Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Non-pathogenic Staphylococcus strains augmented the maize growth through oxidative stress management and nutrient supply under induced salt stress

Non-pathogenic Staphylococcus strains augmented the maize growth through oxidative stress... Purpose The present study was conducted to elucidate the role of phytobeneficial bacteria to control the cellular oxidative damage in maize (Zea mays L.) plants caused by salinity. Methods Bacteria were isolated from the rhizosphere of kallar grass (Leptochloa fusca L.) through serial dilution method and taxonomically identified on the basis of their 16S ribosomal RNA gene sequencing. In vitro phosphate solubilization, indole-3- acetic acid (IAA) synthesis, and 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase activity were evaluated by solubili- zation index measurement, colorimetric method, and turbidity assay, respectively. In the pot experiment, the impact of single and mixed inoculation of these strains at four levels (0, 50, 100, and 200 mM) of salt stress was evaluated in terms of growth and physiological response of maize plants to salinity. Results The bacterial strains (STN-1, STN-5, and STN-14) were taxonomically classified as Staphylococcus spp. At 5% NaCl level, the strains demonstrated substantial potential for phosphate solubilization, ACC deaminase activity, and IAA production both with and without tryptophan. The inoculation of strains STN-1, STN-5, and mixed inoculation resulted in substantial growth improvement of maize plants along with increased antioxidant enzyme activity and decreased levels of reactive oxygen species. In addition, single inoculation of STN-1 and STN-5 along with mixed inoculation augmented the uptake of N, P, K, and Ca and reduced Na uptake. Conclusion Current results demonstrated that the strains STN-1 and STN-5 modulated stress-responsive mechanisms and reg- ulated ion balance in induced salinity to promote maize growth. . . . . . Keywords Antioxidants Indole-3-acetic acid Maize Phosphate solubilization Phytobeneficial bacteria Salinity tolerance Introduction Electronic supplementary material The online version of this article Salinity is a worldwide issue with devastating impacts (https://doi.org/10.1007/s13213-019-01464-9) contains supplementary on soil health and crop production (Shahbaz and Ashraf material, which is available to authorized users. 2013). In Pakistan, a huge area of arable land (6.5 mil- lion ha) is saline and this situation is becoming more * Muhammad Shahid mshahid@gcuf.edu.pk alarming with the diminishing water resources. Moreover, Pakistan is located in the ecological zone where rates of evapotranspiration are high causing the Department of Bioinformatics and Biotechnology, Government College University, Faisalabad 38000, Pakistan salinity problem (Zafar et al. 2016). Salinity causes ion toxicity in plants due to the increased concentration of Department of Botany, Government College University, + − Faisalabad 38000, Pakistan Na and Cl in the root zone. Under such conditions, plants are subjected to cellular oxidative stress which is Department of Environmental Sciences, COMSATS University, Vehari Campus, Vehari, Pakistan harmful for its survival and sustainability (Mayak et al. 2004). Such stressful conditions initiate the cellular ion Department of Environmental Sciences, COMSATS University Islamabad, Abbottabad Campus, Abbottabad, Pakistan imbalance and synthesis of harmful molecules in plants 728 Ann Microbiol (2019) 69:727–739 (Cheng et al. 2012). Under abiotic stress, the ethylene cultivated extensively all over the world (Akram et al. concentration is strictly regulated by rhizospheric bacte- 2016). It is rich in nutrition and a source of food for ria in most plants to facilitate their growth (Panda et al. humans, feed for animals, and raw material for industri- 2009; Shrivastava and Kumar 2015). al purposes. Plant growth-promoting rhizobacteria (PGPR) exist in Based on the literature review, it was hypothesized the root zone and are assets for plants growing under that salt-tolerant bacteria have physiological implications unfavorable conditions. The plants are benefited by in terms of relieving plants from oxidative damage and PGPR in terms of nutrient acquisition from soil, produc- supporting plant growth by nutrient uptake. The current tion of growth hormone and control of many pathogens research was, therefore, planned to assess the capability (Babalola 2010; Heydarian et al. 2016). Both direct and of three salt-tolerant PGPR strains, isolated from kallar indirect mechanisms are involved in PGPR-mediated grass, to sustain maize growth by oxidative damage re- nourishmentofplants (Compantetal. 2005). Fixation pair and ion regulation under induced saline conditions. of atmospheric nitrogen, solubilization of inorganic The elucidation of the underlying mechanisms responsi- phosphates, and production of phytohormones are the ble for PGPR-mediated alterations in plant growth under direct mechanisms. On the other hand, many plant path- salt stress was also in scope of the current work. ogens are indirectly controlled by PGPR by antibiosis and hydrolytic enzymes (Dobbelaere et al. 2003;Kumar et al. 2015). Under normal and stressed conditions, sev- Materials and methods eral documentary evidences confirm the better physio- logical and growth responses of diverse plant species to Isolation of bacteria and soil analysis phytobeneficial bacteria (Kashyap et al. 2017;Meena et al. 2017) The samples from Kallar grass (Leptochloa fusca (L.) Kunth) The PGPR inoculation either on seeds or plants helps rhizospheres were collected from agricultural fields near to ameliorate the salinity stress consequences due to the Dalowal Sammundri road (31.3032° N, 73.0265° E), district activation of several signaling pathways (Shukla et al. Faisalabad, Punjab, Pakistan at maturity stage. The roots with 2012). Salt-tolerant PGPR strains support the growth of adhering soil were cut with a sterilized knife and weighed plants by mitigating the cell oxidative damage and in- (1 g) with electronic balance for isolation of salt-tolerant bac- creasing uptake of nutrient ions (Akram et al. 2016; teria through serial dilution method (Somasegaran and Hoben Shahid et al. 2018). Isolation of some members of ge- 1994). The test tubes containing 9 mL of sterilized saline nus Staphylococcus has been carried out from various solution (0.85% w/v NaCl) were added with 1 g rhizosphere environments and categorized as potential salt-tolerant sample. One milliliter from each tube was transferred to next PGPR with ability to relieve plants from antioxidative tube containing 9 mL saline solution. The mixing of suspen- −4 −6 damage (Roohi et al. 2012). The PGPR also support sion was performed with the help of vortex. The 10 and 10 plant growth under stress conditions by selection and dilutions were poured (100 μL) onto the nutrient agar plates + + 2+ regulation of Na ,K ,andCa ions (Hamdia et al. amended with 5% (w/v) NaCl. These plates were incubated at 2004). Moreover, many halotolerant PGPR species have 28 ± 2 °C for 48 h. The isolates were repeatedly streaked for been isolated from extreme environments and halo- maximum purity. The purified isolates were stored in 20% (v/ phytes including kallar grass in order to harness their v)glycerol at − 80 °C. Out of the total of 21 purified isolates, benefits after inoculation with non-halophytic plants only three isolates (STN-1, STN-5, and STN-14) were select- (Akram et al. 2016; Etesami and Beattie 2018). Kallar ed based on substantial in vitro potential for phosphate solu- grass, being a halophyte, may be a rich source of bilization, IAA potential, and ACC deaminase activity, where- halotolerant PGPR with abiotic stress amelioration po- as the remaining isolates were not included in further experi- tential. Thus, plants inoculated with such salt-tolerant ments. The physico-chemical analysis of sampled soils was PGPR species demonstrated an enhanced osmotic ad- carried out commercially at Ayub Agricultural Research justment and a moderate ethylene level due to the bac- Institute (AARI), Faisalabad, Pakistan. terial synthesis of 1-aminocyclopropane-1-carboxylate (ACC) deaminase (Dimkpa et al. 2009). In several mi- Determination of plant growth-promoting croorganisms, indole-3-acetic acid (IAA) also serves as characteristics of bacterial strains a signaling molecule and helps in abiotic stress toler- ance (Spaepen and Vanderleyden 2011). The restricted Phosphate solubilization nutrition and oxidative damage consequences in saline soil harshly influence the plant biomass including Phosphate solubilization was estimated by measuring the sol- maize, which is the most important cereal crop ubilization index (SI) of halozones formed on Pikovskaya’s Ann Microbiol (2019) 69:727–739 729 agar medium amended with 5% (w/v) NaCl (Pikovskaya using MEGA 7.0 software package as described by Shahid 1948) and containing tricalcium phosphate as inorganic phos- et al. (2017). The clustering constancy of the tree was estimat- phate source. Spot inoculation of Petri plates was accom- ed by bootstrap study of 1000 data sets. The sequence data of plished followed by incubation at 28 ± 2 °C for 7 days. The STN-1, STN-5, and STN-14 were deposited in GenBank un- SI was measured by the following formula. der the accession numbers MH152329, MH152330, and MH152331, respectively. SI ¼ Colony diameter þ Zone diameter=Colony diameter Gelatinase and hemolysis activity 1-Aminocycloproane-1-carboxylic acid deaminase activity Standard procedures described by Harrigan and McCance (1990) and Gerhardt et al. (1981) were used to investigate The ability of the isolates to use ACC (3 μL, 0.5 M) as sole the gelatinase and hemolysis activities, respectively. nitrogen source was determined by measuring the amount of Staphylococcus aureus ATCC 25923 was obtained from α-ketobutyrate produced after the catabolism of ACC in DF Chughtais Lahore Lab, Lahore and was used as positive salt minimal broth amended with 5% (w/v)NaCl. The tubes control. were kept at 28 ± 2 °C for 48 h. The absorbance of inoculated (inoculated with STN-1, STN-5, or STN-14) tubes containing Greenhouse experiment ACC was compared with tubes containing ACC without in- oculation and inoculated tubes without ACC (Penrose and Plant material, soil, and experimental design Glick 2003). Standard curve of α-ketobutyrate ranging be- tween 0.1 and 1.0 μM was drawn to calculate α- The clay loam soil with known physico-chemical prop- ketobutyrate produced by the isolates. Bradford method erties (Shahid et al. 2018) was used to fill the pots. The (Bradford 1976) was employed to calculate the protein con- surface sterilization of maize seeds (cv. FH-992) was centration in cell extracts. carried out by rinsing with sodium hypochlorite (5% w/v) for 10 min and five subsequent washings were Auxin synthesis given with ddH O. The inoculums were prepared by growing the strains STN-1, STN-5, and STN-14 up to 9 − 1 Auxin production of the isolates was estimated by the method 10 CFU mL and diluting the inoculum at 7 −1 described by Gordon and Weber (1951). The cultures were 10 CFU mL with ddH O. The soil was either mixed grown in salt-amended (5% w/v) LB-broth medium supple- with inoculum of STN-1, STN-5, STN-14, and mixed −1 mented with tryptophan (100 mg L ). The isolates were cul- inoculum of these three strains at the rate of 7 mL −1 tured by shaking (150 rpm) at 28 ± 2 °C for 48 h followed by 100 g soil (inoculated soil) or with the same amount harvesting at 13,000g to collect the supernatant. One part of of ddH O (non-inoculated soil). Moreover, the seeds supernatant was mixed in two parts of Salkowisk’s reagent were either dipped in the inoculum or in ddH Ofor (2% 0.5 FeCl in 35% HClO solution) in test tubes. The pink 3 4 20 min. Both inoculated and non-inoculated seeds were color, developed after the incubation for 30 min in the dark, sown in respective pots (five seeds per pot and 700 g was quantified by spectrophotometer. The IAA standards soil in each pot). After the seedling development, the were run on spectrophotometer and standard curve was ob- plants were thinned to three in each pot. Hoagland so- tained to compare the results. lution was applied as nutrition source for plants (Arnon and Hoagland 1940). The four NaCl levels, i.e., 0, 50, Taxonomic identification 100, and 200 mM, were applied (7 mL per 100 g soil) with Hoagland solution twice; firstly, after seedling Genomic DNA of the isolates STN-1, STN-5, and STN-14 emergence, and secondly, after 15 days of planting. was isolated by the CTAB method (Maniatis et al. 1982)and The whole experiment was conducted in greenhouse measured by the Nano Drop™ 2000/2000c (Thermo Fisher (with day/night temperature 25:20 °C, light/dark periods Scientific, Waltham, MA, USA). The DNA was used as a 16:8 h) under completely randomized design (CRD) template to amplify the 16S rRNA gene using primer set with three replications for a period of 1 month. fD1 (5′ AGAGTTTGATCCTGGCTCAG 3′)and rD1 (5′ AAGGAGGTGATCCAGCC 3′) (Weisburg et al. 1991). The