Access the full text.
Sign up today, get DeepDyve free for 14 days.
MS Brown, JL Goldstein (1986)
A receptor-mediated pathway for cholesterol homeostasisScience, 232
SH Al-Sheraji, A Ismail, MY Manap, S Mustafa, RM Yusof, FA Hassan (2012)
Hypocholesterolaemic effect of yoghurt containing Bifidobacterium pseudocatenulatum G4 or Bifidobacterium longum BB536Food Chem, 135
OH Lowry, NJ Rosebrough, AL Farr, RJ Randall (1951)
Protein measurement with the Folin phenol reagentJ Biol Chem, 193
M Sanchez, C Darimont, V Drapeau, S Emady-Azar, M Lepage, E Rezzonico, C Ngom-Bru, B Berger, L Philippe, C Ammon-Zuffrey, P Leone (2014)
Effect of Lactobacillus rhamnosus CGMCC1. 3724 supplementation on weight loss and maintenance in obese men and womenBr J Nutr, 111
TS Kemgang, S Kapila, VP Shanmugam, S Reddi, R Kapila (2016)
Fermented milk with probiotic Lactobacillus rhamnosus S1K3 (MTCC5957) protects mice from salmonella by enhancing immune and nonimmune protection mechanisms at intestinal mucosal levelJ Nutr Biochem, 30
XL Zhang, YF Wu, YS Wang, XZ Wang, CH Piao, JM Liu, YH Wang (2017)
The protective effects of probiotic-fermented soymilk on high-fat diet-induced hyperlipidemia and liver injuryJ Funct Foods, 30
DE Paglia, WN Valentine (1967)
Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidaseJ Lab Clin Med, 70
S Gielen, U Landmesser (2014)
The year in cardiology 2013: cardiovascular disease preventionEur Heart J, 35
S Menard, C Candalh, JC Bambou, K Terpend, N Cerf-Bensussan, M Heyman (2004)
Lactic acid bacteria secrete metabolites retaining anti-inflammatory properties after intestinal transportGut, 53
SC Hung, WT Tseng, TM Pan (2016)
Lactobacillus paracasei subsp. paracasei NTU 101 ameliorates impaired glucose tolerance induced by a high-fat, high-fructose diet in Sprague-Dawley ratsJ Funct Foods, 24
D Kaushal, VK Kansal (2012)
Probiotic dahi containing Lactobacillus acidophilus and Bifidobacteriumbifidum alleviates age-inflicted oxidative stress and improves expression of biomarkers of ageing in miceMol Biol Rep, 39
N Kumar, SK Tomar, K Thakur, AK Singh (2017)
The ameliorative effects of probiotic Lactobacillus fermentum strain RS-2 on alloxan induced diabetic ratsJ Funct Foods, 28
H Kimoto, S Ohmomo, T Okamoto (2002)
Cholesterol removal from media by lactococciJ Dairy Sci, 85
GN Levine, JF Keaney, JA Vita (1995)
Cholesterol reduction in cardiovascular disease—clinical benefits and possible mechanismsN Engl J Med, 332
CS Liu, CC Lin, TC Li (1999)
The relation of white blood cell counts and athero- genic index ratio of LDL-cholesterol to HDL-cholesterol in Taiwan school childrenActa Paediatr Taiwanica, 40
F Yan, H Cao, TL Cover, R Whitehead, MK Washington, DB Polk (2007)
Soluble proteins produced by probiotic bacteria regulate intestinal epithelial cell survival and growthGastroenterology, 132
J Folch, M Lees, GH Sloane-Stanley (1957)
A simple method for the isolation and purification of total lipids from animal tissuesJ Biol Chem, 226
R Sharma, R Kapila, G Dass, S Kapila (2014)
Improvement in Th1/Th2 immune homeostasis, antioxidative status and resistance to pathogenic E coli on consumption of probiotic Lactobacillus rhamnosus fermented milk in aging miceAge, 36
Y Huang, X Wang, J Wang, F Wu, Y Sui, L Yang, Z Wang (2013)
Lactobacillus plantarum strains as potential probiotic cultures with cholesterol-lowering activityJ Dairy Sci, 96
V Saliganti, R Kapila, R Sharma, S Kapila (2015)
Feeding probiotic Lactobacillus rhamnosus (MTCC 5897) fermented milk to suckling mothers alleviates ovalbumin-induced allergic sensitisation in mice offspringBr J Nutr, 114
J Ewaschuk, R Endersby, D Thiel, H Diaz, J Backer, M Ma, T Churchill, K Madsen (2007)
Probiotic bacteria prevent hepatic damage and maintain colonic barrier function in a mouse model of sepsisHepatology, 46
DR Michael, TS Davies, JW Moss, DL Calvente, DP Ramji, JR Marchesi, A Pechlivanis, SF Plummer, TR Hughes (2017)
The anti-cholesterolaemic effect of a consortium of probiotics: an acute study in C57BL/6J miceSci Rep, 7
KL Osterberg, NE Boutagy, RP McMillan, JR Stevens, MI Frisard, JW Kavanaugh, MW Hulver (2015)
Probiotic supplementation attenuates increases in body mass and fat mass during high-fat diet in healthy young adultsObesity, 23
WT Friedewald, RI Levy, DS Fredrickson (1972)
Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifugeClin Chem, 18
