Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Molecular characterization of virulence factors in Staphylococcus aureus isolated from bovine subclinical mastitis in central Ethiopia

Molecular characterization of virulence factors in Staphylococcus aureus isolated from bovine... Purpose: Staphylococcus aureus (S. aureus) is the most important pathogen involved in bovine mastitis in dairy production. S. aureus produces a spectrum of extracellular protein toxins and virulence factors which are thought to contribute to the pathogenicity of the organism. The aim of this work was to isolate and molecular characterize S. aureus associated with bovine subclinical mastitis in the central part of Ethiopia. Methods: A total of 265 lactating dairy cows from various dairy farms in four different geographical locations were screened by the California mastitis test (CMT) for bovine subclinical mastitis. One hundred thirty CMT-positive milk samples were collected and transported to the laboratory. Different biochemical tests and polymerase chain reaction (PCR) were used for the identification of S. aureus isolates. Finally, PCR was performed for molecular detection of virulence genes. Results: From a total of 265 lactating dairy cows screened, 49% (n = 130) were positive for bovine subclinical mastitis. One hundred thirty mastitic milk samples were subjected to bacterial culturing, and one hundred (76%) S. aureus isolates were identified based on phenotypic characters. Sixty-eight confirmed S. aureus isolates were obtained using PCR. The confirmed S. aureus isolates were tested for six virulence genes (tsst-1, hlb, eta, sea, clfA, and icaD) using PCR. Of the six virulence genes screened from all the isolates, only two (clfA and eta) were detected in the isolates. Out of 68 isolates, 25% and 22% were possessed the eta and clfA genes, respectively. Conclusion: The presence of Staphylococcus aureus having virulence genes (eta and clfA) revealed that mastitis is a major concern nowadays affecting animal health, milk quality, and yield. Further genomic study of these isolates will provide broad new insights on virulence. Keywords: Bovine, Staphylococcus aureus, Subclinical mastitis, Virulence genes * Correspondence: desiye.tegegne@gmail.com Animal Biotechnology Research Program, National Agricultural Biotechnology Research Center, Ethiopian Institute of Agricultural Research, P.O. Box: 249, Holeta, Ethiopia Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Tegegne et al. Annals of Microbiology (2021) 71:28 Page 2 of 8 Background et al., 2011). These may in turn contribute to the devel- Mastitis is considered to be the most frequent and most opment of methods to minimize the production losses costly production disease in dairy herds of developed due to mastitis. Further, the study of the evolution of and developing countries including Ethiopia. Mastitis is strain-specific transmission and virulence characteristics an inflammatory response of the teat canal as a result of including antibiotic resistance in S. aureus isolated from bacterial infection (Song et al., 2020). Staphylococcus bovine mastitis may help us to understand mechanisms aureus (S. aureus) is one of the most recognized pathogens behind the emergence of new strains or shifts in mastitis causing many serious diseases in humans and animals epidemiology in response to control measures, including worldwide and is the most common causative agent of antibiotic treatment and vaccination (Yu et al., 2012). clinical and subclinical bovine mastitis (Ote et al., 2011). However, at present, few reports have been reported Mastitis caused by S. aureus is the result of the pro- about the occurrence of virulence factors among S. aur- duction of several virulence factors that can contribute eus isolated from milk of cows suffering from mastitis in different ways of pathogenesis (Vaughn et al., 2020). but not identified by molecular technique in the central Virulence factors of S. aureus can be grouped broadly part of Ethiopia. Furthermore, there is a literature dearth into two major classes which include surface localized on the prevalence and genetic characterization of viru- structural components that serve as virulence factors lence determinants in S. aureus in Ethiopia. As to our and secreted virulence factors, which together help this knowledge, most of the researches in Ethiopia were done pathogen to evade the host’s defenses and colonize in association with the prevalence of bovine mastitis mammary glands (Diep and Otto, 2008). Some of the cases and its associated risk factors (Abera et al., 2010; surface localized structural components that serve as Tesfaye et al., 2010) but molecular data on S. aureus virulence factors include membrane-bound factors causing bovine mastitis in remain scarce. Therefore, the (collagen binding protein, fibrinogen binding protein, aim of this study was to determine the prevalence of S. elastin binding protein, and penicillin binding protein ), aureus isolates associated with bovine subclinical mas- cell wall-bound factors (protein A, β-Lactamase, and titis and the prevalence of virulence genes in those iso- protease), and cell surface-associated factors (capsule lates in central parts of Ethiopia. and slime) (Diep and Otto, 2008). Some of the known secretory virulence factors are toxins (staphylococcal en- Methods terotoxins, toxic shock syndrome toxin 1, hemolysins, Samples and study population and exfoliatin) and enzymes (coagulase, staphylokinase, Two hundred and sixty-five milk samples were collected DNAase, phosphatase, lipase, and phospholipase). In from lactating dairy cows that showed subclinical mas- addition to specific virulence factor, S. aureus also titis symptoms. Milk samples were collected from inten- possesses different mechanisms or traits such as biofilm sive production system across different geographical formation, adhesion to and invasion into mammary locations (Adaberga, Ambo, Bishoftu, and Holeta) in the epithelial cells, and formation of small colony variant central part of Ethiopia since November 2018 to June (SCV) that enables this pathogen to resist host defense 2019. Milk samples were collected and proceeded as de- mechanisms. Some of these toxins are known to function scribed in the previous study (Patel et al., 2017). Briefly, as superantigens that cause increased immunological re- udders were wiped with 70% ethyl alcohol and few drops activity in the host (Rollin et al., 2015; Bobbo et al., 2017). of milk were discarded initially. Simultaneously, CMT The differences in pathogenicity of S. aureus strains was executed on the site, and on the basis of the CMT could result from geographical distribution and from score, samples were collected (Bhatt et al., 2011; Patel host- and tissue-related characteristics (van Leeuwen et al., 2017). The study areas were purposively selected et al., 2005). The numbers and combination of virulence based on the agro-ecological differences and abundance genes may be important contributions to the pathogenic of dairy farm milk sheds. The farms included in this potential of S. aureus strains (Zecconi et al., 2006). A study were involved in the production of milk for self- high number of S. aureus genotypes present in bovine consumption and supplier to milk cooperative. herds worldwide has been studied to develop better strategies of treating mastitis (Kot et al., 2016). The Bacterial isolation and identification identification and characterization of virulence factors of Milk samples were evaluated for mastitis-causing S. aureus causing bovine mastitis will enhance our un- bacteria by bacteriological culture and biochemical tests derstanding of the pathogenesis of intramammary infec- following the National Mastitis Council Guidelines tion (Zecconi et al., 2006). In addition, the antibiogram (Oliver et al., 2004). Briefly, 100 μl of milk sample was of S. aureus needs to be studied which would indicate inoculated onto nutrient broth media (Merck, Germany) the pattern of resistance to various antibacterials with 5% sheep blood (Becton Dickinson Microbiology contributing to their virulence properties (Graveland System, Cockeysville) and incubated at 37 °C for 24 h. Tegegne et al. Annals of Microbiology (2021) 71:28 Page 3 of 8 Plates were evaluated for bacterial growth, colony EdvoCycler™ PCR machine (Edvotek, Inc, Bethesda). morphology, and hemolysis after 24 h. Each pure colony Also, all isolates were tested by PCR for the presence of was identified by Gram-stain, followed by a catalase test. the staphylococcal enterotoxin A (sea), exfoliative toxin Catalase-positive cocci were considered Staphylococcus A(eta), beta hemolysin toxin (hlb), clamping factor A species and further confirmed by polymerase chain (clfa), intercellular adhesion D (icaD), toxic shock syn- reaction (PCR) and tube coagulase test using rabbit drome toxin-1 (tsst-1), and methicillin-resistant genes plasma (NVI, Bishoftu, Ethiopia) to differentiate S. aureus according to the previously described protocol [18-21]. from coagulase-negative Staphylococcus species.The Primers used for the PCR amplification were synthesized resulting culture was used for bacterial DNA extraction, by Sigma-Aldrich (Bonn, Germany) and master mix syn- and the remaining overnight culture of S. aureus isolate in thesized by BioBasic company (BioBasic, Canada). The tryptic soy broth (TSB) (BHI, Merck, Germany) was primers used for molecular identification of different mixed with an equal volume of sterile 85% glycerol and virulence-associated genes are indicated in Table 1. stored in a −80 °C freezer for further molecular work. Lyophilized primers for the target genes were reconsti- tuted using DNase-RNase-free sterile water to obtain Bacterial DNA extraction 1000 μM stock solutions. All primers were stored at Staphylococcus aureus bacteria were sub-cultured on nu- −20 °C and then finally diluted to a working concentra- trient broth media (NB, Merck, Germany) and incubated tion of 10 μM. PCR was carried out in a total volume of at 37 °C for 24 h. Genomic DNA of all phenotypically 25 μl containing 12.5 μlof1X Taq PCR Master Mix (Bio positive S. aureus isolates was extracted from the culture Basic, Canada), 1 μl of the forward primer and 1 μlof using the Zymo Research Fungal and Bacterial Genomic the reverse primer, 3 μl of DNA template, and 7.5 μl DNA MiniPrepTM kit (Zymo Research, Irvine, USA) sterile nuclease-free water. The cyclic polymerase chain following the manufacturer’s instructions. Purity, quality, reaction conditions of the different primer sets are and quantity of extracted DNA were measured using a described in Table 2. PCR products were run on a 1% Nanodrop device (NanoDrop, Thermo Scientific, USA), agarose (w/v) gel using electrophoresis, stained with gel gel electrophoresis, and spectrophotometer. The red (Merck, Darmstadt, Germany) at 120 volts for 1 h, extracted genomic DNA was stored at −20 °C until the and visualized under UV light using a BioDoc-itTM next use. imaging system (Cambridge, UK). We used GeneRuler 100 bp Plus DNA Ladder (Bioneer). Molecular confirmation of S. aureus, detection of virulence, and methicillin-resistant genes Statistical analysis Polymerase chain reaction (PCR) was used to amplify The data generated from the study was arranged, coded, the 16SrRNA gene fragment of S. aureus isolates accord- and entered into an Excel spreadsheet (Microsoft® Office ing to the previously described protocol [17] using Excels 2010) and subjected to statistical analysis. The Table 1 Description of the primers used for molecular identification of different virulence-associated gene detection in S. aureus isolates Target gene Primer name and its sequence (5′→3′) Amplicon size (in bp) Reference mecA MECA_F: GGCTATCGTGTCACAATCGTT 689 Melo et al. (2014) MECA_R: TCACCTTGTCCGTAACCTGA 16SrRNA Sau234_F: CGATTCCCTTAGTAGCGGCG 1267 Riffon et al. (2001) Staph. aureus specific Sau1501_R: CCAATCGCACGCTTCGCCTA sea SEA_F: TTGGAAACGGTTAAAACGAA 120 Mehrotra et al. (2000) SEA_R: GAACCTTCCCATCAAAAACA tsst-1 TSST_F: ATGGCAGCATCAGCTTGATA 350 Mehrotra et al. (2000) TSST_R: TTTCCAATAACCACCCGTTT eta ETA_F: CGCTGCGGACATTCCTACATGG 676 Li et al. (2018a) ETA_R: TACATGCCCGCCACTTGCTTGT hlb HLB_F: GTGCACTTACTGACAATAGTGC 309 Li et al. (2018a) HLB_R: GTTGATGAGTAGCTACCTTCAGT clfA CLFA_F: GCAAAATCCAGCACAACAGGAAACGA 638 Kumar et al. (2009) CLFA_R: CTTGATCTCCAGCCATAATTG GTGG icaD ICAD_F: AAGCCAGACAGAGGCAATATCCA 249 Greco et al. (2008) ICAD_R: AGTACAAACAAACTCATCCATCCGA NB: Sea staphylococcal enterotoxin a, tsst-1 toxic shock syndrome toxin one, eta exfoliative toxin A, hlb beta hemolysin toxin, clfA clumping factor A, icaD intracellular adhesive toxin, mecA methicillin resistance Tegegne et al. Annals of Microbiology (2021) 71:28 Page 4 of 8 Table 2 Cyclic polymerase chain reaction conditions of the different primer sets Target genes Initial Amplification (35 cycles) Final denaturation extension Denaturation Annealing Extension mecA 94 °C/1.5 min 95 °C for 45 s 55 °C for 1 min 72 °C/45 s 72 °C/10 min 16SrRNA 94 °C/5 min 94 °C/30 s 55 °C/30 s 72 °C/45 s 72 °C/5 min S. aureus specific sea 95 °C/10 min 94 °C/2 min 55 °C/2 min 72 °C/1 min 72 °C/1 min tsst-1 95 °C/10 min 94 °C/2 min 55 °C/2 min 72 °C/1 min 72 °C/1 min eta 94 °C/5 min 94 °C/30 s 57 °C/30 s 72 °C/45 s 72 °C/10 min hlb 94 °C/5 min 94 °C/30 s 58 °C/30 s 72 °C/20 s 72 °C/10 min clfA 94 °C/10 min 94 °C/10 min 55 °C/1 min 72 °C/1 min 72 °C/10 min icaD 94 °C/10 min 94 °C/30 s 53 °C/30 s 72 °C/30 s 72 °C/10 min prevalence to every test was calculated as the number of amplification. The presence of 16SrRNA gene (1267 bp) positive cattle divided by the number of examined cases was confirmed by PCR in S. aureus-positive isolates (Fig. 1). within the specified period. The Pearson chi-square test (χ ) was applied to determine the existence of any asso- Prevalence of virulence genes in S. aureus ciation between sampling areas and virulence-associated All 68 PCR-confirmed S. aureus isolates were tested for genes using SPSS software version 22.0. six virulence genes including tsst-1, hlb, eta, sea, clfA, The significance level was set at P-value (0.05) and and icaD using PCR amplification. Of the six virulence 95% confidence level. In all cases, 95% confidence level genes screened from all the isolates, only two (clfA and and p-value less than 0.05 were considered statistical eta) were detected (Fig. 2). The isolates for the current significance. study were obtained from mastitic bovine milk samples representing four geographical locations (Adaberga, Results Ambo, Bishoftu, and Holeta) in the central parts of Isolation and identification of S. aureus isolates Ethiopia. Out of 68 isolates, 17 (25%), 15 (22%), and 6 In this study, of the 265 lactating dairy cows screened, (8.8%) isolates possessed eta, clfA, and a combination of 130 (49%) were positive for bovine mastitis based on eta and clfA genes, respectively. The large proportion of CMT. One hundred and thirty mastitic milk samples these isolates which harbor eta and clfA genes were ob- were subjected to bacterial culturing, and 100 (76%) S. tained from Holeta (46%, 7/15) and Adaberga (52%, 9/17), aureus isolates were identified based on the morpho- respectively. The prevalence of virulence genes was not logical and biochemical characters. From a total of 100 statistically significant between different sampling areas phenotypically positive S. aureus isolates, 68 (68%) of (X =1.239; P = 0.744). The prevalence rates of the viru- them were confirmed S. aureus isolates through PCR lence genes are depicted in Fig. 3. The expected PCR Fig. 1 Amplicons of the 16Sr RNA gene of representative S. aureus with a size of 1267 bp. Lane M is a 100-bp plus DNA marker (DNA ladder, BioBasic); lanes 1 to 5 are test samples Tegegne et al. Annals of Microbiology (2021) 71:28 Page 5 of 8 Fig. 2 Agarose gel electrophoresis of PCR amplicon of clfA and eta genes of representative S. aureus isolates. Lane M is a 1000-bp DNA marker (DNA ladder, Bio Basic); lanes 1 to 6 are test samples product sizes obtained from these PCR products were 638 gene. Figure 4 shows a 1.5% agarose (w/v) gel depicting and 676 bp for clfAand eta, respectively (Fig. 2). the mecA gene fragments that were amplified by PCR with the expected amplicon size (689 bp). Prevalence of methicillin-resistant (mecA) gene of Staphylococcus aureus Discussion Detecting antimicrobial-resistant genes was carried out Staphylococcus aureus is one of the major causes of mas- from the 100 S. aureus isolates, regardless of antimicro- titis that leads to a reduction of milk production in dairy bial susceptibility phenotypes. The results obtained are cattle (Krishnamoorthy et al., 2017). The control of bo- shown in Fig. 4. Methicillin resistance A (mecA) gene vine mastitis is vital not only in Ethiopia but also in the was amplified from the isolates in any of the isolates in world. Therefore, it is essential to investigate the patho- the present study. Out of the 100 isolates of S. aureus, gens using molecular techniques as vibrant components 12% (12/100) of the isolates possessed the mecA gene to control intra-mammary infections. In the dairy