Measurement of growth parameters amplicons were sent to Macrogen, South Korea for sequenc- ing though Sanger method. The taxonomic identity of the The plants were carefully uprooted and length (cm) of strains was confirmed by BLASTn analysis and by construct- root and shoot were measured with the help of a scale ing the neighbor-joining phylogenetic tree with type strains followed by the determination of fresh weight (g) on 730 Ann Microbiol (2019) 69:727–739 electronic balance. The root and shoot samples were Ionic concentration in plant dry matter kept at 80 °C for 48 h in an oven for the measurement of dry weight. Oven-dried plant samples were ground and 0.5 g of the sam- ples were digested with a mixture HNO /HClO /H SO 3 4 2 4 (8:1:1, v/v) at 150 °C for 45 min, mixed with 2 M HCl, and Measurement of physiological parameters filtered with filter paper (Whatman no. 41). After the filtration, distilled water was added to make the volume 100 mL. The + + +2 Lipid peroxidation and proline content ionic contents of Na ,K ,andCa were determined in the digested samples on an atomic absorption spectrophotometer The fresh shoots were sampled for the measurement of lipid (Hitachi Model 7JO-8024, Tokyo, Japan) (Ryan et al. 2007). peroxidation products by thiobarbituric acid (TBA) reaction (Heath and Packer 1968) and proline content by Bates et al. Statistical analyses (1973). The shoot material was subjected to homogenization, centrifugation, and incubation steps as described by the above The data were analyzed by two-way analysis of variance using methods. Lipid peroxidation was estimated at 532 nm and Statistix (version 8.1) software package (Steel et al. 1997). proline content at 520 nm by UV–VIS spectrophotometer The means, composed of three replications, were compared (Hitachi U-2910, Tokyo, Japan). using least significance difference (Fisher’s LSD) at 95% con- fidence level. H O content and total phenolic contents 2 2 Results A method described by Jana and Choudhuri (1982)was employed to measure the plant H O content, while total phe- 2 2 Soil analysis nolic contents were measured by the method described by Julkunen-Tiitto (1985). The centrifugation and incubations Both the bulk soils and kallar grass rhizosphere soil were steps with homogenized samples were performed according found to be sandy loam. The soil samples were high in terms to the above mentioned methods. Colorimetric measurements of EC and pH, but low in organic matter contents. Both soils of H O and phenolic contents were made at 410 nm and 2 2 were poor in nutritional status and found deficient in total N 750 nm, respectively, by using a spectrophotometer unit men- and available P and K (Table 1). tioned in the above section. Physiological characterization and molecular identification Catalase activity and peroxidase activity The strains STN-1, STN-5, and STN-14 were taxonomi- Catalase (CAT) and peroxidase (POD) activities were mea- cally identified as Staphylococcus spp. on the basis of sured by method described by Aebi (1984) and Chance and BLASTn and phylogenetic analysis of their 16S rRNA Maehly (1955), respectively. Homogenization of fresh shoot gene sequence analysis (Table 2,Fig. 1). In the phyloge- samples was made in phosphate buffer (50 mM; pH 7.8) netic tree, strains STN-5 and STN-14 placed themselves followed by spinning at 10,000g for 10 min and absorbance in a separate clade, while strain STN-1 clustered itself was measured by using a spectrophotometer unit mentioned in with Staphylococcus sciuri subsp. sciuri strain DSM the above section at 240 nm for catalase and 470 nm for peroxidase. Table 1 Physico-chemical analysis of sampled soil Soil properties Bulk soil Rhizospheric soil Determination of nutrient elements Textural class Sandy loam Sandy loam −1 For elemental analysis, plants were washed in ddH Otwice, 2 EC (dS m ) 6.98 7.11 dipped in 20 mM EDTA for 3 s, and washed again. The sam- pH 8.1 7.7 ples were oven dried for 24 h at 105 °C followed by digestion Organic matter (%) 1.47 1.91 −1 using wet digestion method in HNO /HClO (7:3 v/v). The 3 4 Organic C (g kg ) 3.4 4.39 −1 clear samples were mixed with distilled water up to 50 mL Total N (g kg ) 0.38 0.55 −1 followed by elemental analysis using an atomic absorption Available P (mg kg ) 3.4 4.5 −1 spectrophotometer (Hitachi Model 7JO-8024, Tokyo, Japan) Available K (mg kg ) 201 222 (Wolf 1982). Ann Microbiol (2019) 69:727–739 731 Table 2 Physiological characterization and taxonomic identification of the strains + − Strain Closest GenBank Identity Accession Solubilization IAA Trp IAA Trp α-Ketobutyrate −1 −1 −1 −1 match (%) number index (μgmL ) (μgmL ) (nmol mg protein h ) STN-1 Staphylococcus sp. 99 MH152329 5.34 ± 0.67 20.34 ± 4.11 11.34 ± 3.67 456.72 ± 33.07 STN-5 Staphylococcus sp. 100 MH152330 3.78 ± 0.46 22.78 ± 5.35 9.39 ± 2.63 666.11 ± 43.69 STN-14 Staphylococcus sp. 99 MH152331 2.65 ± 0.47 9.65 ± 3.87 8.27 + 1.98 437.24 ± 31.67 20345 (AJ421446), Staphylococcus sciuri subsp. Staphylococcus strain STN-5 demonstrated highest IAA rodentium (AB233332), and Staphylococcus sciuri subsp. production ability both with and without tryptophan carnaticus strain GTC 1227 (AB233331). The assigned followed by Staphylococcus strain STN-1 (Table 2). The accession numbers after the sequence submission to isolates STN-1, STN-5, and STN-14 produced α- GenBank were MH152329, MH152330, and MH152331, ketobutyrate representing their ACC deaminase activity. respectively. The strains showed substantial potential for The maximum amount of α-ketobutyrate (666.11 ± −1 −1 inorganic phosphate solubilization and highest solubiliza- 43.69 nmol mg protein h ) is produced by isolate −1 tion index was measured in STN-1 (5.34 ± 0.67) followed STN-5 followed by STN-1 (456.72 ± 33.07 nmol mg −1 by STN-5 (3.78 ± 0.46). The IAA synthesis was estimated protein h ) in culture medium. In comparison to positive to be high under tryptophan-amended culture conditions control, the strains STN-1, STN-5, and STN-14 were as compared to non-tryptophan added media. The found negative for gelatinase and hemolysis activities. Fig. 1 Phylogenetic tree of Staphylococcus spp. (STN-1, STN-5, and clustered together in the bootstrap test (1000 replicates) are shown. The STN-14) with the type strains of genus Staphylococcus.The evolutionary distances were computed using the Maximum Composite evolutionary history was inferred using the neighbor-joining method. Likelihood method and are in the units of the number of base substitutions The percentages (≥ 50%) of replicate trees in which the associated taxa per site 732 Ann Microbiol (2019) 69:727–739 Greenhouse experiment respectively) to be statistically at par with control plants. On the other hand, the activity of cellular antioxidant enzymes Effect of inoculation of Staphylococcus strains on maize like catalase (CAT) and peroxidase (POD) was significantly growth boosted with gradual increase in salt concentration. The max- imum CAT and POD activity was measured in plants inocu- A significant (Fisher’sLSD; P ≤ 0.05) increase in root and lated with mixed inoculum, which was 53.76% and 6.38% shoot length was observed after inoculation of maize plants higher as compared to non-inoculated ones at 200 mM NaCl with Staphylococcus strains STN-1, STN-5, and mixed inoc- concentration. Similarly, the CAT and POD activities of plants ulum (Fig. 2). Although the length of plant roots and shoots inoculated with strains STN-1 and STN-5 were found signif- was significantly reduced up to 200 mM of NaCl stress, the icantly higher than non-treated plants (Fig. 3). In addition, a growth-promoting effect of strains STN-1, STN-5, and mixed significant decrease in total phenolic contents was calculated inoculum was evident. The maximum length of root and shoot with increasing salt stress treatment. Among the inoculation was measured in plants inoculated with mixed inoculum, treatments, the plants inoculated with mixed inoculum −1 whereby the root and shoot length of plants inoculated with showed maximum phenolic contents (36.770 mg g FW) mixed inoculum were 62.75% and 40.21% greater than non- followed by plants inoculated with strain STN-1 −1 −1 inoculated ones at maximum salt stress (200 mM), respective- (35.680 mg g FW) and STN-5 (31.773 mg g FW) as −1 ly. Similarly, strains STN-1, STN-5, and mixed inoculation compared to non-treated plants (19.960 mg g FW) at significantly promoted the maize biomass, which was evident 100 mM salt stress. The inoculation effect of strain STN-14 from root and shoot fresh and dry weight data. An increasing was found non-significant in terms of reducing the cellular salt concentration negatively affected the plant biomass, but oxidative damage and boosting the antioxidant enzymes in strains STN-1, STN-5, and mixed inoculation seemed to tol- plants grown under induced salt stress conditions. erate the salt stress followed by a beneficial effect on plant biomass. At 200 mM salt concentration, the mixed inoculation produced maximum plant fresh and dry weights, where the Effect of inoculation of Staphylococcus strains on maize fresh weight was found 81.90% and 33.22% and dry weight nutrient uptake and ion regulation was measured 65.50% and 61.41% higher than the non- inoculated control plants, respectively. Interestingly, It was evident from the data that the inoculation of maize Staphylococcus strain STN-14 failed to exert a positive inoc- plants with Staphylococcus strains STN-1, STN-5, and mixed ulation effect on maize growth in all the growth parameters inoculum significantly enhanced the N and P uptake from soil studied under salt stress conditions. (Fig. 4). At 200 mM salt stress, the maximum N contents were found in plants inoculated with strain STN-5 and mixed inoc- Effect of inoculation of Staphylococcus strains on maize ulum, which were 35.04% and 34.85% high than non-treated physiology control plants, respectively. The P contents were maximum in maize plants inoculated with strain STN-5, which were A significant increase in lipid peroxidation was estimated in 42.13% high than non-inoculated plants at 200 mM salt stress. maize plants with gradual enhancement in salt concentration Strain STN-1 inoculation also significantly promoted the nu- up to 200 mM. It could be easily concluded from the data that trient uptake at all salt concentrations. A 36.00%, 38.29%, and inoculation of Staphylococcus strains STN-1, STN-5, and 45.21% decrease in Na ion contents was estimated in plants mixed inoculum significantly decreased the lipid peroxidation inoculated with strain STN-1, STN-5, and mixed inoculum, in maize plants in order to relieve cells from oxidative dam- respectively, at 200 mM salt concentration. The uptake of K age. At 200 mM salt stress, the lipid peroxidation measured in and Ca ions was significantly promoted as result of the terms of malondialdehyde (MDA) was 62.29%, 42.46%, and inoculation of strain STN-1, STN-5, and mixed inoculum un- 49.29% less in plants inoculated with Staphylococcus strains der induced salinity conditions. Moreover, the uptake of K STN-1, STN-5, and mixed inoculum, respectively. and Ca ions was significantly reduced with increased salin- + +2 Interestingly, there was no gradual increase in H O and pro- ity stress. At 200 mM salt stress, the maximum K and Ca 2 2 line contents of maize plants with increasing salt stress; how- ion uptake was found in plants inoculated with mixed inocu- ever, inoculation of maize plants with strains STN-1, SNT-5, lum, which was 33.19% and 80.36% higher, respectively. + + and mixed inoculum significantly decreased H O and proline Similarly, the K /Na ratio was estimated significantly higher 2 2 contents at all salt concentrations. At maximum salt concen- in mixed inoculum-treated plants followed by plants inoculat- tration (200 mM), the H O contents of STN-1, STN-5, and ed with strains STN-1 and STN-5 at 200 mM salt stress, while 2 2 +2 + mixed culture were found to be 42.43%, 43.86%, and 47.38% Ca /Na ratio was found statistically higher in plants inocu- less than non-inoculated plants, whereas the proline contents lated with strains STN-1, STN-5, and mixed inoculum. Again, −1 were estimated (2.110, 2.077, and 2.060 mg g DW, the inoculation of strain STN-14 failed to trigger nutrient Ann Microbiol (2019) 69:727–739 733 a a b a b b b b c b d c d c e d cd b a c c b d a c a c a a e c b b cd ef b a a a b bc a a a b b a b b ab d b c d Fig. 2 Effect of salt-tolerant Staphylococcus strains on growth parameters of maize under induced salinity stress. The data was analyzed by two-way analysis of variance (Fisher’s LSD; P ≤ 0.05). Different lowercase letters on bars represent the significance among inoculated and non-inoculated treatment means (n = 3) and the letters on horizontal lines corresponds to the significance among induced salinity levels = Non-inoculated plants. = Plants inoculated with Staphylococcus strain STN-1. = Plants inoculated with Staphylococcus strain STN-5. = Plants inoculated with Staphylococcus strain STN-14. = Plants inoculated with mixed inoculum. 