H Aebi (1984)
[13] Catalase in vitroMethods Enzymol, 105
S Kalyan, S Meena, S Kapila, K Sowmya, R Kumar (2018)
Evaluation of goat milk fat and goat milk casein fraction for anti-hypercholesterolaemic and antioxidative properties in hypercholesterolaemic ratsInt Dairy J, 84
SW Coppack (2001)
Pro-inflammatory cytokines and adipose tissueProc Nutr, 60
SH Al-Sheraji (2012)
356Food Chem, 135
M Kumar, R Shruti, N Ravinder, RA Hemalatha, V Sudarshan, R Ramagoni (2013)
Probiotic Lactobacillus rhamnosus GG and aloe vera gel improve lipid profiles in hypercholesterolemic ratsNutrition, 29
EA Choi, HC Chang (2015)
Cholesterol-lowering effects of a putative probiotic strain Lactobacillus plantarum EM isolated from kimchiLWT-Food Sci Technol, 62
Y Yonejima, K Ushida, Y Mori (2013)
Lactobacillus gasseri NT decreased visceral fat through enhancement of lipid excretion in feces of KK-A y miceBiosci Biotechnol Biochem, 77
Y Liu, F Zhao, J Liu, H Wang, X Han, Y Zhang, Z Yang (2017)
Selection of cholesterol-lowering lactic acid bacteria and its effects on rats fed with high-cholesterol dietCurr Microbiol, 74
C Dai, DH Zhao, M Jiang (2012)
VSL# 3 probiotics regulate the intestinal epithelial barrier in vivo and in vitro via the p38 and ERK signaling pathwaysInt J Mol Med, 29
JZ Xiao, S Kondo, N Takahashi, K Miyaji, K Oshida, A Hiramatsu, K Iwatsuki, S Kokubo, A Hosono (2003)
Effects of milk products fermented by Bifidobacteriumlongum on blood lipids in rats and healthy adult male volunteersJ Dairy Sci, 86
H Aebi (1984)
121Methods Enzymol, 105
(1990)
Official methods of analysis
M Boers, MT Nurmohamed, CJ Doelman, LR Lard, AC Verhoeven, AE Voskuyl, TW Huizinga, RJ Stadt, BA Dijkmans, S Linden (2003)
Influence of glucocorticoids and disease activity on total and high density lipoprotein cholesterol in patients with rheumatoid arthritisAnn Rheum Dis, 62
JL Goldstein, MS Brown (1990)
Regulation of the mevalonate pathwayNature, 343
SR Yoo, YJ Kim, DY Park, UJ Jung, SM Jeon, YT Ahn, MS Choi (2013)
Probiotics L. plantarum and L. curvatus in combination alter hepatic lipid metabolism and suppress diet-induced obesityObesity, 21
S Marklund, G Marklund (1974)
Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutaseFEBS J, 47
MT Liong, NP Shah (2005)
Acid and bile tolerance and cholesterol removal ability of lactobacilli strainsJ Dairy Sci, 88
The current study was intended to investigate the cholesterol-lowering potential of the two Lactobacillus rhamnosus probiotic strains, LR 5957 and LR 5897, isolated from ‘dahi’. Cholesterol-lowering ability of both strains was determined in in vitro conditions. For in vivo investigations, the Wistar rats were randomly assigned into five groups and treated with different diets: standard diet (SD), high-cholesterol diet (HCD), HCD with Milk, HCD with LR 5957–fermented milk, and HCD with LR 5897– fermented milk. After 3 months of feeding, different parameters of hypercholesterolemia were measured in blood, feces, liver, and kidney. Both the strains, LR 5957 and LR 5897, showed the ability to grow in the presence of cholesterol and eliminate the cholesterol under in vitro conditions. In vivo results indicate that consumption of probiotic-fermented milk has significantly reduced the HCD-induced body weight, hyperlipidemia, and hepatic lipids (total cholesterol and triacylglycerol). Further, increased cholesterol excretion in feces was also observed in probiotic-fed groups. The studied fermented milk also helped to maintain healthy liver and kidney by increasing the antioxidant activities and decreasing the lipid peroxidation. Consumption of probiotic-fermented milk also found to decrease the mRNA expression of the inflammatory markers TNF-α and IL-6 in the liver. Overall, our results indicate that the L. rhamnosus strains, LR 5957 and LR 5897, are two potential probiotic strains that can ameliorate the diet-induced hypercholesterolemia. . . . Keywords Probiotics Hypercholesterolemia Probiotic-fermented milk Lactobacillus rhamnosus Introduction inflammatory cytokines such as tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6) (Coppack 2001)which Hypercholesterolemia is a common cause of concern for plays a crucial role in the development of oxidative stress, all humans since it constitutes a high risk factor for which further triggers lipid peroxidation, tissue injury, and