indus- and a large proportion of these isolates were obtained try, mastitis can be reduced by identification of exact from Holeta 58.34% (7/12). None of the isolates from pathogenesis and virulent factors present in infectious Adaberga possessed the methicillin-resistant (mecA) microorganisms. The molecular typing of infectious Fig. 3 Prevalence of virulence genes in S. aureus isolated from bovine subclinical mastitis Tegegne et al. Annals of Microbiology (2021) 71:28 Page 6 of 8 Fig. 4 Agarose gel electrophoresis analysis for the mecA gene in S. aureus isolates. Lane M = l00-bp DNA marker, lanes 1–7 = test samples agents is known to be an essential part of infection In this study, from a total of 130 CMT-positive iso- control strategies and is crucial to the track and spread lates, S. aureus was the most frequently encountered of contagious infections from one region to others or organism with an isolation rate of 76%. The predomin- among different herds. Consequently, it is crucial to ance and primary role of S. aureus isolate in bovine examine the mastitis-causing bacteria using molecular mastitis have also been reported in other studies (Abera methods as forceful tools to control IMI. Because S. aur- et al., 2012; Demissie et al., 2018). Apart from Ethiopia, eus is the most commonly contagious mastitis pathogens S. aureus has also been reported as the chief etiological worldwide, it is important to reveal virulence factors of agent of mastitis in cattle by many studies from African these agents to develop effective control strategies and Asian countries (Abebe et al., 2016). Though direct against mastitis caused by this pathogen (Khan et al., comparisons among studies might be difficult, but in 2013). In addition, an effective vaccine against IMI is not general, the variation in the prevalence between the available; therefore, prevention and control of mastitis present and previous studies might be due to differ- needs detection of the principal antigenic determinants ences in detection methods, geographical location of for the strategy and progress of more proficient vaccines the study sites, and differences in farm management against mastitis-causing bacteria, especially S. aureus. practices in each studied farms. S. aureus is adapted to A number of studies have been conducted in Ethiopia survive in the udder and usually establishes mild sub- on the prevalence of S. aureus in bovine milk (Abera clinical infection of long duration from which it is shed et al., 2012; Mekonnen et al., 2017). Most of these through milk serving as the source of infection for researches focused on the importance of this pathogen other healthy cows and transmitted during the milking as a cause of clinical and subclinical mastitis; however, process (Radostits et al., 2007). Hence, the organism its virulence determinants have not been well addressed. has been assuming apposition of major importance as a To our knowledge, there is no reliable information on cause of bovine mastitis. molecular data of virulence genes in S. aureus from mas- Out of 100 phenotypically positive S. aureus isolates, titic bovine milk samples in Ethiopia. Epidemiological 68% of them were confirmed S. aureus isolates by using studies indicate that S. aureus strain agents of milk PCR amplification. The finding of this study was in produce a group of virulence factors and it is believed agreement with Li et al. (2018b). Regardless of the isola- that there is a relationship between the severity of the tion and identification techniques employed, the con- infection and the virulence factors produced by S. aureus firmation of S. aureus in milk using molecular highlights (Almaw et al., 2008). Hence, in this study, the prevalence the need for both strict farm management practices and of certain virulence genes such as sea, eta, hlb, clfA, proper sanitary procedures to be implemented during icaD, and tsst-1 for S. aureus was evaluated. milking operations. Tegegne et al. Annals of Microbiology (2021) 71:28 Page 7 of 8 The pathogenicity of S. aureus is closely related to the adhesive toxin D; P-value: Predictive value; PCR: Polymerase chain reaction; Sea: Staphylococcal enterotoxin a; tsst-1: Toxic shock syndrome toxin one; presence of various virulence genes (Kot et al., 2016). In χ : Pearson chi-square this study, six virulence factors of the pathogen were screened but only two of them were positive based on Acknowledgements The authors greatly appreciate the contribution made by the Ethiopian PCR amplification. Our data showed that 15 out of 68 S. Institute of Agricultural Research, National Agricultural Biotechnology aureus isolates carried exfoliative toxin A (eta) (22.05%) Research Center, in funding this project and the staff of the Animal and 17 out of 68 S. aureus isolates contained clfA (25%) Biotechnology Research Laboratory for assisting during the bench work which has led to the success of this study. We are thankful to the farmers genes. Of 68 S. aureus examined, 32 (47.05%) were and veterinarians who provided the milk samples used in this study. positive for one or more virulence genes. About half (52.95%) of the isolates did not contain any of the Authors’ contributions virulence genes tested. The eta and clfA were found at The research idea and study design was developed by DTT. Sample collection were done by DTT, GM, HW and YEM. DTT supervised the study. higher frequencies whereas sea, hlb, icaD,and tsst-1 DTT and YEM provided valuable information on data analysis and manuscript were not found in all tested isolates. Five isolates writing. All authors read and approved the fnal manuscript. harbored both eta and clfA genes. There has been no published information regarding clamping factor A Funding This study was supported by the Ethiopian Institute of Agricultural Research (clfA) and exfoliative toxin A (eta) in the Ethiopian and Addis Ababa University. The institutions had no role in the design of the context. This is the first investigation regarding these study; in the collection, analysis, and interpretation of the data; and in genes in Ethiopia and there is no other work on these writing the manuscript. virulence factors. This finding is different from Availability of data and materials Srinivasan et al. (2006) who examined 78 S. aureus iso- The datasets used and/or analyzed during the current study are available lates from the milk of cows with mastitis for 16 entero- from the corresponding author on reasonable request. toxin genes and found that 73 (93.6%) of the isolates Declarations were positive for one or more enterotoxin genes from a similar area. However, Srinivasan et al. (2006) tested for Ethics approval and consent to participate 16 enterotoxin genes whereas in this study only one en- This study was conducted after gaining full approval by the ethical review board of the College of Veterinary Medicine and Agriculture, Addis Ababa terotoxin gene was tested. This might be the reason for University, Ethiopia. Informed written consent was taken from all participants the low prevalence of positive isolates in this study. The prior to participation in this study. Also, permission from dairy farm owners/ presence of the clumping factor gene is considered as managers was obtained before the collection of milk samples. Staphylococcus species virulence gene in the development Consent for publication and severity of mastitis in cows (Aarestrup et al., 1995). Not applicable The above results suggested that S. aureus isolates with different genetic backgrounds have different abilities to ac- Competing interests The authors declare that they have no competing interests. quire mobile genetic elements such as plasmids, phages, and pathogenicity islands. Author details Animal Biotechnology Research Program, National Agricultural Biotechnology Research Center, Ethiopian Institute of Agricultural Research, Conclusions P.O. Box: 249, Holeta, Ethiopia. Addis Ababa University, College of Veterinary The high prevalence of virulence genes (clfA and eta)in Medicine and Agriculture, Department of Veterinary Microbiology, S. aureus bacteria was the most important finding of our Immunology and Public Health, P.O. Box: 34, Bishoftu, Ethiopia. study. All of the S. aureus bacteria harbored clfA and eta Received: 22 March 2021 Accepted: 24 June 2021 putative virulence factors which showed that they can be use as specific genetic markers for detection of patho- genic S. aureus bacteria in bovine subclinical mastitis References Aarestrup FM, Wegener H, Rosdahl V (1995) Evaluation of phenotypic and cows. The presence of virulence factors in mastitis- genotypic methods for epidemiological typing of Staphylococcus aureus causing Staphylococcus aureus is an alarming spot for isolates from bovine mastitis in Denmark. Vet Microbiol 45(2-3):139–150. veterinarians, as several sources are there for spreading https://doi.org/10.1016/0378-1135(95)00043-A Abebe R, Hatiya H, Abera M, Megersa B, Asmare K (2016) Bovine mastitis: of microorganisms to human being. The emergence of prevalence, risk factors and isolation of Staphylococcus aureus in dairy herds different antibiotic resistance and virulence in the last at Hawassa milk shed, South Ethiopia. BMC Vet Res 12(1):270. https://doi. two decades is exerting a lot of pressure in the health org/10.1186/s12917-016-0905-3 Abera M, Demie B, Aragaw K, Regassa F, Regassa A (2010) Isolation and sector. Detailed genomic evaluation of particular identification of Staphylococcus aureus from bovine mastitic milk and their antibiotic-resistant strain with virulent factors may possess drug resistance patterns in Adama town, Ethiopia. J Vet Med Anim Health 2: a great scope to develop a new disease control strategy. 