734 Ann Microbiol (2019) 69:727–739 ab a a a a b a b b b b c c b cd d d c c c b a a b b cd b ab a ab b b a a a b c b a a b a a c c c c bc a bc c b c c cc c ef b b b b c b b b a a a c c c d a a a c b b b d e c c c Fig. 3 Effect of salt-tolerant Staphylococcus strains on cellular antioxidants and reactive oxygen species under induced salt stress. The data was analyzed by two-way analysis of variance (Fisher’sLSD; P ≤ 0.05). Different lowercase letters on bars represent the significance among inoculated and non- inoculated treatment means (n = 3) and the letters on horizontal lines correspond to the significance among induced salinity levels = Non-inoculated plants. = Plants inoculated with Staphylococcus strain STN-1. = Plants inoculated with Staphylococcus strain STN-5. = Plants inoculated with Staphylococcus strain STN-14. = Plants inoculated with mixed inoculum. Ann Microbiol (2019) 69:727–739 735 uptake and to establish ionic balance in maize plants under evident from the amount of α-ketobutyrate produced in the induced salinity conditions (Fig. 4). culture medium. Bacterial ACC deaminase activity synthesis is a characteristic with utmost importance in stress tolerance induction in plants when bacteria is in association with roots Discussion or aerial parts due to cleavage of ACC into α-ketobutyrate and ammonia in plant cells by the activity of this enzyme (Glick Soil salinity is a major agricultural problem frequently prevail- 2014; Mahmood et al. 2017). Moreover, the IAA is an impor- ing in arid and semiarid soils of Pakistan (Qureshi et al. 2008). tant signaling molecule involved in root cell proliferation and Although salts are required by plants in certain amounts to elongation even in very small concentrations (Glick 2014;Liu maintain normal functions, their high concentration in the soil et al. 2018). When bacteria associate with plant roots, both inhibits plant metabolic functions except in halophytes. bacterially produced IAA and plant IAA trigger the transcrip- Nowadays, salt-tolerant bacteria, especially the PGPR, are tion of ACC synthase followed by synthesis of substantial being extensively investigated as supplements to chemical amounts of ACC. Some of the ACC will ultimately be exuded fertilizers to support plant growth and induce salinity tolerance from the roots and converted to ammonia and α-ketobutyrate (Akram et al. 2016; Shahid et al. 2018). In the present study, before being converted to ethylene in plants. Thus, both IAA three Staphylococcus strains were physiologically character- and ACC deaminase synthesis activities of PGPR are directly ized as phytobeneficial and salt tolerant under in vitro condi- involved in plant growth and stress alleviation (Glick 2014). tions and they promoted maize growth by mitigating cellular Before direct inoculation onto maize plants, pathogenicity oxidative damage and maintaining ion regulation. testing of Staphylococcus strains STN-1, STN-5, and STN14 The Staphylococcus strains were isolated from kallar grass, was investigated and the strains were found non-pathogenic. which is a well-known halophytic plant and wildly found on It has been documented that salt-tolerant PGPR inoculation saline areas (Ola et al. 2012). The taxonomic explanation of in salt-affected soils has ultimately resulted in an increased the three strains was based on 16S rRNA gene analysis, which plant biomass in addition to alleviation of deleterious effects suggested the molecular identity as Staphylococcus of salt stress (Kim et al. 2014; Akram et al. 2016; Shahid et al. (MH152329, MH152330, and MH152331) (Table 2). 2018). Evidences are also available for enhancement of non- Furthermore, the phylogeny of the Staphylococcus strains halotolerant plant growth by the inoculation of PGPR isolated STN-1, STN-5, and STN-14, studied by neighbor-joining from the rhizosphere of halophytes (Etesami and Beattie phylogenetic tree, with the type strains of the same genus also 2018). Results revealed that the inoculation with confirmed the molecular identity. Many Staphylococcus spe- Staphylococcus strains STN-1, STN-5, or mixed inocula sig- cies have been identified as commensal pathogens of animals nificantly increased the maize growth up to 200 mM NaCl concentration. This growth-stimulating effect might be due (Nemeghaire et al. 2014) and plants (Prithiviraj et al. 2005); however, their ecological existance in terms of salt-tolerant to better soil phosphate mobilization, IAA synthesis, and species (Khan et al. 2015; Akram et al. 2016)and ACC deaminase ability of these strains as compared to non- phytobeneficial agents (Yildrim et al. 2008; Akram et al. inoculated plants. Under stress conditions, ACC deaminase 2016) is well reported. Akram et al. (2016) reported the in- becomes vital due to regulation of plant cell ethylene levels. creased growth of maize plants in response to the inoculation The proposed model (Glick 2014) states that IAA stimulates of Staphylococcus sciuri SAT-17 under induced salinity stress. the synthesis of ACC in plant cells, which is secreted by plant Rhizosphere acidosis is necessary to release the bound soil roots and consumed by associated bacteria as nitrogen source. +2 +2 +2 phosphates from cations (Ca ,Al ,andFe ). The in vitro Hence, more secretion of ACC by plant roots leads to less measurement of this soil acidification is directly related to cellular ethylene levels. Moreover, the strain STN-14 failed solubilization of tricalcium phosphate in culture medium. to promote maize growth under saline conditions possibly due Substantial phosphate solubilization ability was measured in to poor colonization and adaptation with semi-natural envi- Staphylococcus strains, which means that the strains might ronment of plant roots after inoculation. The phytohormone have organic acid synthesis ability. The in vitro phosphate IAA is reported to stimulate the formation of root hairs follow- solubilization ability of Staphylococcus strains STN-1, STN- ed by the intense colonization of plant with PGPR strains and 5, and STN-14 was comparable with those reported previous- more access of roots to nutrients and water (Couillerot et al. ly (Akram et al. 2016; Alibrandi et al. 2018). The strains STN- 2011; Shahid et al. 2015). Moreover, decrease in maize length 1, STN-5, and STN-14 exhibited substantial in vitro IAA syn- and biomass with increasing salt stress may be attributed to thesizing capacity both in the presence as well as in the ab- limited water uptake due to the ion osmotic potential, reduced sence of tryptophan (Trp) representing that both Trp- photosynthetic activity, less nutrient uptake, and disturbance dependent and Trp-independent pathways were active in in many other metabolic functions (Kumar et al. 2005). The Staphylococcus strains. In addition, the Staphylococcus strains maximum plant growth-promoting potential of mixed inocu- lation may be attributed to cumulative effect of strains STN-1 were also found to show ACC deaminase activity, which is 736 Ann Microbiol (2019) 69:727–739 a b a b ab a a a ab b a b b d b b a c d a d b bb a c b c c b b c b cd c c d b b b b a c a e c d d e ef c a a b a c c b b a b b d c e c d d bb e c e d e d c c bc d Ann Microbiol (2019) 69:727–739 737 Fig. 4 Effect of salt-tolerant Staphylococcus strains on nutrient uptake Sahoo et al. (2014) reported that the inoculation of rice plants and ion regulation under induced salt stress. The data was analyzed by with Azotobacter vinellandii (SRIAz3) resulted in an increased two-way analysis of variance (Fisher’sLSD; P ≤ 0.05). Different lower- rice biomass. The inoculation of Staphylococcus strains STN- case letters on bars represent the significance among inoculated and non- 1, STN-5, and mixed inoculum increased the total phenolic inoculated treatment means (n = 3) and the letters on horizontal lines corresponds to the significance among induced salinity levels contents in maize plants and this phenomenon might be attrib- = Non-inoculated plants. uted to better utilization of cellar antioxidative repair mecha- = Plants inoculated with Staphylococcus strain STN-1. nisms by plants as compared to non-treated ones (Akram et al. = Plants inoculated with Staphylococcus strain STN-5. 2016). The maximum antioxidant levels in plants treated with = Plants inoculated with Staphylococcus strain STN-14. = Plants inoculated with mixed inoculum. mixed inoculum might be due to the synergistic effect of strains STN-1 and STN-5. It was found that the uptake of N and P in maize showed a and STN-5 (Fig. 2). The modulation of ethylene stress due to decreasing trend with increasing salt stress, probably due to + − production of ACC deaminase by Staphylococcus strains increased Na and Cl ions uptake (Fig. 4). It is well + +2 might also have added to the growth stimulatory effects in established that under salt stress, the uptake of K and Ca + + inoculated maize plants (Glick 2014; Kim et al. 2014). is reduced due to the antagonistic effect of Na and K Shahid et al. (2018) concluded that Planomicrobium sp. (Rahneshan et al. 2018). Increased uptake of N, P, K ,and MSSA-10 with PGPR characteristics promoted the growth Ca as a result of the inoculation with Staphylococcus strains of pea plants under induced salinity stress. Moreover, STN-1, STN-5, and mixed inoculum may be attributed to the Ahmad et al. (2014) reported that the combined application plant growth-promoting and nutrient mobilization potential of of PGPR, biogas slurry, and nitrogen boosted the growth of the strains, root proliferation due to IAA production, and low + + + 2+ + maize. Inoculation with Erwinia persicinus strain RA2 signif- Na uptake. The K /Na and Ca /Na ratios were also found icantly increased biomass of tomato plants under salinity con- comparatively higher in inoculated plants. The enhanced nu- ditions (Cha-Um and Kirdmanee 2009). trient uptake might be due to the better root growth due to In non-treated plants, the MDA and H O content were PGPR inoculation (Shahid et al. 2012). However, the mecha- 2 2 elevated with the increasing levels of salt stress. This was nisms underlying bacterially induced ion regulation and nutri- the indication that the plants cells were in oxidative injury ent translocation from soil to plant shoot are not completely (Nasraoui-Hajaji et al. 2012). This condition not only affects understood. Furthermore, IAA production might have stimu- + +2 cellular metabolic activity but also nutrient and water uptake lated the uptake of K and Ca with subsequent restriction in from soil. The significant decrease in lipid oxidation of mem- the uptake of Na , and this relation between ion regulation and branes and in H O content, and the increase in cellular anti- 2 2 nutrient uptake is presented by Forni et al. (2017). oxidant enzyme content (CAT and POD) in plants inoculated with Staphylococcus strains STN-1, STN-5, and mixed inoc- ulum might be attributed to the complex signaling pathways Conclusion triggered by bacterial inoculation (Fig. 3). It has been already established that PGPR induced stress tolerance in plants by Three strains STN-1, STN-5, and STN-14 were taxonomically triggering the cellular antioxidant levels (Younesi and Moradi identified as Staphylococcus spp. and physiologically charac- 2014; Shahid et al. 2018). Proline is a very important osmolyte terized as salt-tolerant PGPR strains. Inoculation of maize involved in osmoregulation and stabilization of many other plants with Staphylococcus strains STN-1, STN-5, and mixed macromolecules (Curá et al. 2017). In the present study, inoc- inoculum significantly promoted plant growth and alleviated ulated plants showed reduced proline contents, which could maize plants from oxidative damage by decreasing the levels be attributed to the fact that the inoculation of maize plants of reactive oxygen species due to enhanced production of with strains STN-1, STN-5, and mixed inoculum alleviated enzymatic and non-enzymatic antioxidants. It was found that the plants from stress conditions. The synthesis of elevated − salt stress alleviation after the inoculation with STN-1, STN-5, levels of hydrogen peroxide (H O ), superoxide (O ), and/ 2 2 2 − and mixed inoculum was also the result of better nutrient or hydroxyl (OH ) radicals are the direct signals of oxidative acquisition and regulation of ionic balance in plant cells. stress (Waszczak et al. 2018). Conversely, plant antioxidant The study concluded that Staphylococcus strains STN-1 and defense mechanism, composing of enzymatic and non- STN-5 are potent salt-tolerant PGPR, which can be used as enzymatic molecules, ensure the defense against the adverse mixed inoculum to boost maize growth under saline effects of ROS (Sun et al. 2018). Another possible mechanism environment. of salt stress alleviation in plants is the bacterial exopolysaccharides synthesis, which restricts the uptake of Funding This research work was funded by GCUF-RSP research grant Na by roots (Ilangumaran and Smith 2017) and regulate the (project no. 38-B&B-15) entitled BDevelopment of salt-tolerant tissue-specific sodium transporter HKT1 (Zhang et al. 2008). biofertilizer for saline agriculture in Pakistan.