilanti L, Silvestri G, Zannini A, Osimani A, Santarelli S, Clementi F Mora D, Fortina MG, Parini C, Daffonchio D, Manachini PL (2000) (2007) Phenotypic, genotypic and technological characterization of Genomic sub-populations within the species Pediococcus predominant lactic acid bacteria in pecorino cheese from central acidilactici detected by multi locus typing analysis: relationships Italy. J Appl Microbiol 103:948–960 between pediocin AcH/PA-1 producing and nonproducing strains. Camu N, De Winter T, Verbrugghe K, Cleenwerck I, Vandamme P, Microbiol 146:2027–2038 Takrama JF, Vancanneyt M, De Vuyst L (2007) Dynamics and bio- Novotna G, Hill C, Vincent K, Liu C, Hong H (2012) A novel membrane diversity of populations of lactic acid bacteria and acetic acid bacte- protein vanJ conferring resistance to teicoplanin. Antimicrob Agents ria involved in spontaneous heap fermentation of cocoa beans in Chemother 56:1784–1796 Ghana. Appl Environ Microbiol 73:1809–1824 Reynolds E, Cove JH (2005) Enhanced resistance to erythromycin is Clinical and Laboratory Standards Institute (2007) Performance standards conferred by the enterococcal msrCdeterminant in Staphylococcus for antimicrobial susceptibility testing; Seventeenth information aureus. J Antimicrob Chemother 55:260–264 supplement, CLSI document M100-S17, Clinical and Laboratory Sapkota AR, Hulet RM, Zhang G, McDermott P, Kinney EL, Schwab KJ, Standards Institute, Wayne, PA Joseph SW (2011) Lower prevalence of antibiotic-resistant entero- Cochetti I, Tili E, Vecchi M, Manzin A, Mingoia M, Varaldo PE, cocci on US conventional poultry farms that transitioned to organic Montanari MP (2007) New Tn916-related elements causing practices. Environ Health Perspect 119:1622–1628 erm(B)-mediated erythromycin resistance in tetracycline- Schjørring S, Krogfelt KA (2010) Assessment of bacterial antibiotic re- susceptible pneumococci. J Antimicrob Chemother 60:127–131 sistance transfer in the gut. Int J Microbiol 20:1–10 Dahl KH, Mater DD, Flores MJ, Johnsen PJ, Midtvedt T, Corthier G, Shryock TR, Richwine A (2010) The interface between veterinary and Sundsfjord A (2007) Transfer of plasmid and chromosomal glyco- human antibiotic use. Ann N Y Acad Sci 1213:92–105 peptide resistance determinants occurs more readily in the digestive Sullivan A, Edlund C, Nord CE (2001) Effect of antimicrobial agents on tract of mice than in vitro and exconjugants can persist stably in vivo the ecological balance of human microflora. Lancet Infect Dis 1: in the absence of glycopeptide selection. J Antimicrob Chemother 101–114 59:478–486 Thumu SCR, Halami PM (2012) Presence of erythromycin and tetracy- Dutka-Malen S, Evers S, Courvalin P (1995) Detection of glycopeptide cline resistance genes in lactic acid bacteria from fermented foods of resistance genotypes and identification to the species level of clini- Indian origin. Antonie van Leeuwenhoek 102:541–551 cally relevant enterococci by PCR. J Clin Microbiol 33:24–27 Thumu SCR, Halami PM (2014) Phenotypic expression and molecular European Food Safety Authority (2012) Guidance on the assessment of characterization of erythromycin resistance in Enterococcus spp iso- bacterial susceptibility to antimicrobials of human and veterinary lated from naturally fermented food. J Appl Microbiol 116:689–699 importance. EFSA J 10(6):2740 Van Boeckel TP, Brower C, Gilbert M, Grenfell BT, Levin SA, Robinson Feld L, Schjørring S, Hammer K, Licht TR, Danielsen M, Krogfelt K, TP, Teillant