29–34 Abera M, Habte T, Aragaw K, Asmare K, Sheferaw D (2012) Major causes of Abbreviations mastitis and associated risk factors in smallholder dairy farms in and around clfA: Clumping factor A; CMT: California mastitis test; DNA: Deoxyribonucleic Hawassa, Southern Ethiopia. Trop Anim Health Prod 44(6):1175–1179. https:// acid; eta: Exfoliative toxin A; hlb: Beta hemolysin toxin; icaD: Intracellular doi.org/10.1007/s11250-011-0055-3 Tegegne et al. Annals of Microbiology (2021) 71:28 Page 8 of 8 Almaw G, Zerihun A, Asfaw Y (2008) Bovine mastitis and its association with mastitis by PCR. J Clin Microbiol 39(7):2584–2589. https://doi.org/10.1128/ selected risk factors in smallholder dairy farms in and around Bahir Dar, JCM.39.7.2584-2589.2001 Ethiopia. Trop Anim Health Prod 40(6):427–432. https://doi.org/10.1007/s112 Rollin E, Dhuyvetter K, Overton M (2015) The cost of clinical mastitis in the first 50-007-9115-0 30 days of lactation: an economic modeling tool. Prev Vet Med 122(3):257– Bhatt VD, Patel MS, Joshi CG, Kunjadia A (2011) Identification and antibiogram of 264. https://doi.org/10.1016/j.prevetmed.2015.11.006 microbes associated with bovine mastitis. Anim Biotechnol 22(3):163–169. Song X, Huang X, Xu H, Zhang C, Chen S, Liu F, Guan S, Zhang S, Zhu K, Wu C https://doi.org/10.1080/10495398.2011.570132 (2020) The prevalence of pathogens causing bovine mastitis and their associated risk factors in 15 large dairy farms in China: an observational Bobbo T, Ruegg P, Stocco G, Fiore E, Gianesella M, Morgante M, Pasotto D, study. Vet Microbiol 247:108757. https://doi.org/10.1016/j.vetmic.2020.108757 Bittante G, Cecchinato A (2017) Associations between pathogen-specific Srinivasan V, Sawant AA, Gillespie BE, Headrick SJ, Ceasaris L, Oliver SP (2006) cases of subclinical mastitis and milk yield, quality, protein composition, and Prevalence of enterotoxin and toxic shock syndrome toxin genes in cheese-making traits in dairy cows. J Dairy Sc 100(6):4868–4883. https://doi. Staphylococcus aureus isolated from milk of cows with mastitis. Foodbourne org/10.3168/jds.2016-12353 Pathog Dis 3(3):274–283. https://doi.org/10.1089/fpd.2006.3.274 Demissie TF, Menghistu HT, Mitiku MA (2018) Prevalence of mastitis and Tesfaye GY, Regassa FG, Kelay B (2010) Milk yield and associated economic losses identification of its bacterial causative agents in small holder dairy farms in in quarters with subclinical mastitis due to Staphylococcus aureus in and around Wukro of Tigray region, Ethiopia. Int. J. Adv. Res. Biol. Sci 5:10–22 Ethiopian crossbred dairy cows. Trop Anim Health Prod 42(5):925–931. Diep BA, Otto M (2008) The role of virulence determinants in community- https://doi.org/10.1007/s11250-009-9509-2 associated MRSA pathogenesis. Trends Microbiol 16(8):361–369. https://doi. van Leeuwen WB, Melles DC, Alaidan A, Al-Ahdal M, Boelens HA, Snijders SV, org/10.1016/j.tim.2008.05.002 Wertheim H, van Duijkeren E, Peeters JK, van der Spek PJ (2005) Host- and Graveland H, Duim B, Van Duijkeren E, Heederik D, Wagenaar JA (2011) Livestock- tissue-specific pathogenic traits of Staphylococcus aureus. J Bacteriol 187(13): associated methicillin-resistant Staphylococcus aureus in animals and 4584–4591. https://doi.org/10.1128/JB.187.13.4584-4591.2005 humans. Int J Med Microbiol 301(8):630–634. https://doi.org/10.1016/j.ijmm.2 Vaughn J, Abdi RD, Gillespie BE, Dego OK (2020) Genetic diversity and virulence 011.09.004 characteristics of Staphylococcus aureus isolates from cases of bovine Greco C, Mastronardi C, Pagotto F, Mack D, Ramirez-Arcos S (2008) Assessment of mastitis. Microb Pathog 144:104171. https://doi.org/10.1016/j.micpath.2020.1 biofilm-forming ability of coagulase-negative staphylococci isolated from contaminated platelet preparations in Canada. Transfusion 48(5):969–977. Yu F, Li T, Huang X, Xie J, Xu Y, Tu J, Qin Z, Parsons C, Wang J, Hu L (2012) https://doi.org/10.1111/j.1537-2995.2007.01631.x Virulence gene profiling and molecular characterization of hospital-acquired Khan A, Hussain R, Javed MT, Mahmood F (2013) Molecular analysis of virulent Staphylococcus aureus isolates associated with bloodstream infection. Diagn genes (coa and spa) of Staphylococcus aureus involved in natural cases of Microbiol Infect Dis 74(4):363–368. https://doi.org/10.1016/j.diagmicrobio.2 bovine mastitis. Pak J Agric Sci 50:739–743 012.08.015 Kot B, Szweda P, Frankowska-Maciejewska A, Piechota M, Wolska K (2016) Zecconi A, Cesaris L, Liandris E, Daprà V, Piccinini R (2006) Role of several Virulence gene profiles in Staphylococcus aureus isolated from cows with Staphylococcus aureus virulence factors on the inflammatory response in subclinical mastitis in eastern Poland. J Dairy Res 83(2):228–235. https://doi. bovine mammary gland. Microb Pathog 40(4):177–183. https://doi.org/10.101 org/10.1017/S002202991600008X 6/j.micpath.2006.01.001 Krishnamoorthy P, Suresh K, Saha S, Govindaraj G, Shome B, Roy P (2017). Meta- analysis of prevalence of subclinical and clinical mastitis, major mastitis pathogens in dairy cattle in India. Int J Curr Microbiol App Sci 6(3):1214–1234 Publisher’sNote Kumar JD, Negi YK, Gaur A, Khanna D (2009) Detection of virulence genes in Springer Nature remains neutral with regard to jurisdictional claims in Staphylococcus aureus isolated from paper currency. Int J Infect Dis 13(6): published maps and institutional affiliations. e450–e455. https://doi.org/10.1016/j.ijid.2009.02.020 Li X, Fang F, Zhao J, Lou N, Li C, Huang T, Li Y (2018a) Molecular characteristics and virulence gene profiles of Staphylococcus aureus causing bloodstream infection. Braz J Infect Dis 22(6):487–494. https://doi.org/10.1016/j.bjid.201 8.12.001 Li X, Fang F, Zhao J, Lou N, Li C, Huang T, Li Y (2018b) Molecular characteristics and virulence gene profiles of Staphylococcus aureus causing bloodstream infection. Braz J Infect Dis 22(6):487–494. https://doi.org/10.1016/j.bjid.201 8.12.001 Mehrotra M, Wang G, Johnson WM (2000) Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol 38(3):1032– 1035. https://doi.org/10.1128/JCM.38.3.1032-1035.2000 Mekonnen SA, Koop G, Melkie ST, Getahun CD, Hogeveen H, Lam TJ (2017) Prevalence of subclinical mastitis and associated risk factors at cow and herd level in dairy farms in North-West Ethiopia. Prev Vet Med 145:23–31. https:// doi.org/10.1016/j.prevetmed.2017.06.009 Oliver, S., Gonzalez, R., Hogan, J., Jayarao, B., Owens, W., 2004. Microbiological procedures for the diagnosis of bovine udder infection and determination of milk quality, Verona, WI, USA: the National Mastitis Council. Inc.[Google Scholar]. Ote I, Taminiau B, Duprez J-N, Dizier I, Mainil JG (2011) Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. Vet Microbiol 153(3-4):285–292. https://doi.org/10.1016/ j.vetmic.2011.05.042 Patel K, Joshi C, Kunjadiya A (2017) Isolation and molecular identification of Staphylococcus spp. from bovine mastitis milk samples. Int J Adv Res 5:2320– Radostits OM, Gay C, Hinchcliff KW, Constable PD (2007) A textbook of the diseases of cattle, horses, sheep, pigs and goats. Vet Med 10:2045–2050 Riffon R, Sayasith K, Khalil H, Dubreuil P, Drolet M, Lagacé J (2001) Development of a rapid and sensitive test for identification of major pathogens in bovine http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

Molecular characterization of virulence factors in Staphylococcus aureus isolated from bovine subclinical mastitis in central Ethiopia

Loading next page...