^ 738 Ann Microbiol (2019) 69:727–739 increases the tolerance of maize to drought stress. Microorganisms Compliance with ethical standards 5(3):41 Dimkpa C, Weinand T, Asch F (2009) Plant–rhizobacteria interactions Conflict of interest The authors declare that they have no conflict of alleviate abiotic stress conditions. Plant Cell Environ 32(12):1682– interest. Dobbelaere S, Vanderleyden J, Okon Y (2003) Plant growth-promoting Ethical approval This article does not contain any studies with human effects of diazotrophs in the rhizosphere. Crit Rev Plant Sci 22(2): participants or animals performed by any of the authors. 107–149 Etesami H, Beattie GA (2018) Mining halophytes for plant growth- Informed consent Informed consent was obtained from all individual promoting halotolerant bacteria to enhance the salinity tolerance of participants included in the study. non-halophytic crops. Front Microbiol 9:148 Forni C, Duca D, Glick BR (2017) Mechanisms of plant response to salt and drought stress and their alteration by rhizobacteria. Plant Soil 410(1–2):335–356 Gerhardt P, Murray RGE, Costilow RN, Nester EW, Wood WA, Krieg NR, Phillips GB (1981) Manual of methods for general bacteriolo- gy. American Society for Microbiology, Washington, DC ISBN 0- References 914826-30-1 Glick BR (2014) Bacteria with ACC deaminase can promote plant Aebi H (1984) Catalase in vitro. Methods Enzymol Elsevier; p 121–126 growth and help to feed the world. Microbiol Res 169(1):30–39 Ahmad M, Zahir ZA, Jamil M, Nazli F, Latif M, Akhtar M (2014) Gordon SA, Weber RP (1951) Colorimetric estimation of indoleacetic Integrated use of plant growth promoting rhizobacteria, biogas slur- acid. Plant Physiol 26(1):192–195 ry and chemical nitrogen for sustainable production of maize under Hamdia MAE-S, Shaddad M, Doaa MM (2004) Mechanisms of salt salt-affected conditions. Pak J Bot 46(1):375–382 tolerance and interactive effects of Azospirillum brasilense inocula- Akram MS, Shahid M, Tariq M, Azeem M, Javed MT, Saleem S, Riaz S tion on maize cultivars grown under salt stress conditions. Plant (2016) Deciphering Staphylococcus sciuri SAT-17 mediated anti- Growth Regul 44(2):165–174 oxidative defense mechanisms and growth modulations in salt Harrigan WF, McCance ME (1990) Laboratory methods and food and stressed maize (Zea mays L.). Front Microbiol 7:867 dairy microbiology. Academic Press, London Alibrandi P, Cardinale M, Rahman MM, Strati F, Ciná P, de Viana ML, Heath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts: I. Giamminola EM, Gallo G, Schnell S, De Filippo C (2018) The seed Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem endosphere of Anadenanthera colubrina is inhabited by a complex Biophys 125(1):189–198 microbiota, including Methylobacterium spp. and Staphylococcus Heydarian Z, Yu M, Gruber M, Glick BR, Zhou R, Hegedus DD (2016) spp. with potential plant-growth promoting activities. Plant Soil Inoculation of soil with plant growth promoting bacteria producing 422(1–2):81–99 1-aminocyclopropane-1-carboxylate deaminase or expression of the Arnon D, Hoagland D (1940) Crop production in artificial culture solu- corresponding acdS gene in transgenic plants increases salinity tol- tions and in soils with special reference to factors influencing yields erance in Camelina sativa. Front Microbiol 7:1966 and absorption of inorganic nutrients. Soil Sci 50:463–485 Ilangumaran G, Smith DL (2017) Plant growth promoting rhizobacteria Babalola OO (2010) Beneficial bacteria of agricultural importance. in amelioration of salinity stress: a systems biology perspective. Biotechnol Lett 32(11):1559–1570 Front Plant Sci 8:1768 Bates L, Waldren R, Teare I (1973) Rapid determination of free proline Jana S, Choudhuri MA (1982) Glycolate metabolism of three submersed for water-stress studies. Plant Soil 39(1):205–207 aquatic angiosperms during ageing. Aquat Bot 12:345–354 Bradford MM (1976) A rapid and sensative method for the quantitation of Julkunen-Tiitto R (1985) Phenolic constituents in the leaves of northern microgram quantities of protein utilizing the principle of protein– willows: methods for the analysis of certain phenolics. J Agric Food dye binding. Ann Biochem 72:248–254 Chem 33(2):213–217 Cha-Um S, Kirdmanee C (2009) Effect of salt stress on proline accumu- Kashyap AS, Pandey VK, Manzar N, Kannojia P, Singh UB, Sharma P lation, photosynthetic ability and growth characters in two maize (2017) Role of plant growth-promoting rhizobacteria for improving cultivars. Pak J Bot 41(1):87–98 crop productivity in sustainable agriculture. Plant-Microbe Chance B, Maehly A (1955) Assay of catalases and peroxidases. Methods Interactions in Agro-Ecological Perspectives Springer; pp 673–693 Enzymol 2:764–775 Khan MU, Sessitsch A, Harris M, Fatima K, Imran A, Arslan M, Shabir Cheng Z, Woody OZ, McConkey BJ, Glick BR (2012) Combined effects G, Khan QM, Afzal M (2015) Cr-resistant rhizo- and endophytic of the plant growth-promoting bacterium Pseudomonas putida bacteria associated with Prosopis juliflora and their potential as UW4 and salinity stress on the Brassica napus proteome. Appl phytoremediation enhancing agents in metal-degraded soils. Front Soil Ecol 61:255–263 Plant Sci 5:755 Compant S, Duffy B, Nowak J, Clément C, Barka EA (2005) Use of plant Kim K, Jang Y-J, Lee S-M, Oh B-T, Chae J-C, Lee K-J (2014) Alleviation growth-promoting bacteria for biocontrol of plant diseases: princi- of salt stress by Enterobacter sp. EJ01 in tomato and Arabidopsis is ples, mechanisms of action, and future prospects. Appl Environ accompanied by up-regulation of conserved salinity responsive fac- Microbiol 71(9):4951–4959 tors in plants. Mol Cell 37(2):109 Kumar A, Bahadur I, Maurya B, Raghuwanshi R, Meena V, Singh D, Couillerot O, Combes-Meynet E, Pothier JF, Bellvert F, Challita E, Dixit J (2015) Does a plant growth promoting rhizobacteria enhance Poirier M-A, Rohr R, Comte G, Moënne-Loccoz Y, Prigent- agricultural sustainability. J Pure Appl Microbiol 9(1):715–724 Combaret C (2011) The role of the antimicrobial compound 2, 4- diacetylphloroglucinol in the impact of biocontrol Pseudomonas Kumar R, Goyal V, Kuhad M (2005) Influence of fertility–salinity inter- fluorescens F113 on Azospirillum brasilense phytostimulators. actions on growth, water status and yield of Indian mustard Microbiol 157(6):1694–1705 (Brassica juncea). Indian J Plant Physiol 10(2):139 Curá JA, Franz DR, Filosofía JE, Balestrasse KB, Burgueño LE (2017) Liu M, Chen Y, Chen Y, Shin JH, Mila I, Audran C, Zouine M, Pirrello J, Inoculation with Azospirillum sp. and Herbaspirillum sp. bacteria Bouzayen M (2018) The tomato ethylene response factor Sl-ERF. Ann Microbiol (2019) 69:727–739 739 B3 integrates ethylene and auxin signaling via direct regulation of strain Planomicrobium sp. MSSA-10 triggered oxidative stress re- sponsive mechanisms and regulated the growth of pea plants under Sl-aux/IAA 27. New Phytol 9(2):631–640 Mahmood F, Shahid M, Hussain S, Shahzad T, Tahir M, Ijaz M, Hussain induced saline environment. J Appl Microbiol 124(6):1566–1579 A, Mahmood K, Imran M, Babar SAK (2017) Potential plant Shahid M, Hameed S, Imran A, Ali S, van Elsas JD (2012) Root coloni- growth-promoting strain Bacillus sp. SR-2-1/1 decolorized azo dyes zation and growth promotion of sunflower (Helianthus annuus L.) through NADH-ubiquinone: oxidoreductase activity. Bioresour by phosphate solubilizing Enterobacter sp. Fs-11. World J Technol 235:176–184 Microbiol Biotechnol 28(8):2749–2758 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a labora- Shahid M, Hameed S, Tariq M, Zafar M, Ali A, Ahmad N (2015) tory manual, vol 545. Cold Spring Harbor Laboratory, Cold Spring Characterization of mineral phosphate-solubilizing bacteria for en- Harbor, NY hanced sunflower growth and yield-attributing traits. Ann Microbiol Mayak S, Tirosh T, Glick BR (2004) Plant growth-promoting bacteria 65(3):1525–1536 confer resistance in tomato plants to salt stress. Plant Physiol Shahid M, Hussain B, Riaz D, Khurshid M, Ismail M, Tariq M (2017) Biochem 42(6):565–572 Identification and partial characterization of potential probiotic lactic Meena VS, Meena SK, Verma JP, Kumar A, Aeron A, Mishra PK, Bisht acid bacteria in freshwater Labeo rohita and Cirrhinus mrigala. JK, Pattanayak A, Naveed M, Dotaniya M (2017) Plant beneficial Aquac Res 48(4):1688–1698 rhizospheric microorganism (PBRM) strategies to improve nutrients Shrivastava P, Kumar R (2015) Soil salinity: a serious environmental use efficiency: a review. Ecol Eng 107:8–32 issue and plant growth promoting bacteria as one of the tools for Nasraoui-Hajaji A, Gouia H, Carrayol E, Haouari-Chaffei C (2012) its alleviation. Saudi J Biol Sci 22(2):123–131 Ammonium alleviates redox state in Solanum seedlings under cad- Shukla PS, Agarwal PK, Jha B (2012) Improved salinity tolerance of mium stress conditions. J Environ Anal Toxicol 2:116–120 Arachis hypogaea (L.) by the interaction of halotolerant plant- Nemeghaire S, Argudín MA, Feßler AT, Hauschild T, Schwarz S, Butaye growth-promoting rhizobacteria. J Plant Growth Regul 31(2):195– P (2014) The ecological importance of the Staphylococcus sciuri species group as a reservoir for resistance and virulence genes. Vet Somasegaran P, Hoben HJ (1994) Handbook for rhizobia: methods in Microbiol 171(3–4):342–356 legume-rhizobium technology. Springer Science & Business Media Ola HAE, Reham EF, Eisa S, Habib S (2012) Morpho-anatomical chang- Spaepen S, Vanderleyden J (2011) Auxin and plant–microbe interactions. es in salt stressed kallar grass (Leptochloa fusca L. Kunth). Res J Cold Spring Harb Perspect Biol 3(4):a001438 Agric Biol Sci 8(2):158–166 Steel R, Torrie J, Dickey DA (1997) Principles and procedures of statis- Panda SK, Baluška F, Matsumoto H (2009) Aluminum stress signaling in tics: a biometrical approach. McGraw-Hill plants. Plant Signal Behav 4(7):592–597 Sun H, Mu B, Song Z, Ma Z, Mu T (2018) The in vitro antioxidant Penrose DM, Glick BR (2003) Methods for isolating and characterizing activity and inhibition of intracellular reactive oxygen species of ACC deaminase-containing plant growth-promoting rhizobacteria. sweet potato leaf polyphenols. Oxidative Med Cell Longev 2018:11 Physiol Plant 118:10–15 Waszczak C, Carmody M, Kangasjärvi J (2018) Reactive oxygen species Pikovskaya R (1948) Mobilization of phosphorus in soil in connection in plant signaling. Annu Rev Plant Biol 69:209–236 with vital activity of some microbial species. Mikrobiologiya 17: Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal 362–370 DNA amplification for phylogenetic study. J Bacteriol 173(2):697– Prithiviraj B, Bais HP, Jha AK, Vivanco JM (2005) Staphylococcus aureus pathogenicity on Arabidopsis thaliana is mediated either Wolf B (1982) A comprehensive system of leaf analyses and its use for by a direct effect of salicylic acid on the pathogen or by SA-depen- diagnosing crop nutrient status. Commun Soil Sci Plant Anal 13: dent, NPR1-independent host responses. Plant J 42(3):417–432 1035–1059. https://doi.org/10.1080/00103628209367332 Qureshi AS, McCornick PG, Qadir M, Aslam Z (2008) Managing salinity Yildrim E, Donmez MF, Turan M (2008) Use of bioinoculants in ame- and waterlogging in the Indus Basin of Pakistan. Agric Water liorative effects on radish plants under salinity stress. J Plant Nutr Manag 95(1):1–10 31(12):2059–2074 Rahneshan Z, Nasibi F, Moghadam AA (2018) Effects of salinity stress Younesi O, Moradi A (2014) Effects of plant growth-promoting on some growth, physiological, biochemical parameters and nutri- rhizobacterium (PGPR) and arbuscular mycorrhizal fungus (AMF) ents in two pistachio (Pistacia vera L.) rootstocks. J Plant Interact on antioxidant enzyme activities in salt-stressed bean (Phaseolus 13(1):73–82 vulgaris L.). Agric 60(1):10–21 Roohi A, Ahmed I, Iqbal M, Jamil M (2012) Preliminary isolation and Zafar S, Ashraf MY, Anwar S, Ali Q, Noman A (2016) Yield enhance- characterization of halotolerant and halophilic bacteria from salt ment in wheat by soil and foliar fertilization of K and Zn under mines of Karak, Pakistan. Pak J Bot 44(SI 1):365–370 saline environment. Soil Environ 35(1):46–55 Ryan J, Estefan G, Rashid, A (2007) Soil and plant analysis laboratory Zhang H, Kim M-S, Sun Y, Dowd SE, Shi H, Paré PW (2008) Soil manual. ICARDA bacteria confer plant salt tolerance by tissue-specific regulation of Sahoo RK, Ansari MW, Pradhan M, Dangar TK, Mohanty S, Tuteja N the sodium transporter HKT1. Mol Plant-Microbe Interact 21(6): (2014) A novel Azotobacter vinellandii (SRI Az 3) functions in 737–744 salinity stress tolerance in rice. Plant Signal Behav 9(7):511–523 Shahbaz M, Ashraf M (2013) Improving salinity tolerance in cereals. Crit Rev Plant Sci 32(4):237–249 Publisher’snote Springer Nature remains neutral with regard to jurisdic- Shahid M, Akram MS, Khan MA, Zubair M, Shah SM, Ismail M, Not tional claims in published maps and institutional affiliations. Shabir G, Basheer S, Aslam K, Tariq M (2018) A phytobeneficial http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

Non-pathogenic Staphylococcus strains augmented the maize growth through oxidative stress management and nutrient supply under induced salt stress

Download PDF
13 pages

Loading next page...