cardiovascular diseases (CVD) such as atherosclerosis, liver cirrhosis. In healthy subjects, enzymes such as superox- diabetes, and hypertension (Gielen and Landmesser 2014). ide dismutase (SOD), catalase (CAT), glutathione (GSH), and Hypercholesterolemia constitutes abnormally high levels of glutathione-related enzymes protect tissues from oxidative total cholesterol (TC), low-density lipoprotein (LDL)-choles- stress (Yoo et al. 2013). However, excessive consumption of terol, and triacylglycerol (TGs), and low levels of high-density cholesterol adversely affects above antioxidation mechanism lipoprotein (HDL)-cholesterol in the blood and blood vessels. and augments oxidative processes in the tissues causing DNA, Long-term cholesterol consumption causes dysregulated lipid protein, and lipid damage. metabolism and leads to hypercholesterolemia. Excess lipid Excess dietary intake of cholesterol also leads to accumu- accumulation in the body arouses the activity of pro- lation of cholesterol in blood vessels and causes atherosclero- sis and associated diseases such as coronary heart disease and peripheral vascular disease. As treatment strategy, statins are widely used to normalize the elevated circulating cholesterol * Radha Yadav levels and can reduce CVD-related events. But, due to their radhanuniwal@gmail.com potential association with adverse side effects such as liver 1 damage and carcinogenicity, their safety has been questioned Animal Biochemistry Division, National Dairy Research Institute, for a long time (Levine et al. 1995). Therefore, high mortality Karnal, Haryana 132001, India 484 Ann Microbiol (2019) 69:483–494 rates associated with CVD and increasing safety concerns In vitro cholesterol removal activity associated with current treatment methods demand an alterna- tive therapeutic strategy to combat CVD. Government poli- The effect of cholesterol on the growth of lactobacilli cultures cies favoring dairy industry in India besides growing aware- was investigated according to Liong and Shah (2005). Briefly, ness and rising preferences of consumers for probiotic usages probiotics were cultured in MRS Broth supplemented with have generated a great deal of attention towards probiotic cholesterol and 0.3% oxgal for 18 h in aerobic conditions. foods. Many recent studies led to renewed interest in An aliquot of 2 mL of spent MRS media was taken from probiotic bacteria as a potential supplementation tool bacterial culture at every 2 h interval during culturing. in combating CVD and associated complications. The Thereafter, bacterial growth was measured by spectrophotom- cholesterol-lowering efficacy of probiotic bacteria is eter at 600 nm and the effect of cholesterol on bacterial growth highly strain-specific. Probiotics were shown to attenu- was evaluated by plotting optical density and time interval on ate hypercholesterolemia by rebalancing the blood lipid Y and X axis respectively. The cholesterol assimilating ability profile (Xiao et al. 2003), increasing the cholesterol ex- of growing, resting, and dead LR 5957 and LR 5897 bacterial cretion in feces (Salaj et al. 2013), promoting the activ- cells was assessed by following the methods of Kimoto et al. ities of antioxidative defense system (Yoo et al. 2013), (2002) and Liong and Shah (2005) withslightmodifications. and decreasing the pro-inflammatory signaling cascade The cholesterol concentration in MRS was determined using (Dai et al. 2012) in hypercholesterolemic subjects. commercial enzymatic kit, Span Diagnostics Pvt. Ltd., Surat, Lactobacillus rhamnosus MTCC: 5957 (LR 5957) and India, as per the standard protocol recommended by the com- Lactobacillus rhamnosus MTCC: 5897 (LR 5897) were orig- pany. The percentage of cholesterol reduction in broth was inally isolated in our lab from locally fermented milk product calculated comparing with control. Each result was the in India called Bdahi^ and characterized for their probiotic average of three independent assays. attributes in previous studies (Sharma et al. 2014;Kemgang et al. 2016). LR 5957 was studied for its ability to induce Cholesterol reduction% mucosal and systemic compartments of immune system ¼½1−ðÞ residual cholesterol in cell free broth = (Kemgang et al. 2016). Whereas, LR 5897–fermented milk has been proved to resist immunosenescence during aging ðÞ cholesterol