 
/lp/springer-journals/molecular-characterization-of-virulence-factors-in-staphylococcus-LPcMVsVSSP
Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2021
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1186/s13213-021-01639-3
Publisher site
See Article on Publisher Site

Abstract

Purpose: Staphylococcus aureus (S. aureus) is the most important pathogen involved in bovine mastitis in dairy production. S. aureus produces a spectrum of extracellular protein toxins and virulence factors which are thought to contribute to the pathogenicity of the organism. The aim of this work was to isolate and molecular characterize S. aureus associated with bovine subclinical mastitis in the central part of Ethiopia. Methods: A total of 265 lactating dairy cows from various dairy farms in four different geographical locations were screened by the California mastitis test (CMT) for bovine subclinical mastitis. One hundred thirty CMT-positive milk samples were collected and transported to the laboratory. Different biochemical tests and polymerase chain reaction (PCR) were used for the identification of S. aureus isolates. Finally, PCR was performed for molecular detection of virulence genes. Results: From a total of 265 lactating dairy cows screened, 49% (n = 130) were positive for bovine subclinical mastitis. One hundred thirty mastitic milk samples were subjected to bacterial culturing, and one hundred (76%) S. aureus isolates were identified based on phenotypic characters. Sixty-eight confirmed S. aureus isolates were obtained using PCR. The confirmed S. aureus isolates were tested for six virulence genes (tsst-1, hlb, eta, sea, clfA, and icaD) using PCR. Of the six virulence genes screened from all the isolates, only two (clfA and eta) were detected in the isolates. Out of 68 isolates, 25% and 22% were possessed the eta and clfA genes, respectively. Conclusion: The presence of Staphylococcus aureus having virulence genes (eta and clfA) revealed that mastitis is a major concern nowadays affecting animal health, milk quality, and yield. Further genomic study of these isolates will provide broad new insights on virulence. Keywords: Bovine, Staphylococcus aureus, Subclinical mastitis, Virulence genes * Correspondence: desiye.tegegne@gmail.com Animal Biotechnology Research Program, National Agricultural Biotechnology Research Center, Ethiopian Institute of Agricultural Research, P.O. Box: 249, Holeta, Ethiopia Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Tegegne et al. Annals of Microbiology (2021) 71:28 Page 2 of 8 Background et al., 2011). These may in turn contribute to the devel- Mastitis is considered to be the most frequent and most opment of methods to minimize the production losses costly production disease in dairy herds of developed due to mastitis. Further, the study of the evolution of and developing countries including Ethiopia. Mastitis is strain-specific transmission and virulence characteristics an inflammatory response of the teat canal as a result of including antibiotic resistance in S. aureus isolated from bacterial infection (Song et al., 2020). Staphylococcus bovine mastitis may help us to understand mechanisms aureus (S. aureus) is one of the most recognized pathogens behind the emergence of new strains or shifts in mastitis causing many serious diseases in humans and animals epidemiology in response to control measures, including worldwide and is the most common causative agent of antibiotic treatment and vaccination (Yu et al., 2012). clinical and subclinical bovine mastitis (Ote et al., 2011). However, at present, few reports have been reported Mastitis caused by S. aureus is the result of the pro- about the occurrence of virulence factors among S. aur- duction of several virulence factors that can contribute eus isolated from milk of cows suffering from mastitis in different ways of pathogenesis (Vaughn et al., 2020). but not identified by molecular technique in the central Virulence factors of S. aureus can be grouped broadly part of Ethiopia. Furthermore, there is a literature dearth into two major classes which include surface localized on the prevalence and genetic characterization of viru- structural components that serve as virulence factors lence determinants in S. aureus in Ethiopia. As to our and secreted virulence factors, which together help this knowledge, most of the researches in Ethiopia were done pathogen to evade the host’s defenses and colonize in association with the prevalence of bovine mastitis mammary glands (Diep and Otto, 2008). Some of the cases and its associated risk factors (Abera et al., 2010; surface localized structural components that serve as Tesfaye et al., 2010) but molecular data on S. aureus virulence factors include membrane-bound factors causing bovine mastitis in remain scarce. Therefore, the (collagen binding protein, fibrinogen binding protein, aim of this study was to determine the prevalence of S. elastin binding protein, and penicillin binding protein ), aureus isolates associated with bovine subclinical mas- cell wall-bound factors (protein A, β-Lactamase, and titis and the prevalence of virulence genes in those iso- protease), and cell surface-associated factors (capsule lates in central parts of Ethiopia. and slime) (Diep and Otto, 2008). Some of the known secretory virulence factors are toxins (staphylococcal en- Methods terotoxins, toxic shock syndrome toxin 1, hemolysins, Samples and study population and exfoliatin) and enzymes (coagulase, staphylokinase, Two hundred and sixty-five milk samples were collected DNAase, phosphatase, lipase, and phospholipase). In from lactating dairy cows that showed subclinical mas- addition to specific virulence factor, S. aureus also titis symptoms. Milk samples were collected from inten- possesses different mechanisms or traits such as biofilm sive production system across different geographical formation, adhesion to and invasion into mammary locations (Adaberga, Ambo, Bishoftu, and Holeta) in the epithelial cells, and formation of small colony variant central part of Ethiopia since November 2018 to June (SCV) that enables this pathogen to resist host defense 2019. Milk samples were collected and proceeded as de- mechanisms. Some of these toxins are known to function scribed in the previous study (Patel et al., 2017). Briefly, as superantigens that cause increased immunological re- udders were wiped with 70% ethyl alcohol and few drops activity in the host (Rollin et al., 2015; Bobbo et al., 2017). of milk were discarded initially. Simultaneously, CMT The differences in pathogenicity of S. aureus strains was executed on the site, and on the basis of the CMT could result from geographical distribution and from score, samples were collected (Bhatt et al., 2011; Patel host- and tissue-related characteristics (van Leeuwen et al., 2017). The study areas were purposively selected et al., 2005). The numbers and combination of virulence based on the agro-ecological differences and abundance genes may be important contributions to the pathogenic of dairy farm milk sheds. The farms included in this potential of S. aureus strains (Zecconi et al., 2006). A study were involved in the production of milk for self- high number of S. aureus genotypes present in bovine consumption and supplier to milk cooperative. herds worldwide has been studied to develop better strategies of treating mastitis (Kot et al., 2016). The Bacterial isolation and identification identification and characterization of virulence factors of Milk samples were evaluated for mastitis-causing S. aureus causing bovine mastitis will enhance our un- bacteria by bacteriological culture and biochemical tests derstanding of the pathogenesis of intramammary infec- following the National Mastitis Council Guidelines tion (Zecconi et al., 2006). In addition, the antibiogram (Oliver et al., 2004). Briefly, 100 μl of milk sample was of S. aureus needs to be studied which would indicate inoculated onto nutrient broth media (Merck, Germany) the pattern of resistance to various antibacterials with 5% sheep blood (Becton Dickinson Microbiology contributing to their virulence properties (Graveland System, Cockeysville) and incubated at 37 °C for 24 h. Tegegne et al. Annals of Microbiology (2021) 71:28 Page 3 of 8 Plates were evaluated for bacterial growth, colony EdvoCycler™ PCR machine (Edvotek, Inc, Bethesda). morphology, and hemolysis after 24 h. Each pure colony Also, all isolates were tested by PCR for the presence of was identified by Gram-stain, followed by a catalase test. the staphylococcal