 
/lp/springer-journals/non-pathogenic-staphylococcus-strains-augmented-the-maize-growth-E44aZ3Xuwc

References (63)

Publisher
Springer Journals
Copyright
Copyright © 2019 by Università degli studi di Milano
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Mycology; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/s13213-019-01464-9
Publisher site
See Article on Publisher Site

Abstract

Purpose The present study was conducted to elucidate the role of phytobeneficial bacteria to control the cellular oxidative damage in maize (Zea mays L.) plants caused by salinity. Methods Bacteria were isolated from the rhizosphere of kallar grass (Leptochloa fusca L.) through serial dilution method and taxonomically identified on the basis of their 16S ribosomal RNA gene sequencing. In vitro phosphate solubilization, indole-3- acetic acid (IAA) synthesis, and 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase activity were evaluated by solubili- zation index measurement, colorimetric method, and turbidity assay, respectively. In the pot experiment, the impact of single and mixed inoculation of these strains at four levels (0, 50, 100, and 200 mM) of salt stress was evaluated in terms of growth and physiological response of maize plants to salinity. Results The bacterial strains (STN-1, STN-5, and STN-14) were taxonomically classified as Staphylococcus spp. At 5% NaCl level, the strains demonstrated substantial potential for phosphate solubilization, ACC deaminase activity, and IAA production both with and without tryptophan. The inoculation of strains STN-1, STN-5, and mixed inoculation resulted in substantial growth improvement of maize plants along with increased antioxidant enzyme activity and decreased levels of reactive oxygen species. In addition, single inoculation of STN-1 and STN-5 along with mixed inoculation augmented the uptake of N, P, K, and Ca and reduced Na uptake. Conclusion Current results demonstrated that the strains STN-1 and STN-5 modulated stress-responsive mechanisms and reg- ulated ion balance in induced salinity to promote maize growth. . . . . . Keywords Antioxidants Indole-3-acetic acid Maize Phosphate solubilization Phytobeneficial bacteria Salinity tolerance Introduction Electronic supplementary material The online version of this article Salinity is a worldwide issue with devastating impacts (https://doi.org/10.1007/s13213-019-01464-9) contains supplementary on soil health and crop production (Shahbaz and Ashraf material, which is available to authorized users. 2013). In Pakistan, a huge area of arable land (6.5 mil- lion ha) is saline and this situation is becoming more * Muhammad Shahid mshahid@gcuf.edu.pk alarming with the diminishing water resources. Moreover, Pakistan is located in the ecological zone where rates of evapotranspiration are high causing the Department of Bioinformatics and Biotechnology, Government College University, Faisalabad 38000, Pakistan salinity problem (Zafar et al. 2016). Salinity causes ion toxicity in plants due to the increased concentration of Department of Botany, Government College University, + − Faisalabad 38000, Pakistan Na and Cl in the root zone. Under such conditions, plants are subjected to cellular oxidative stress which is Department of Environmental Sciences, COMSATS University, Vehari Campus, Vehari, Pakistan harmful for its survival and sustainability (Mayak et al. 2004). Such stressful conditions initiate the cellular ion Department of Environmental Sciences, COMSATS University Islamabad, Abbottabad Campus, Abbottabad, Pakistan imbalance and synthesis of harmful molecules in plants 728 Ann Microbiol (2019) 69:727–739 (Cheng et al. 2012). Under abiotic stress, the ethylene cultivated extensively all over the world (Akram et al. concentration is strictly regulated by rhizospheric bacte- 2016). It is rich in nutrition and a source of food for ria in most plants to facilitate their growth (Panda et al. humans, feed for animals, and raw material for industri- 2009; Shrivastava and Kumar 2015). al purposes. Plant growth-promoting rhizobacteria (PGPR) exist in Based on the literature review, it was hypothesized the root zone and are assets for plants growing under that salt-tolerant bacteria have physiological implications unfavorable conditions. The plants are benefited by in terms of relieving plants from oxidative damage and PGPR in terms of nutrient acquisition from soil, produc- supporting plant growth by nutrient uptake. The current tion of growth hormone and control of many pathogens research was, therefore, planned to assess the capability (Babalola 2010; Heydarian et al. 2016). Both direct and of three salt-tolerant PGPR strains, isolated from kallar indirect mechanisms are involved in PGPR-mediated grass, to sustain maize growth by oxidative damage re- nourishmentofplants (Compantetal. 2005). Fixation pair and ion regulation under induced saline conditions. of atmospheric nitrogen, solubilization of inorganic The elucidation of the underlying mechanisms responsi- phosphates, and production of phytohormones are the ble for PGPR-mediated alterations in plant growth under direct mechanisms. On the other hand, many plant path- salt stress was also in scope of the current work. ogens are indirectly controlled by PGPR by antibiosis and hydrolytic enzymes (Dobbelaere et al. 2003;Kumar et al. 2015). Under normal and stressed conditions, sev- Materials and methods eral documentary evidences confirm the better physio- logical and growth responses of diverse plant species to Isolation of bacteria and soil analysis phytobeneficial bacteria (Kashyap et al. 2017;Meena et al. 2017) The samples from Kallar grass (Leptochloa fusca (L.) Kunth) The PGPR inoculation either on seeds or plants helps rhizospheres were collected from agricultural fields near to ameliorate the salinity stress consequences due to the Dalowal Sammundri road (31.3032° N, 73.0265° E), district activation of several signaling pathways (Shukla et al. Faisalabad, Punjab, Pakistan at maturity stage. The roots with 2012). Salt-tolerant PGPR strains support the growth of adhering soil were cut with a sterilized knife and weighed plants by mitigating the cell oxidative damage and in- (1 g) with electronic balance for isolation of salt-tolerant bac- creasing uptake of nutrient ions (Akram et al. 2016; teria through serial dilution method (Somasegaran and Hoben Shahid et al. 2018). Isolation of some members of ge- 1994). The test tubes containing 9 mL of sterilized saline nus Staphylococcus has been carried out from various solution (0.85% w/v NaCl) were added with 1 g rhizosphere environments and categorized as potential salt-tolerant sample. One milliliter from each tube was transferred to next PGPR with ability to relieve plants from antioxidative tube containing 9 mL saline solution. The mixing of suspen- −4 −6 damage (Roohi et al. 2012). The PGPR also support sion was performed with the help of vortex. The 10 and 10 plant growth under stress conditions by selection and dilutions were poured (100 μL) onto the nutrient agar plates + + 2+ regulation of Na ,K ,andCa ions (Hamdia et al. amended with 5% (w/v) NaCl. These plates were incubated at 2004). Moreover, many halotolerant PGPR species have 28 ± 2 °C for 48 h. The isolates were repeatedly streaked for been isolated from extreme environments and halo- maximum purity. The purified isolates were stored in 20% (v/ phytes including kallar grass in order to harness their v)glycerol at − 80 °C. Out of the total of 21 purified isolates, benefits after inoculation with non-halophytic plants only three isolates (STN-1, STN-5, and STN-14) were select- (Akram et al. 2016; Etesami and Beattie 2018). Kallar ed based on substantial in vitro potential for phosphate solu- grass, being a halophyte, may be a rich source of bilization, IAA potential, and ACC deaminase activity, where- halotolerant PGPR with abiotic stress amelioration po- as the remaining isolates were not included in further experi- tential. Thus, plants inoculated with such salt-tolerant ments. The physico-chemical analysis of sampled soils was PGPR species demonstrated an enhanced osmotic ad- carried out commercially at Ayub Agricultural Research justment and a moderate ethylene level due to the bac- Institute (AARI), Faisalabad, Pakistan. terial synthesis of 1-aminocyclopropane-1-carboxylate (ACC) deaminase (Dimkpa et al. 2009). In several mi- Determination of plant growth-promoting croorganisms, indole-3-acetic acid (IAA) also serves as characteristics of bacterial strains a signaling molecule and helps in abiotic stress toler- ance (Spaepen and Vanderleyden 2011). The restricted Phosphate solubilization nutrition and oxidative damage consequences in saline soil harshly influence the plant biomass including Phosphate solubilization was estimated by measuring the sol- maize, which is the most important cereal crop ubilization index (SI) of halozones formed on Pikovskaya’s Ann Microbiol (2019) 69:727–739 729 agar medium amended with 5% (w/v) NaCl (Pikovskaya using MEGA 7.0 software package as described by Shahid 1948) and containing tricalcium phosphate as inorganic phos- et al. (2017). The clustering constancy of the tree was estimat- phate source. Spot inoculation of Petri plates was accom- ed by bootstrap study of 1000 data sets. The sequence data of plished followed by incubation at 28 ± 2 °C for 7 days. The STN-1, STN-5, and STN-14 were deposited in GenBank un- SI was measured by the following formula. der the accession numbers MH152329, MH152330, and MH152331, respectively. SI ¼ Colony diameter þ Zone diameter=Colony diameter Gelatinase and hemolysis activity 1-Aminocycloproane-1-carboxylic acid deaminase activity Standard procedures described by Harrigan and McCance (1990) and Gerhardt et al. (1981) were used to investigate The ability of the isolates to use ACC (3 μL, 0.5 M) as sole the gelatinase and hemolysis activities, respectively. nitrogen source was determined by measuring the amount of Staphylococcus aureus ATCC 25923 was obtained from α-ketobutyrate produced after the catabolism of ACC in DF Chughtais Lahore Lab, Lahore and was used as positive salt minimal broth amended with 5% (w/v)NaCl. The tubes control. were kept at 28 ± 2 °C for 48 h. The absorbance of inoculated (inoculated with STN-1, STN-5, or STN-14) tubes containing Greenhouse experiment ACC was compared with tubes containing ACC without in- oculation and inoculated tubes without ACC (Penrose and Plant material, soil, and experimental design Glick 2003). Standard curve of α-ketobutyrate ranging be- tween 0.1 and 1.0 μM was drawn to calculate α- The clay loam soil with known physico-chemical prop- ketobutyrate produced by the isolates. Bradford method erties (Shahid et al. 2018) was used to fill the pots. The (Bradford 1976) was employed to calculate the protein con- surface sterilization of maize seeds (cv. FH-992) was centration in cell extracts. carried out by rinsing with sodium hypochlorite (5% w/v) for 10 min and five subsequent washings were Auxin synthesis given with ddH O. The inoculums were prepared by growing the strains STN-1, STN-5, and STN-14 up to 9 − 1 Auxin production of the isolates was estimated by the method 10 CFU mL and diluting the inoculum at 7 −1 described by Gordon and Weber (1951). The cultures were 10 CFU mL with ddH O. The soil was either mixed grown in salt-amended (5% w/v) LB-broth medium supple- with inoculum of STN-1, STN-5, STN-14, and mixed −1 mented with tryptophan (100 mg L ). The isolates were cul- inoculum of these three strains at the rate of 7 mL −1 tured by shaking (150 rpm) at 28 ± 2 °C for 48 h followed by 100 g soil (inoculated soil) or with the same amount harvesting at 13,000g to collect the supernatant. One part of of ddH O (non-inoculated soil). Moreover, the seeds supernatant was mixed in two parts of Salkowisk’s reagent were either dipped in the inoculum or in ddH Ofor (2% 0.5 FeCl in 35% HClO solution) in test tubes. The pink 3 4 20 min. Both inoculated and non-inoculated seeds were color, developed after the incubation for 30 min in the dark, sown in respective pots (five seeds per pot and 700 g was quantified by spectrophotometer. The IAA standards soil in each pot). After the seedling development, the were run on spectrophotometer and standard curve was ob- plants were thinned to three in each pot. Hoagland so- tained to compare the results. lution was applied as nutrition source for plants (Arnon and Hoagland 1940). The four NaCl levels, i.e., 0, 50, Taxonomic identification 100, and 200 mM, were applied (7 mL per 100 g soil) with Hoagland solution twice; firstly, after seedling Genomic DNA of the isolates STN-1, STN-5, and STN-14 emergence, and secondly, after 15 days of planting. was isolated by the CTAB method (Maniatis et al. 1982)and The whole experiment was conducted in greenhouse measured by the Nano Drop™ 2000/2000c (Thermo Fisher (with day/night temperature 25:20 °C, light/dark periods Scientific, Waltham, MA, USA). The DNA was used as a 16:8 h) under completely randomized design (CRD) template to amplify the 16S rRNA gene using primer set with three replications for a period