A, Laxminarayan R (2015) Global trends in antimicro- Wilcks A (2008) Selective pressure affects transfer and establish- bial use in food animals. Proc Natl Acad Sci USA 112:5649–5654 ment of a Lactobacillus plantarum resistance plasmid in the gastro- intestinal environment. J Antimicrob Chemother 61:845–852 van den Bogaard AE, London N, Driessen C, Stobberingh EE (2001) Fraqueza MJ (2015) Antibiotic resistance of lactic acid bacteria isolated Antibiotic resistance of faecal Escherichia coli in poultry poultry from dry-fermented sausages. Int J Food Microbiol 212:76–88 farmers and poultry slaughterers. J Antimicrob Chemother 47: Gevers D, Huys G, Swings J (2003) In vitro conjugal transfer of tetracy- 763–771 cline resistance from Lactobacillus isolates to other gram-positive van den Bogaard AE, Willems R, London N, Top J, Stobberingh EE bacteria. FEMS Microbiol Lett 225:125–130 (2001) Antibiotic resistance of faecal Enterococci in poultry, poultry Gudeta DD, Moodley A, Bortolaia V, Guardabassi L (2014) vanO a new farmers, and poultry slaughterers. J Antimicrob Chemother 49:497– glycopeptide resistance operon in environmental Rhodococcus equi isolates. Antimicrob Agents Chemother 58:1768–1770 Walther C, Rossano A, Thomann A, Perreten V (2008) Antibiotic resis- Hammes WP, Knauf HJ (1994) Starters in processing of meat products. tance in Lactococcus species from bovine milk: presence of a mu- Meat Sci 36:155–168 tated multidrug transporter mdt(a) gene in susceptible Lactococcus Hayes JR, English LL, Carter PJ, Proescholdt T, Lee KY, Wagner DD, garvieae strains. Vet Microbiol 131:348–357 White DG (2003) Prevalence and antimicrobial resistance of Werner G, Hildebrandt B, Witte W (2001) The newly described msr(C) Enterococcus species isolated from retail meats. Appl Environ gene is not equally distributed among all the isolates of Microbiol 69:7153–7160 Enterococcus faecium. Antimicrob Agents Chemother 45:3672– Hayes JR, English LL, Carr LE, Wagner DD, Joseph SW (2004) Multiple-antibiotic resistance of Enterococcus spp isolated from WHO (2014) Antimicrobial resistance: global report on surveillance. commercial poultry production environments. Appl Environ World Health Organization, Geneva, Switzerland 978 92 4 156474 Microbiol 70:6005–6011 8, p 232 Holt JG, Kreig NR, Sneath PHA, Stanley JT, Williams ST (1994) Witte W (2000) Selective pressure by antibiotic use in livestock. Int J Bergey’s manual of determinative bacteriology. Williams and Antimicrob Agents 16:19–24 Wilkins, Baltimore, pp 559–564 Xu X, Lin D, Yan G, Ye X, Wu S, Guo Y, Zhu D, Hu F, Zhang Y, Wang F, Jacobsen L, Wilcks A, Hammer K, Huys G, Gevers D, Andersen SR Jacoby GA, Wang M (2010) vanM a new glycopeptide resistance (2007) Horizontal gene transfer of tet(M) and erm(B) resistant plas- gene cluster found in Enterococcus faecium. Antimicrob Agents mids from food strains of Lactobacillus plantarum to Enterococcus Chemother 54:4643–4647 faecalis JH2-2 in the gastrointestinal tract of gnobiotic rats. FEMS Zhou N, Zhang JX, Fan MT, Wang J, Guo G, Wei XY (2012) Antibiotic Microbiol Ecol 59:158–166 resistance of lactic acid bacteria isolated from Chinese yogurts. J Jensen LB, Frimodt-Moller N, Aarestrup FM (1999) Presence of erm Dairy Sci 95:4775–4783 gene classes in gram-positive bacteria of animal and human origin in Denmark. FEMS Microbiol Lett 170:151–158

Journal

Annals of Microbiology – Springer Journals

Published: May 19, 2017

There are no references for this article.