enterotoxin A (sea), exfoliative toxin Catalase-positive cocci were considered Staphylococcus A(eta), beta hemolysin toxin (hlb), clamping factor A species and further confirmed by polymerase chain (clfa), intercellular adhesion D (icaD), toxic shock syn- reaction (PCR) and tube coagulase test using rabbit drome toxin-1 (tsst-1), and methicillin-resistant genes plasma (NVI, Bishoftu, Ethiopia) to differentiate S. aureus according to the previously described protocol [18-21]. from coagulase-negative Staphylococcus species.The Primers used for the PCR amplification were synthesized resulting culture was used for bacterial DNA extraction, by Sigma-Aldrich (Bonn, Germany) and master mix syn- and the remaining overnight culture of S. aureus isolate in thesized by BioBasic company (BioBasic, Canada). The tryptic soy broth (TSB) (BHI, Merck, Germany) was primers used for molecular identification of different mixed with an equal volume of sterile 85% glycerol and virulence-associated genes are indicated in Table 1. stored in a −80 °C freezer for further molecular work. Lyophilized primers for the target genes were reconsti- tuted using DNase-RNase-free sterile water to obtain Bacterial DNA extraction 1000 μM stock solutions. All primers were stored at Staphylococcus aureus bacteria were sub-cultured on nu- −20 °C and then finally diluted to a working concentra- trient broth media (NB, Merck, Germany) and incubated tion of 10 μM. PCR was carried out in a total volume of at 37 °C for 24 h. Genomic DNA of all phenotypically 25 μl containing 12.5 μlof1X Taq PCR Master Mix (Bio positive S. aureus isolates was extracted from the culture Basic, Canada), 1 μl of the forward primer and 1 μlof using the Zymo Research Fungal and Bacterial Genomic the reverse primer, 3 μl of DNA template, and 7.5 μl DNA MiniPrepTM kit (Zymo Research, Irvine, USA) sterile nuclease-free water. The cyclic polymerase chain following the manufacturer’s instructions. Purity, quality, reaction conditions of the different primer sets are and quantity of extracted DNA were measured using a described in Table 2. PCR products were run on a 1% Nanodrop device (NanoDrop, Thermo Scientific, USA), agarose (w/v) gel using electrophoresis, stained with gel gel electrophoresis, and spectrophotometer. The red (Merck, Darmstadt, Germany) at 120 volts for 1 h, extracted genomic DNA was stored at −20 °C until the and visualized under UV light using a BioDoc-itTM next use. imaging system (Cambridge, UK). We used GeneRuler 100 bp Plus DNA Ladder (Bioneer). Molecular confirmation of S. aureus, detection of virulence, and methicillin-resistant genes Statistical analysis Polymerase chain reaction (PCR) was used to amplify The data generated from the study was arranged, coded, the 16SrRNA gene fragment of S. aureus isolates accord- and entered into an Excel spreadsheet (Microsoft® Office ing to the previously described protocol [17] using Excels 2010) and subjected to statistical analysis. The Table 1 Description of the primers used for molecular identification of different virulence-associated gene detection in S. aureus isolates Target gene Primer name and its sequence (5′→3′) Amplicon size (in bp) Reference mecA MECA_F: GGCTATCGTGTCACAATCGTT 689 Melo et al. (2014) MECA_R: TCACCTTGTCCGTAACCTGA 16SrRNA Sau234_F: CGATTCCCTTAGTAGCGGCG 1267 Riffon et al. (2001) Staph. aureus specific Sau1501_R: CCAATCGCACGCTTCGCCTA sea SEA_F: TTGGAAACGGTTAAAACGAA 120 Mehrotra et al. (2000) SEA_R: GAACCTTCCCATCAAAAACA tsst-1 TSST_F: ATGGCAGCATCAGCTTGATA 350 Mehrotra et al. (2000) TSST_R: TTTCCAATAACCACCCGTTT eta ETA_F: CGCTGCGGACATTCCTACATGG 676 Li et al. (2018a) ETA_R: TACATGCCCGCCACTTGCTTGT hlb HLB_F: GTGCACTTACTGACAATAGTGC 309 Li et al. (2018a) HLB_R: GTTGATGAGTAGCTACCTTCAGT clfA CLFA_F: GCAAAATCCAGCACAACAGGAAACGA 638 Kumar et al. (2009) CLFA_R: CTTGATCTCCAGCCATAATTG GTGG icaD ICAD_F: AAGCCAGACAGAGGCAATATCCA 249 Greco et al. (2008) ICAD_R: AGTACAAACAAACTCATCCATCCGA NB: Sea staphylococcal enterotoxin a, tsst-1 toxic shock syndrome toxin one, eta exfoliative toxin A, hlb beta hemolysin toxin, clfA clumping factor A, icaD intracellular adhesive toxin, mecA methicillin resistance Tegegne et al. Annals of Microbiology (2021) 71:28 Page 4 of 8 Table 2 Cyclic polymerase chain reaction conditions of the different primer sets Target genes Initial Amplification (35 cycles) Final denaturation extension Denaturation Annealing Extension mecA 94 °C/1.5 min 95 °C for 45 s 55 °C for 1 min 72 °C/45 s 72 °C/10 min 16SrRNA 94 °C/5 min 94 °C/30 s 55 °C/30 s 72 °C/45 s 72 °C/5 min S. aureus specific sea 95 °C/10 min 94 °C/2 min 55 °C/2 min 72 °C/1 min 72 °C/1 min tsst-1 95 °C/10 min 94 °C/2 min 55 °C/2 min 72 °C/1 min 72 °C/1 min eta 94 °C/5 min 94 °C/30 s 57 °C/30 s 72 °C/45 s 72 °C/10 min hlb 94 °C/5 min 94 °C/30 s 58 °C/30 s 72 °C/20 s 72 °C/10 min clfA 94 °C/10 min 94 °C/10 min 55 °C/1 min 72 °C/1 min 72 °C/10 min icaD 94 °C/10 min 94 °C/30 s 53 °C/30 s 72 °C/30 s 72 °C/10 min prevalence to every test was calculated as the number of amplification. The presence of 16SrRNA gene (1267 bp) positive cattle divided by the number of examined cases was confirmed by PCR in S. aureus-positive isolates (Fig. 1). within the specified period. The Pearson chi-square test (χ ) was applied to determine the existence of any asso- Prevalence of virulence genes in S. aureus ciation between sampling areas and virulence-associated All 68 PCR-confirmed S. aureus isolates were tested for genes using SPSS software version 22.0. six virulence genes including tsst-1, hlb, eta, sea, clfA, The significance level was set at P-value (0.05) and and icaD using PCR amplification. Of the six virulence 95% confidence level. In all cases, 95% confidence level genes screened from all the isolates, only two (clfA and and p-value less than 0.05 were considered statistical eta) were detected (Fig. 2). The isolates for the current significance. study were obtained from mastitic bovine milk samples representing four geographical locations (Adaberga, Results Ambo, Bishoftu, and Holeta) in the central parts of Isolation and identification of S. aureus isolates Ethiopia. Out of 68 isolates, 17 (25%), 15 (22%), and 6 In this study, of the 265 lactating dairy cows screened, (8.8%) isolates possessed eta, clfA, and a combination of 130 (49%) were positive for bovine mastitis based on eta and clfA genes, respectively. The large proportion of CMT. One hundred and thirty mastitic milk samples these isolates which harbor eta and clfA genes were ob- were subjected to bacterial culturing, and 100 (76%) S. tained from Holeta (46%, 7/15) and Adaberga (52%, 9/17), aureus isolates were identified based on the morpho- respectively. The prevalence of virulence genes was not logical and biochemical characters. From a total of 100 statistically significant between different sampling areas phenotypically positive S. aureus isolates, 68 (68%) of (X =1.239; P = 0.744). The prevalence rates of the viru- them were confirmed S. aureus isolates through PCR lence genes are depicted in Fig. 3. The expected PCR Fig. 1 Amplicons of the 16Sr RNA gene of representative S. aureus with a size of 1267 bp. Lane M is a 100-bp plus DNA marker (DNA ladder, BioBasic); lanes 1 to 5 are test samples Tegegne et al. Annals of Microbiology (2021) 71:28 Page 5 of 8 Fig. 2 Agarose gel electrophoresis of PCR amplicon of clfA and eta genes of representative S. aureus isolates. Lane M is a 1000-bp DNA marker (DNA ladder, Bio Basic); lanes 1 to 6 are test samples product sizes obtained from these PCR products were 638 gene. Figure 4 shows a 1.5% agarose (w/v) gel depicting and 676 bp for clfAand eta, respectively (Fig. 2). the mecA gene fragments that were amplified by PCR with the expected amplicon size (689 bp). Prevalence of methicillin-resistant (mecA) gene of Staphylococcus aureus Discussion Detecting antimicrobial-resistant genes was carried out Staphylococcus aureus is one of the major causes of mas- from the 100 S. aureus isolates, regardless of antimicro- titis that leads to a reduction of milk production in dairy bial susceptibility phenotypes. The results obtained are cattle (Krishnamoorthy et al., 2017). The control of bo- shown in Fig. 4. Methicillin resistance A (mecA) gene vine mastitis is vital not only in Ethiopia but also in the was amplified from the isolates in any of the isolates in world. Therefore, it is essential to investigate the patho- the present study. Out of the 100 isolates of S. aureus, gens using molecular techniques as vibrant components 12% (12/100) of the isolates possessed the mecA gene to control intra-mammary