of 1 month. fD1 (5′ AGAGTTTGATCCTGGCTCAG 3′)and rD1 (5′ AAGGAGGTGATCCAGCC 3′) (Weisburg et al. 1991). The Measurement of growth parameters amplicons were sent to Macrogen, South Korea for sequenc- ing though Sanger method. The taxonomic identity of the The plants were carefully uprooted and length (cm) of strains was confirmed by BLASTn analysis and by construct- root and shoot were measured with the help of a scale ing the neighbor-joining phylogenetic tree with type strains followed by the determination of fresh weight (g) on 730 Ann Microbiol (2019) 69:727–739 electronic balance. The root and shoot samples were Ionic concentration in plant dry matter kept at 80 °C for 48 h in an oven for the measurement of dry weight. Oven-dried plant samples were ground and 0.5 g of the sam- ples were digested with a mixture HNO /HClO /H SO 3 4 2 4 (8:1:1, v/v) at 150 °C for 45 min, mixed with 2 M HCl, and Measurement of physiological parameters filtered with filter paper (Whatman no. 41). After the filtration, distilled water was added to make the volume 100 mL. The + + +2 Lipid peroxidation and proline content ionic contents of Na ,K ,andCa were determined in the digested samples on an atomic absorption spectrophotometer The fresh shoots were sampled for the measurement of lipid (Hitachi Model 7JO-8024, Tokyo, Japan) (Ryan et al. 2007). peroxidation products by thiobarbituric acid (TBA) reaction (Heath and Packer 1968) and proline content by Bates et al. Statistical analyses (1973). The shoot material was subjected to homogenization, centrifugation, and incubation steps as described by the above The data were analyzed by two-way analysis of variance using methods. Lipid peroxidation was estimated at 532 nm and Statistix (version 8.1) software package (Steel et al. 1997). proline content at 520 nm by UV–VIS spectrophotometer The means, composed of three replications, were compared (Hitachi U-2910, Tokyo, Japan). using least significance difference (Fisher’s LSD) at 95% con- fidence level. H O content and total phenolic contents 2 2 Results A method described by Jana and Choudhuri (1982)was employed to measure the plant H O content, while total phe- 2 2 Soil analysis nolic contents were measured by the method described by Julkunen-Tiitto (1985). The centrifugation and incubations Both the bulk soils and kallar grass rhizosphere soil were steps with homogenized samples were performed according found to be sandy loam. The soil samples were high in terms to the above mentioned methods. Colorimetric measurements of EC and pH, but low in organic matter contents. Both soils of H O and phenolic contents were made at 410 nm and 2 2 were poor in nutritional status and found deficient in total N 750 nm, respectively, by using a spectrophotometer unit men- and available P and K (Table 1). tioned in the above section. Physiological characterization and molecular identification Catalase activity and peroxidase activity The strains STN-1, STN-5, and STN-14 were taxonomi- Catalase (CAT) and peroxidase (POD) activities were mea- cally identified as Staphylococcus spp. on the basis of sured by method described by Aebi (1984) and Chance and BLASTn and phylogenetic analysis of their 16S rRNA Maehly (1955), respectively. Homogenization of fresh shoot gene sequence analysis (Table 2,Fig. 1). In the phyloge- samples was made in phosphate buffer (50 mM; pH 7.8) netic tree, strains STN-5 and STN-14 placed themselves followed by spinning at 10,000g for 10 min and absorbance in a separate clade, while strain STN-1 clustered itself was measured by using a spectrophotometer unit mentioned in with Staphylococcus sciuri subsp. sciuri strain DSM the above section at 240 nm for catalase and 470 nm for peroxidase. Table 1 Physico-chemical analysis of sampled soil Soil properties Bulk soil Rhizospheric soil Determination of nutrient elements Textural class Sandy loam Sandy loam −1 For elemental analysis, plants were washed in ddH Otwice, 2 EC (dS m ) 6.98 7.11 dipped in 20 mM EDTA for 3 s, and washed again. The sam- pH 8.1 7.7 ples were oven dried for 24 h at 105 °C followed by digestion Organic matter (%) 1.47 1.91 −1 using wet digestion method in HNO /HClO (7:3 v/v). The 3 4 Organic C (g kg ) 3.4 4.39 −1 clear samples were mixed with distilled water up to 50 mL Total N (g kg ) 0.38 0.55 −1 followed by elemental analysis using an atomic absorption Available P (mg kg ) 3.4 4.5 −1 spectrophotometer (Hitachi Model 7JO-8024, Tokyo, Japan) Available K (mg kg ) 201 222 (Wolf 1982). Ann Microbiol (2019) 69:727–739 731 Table 2 Physiological characterization and taxonomic identification of the strains + − Strain Closest GenBank Identity Accession Solubilization IAA Trp IAA Trp α-Ketobutyrate −1 −1 −1 −1 match (%) number index (μgmL ) (μgmL ) (nmol mg protein h ) STN-1 Staphylococcus sp. 99 MH152329 5.34 ± 0.67 20.34 ± 4.11 11.34 ± 3.67 456.72 ± 33.07 STN-5 Staphylococcus sp. 100 MH152330 3.78 ± 0.46 22.78 ± 5.35 9.39 ± 2.63 666.11 ± 43.69 STN-14 Staphylococcus sp. 99 MH152331 2.65 ± 0.47 9.65 ± 3.87 8.27 + 1.98 437.24 ± 31.67 20345 (AJ421446), Staphylococcus sciuri subsp. Staphylococcus strain STN-5 demonstrated highest IAA rodentium (AB233332), and Staphylococcus sciuri subsp. production ability both with and without tryptophan carnaticus strain GTC 1227 (AB233331). The assigned followed by Staphylococcus strain STN-1 (Table 2). The accession numbers after the sequence submission to isolates STN-1, STN-5, and STN-14 produced α- GenBank were MH152329, MH152330, and MH152331, ketobutyrate representing their ACC deaminase activity. respectively. The strains showed substantial potential for The maximum amount of α-ketobutyrate (666.11 ± −1 −1 inorganic phosphate solubilization and highest solubiliza- 43.69 nmol mg protein h ) is produced by isolate −1 tion index was measured in STN-1 (5.34 ± 0.67) followed STN-5 followed by STN-1 (456.72 ± 33.07 nmol mg −1 by STN-5 (3.78 ± 0.46). The IAA synthesis was estimated protein h ) in culture medium. In comparison to positive to be high under tryptophan-amended culture conditions control, the strains STN-1, STN-5, and STN-14 were as compared to non-tryptophan added media. The found negative for gelatinase and hemolysis activities. Fig. 1 Phylogenetic tree of Staphylococcus spp. (STN-1, STN-5, and clustered together in the bootstrap test (1000 replicates) are shown. The STN-14) with the type strains of genus Staphylococcus.The evolutionary distances were computed using the Maximum Composite evolutionary history was inferred using the neighbor-joining method. Likelihood method and are in the units of the number of base substitutions The percentages (≥ 50%) of replicate trees in which the associated taxa per site 732 Ann Microbiol (2019) 69:727–739 Greenhouse experiment respectively) to be statistically at par with control plants. On the other hand, the activity of cellular antioxidant enzymes Effect of inoculation of Staphylococcus strains on maize like catalase (CAT) and peroxidase (POD) was significantly growth boosted with gradual increase in salt concentration. The max- imum CAT and POD activity was measured in plants inocu- A significant (Fisher’sLSD; P ≤ 0.05) increase in root and lated with mixed inoculum, which was 53.76% and 6.38% shoot length was observed after inoculation of maize plants higher as compared to non-inoculated ones at 200 mM NaCl with Staphylococcus strains STN-1, STN-5, and mixed inoc- concentration. Similarly, the CAT and POD activities of plants ulum (Fig. 2). Although the length of plant roots and shoots inoculated with strains STN-1 and STN-5 were found signif- was significantly reduced up to 200 mM of NaCl stress, the icantly higher than non-treated plants (Fig. 3). In addition, a growth-promoting effect of strains STN-1, STN-5, and mixed significant decrease in total phenolic contents was calculated inoculum was evident. The maximum length of root and shoot with increasing salt stress treatment. Among the inoculation was measured in plants inoculated with mixed inoculum, treatments, the plants inoculated with mixed inoculum −1 whereby the root and shoot length of plants inoculated with showed maximum phenolic contents (36.770 mg g FW) mixed inoculum were 62.75% and 40.21% greater than non- followed by plants inoculated with strain STN-1 −1 −1 inoculated ones at maximum salt stress (200 mM), respective- (35.680 mg g FW) and STN-5 (31.773 mg g FW) as −1 ly. Similarly, strains STN-1, STN-5, and mixed inoculation compared to non-treated plants (19.960 mg g FW) at significantly promoted the maize biomass, which was evident 100 mM salt stress. The inoculation effect of strain STN-14 from root and shoot fresh and dry weight data. An increasing was found non-significant in terms of reducing the cellular salt concentration negatively affected the plant biomass, but oxidative damage and boosting the antioxidant enzymes in strains STN-1, STN-5, and mixed inoculation seemed to tol- plants grown under induced salt stress conditions. erate the salt stress followed by a beneficial effect on plant biomass. At 200 mM salt concentration, the mixed inoculation produced maximum plant fresh and dry weights, where the Effect of inoculation of Staphylococcus strains on maize fresh weight was found 81.90% and 33.22% and dry weight nutrient uptake and ion regulation was measured 65.50% and 61.41% higher than the non- inoculated control plants, respectively. Interestingly, It was evident from the data that the inoculation of maize Staphylococcus strain STN-14 failed to exert a positive inoc- plants with Staphylococcus strains STN-1, STN-5, and mixed ulation effect on maize growth in all the growth parameters inoculum significantly enhanced the N and P uptake from soil studied under salt stress conditions. (Fig. 4). At 200 mM salt stress, the maximum N contents were found in plants inoculated with strain STN-5 and mixed inoc- Effect of inoculation of Staphylococcus strains on maize ulum, which were 35.04% and 34.85% high than non-treated physiology control plants, respectively. The P contents were maximum in maize plants inoculated with strain STN-5, which were A significant increase in lipid peroxidation was estimated in 42.13% high than non-inoculated plants at 200 mM salt stress. maize plants with gradual enhancement in salt concentration Strain STN-1 inoculation also significantly promoted the nu- up to 200 mM. It could be easily concluded from the data that trient uptake at all salt concentrations. A 36.00%, 38.29%, and inoculation of Staphylococcus strains STN-1, STN-5, and 45.21% decrease in Na ion contents was estimated in plants mixed inoculum significantly decreased the lipid peroxidation inoculated with strain STN-1, STN-5, and mixed inoculum, in maize plants in order to relieve cells from oxidative dam- respectively, at 200 mM salt concentration. The uptake of K age. At 200 mM salt stress, the lipid peroxidation measured in and Ca ions was significantly promoted as result of the terms of malondialdehyde (MDA) was 62.29%, 42.46%, and inoculation of strain STN-1, STN-5, and mixed inoculum un- 49.29% less in plants inoculated with Staphylococcus strains der induced salinity conditions. Moreover, the uptake of K STN-1, STN-5, and mixed inoculum, respectively. and Ca ions was significantly reduced with increased salin- + +2 Interestingly, there was no gradual increase in H O and pro- ity stress. At 200 mM salt stress, the maximum K and Ca 2 2 line contents of maize plants with increasing salt stress; how- ion uptake was found in plants inoculated with mixed inocu- ever, inoculation of maize plants with strains STN-1, SNT-5, lum, which was 33.19% and 80.36% higher, respectively. + + and mixed inoculum significantly decreased H O and proline Similarly, the K /Na ratio was estimated significantly higher 2 2 contents at all salt concentrations. At maximum salt concen- in mixed inoculum-treated plants followed by plants inoculat- tration (200 mM), the H O contents of STN-1, STN-5, and ed with strains STN-1 and STN-5 at 200 mM salt stress, while 2 2 +2 + mixed culture were found to be 42.43%, 43.86%, and 47.38% Ca /Na ratio was found statistically higher in plants inocu- less than non-inoculated plants, whereas the proline contents lated with strains STN-1, STN-5, and mixed inoculum. Again, −1 were estimated (2.110, 2.077, and 2.060 mg g DW, the inoculation of strain STN-14 failed to trigger nutrient Ann Microbiol (2019) 69:727–739 733 a a b a b b b b c b d c d c e d cd b a c c b d a c a c a a e c b b cd ef b a a a b bc a a a b b a b b ab d b c d Fig. 2 Effect of salt-tolerant Staphylococcus strains on growth parameters of maize under induced salinity stress. The data was analyzed by two-way analysis of variance (Fisher’s LSD; P ≤ 0.05). Different lowercase letters on bars represent the significance among inoculated and non-inoculated treatment means (n = 3) and the letters on horizontal lines corresponds to the significance among induced salinity levels = Non-inoculated plants. = Plants inoculated with Staphylococcus strain STN-1. = Plants inoculated with Staphylococcus strain STN-5. = Plants inoculated with Staphylococcus strain STN-14. = Plants inoculated with mixed inoculum. 734 Ann Microbiol (2019) 69:727–739 ab a a a a b a b b b b c c b cd d d c c c b a a b b cd b ab a ab b b a a a b c b a a b a a c c c c bc a bc c b c c cc c ef b b b b c b b b a a a c c c d a a a c b b b d e c c c Fig. 3 Effect of salt-tolerant Staphylococcus strains on cellular antioxidants and reactive oxygen species under induced salt stress. The data was analyzed by two-way analysis of variance (Fisher’sLSD; P ≤ 0.05). Different lowercase letters on bars represent the significance among inoculated and non- inoculated treatment means (n = 3) and the letters on horizontal lines correspond to the significance among induced salinity levels = Non-inoculated plants. = Plants inoculated with Staphylococcus strain STN-1. = Plants inoculated with Staphylococcus strain STN-5. = Plants inoculated with Staphylococcus strain STN-14. = Plants inoculated with mixed inoculum. Ann Microbiol (2019) 69:727–739 735 uptake and to establish ionic balance in maize plants under evident from the amount of α-ketobutyrate produced in the induced salinity conditions (Fig. 4). culture medium. Bacterial ACC deaminase activity synthesis is a characteristic with utmost importance in stress tolerance induction in plants when bacteria is in association with roots Discussion or aerial parts due to cleavage of ACC into α-ketobutyrate and ammonia in plant cells by the activity of this enzyme (Glick Soil salinity is a major agricultural problem frequently prevail- 2014; Mahmood et al. 2017). Moreover, the IAA is an impor- ing in arid and semiarid soils of Pakistan (Qureshi et al. 2008). tant signaling molecule involved in root cell proliferation and Although salts are required by plants in certain amounts to elongation even in very small concentrations (Glick 2014;Liu maintain normal functions, their high concentration in the soil et al. 2018). When bacteria associate with plant roots, both inhibits plant metabolic functions except in halophytes. bacterially produced IAA and plant IAA trigger the transcrip- Nowadays, salt-tolerant bacteria, especially the PGPR, are tion of ACC synthase followed by synthesis of substantial being extensively investigated as supplements to chemical amounts of ACC. Some of the ACC will ultimately be exuded fertilizers to support plant growth and induce salinity tolerance from the roots and converted to ammonia and α-ketobutyrate (Akram et al. 2016; Shahid et al. 2018). In the present study, before being converted to ethylene in plants. Thus, both IAA three Staphylococcus strains were physiologically character- and ACC deaminase synthesis activities of PGPR are directly ized as phytobeneficial and salt tolerant under in vitro condi- involved in plant growth and stress alleviation (Glick 2014). tions and they promoted maize growth by mitigating cellular Before direct inoculation onto maize plants, pathogenicity oxidative damage and maintaining ion regulation. testing of Staphylococcus strains STN-1, STN-5, and STN14 The Staphylococcus strains were isolated from kallar grass, was investigated and the strains were found non-pathogenic. which is a well-known halophytic plant and wildly found on It has been documented that salt-tolerant PGPR inoculation saline areas (Ola et al. 2012). The taxonomic explanation of in salt-affected soils has ultimately resulted in an increased the three strains was based on 16S rRNA gene analysis, which plant biomass in addition to alleviation of deleterious effects suggested the molecular identity as Staphylococcus of salt stress (Kim et al. 2014; Akram et al. 2016; Shahid et al. (MH152329, MH152330, and MH152331) (Table 2). 2018). Evidences are also available for enhancement of non- Furthermore, the phylogeny of the Staphylococcus strains halotolerant plant growth by the inoculation of PGPR isolated STN-1, STN-5, and STN-14, studied by neighbor-joining from the rhizosphere of halophytes (Etesami and Beattie phylogenetic tree, with the type strains of the same genus also 2018). Results revealed that the inoculation with confirmed the molecular identity. Many Staphylococcus spe- Staphylococcus strains STN-1, STN-5, or mixed inocula sig- cies have been identified as commensal pathogens of animals nificantly increased the maize growth up to 200 mM NaCl concentration. This growth-stimulating effect might be due (Nemeghaire et al. 2014) and plants (Prithiviraj et al. 2005); however, their ecological existance in terms of salt-tolerant to better soil phosphate mobilization, IAA synthesis, and species (Khan et al. 2015; Akram et al. 2016)and ACC deaminase ability of these strains as compared to non- phytobeneficial agents (Yildrim et al. 2008; Akram et al. inoculated plants. Under stress conditions, ACC deaminase 2016) is well reported. Akram et al. (2016) reported the in- becomes vital due to regulation of plant cell ethylene levels. creased growth of maize plants in response to the inoculation The proposed model (Glick 2014) states that IAA stimulates of Staphylococcus sciuri SAT-17 under induced salinity stress. the synthesis of ACC in plant cells, which is secreted by plant Rhizosphere acidosis is necessary to release the bound soil roots and consumed by associated bacteria as nitrogen source. +2 +2 +2 phosphates from cations (Ca ,Al ,andFe ). The in vitro Hence, more secretion of ACC by plant roots leads to less measurement of this soil acidification is directly related to cellular ethylene levels. Moreover, the strain STN-14 failed solubilization of tricalcium phosphate in culture medium. to promote maize growth under saline conditions possibly due Substantial phosphate solubilization ability was measured in to poor colonization and adaptation with semi-natural envi- Staphylococcus strains, which means that the strains might ronment of plant roots after inoculation. The phytohormone have organic acid synthesis ability. The in vitro phosphate IAA is reported to stimulate the formation of root hairs follow- solubilization ability of Staphylococcus strains STN-1, STN- ed by the intense colonization of plant with PGPR strains and 5, and STN-14 was comparable with those reported previous- more access of roots to nutrients and water (Couillerot et al. ly (Akram et al. 2016; Alibrandi et al. 2018). The strains STN- 2011; Shahid et al. 2015). Moreover, decrease in maize length 1, STN-5, and STN-14 exhibited substantial in vitro IAA syn- and biomass with increasing salt stress may be attributed to thesizing capacity both in the presence as well as in the ab- limited water uptake due to the ion osmotic potential, reduced sence of tryptophan (Trp) representing that both Trp- photosynthetic activity, less nutrient uptake, and disturbance dependent and Trp-independent pathways were active in in many other metabolic functions (Kumar et al. 2005). The Staphylococcus strains. In addition, the Staphylococcus strains maximum plant growth-promoting potential of mixed inocu- lation may be attributed to cumulative effect of strains STN-1 were also found to show ACC deaminase activity, which is 736 Ann Microbiol (2019) 69:727–739 a b a b ab a a a ab b a b b d b b a c d a d b bb a c b c c b b c b cd c c d b b b b a c a e c d d e ef c a a b a c c b b a b b d c e c d d bb e c e d e d c c bc d Ann Microbiol (2019) 69:727–739 737 Fig. 4 Effect of salt-tolerant Staphylococcus strains on nutrient uptake Sahoo et al. (2014) reported that the inoculation of rice plants and ion regulation under induced salt stress. The data was analyzed by with Azotobacter vinellandii (SRIAz3) resulted in an increased two-way analysis of variance (Fisher’sLSD; P ≤ 0.05). Different lower- rice biomass. The inoculation of Staphylococcus strains STN- case letters on bars represent the significance among inoculated and non- 1, STN-5, and mixed inoculum increased the total phenolic inoculated treatment means (n = 3) and the letters on horizontal lines corresponds to the significance among induced salinity levels contents in maize plants and this phenomenon might be attrib- = Non-inoculated plants. uted to better utilization of cellar antioxidative repair mecha- = Plants inoculated with Staphylococcus strain STN-1. nisms by plants as compared to non-treated ones (Akram et al. = Plants inoculated with Staphylococcus strain STN-5. 2016). The maximum antioxidant levels in plants treated with = Plants inoculated with Staphylococcus strain STN-14. = Plants inoculated with mixed inoculum. mixed inoculum might be due to the synergistic effect of strains STN-1 and STN-5. It was found that the uptake of N and P in maize showed a and STN-5 (Fig. 2). The modulation of ethylene stress due to decreasing trend with increasing salt stress, probably due to + − production of ACC deaminase by Staphylococcus strains increased Na and Cl ions uptake (Fig. 4). It is well + +2 might also have added to the growth stimulatory effects in established that under salt stress, the uptake of K and Ca + + inoculated maize plants (Glick 2014; Kim et al. 2014). is reduced due to the antagonistic effect of Na and K Shahid et al. (2018) concluded that Planomicrobium sp. (Rahneshan et al. 2018). Increased uptake of N, P, K ,and MSSA-10 with PGPR characteristics promoted the growth Ca as a result of the inoculation with Staphylococcus strains of pea plants under induced salinity stress. Moreover, STN-1, STN-5, and mixed inoculum may be attributed to the Ahmad et al. (2014) reported that the combined application plant growth-promoting and nutrient mobilization potential of of PGPR, biogas slurry, and nitrogen boosted the growth of the strains, root proliferation due to IAA production, and low + + + 2+ + maize. Inoculation with Erwinia persicinus strain RA2 signif- Na uptake. The K /Na and Ca /Na ratios were also found icantly increased biomass of tomato plants under salinity con- comparatively higher in inoculated plants. The enhanced nu- ditions (Cha-Um and Kirdmanee 2009). trient uptake might be due to the better root growth due to In non-treated plants, the MDA and H O content were PGPR inoculation (Shahid et al. 2012). However, the mecha- 2 2 elevated with the increasing levels of salt stress. This was nisms underlying bacterially induced ion regulation and nutri- the indication that the plants cells were in oxidative injury ent translocation from soil to plant shoot are not completely (Nasraoui-Hajaji et al. 2012). This condition not only affects understood. Furthermore, IAA production might have stimu- + +2 cellular metabolic activity but also nutrient and water uptake lated the uptake of K and Ca with subsequent restriction in from soil. The significant decrease in lipid oxidation of mem- the uptake of Na , and this relation between ion regulation and branes and in H O content, and the increase in cellular anti- 2 2 nutrient uptake is presented by Forni et al. (2017). oxidant enzyme content (CAT and POD) in plants inoculated with Staphylococcus strains STN-1, STN-5, and mixed inoc- ulum might be attributed to the complex signaling pathways Conclusion triggered by bacterial inoculation (Fig. 3). It has been already established that PGPR induced stress tolerance in plants by Three strains STN-1, STN-5, and STN-14 were taxonomically triggering the cellular antioxidant levels (Younesi and Moradi identified as Staphylococcus spp. and physiologically charac- 2014; Shahid et al. 2018). Proline is a very important osmolyte terized as salt-tolerant PGPR strains. Inoculation of maize involved in osmoregulation and stabilization of many other plants with Staphylococcus strains STN-1, STN-5, and mixed macromolecules (Curá et al. 2017). In the present study, inoc- inoculum significantly promoted plant growth and alleviated ulated plants showed reduced proline contents, which could maize plants from oxidative damage by decreasing the levels be attributed to the fact that the inoculation of maize plants of reactive oxygen species due to enhanced production of with strains STN-1, STN-5, and mixed inoculum alleviated enzymatic and non-enzymatic antioxidants. It was found that the plants from stress conditions. The synthesis of elevated − salt stress alleviation after the inoculation with STN-1, STN-5, levels of hydrogen peroxide (H O ), superoxide (O ), and/ 2 2 2 − and mixed inoculum was also the result of better nutrient or hydroxyl (OH ) radicals are the direct signals of oxidative acquisition and regulation of ionic balance in plant cells. stress (Waszczak et al. 2018). Conversely, plant antioxidant The study concluded that Staphylococcus strains STN-1 and defense mechanism, composing of enzymatic and non- STN-5 are potent salt-tolerant PGPR, which can be used as enzymatic molecules, ensure the defense against the adverse mixed inoculum to boost maize growth under saline effects of ROS (Sun et al. 2018). Another possible mechanism environment. of salt stress alleviation in plants is the bacterial exopolysaccharides synthesis, which restricts the uptake of Funding This research work was funded by GCUF-RSP research grant Na by roots (Ilangumaran and Smith 2017) and regulate the (project no. 38-B&B-15) entitled BDevelopment of salt-tolerant tissue-specific sodium transporter HKT1 (Zhang et al. 2008). biofertilizer for saline agriculture in Pakistan.