infections. In the dairy indus- and a large proportion of these isolates were obtained try, mastitis can be reduced by identification of exact from Holeta 58.34% (7/12). None of the isolates from pathogenesis and virulent factors present in infectious Adaberga possessed the methicillin-resistant (mecA) microorganisms. The molecular typing of infectious Fig. 3 Prevalence of virulence genes in S. aureus isolated from bovine subclinical mastitis Tegegne et al. Annals of Microbiology (2021) 71:28 Page 6 of 8 Fig. 4 Agarose gel electrophoresis analysis for the mecA gene in S. aureus isolates. Lane M = l00-bp DNA marker, lanes 1–7 = test samples agents is known to be an essential part of infection In this study, from a total of 130 CMT-positive iso- control strategies and is crucial to the track and spread lates, S. aureus was the most frequently encountered of contagious infections from one region to others or organism with an isolation rate of 76%. The predomin- among different herds. Consequently, it is crucial to ance and primary role of S. aureus isolate in bovine examine the mastitis-causing bacteria using molecular mastitis have also been reported in other studies (Abera methods as forceful tools to control IMI. Because S. aur- et al., 2012; Demissie et al., 2018). Apart from Ethiopia, eus is the most commonly contagious mastitis pathogens S. aureus has also been reported as the chief etiological worldwide, it is important to reveal virulence factors of agent of mastitis in cattle by many studies from African these agents to develop effective control strategies and Asian countries (Abebe et al., 2016). Though direct against mastitis caused by this pathogen (Khan et al., comparisons among studies might be difficult, but in 2013). In addition, an effective vaccine against IMI is not general, the variation in the prevalence between the available; therefore, prevention and control of mastitis present and previous studies might be due to differ- needs detection of the principal antigenic determinants ences in detection methods, geographical location of for the strategy and progress of more proficient vaccines the study sites, and differences in farm management against mastitis-causing bacteria, especially S. aureus. practices in each studied farms. S. aureus is adapted to A number of studies have been conducted in Ethiopia survive in the udder and usually establishes mild sub- on the prevalence of S. aureus in bovine milk (Abera clinical infection of long duration from which it is shed et al., 2012; Mekonnen et al., 2017). Most of these through milk serving as the source of infection for researches focused on the importance of this pathogen other healthy cows and transmitted during the milking as a cause of clinical and subclinical mastitis; however, process (Radostits et al., 2007). Hence, the organism its virulence determinants have not been well addressed. has been assuming apposition of major importance as a To our knowledge, there is no reliable information on cause of bovine mastitis. molecular data of virulence genes in S. aureus from mas- Out of 100 phenotypically positive S. aureus isolates, titic bovine milk samples in Ethiopia. Epidemiological 68% of them were confirmed S. aureus isolates by using studies indicate that S. aureus strain agents of milk PCR amplification. The finding of this study was in produce a group of virulence factors and it is believed agreement with Li et al. (2018b). Regardless of the isola- that there is a relationship between the severity of the tion and identification techniques employed, the con- infection and the virulence factors produced by S. aureus firmation of S. aureus in milk using molecular highlights (Almaw et al., 2008). Hence, in this study, the prevalence the need for both strict farm management practices and of certain virulence genes such as sea, eta, hlb, clfA, proper sanitary procedures to be implemented during icaD, and tsst-1 for S. aureus was evaluated. milking operations. Tegegne et al. Annals of Microbiology (2021) 71:28 Page 7 of 8 The pathogenicity of S. aureus is closely related to the adhesive toxin D; P-value: Predictive value; PCR: Polymerase chain reaction; Sea: Staphylococcal enterotoxin a; tsst-1: Toxic shock syndrome toxin one; presence of various virulence genes (Kot et al., 2016). In χ : Pearson chi-square this study, six virulence factors of the pathogen were screened but only two of them were positive based on Acknowledgements The authors greatly appreciate the contribution made by the Ethiopian PCR amplification. Our data showed that 15 out of 68 S. Institute of Agricultural Research, National Agricultural Biotechnology aureus isolates carried exfoliative toxin A (eta) (22.05%) Research Center, in funding this project and the staff of the Animal and 17 out of 68 S. aureus isolates contained clfA (25%) Biotechnology Research Laboratory for assisting during the bench work which has led to the success of this study. We are thankful to the farmers genes. Of 68 S. aureus examined, 32 (47.05%) were and veterinarians who provided the milk samples used in this study. positive for one or more virulence genes. About half (52.95%) of the isolates did not contain any of the Authors’ contributions virulence genes tested. The eta and clfA were found at The research idea and study design was developed by DTT. Sample collection were done by DTT, GM, HW and YEM. DTT supervised the study. higher frequencies whereas sea, hlb, icaD,and tsst-1 DTT and YEM provided valuable information on data analysis and manuscript were not found in all tested isolates. Five isolates writing. All authors read and approved the fnal manuscript. harbored both eta and clfA genes. There has been no published information regarding clamping factor A Funding This study was supported by the Ethiopian Institute of Agricultural Research (clfA) and exfoliative toxin A (eta) in the Ethiopian and Addis Ababa University. The institutions had no role in the design of the context. This is the first investigation regarding these study; in the collection, analysis, and interpretation of the data; and in genes in Ethiopia and there is no other work on these writing the manuscript. virulence factors. This finding is different from Availability of data and materials Srinivasan et al. (2006) who examined 78 S. aureus iso- The datasets used and/or analyzed during the current study are available lates from the milk of cows with mastitis for 16 entero- from the corresponding author on reasonable request. toxin genes and found that 73 (93.6%) of the isolates Declarations were positive for one or more enterotoxin genes from a similar area. However, Srinivasan et al. (2006) tested for Ethics approval and consent to participate 16 enterotoxin genes whereas in this study only one en- This study was conducted after gaining full approval by the ethical review board of the College of Veterinary Medicine and Agriculture, Addis Ababa terotoxin gene was tested. This might be the reason for University, Ethiopia. Informed written consent was taken from all participants the low prevalence of positive isolates in this study. The prior to participation in this study. Also, permission from dairy farm owners/ presence of the clumping factor gene is considered as managers was obtained before the collection of milk samples. Staphylococcus species virulence gene in the development Consent for publication and severity of mastitis in cows (Aarestrup et al., 1995). Not applicable The above results suggested that S. aureus isolates with different genetic backgrounds have different abilities to ac- Competing interests The authors declare that they have no competing interests. quire mobile genetic elements such as plasmids, phages, and pathogenicity islands. Author details Animal Biotechnology Research Program, National Agricultural Biotechnology Research Center, Ethiopian Institute of Agricultural Research, Conclusions P.O. Box: 249, Holeta, Ethiopia. Addis Ababa University, College of Veterinary The high prevalence of virulence genes (clfA and eta)in Medicine and Agriculture, Department of Veterinary Microbiology, S. aureus bacteria was the most important finding of our Immunology and Public Health, P.O. Box: 34, Bishoftu, Ethiopia. study. All of the S. aureus bacteria harbored clfA and eta Received: 22 March 2021 Accepted: 24 June 2021 putative virulence factors which showed that they can be use as specific genetic markers for detection of patho- genic S. aureus bacteria in bovine subclinical mastitis References Aarestrup FM, Wegener H, Rosdahl V (1995) Evaluation of phenotypic and cows. The presence of virulence factors in mastitis- genotypic methods for epidemiological typing of Staphylococcus aureus causing Staphylococcus aureus is an alarming spot for isolates from bovine mastitis in Denmark. Vet Microbiol 45(2-3):139–150. veterinarians, as several sources are there for spreading https://doi.org/10.1016/0378-1135(95)00043-A Abebe R, Hatiya H, Abera M, Megersa B, Asmare K (2016) Bovine mastitis: of microorganisms to human being. The emergence of prevalence, risk factors and isolation of Staphylococcus aureus in dairy herds different antibiotic resistance and virulence in the last at Hawassa milk shed, South Ethiopia. BMC Vet Res 12(1):270. https://doi. two decades is exerting a lot of pressure in the health org/10.1186/s12917-016-0905-3 Abera M, Demie B, Aragaw K, Regassa F, Regassa A (2010) Isolation and sector. Detailed genomic evaluation of particular identification of Staphylococcus aureus from bovine mastitic milk and their antibiotic-resistant strain with virulent factors may possess drug resistance patterns in Adama town, Ethiopia. J Vet Med Anim Health 2: a great scope to develop a new disease control strategy. 