^ 738 Ann Microbiol (2019) 69:727–739 increases the tolerance of maize to drought stress. Microorganisms Compliance with ethical standards 5(3):41 Dimkpa C, Weinand T, Asch F (2009) Plant–rhizobacteria interactions Conflict of interest The authors declare that they have no conflict of alleviate abiotic stress conditions. Plant Cell Environ 32(12):1682– interest. Dobbelaere S, Vanderleyden J, Okon Y (2003) Plant growth-promoting Ethical approval This article does not contain any studies with human effects of diazotrophs in the rhizosphere. Crit Rev Plant Sci 22(2): participants or animals performed by any of the authors. 107–149 Etesami H, Beattie GA (2018) Mining halophytes for plant growth- Informed consent Informed consent was obtained from all individual promoting halotolerant bacteria to enhance the salinity tolerance of participants included in the study. non-halophytic crops. Front Microbiol 9:148 Forni C, Duca D, Glick BR (2017) Mechanisms of plant response to salt and drought stress and their alteration by rhizobacteria. Plant Soil 410(1–2):335–356 Gerhardt P, Murray RGE, Costilow RN, Nester EW, Wood WA, Krieg NR, Phillips GB (1981) Manual of methods for general bacteriolo- gy. American Society for Microbiology, Washington, DC ISBN 0- References 914826-30-1 Glick BR (2014) Bacteria with ACC deaminase can promote plant Aebi H (1984) Catalase in vitro. Methods Enzymol Elsevier; p 121–126 growth and help to feed the world. Microbiol Res 169(1):30–39 Ahmad M, Zahir ZA, Jamil M, Nazli F, Latif M, Akhtar M (2014) Gordon SA, Weber RP (1951) Colorimetric estimation of indoleacetic Integrated use of plant growth promoting rhizobacteria, biogas slur- acid. Plant Physiol 26(1):192–195 ry and chemical nitrogen for sustainable production of maize under Hamdia MAE-S, Shaddad M, Doaa MM (2004) Mechanisms of salt salt-affected conditions. Pak J Bot 46(1):375–382 tolerance and interactive effects of Azospirillum brasilense inocula- Akram MS, Shahid M, Tariq M, Azeem M, Javed MT, Saleem S, Riaz S tion on maize cultivars grown under salt stress conditions. Plant (2016) Deciphering Staphylococcus sciuri SAT-17 mediated anti- Growth Regul 44(2):165–174 oxidative defense mechanisms and growth modulations in salt Harrigan WF, McCance ME (1990) Laboratory methods and food and stressed maize (Zea mays L.). Front Microbiol 7:867 dairy microbiology. Academic Press, London Alibrandi P, Cardinale M, Rahman MM, Strati F, Ciná P, de Viana ML, Heath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts: I. Giamminola EM, Gallo G, Schnell S, De Filippo C (2018) The seed Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem endosphere of Anadenanthera colubrina is inhabited by a complex Biophys 125(1):189–198 microbiota, including Methylobacterium spp. and Staphylococcus Heydarian Z, Yu M, Gruber M, Glick BR, Zhou R, Hegedus DD (2016) spp. with potential plant-growth promoting activities. Plant Soil Inoculation of soil with plant growth promoting bacteria producing 422(1–2):81–99 1-aminocyclopropane-1-carboxylate deaminase or expression of the Arnon D, Hoagland D (1940) Crop production in artificial culture solu- corresponding acdS gene in transgenic plants increases salinity tol- tions and in soils with special reference to factors influencing yields erance in Camelina sativa. Front Microbiol 7:1966 and absorption of inorganic nutrients. Soil Sci 50:463–485 Ilangumaran G, Smith DL (2017) Plant growth promoting rhizobacteria Babalola OO (2010) Beneficial bacteria of agricultural importance. in amelioration of salinity stress: a systems biology perspective. Biotechnol Lett 32(11):1559–1570 Front Plant Sci 8:1768 Bates L, Waldren R, Teare I (1973) Rapid determination of free proline Jana S, Choudhuri MA (1982) Glycolate metabolism of three submersed for water-stress studies. Plant Soil 39(1):205–207 aquatic angiosperms during ageing. Aquat Bot 12:345–354 Bradford MM (1976) A rapid and sensative method for the quantitation of Julkunen-Tiitto R (1985) Phenolic constituents in the leaves of northern microgram quantities of protein utilizing the principle of protein– willows: methods for the analysis of certain phenolics. J Agric Food dye binding. Ann Biochem 72:248–254 Chem 33(2):213–217 Cha-Um S, Kirdmanee C (2009) Effect of salt stress on proline accumu- Kashyap AS, Pandey VK, Manzar N, Kannojia P, Singh UB, Sharma P lation, photosynthetic ability and growth characters in two maize (2017) Role of plant growth-promoting rhizobacteria for improving cultivars. Pak J Bot 41(1):87–98 crop productivity in sustainable agriculture. Plant-Microbe Chance B, Maehly A (1955) Assay of catalases and peroxidases. Methods Interactions in Agro-Ecological Perspectives Springer; pp 673–693 Enzymol 2:764–775 Khan MU, Sessitsch A, Harris M, Fatima K, Imran A, Arslan M, Shabir Cheng Z, Woody OZ, McConkey BJ, Glick BR (2012) Combined effects G, Khan QM, Afzal M (2015) Cr-resistant rhizo- and endophytic of the plant growth-promoting bacterium Pseudomonas putida bacteria associated with Prosopis juliflora and their potential as UW4 and salinity stress on the Brassica napus proteome. Appl phytoremediation enhancing agents in metal-degraded soils. Front Soil Ecol 61:255–263 Plant Sci 5:755 Compant S, Duffy B, Nowak J, Clément C, Barka EA (2005) Use of plant Kim K, Jang Y-J, Lee S-M, Oh B-T, Chae J-C, Lee K-J (2014) Alleviation growth-promoting bacteria for biocontrol of plant diseases: princi- of salt stress by Enterobacter sp. EJ01 in tomato and Arabidopsis is ples, mechanisms of action, and future prospects. Appl Environ accompanied by up-regulation of conserved salinity responsive fac- Microbiol 71(9):4951–4959 tors in plants. Mol Cell 37(2):109 Kumar A, Bahadur I, Maurya B, Raghuwanshi R, Meena V, Singh D, Couillerot O, Combes-Meynet E, Pothier JF, Bellvert F, Challita E, Dixit J (2015) Does a plant growth promoting rhizobacteria enhance Poirier M-A, Rohr R, Comte G, Moënne-Loccoz Y, Prigent- agricultural sustainability. J Pure Appl Microbiol 9(1):715–724 Combaret C (2011) The role of the antimicrobial compound 2, 4- diacetylphloroglucinol in the impact of biocontrol Pseudomonas Kumar R, Goyal V, Kuhad M (2005) Influence of fertility–salinity inter- fluorescens F113 on Azospirillum brasilense phytostimulators. actions on growth, water status and yield of Indian mustard Microbiol 157(6):1694–1705 (Brassica juncea). Indian J Plant Physiol 10(2):139 Curá JA, Franz DR, Filosofía JE, Balestrasse KB, Burgueño LE (2017) Liu M, Chen Y, Chen Y, Shin JH, Mila I, Audran C, Zouine M, Pirrello J, Inoculation with Azospirillum sp. and Herbaspirillum sp. bacteria Bouzayen M (2018) The tomato ethylene response factor Sl-ERF. Ann Microbiol (2019) 69:727–739 739 B3 integrates ethylene and auxin signaling via direct regulation of strain Planomicrobium sp. MSSA-10 triggered oxidative stress re- sponsive mechanisms and regulated the growth of pea plants under Sl-aux/IAA 27. New Phytol 9(2):631–640 Mahmood F, Shahid M, Hussain S, Shahzad T, Tahir M, Ijaz M, Hussain induced saline environment. J Appl Microbiol 124(6):1566–1579 A, Mahmood K, Imran M, Babar SAK (2017) Potential plant Shahid M, Hameed S, Imran A, Ali S, van Elsas JD (2012) Root coloni- growth-promoting strain Bacillus sp. SR-2-1/1 decolorized azo dyes zation and growth promotion of sunflower (Helianthus annuus L.) through NADH-ubiquinone: oxidoreductase activity. Bioresour by phosphate solubilizing Enterobacter sp. Fs-11. World J Technol 235:176–184 Microbiol Biotechnol 28(8):2749–2758 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a labora- Shahid M, Hameed S, Tariq M, Zafar M, Ali A, Ahmad N (2015) tory manual, vol 545. Cold Spring Harbor Laboratory, Cold Spring Characterization of mineral phosphate-solubilizing bacteria for en- Harbor, NY hanced sunflower growth and yield-attributing traits. Ann Microbiol Mayak S, Tirosh T, Glick BR (2004) Plant growth-promoting bacteria 65(3):1525–1536 confer resistance in tomato plants to salt stress. Plant Physiol Shahid M, Hussain B, Riaz D, Khurshid M, Ismail M, Tariq M (2017) Biochem 42(6):565–572 Identification and partial characterization of potential probiotic lactic Meena VS, Meena SK, Verma JP, Kumar A, Aeron A, Mishra PK, Bisht acid bacteria in freshwater Labeo rohita and Cirrhinus mrigala. JK, Pattanayak A, Naveed M, Dotaniya M (2017) Plant beneficial Aquac Res 48(4):1688–1698 rhizospheric microorganism (PBRM) strategies to improve nutrients Shrivastava P, Kumar R (2015) Soil salinity: a serious environmental use efficiency: a review. Ecol Eng 107:8–32 issue and plant growth promoting bacteria as one of the tools for Nasraoui-Hajaji A, Gouia H, Carrayol E, Haouari-Chaffei C (2012) its alleviation. Saudi J Biol Sci 22(2):123–131 Ammonium alleviates redox state in Solanum seedlings under cad- Shukla PS, Agarwal PK, Jha B (2012) Improved salinity tolerance of mium stress conditions. J Environ Anal Toxicol 2:116–120 Arachis hypogaea (L.) by the interaction of halotolerant plant- Nemeghaire S, Argudín MA, Feßler AT, Hauschild T, Schwarz S, Butaye growth-promoting rhizobacteria. J Plant Growth Regul 31(2):195– P (2014) The ecological importance of the Staphylococcus sciuri species group as a reservoir for resistance and virulence genes. Vet Somasegaran P, Hoben HJ (1994) Handbook for rhizobia: methods in Microbiol 171(3–4):342–356 legume-rhizobium technology. Springer Science & Business Media Ola HAE, Reham EF, Eisa S, Habib S (2012) Morpho-anatomical chang- Spaepen S, Vanderleyden J (2011) Auxin and plant–microbe interactions. es in salt stressed kallar grass (Leptochloa fusca L. Kunth). Res J Cold Spring Harb Perspect Biol 3(4):a001438 Agric Biol Sci 8(2):158–166 Steel R, Torrie J, Dickey DA (1997) Principles and procedures of statis- Panda SK, Baluška F, Matsumoto H (2009) Aluminum stress signaling in tics: a biometrical approach. McGraw-Hill plants. Plant Signal Behav 4(7):592–597 Sun H, Mu B, Song Z, Ma Z, Mu T (2018) The in vitro antioxidant Penrose DM, Glick BR (2003) Methods for isolating and characterizing activity and inhibition of intracellular reactive oxygen species of ACC deaminase-containing plant growth-promoting rhizobacteria. sweet potato leaf polyphenols. Oxidative Med Cell Longev 2018:11 Physiol Plant 118:10–15 Waszczak C, Carmody M, Kangasjärvi J (2018) Reactive oxygen species Pikovskaya R (1948) Mobilization of phosphorus in soil in connection in plant signaling. Annu Rev Plant Biol 69:209–236 with vital activity of some microbial species. Mikrobiologiya 17: Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal 362–370 DNA amplification for phylogenetic study. J Bacteriol 173(2):697– Prithiviraj B, Bais HP, Jha AK, Vivanco JM (2005) Staphylococcus aureus pathogenicity on Arabidopsis thaliana is mediated either Wolf B (1982) A comprehensive system of leaf analyses and its use for by a direct effect of salicylic acid on the pathogen or by SA-depen- diagnosing crop nutrient status. Commun Soil Sci Plant Anal 13: dent, NPR1-independent host responses. Plant J 42(3):417–432 1035–1059. https://doi.org/10.1080/00103628209367332 Qureshi AS, McCornick PG, Qadir M, Aslam Z (2008) Managing salinity Yildrim E, Donmez MF, Turan M (2008) Use of bioinoculants in ame- and waterlogging in the Indus Basin of Pakistan. Agric Water liorative effects on radish plants under salinity stress. J Plant Nutr Manag 95(1):1–10 31(12):2059–2074 Rahneshan Z, Nasibi F, Moghadam AA (2018) Effects of salinity stress Younesi O, Moradi A (2014) Effects of plant growth-promoting on some growth, physiological, biochemical parameters and nutri- rhizobacterium (PGPR) and arbuscular mycorrhizal fungus (AMF) ents in two pistachio (Pistacia vera L.) rootstocks. J Plant Interact on antioxidant enzyme activities in salt-stressed bean (Phaseolus 13(1):73–82 vulgaris L.). Agric 60(1):10–21 Roohi A, Ahmed I, Iqbal M, Jamil M (2012) Preliminary isolation and Zafar S, Ashraf MY, Anwar S, Ali Q, Noman A (2016) Yield enhance- characterization of halotolerant and halophilic bacteria from salt ment in wheat by soil and foliar fertilization of K and Zn under mines of Karak, Pakistan. Pak J Bot 44(SI 1):365–370 saline environment. Soil Environ 35(1):46–55 Ryan J, Estefan G, Rashid, A (2007) Soil and plant analysis laboratory Zhang H, Kim M-S, Sun Y, Dowd SE, Shi H, Paré PW (2008) Soil manual. ICARDA bacteria confer plant salt tolerance by tissue-specific regulation of Sahoo RK, Ansari MW, Pradhan M, Dangar TK, Mohanty S, Tuteja N the sodium transporter HKT1. Mol Plant-Microbe Interact 21(6): (2014) A novel Azotobacter vinellandii (SRI Az 3) functions in 737–744 salinity stress tolerance in rice. Plant Signal Behav 9(7):511–523 Shahbaz M, Ashraf M (2013) Improving salinity tolerance in cereals. Crit Rev Plant Sci 32(4):237–249 Publisher’snote Springer Nature remains neutral with regard to jurisdic- Shahid M, Akram MS, Khan MA, Zubair M, Shah SM, Ismail M, Not tional claims in published maps and institutional affiliations. Shabir G, Basheer S, Aslam K, Tariq M (2018) A phytobeneficial

Journal

Annals of Microbiology – Springer Journals

Published: Mar 23, 2019

There are no references for this article.