29–34 Abera M, Habte T, Aragaw K, Asmare K, Sheferaw D (2012) Major causes of Abbreviations mastitis and associated risk factors in smallholder dairy farms in and around clfA: Clumping factor A; CMT: California mastitis test; DNA: Deoxyribonucleic Hawassa, Southern Ethiopia. Trop Anim Health Prod 44(6):1175–1179. https:// acid; eta: Exfoliative toxin A; hlb: Beta hemolysin toxin; icaD: Intracellular doi.org/10.1007/s11250-011-0055-3 Tegegne et al. Annals of Microbiology (2021) 71:28 Page 8 of 8 Almaw G, Zerihun A, Asfaw Y (2008) Bovine mastitis and its association with mastitis by PCR. J Clin Microbiol 39(7):2584–2589. https://doi.org/10.1128/ selected risk factors in smallholder dairy farms in and around Bahir Dar, JCM.39.7.2584-2589.2001 Ethiopia. Trop Anim Health Prod 40(6):427–432. https://doi.org/10.1007/s112 Rollin E, Dhuyvetter K, Overton M (2015) The cost of clinical mastitis in the first 50-007-9115-0 30 days of lactation: an economic modeling tool. Prev Vet Med 122(3):257– Bhatt VD, Patel MS, Joshi CG, Kunjadia A (2011) Identification and antibiogram of 264. https://doi.org/10.1016/j.prevetmed.2015.11.006 microbes associated with bovine mastitis. Anim Biotechnol 22(3):163–169. Song X, Huang X, Xu H, Zhang C, Chen S, Liu F, Guan S, Zhang S, Zhu K, Wu C https://doi.org/10.1080/10495398.2011.570132 (2020) The prevalence of pathogens causing bovine mastitis and their associated risk factors in 15 large dairy farms in China: an observational Bobbo T, Ruegg P, Stocco G, Fiore E, Gianesella M, Morgante M, Pasotto D, study. Vet Microbiol 247:108757. https://doi.org/10.1016/j.vetmic.2020.108757 Bittante G, Cecchinato A (2017) Associations between pathogen-specific Srinivasan V, Sawant AA, Gillespie BE, Headrick SJ, Ceasaris L, Oliver SP (2006) cases of subclinical mastitis and milk yield, quality, protein composition, and Prevalence of enterotoxin and toxic shock syndrome toxin genes in cheese-making traits in dairy cows. J Dairy Sc 100(6):4868–4883. https://doi. Staphylococcus aureus isolated from milk of cows with mastitis. Foodbourne org/10.3168/jds.2016-12353 Pathog Dis 3(3):274–283. https://doi.org/10.1089/fpd.2006.3.274 Demissie TF, Menghistu HT, Mitiku MA (2018) Prevalence of mastitis and Tesfaye GY, Regassa FG, Kelay B (2010) Milk yield and associated economic losses identification of its bacterial causative agents in small holder dairy farms in in quarters with subclinical mastitis due to Staphylococcus aureus in and around Wukro of Tigray region, Ethiopia. Int. J. Adv. Res. Biol. Sci 5:10–22 Ethiopian crossbred dairy cows. Trop Anim Health Prod 42(5):925–931. Diep BA, Otto M (2008) The role of virulence determinants in community- https://doi.org/10.1007/s11250-009-9509-2 associated MRSA pathogenesis. Trends Microbiol 16(8):361–369. https://doi. van Leeuwen WB, Melles DC, Alaidan A, Al-Ahdal M, Boelens HA, Snijders SV, org/10.1016/j.tim.2008.05.002 Wertheim H, van Duijkeren E, Peeters JK, van der Spek PJ (2005) Host- and Graveland H, Duim B, Van Duijkeren E, Heederik D, Wagenaar JA (2011) Livestock- tissue-specific pathogenic traits of Staphylococcus aureus. J Bacteriol 187(13): associated methicillin-resistant Staphylococcus aureus in animals and 4584–4591. https://doi.org/10.1128/JB.187.13.4584-4591.2005 humans. Int J Med Microbiol 301(8):630–634. https://doi.org/10.1016/j.ijmm.2 Vaughn J, Abdi RD, Gillespie BE, Dego OK (2020) Genetic diversity and virulence 011.09.004 characteristics of Staphylococcus aureus isolates from cases of bovine Greco C, Mastronardi C, Pagotto F, Mack D, Ramirez-Arcos S (2008) Assessment of mastitis. Microb Pathog 144:104171. https://doi.org/10.1016/j.micpath.2020.1 biofilm-forming ability of coagulase-negative staphylococci isolated from contaminated platelet preparations in Canada. Transfusion 48(5):969–977. Yu F, Li T, Huang X, Xie J, Xu Y, Tu J, Qin Z, Parsons C, Wang J, Hu L (2012) https://doi.org/10.1111/j.1537-2995.2007.01631.x Virulence gene profiling and molecular characterization of hospital-acquired Khan A, Hussain R, Javed MT, Mahmood F (2013) Molecular analysis of virulent Staphylococcus aureus isolates associated with bloodstream infection. Diagn genes (coa and spa) of Staphylococcus aureus involved in natural cases of Microbiol Infect Dis 74(4):363–368. https://doi.org/10.1016/j.diagmicrobio.2 bovine mastitis. Pak J Agric Sci 50:739–743 012.08.015 Kot B, Szweda P, Frankowska-Maciejewska A, Piechota M, Wolska K (2016) Zecconi A, Cesaris L, Liandris E, Daprà V, Piccinini R (2006) Role of several Virulence gene profiles in Staphylococcus aureus isolated from cows with Staphylococcus aureus virulence factors on the inflammatory response in subclinical mastitis in eastern Poland. J Dairy Res 83(2):228–235. https://doi. bovine mammary gland. Microb Pathog 40(4):177–183. https://doi.org/10.101 org/10.1017/S002202991600008X 6/j.micpath.2006.01.001 Krishnamoorthy P, Suresh K, Saha S, Govindaraj G, Shome B, Roy P (2017). Meta- analysis of prevalence of subclinical and clinical mastitis, major mastitis pathogens in dairy cattle in India. Int J Curr Microbiol App Sci 6(3):1214–1234 Publisher’sNote Kumar JD, Negi YK, Gaur A, Khanna D (2009) Detection of virulence genes in Springer Nature remains neutral with regard to jurisdictional claims in Staphylococcus aureus isolated from paper currency. Int J Infect Dis 13(6): published maps and institutional affiliations. e450–e455. https://doi.org/10.1016/j.ijid.2009.02.020 Li X, Fang F, Zhao J, Lou N, Li C, Huang T, Li Y (2018a) Molecular characteristics and virulence gene profiles of Staphylococcus aureus causing bloodstream infection. Braz J Infect Dis 22(6):487–494. https://doi.org/10.1016/j.bjid.201 8.12.001 Li X, Fang F, Zhao J, Lou N, Li C, Huang T, Li Y (2018b) Molecular characteristics and virulence gene profiles of Staphylococcus aureus causing bloodstream infection. Braz J Infect Dis 22(6):487–494. https://doi.org/10.1016/j.bjid.201 8.12.001 Mehrotra M, Wang G, Johnson WM (2000) Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol 38(3):1032– 1035. https://doi.org/10.1128/JCM.38.3.1032-1035.2000 Mekonnen SA, Koop G, Melkie ST, Getahun CD, Hogeveen H, Lam TJ (2017) Prevalence of subclinical mastitis and associated risk factors at cow and herd level in dairy farms in North-West Ethiopia. Prev Vet Med 145:23–31. https:// doi.org/10.1016/j.prevetmed.2017.06.009 Oliver, S., Gonzalez, R., Hogan, J., Jayarao, B., Owens, W., 2004. Microbiological procedures for the diagnosis of bovine udder infection and determination of milk quality, Verona, WI, USA: the National Mastitis Council. Inc.[Google Scholar]. Ote I, Taminiau B, Duprez J-N, Dizier I, Mainil JG (2011) Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. Vet Microbiol 153(3-4):285–292. https://doi.org/10.1016/ j.vetmic.2011.05.042 Patel K, Joshi C, Kunjadiya A (2017) Isolation and molecular identification of Staphylococcus spp. from bovine mastitis milk samples. Int J Adv Res 5:2320– Radostits OM, Gay C, Hinchcliff KW, Constable PD (2007) A textbook of the diseases of cattle, horses, sheep, pigs and goats. Vet Med 10:2045–2050 Riffon R, Sayasith K, Khalil H, Dubreuil P, Drolet M, Lagacé J (2001) Development of a rapid and sensitive test for identification of major pathogens in bovine

Journal

Annals of MicrobiologySpringer Journals

Published: Jul 13, 2021

Keywords: Bovine; Staphylococcus aureus; Subclinical mastitis; Virulence genes

References