in control broth 100 along with oxidative stress in the liver and red blood cells (Sharma et al. 2014). LR 5897 was also studied for its Preparation of probiotic-fermented milk potential to alleviate allergic responses in newborn mice during weaning transition when fed as fermented milk for treatment groups to mothers and their babies (Saliganti et al. 2015). Considering Lactobacillus strains, LR 595 7 and LR 5897, were sub- the above probiotic attributes of these strains, in the present study, we aimed to explore the antihypercholesterolemic po- cultured (1% v/v)in sterilizedskimmilkat37°C/18 h. Probiotic-fermented milk (PFM) was prepared by inoculating tential of LR 5957– and LR 5897–fermented milk in the Wistar rats. fresh milk (2.5% fat) with 1% activated LR 5957 and LR 5897 culturein skimmilkfollowedbyincubationat 37 °C/18 h. As a control, uninoculated sterilized milk was simultaneously incubated under similar conditions. Material and methods The number of bacteria in the fermented milk was de- termined by plate counting on MRS agar plates after Source and maintenance of probiotic cultures aerobic incubation at 37 °C/48 h. Milk was used as a vehicle because it is a convenient way of probiotic consumption in The two indigenous probiotic strains, Lactobacillus India. rhamnosus MTCC: 5957 (LR 5957) and Lactobacillus rhamnosus MTCC: 5897 (LR 5897), used in present study were isolated from locally fermented milk product called Experimental design and feeding schedule Bdahi^ and characterized earlier for their probiotic attributes, immunomodulatory, and antioxidative properties (Sharma Six-week-old male Wistar rats (n = 30) approximately of sim- et al. 2014; Kemgang et al. 2016). Cultures were stored at − ilar body weight (BW), 155 g, were procured from the small 80 °C in MRS Broth supplemented with 20% glycerol and animal house of ICAR-National Dairy Research Institute, propagated twice in MRS Broth prior to use. Before each Karnal, Haryana, India, to conduct the experiments. Rats were experiment, purity and morphological identification of housed in polypropylene cages under controlled conditions of lactobacilli were confirmed microscopically by gram- temperature (24 ± 1 °C), humidity (55 ± 5%), and light (12-h positive and negative staining. light/dark). After 2 weeks of adaptive period on standard diet, Ann Microbiol (2019) 69:483–494 485 30 rats were randomly assigned to five groups of six rats each HDL-C levels were determined using enzymatic colorimetric and fed as follows: kits as per instructions of the manufacturer (Span Diagnostics Pvt. Ltd., Surat, India). 1. SD group maintained on standard diet LDL-C and very low-density lipoprotein-cholesterol 2. HCD group maintained on high-cholesterol diet (VLDL-C) were calculated according to Friedewal’sequation 3. HCD + milk group maintained on high-cholesterol diet (Friedewald et al. 1972). supplemented with milk (2 mL/animal/day) LDL−C ¼½ TC− HDL−C—ðÞ TGs=5 4. HCD + LR 5957group maintained on high-cholesterol VLDL−C ¼ TG=5 diet supplemented with LR: 5957–fermented milk (2 × 10 cfu/animal/day in 2 mL PFM) Atherogenic index (AI) was calculated according to the 5. HCD + LR 5897 group maintained on high-cholesterol method described by Liu et al. (1999) and expressed as: diet supplemented with LR: 5897–fermented milk (2 × 10 cfu/animal/day in 2 mL PFM). AI ¼ðÞ TC—HDL−C =HDL−C The animals were maintained on 15 g standard diet (SD) or Coronary artery risk index (CRI) was calculated using the high-cholesterol diet (HCD) per day for 3 months. The com- ponents of SD and HCD diet are prepared and mixed following formula (Boers et al. 2003). according to AOAC (1990) as shown in Table 1. The fat source used for the preparation of the standard chew diet CRI ¼ TC=HDL−C was refined soybean oil obtained from a commercial supplier (Fortune, Adani Wilmar Limited, India). A single lot of soy- bean oil was used for the whole experiment. The cellulose Effect of probiotic-fermented milk on feces used in the diet was of analytical grade (Product code 025791) and obtained from Central Drug House Pvt. Ltd., At 30 days of interval, feces were collected in a sterile tube India.Water was provided ad libitum and replaced daily gently stimulating the rectal part and were processed within throughout the 3 months of experimental feeding. The com- 60 min of collection for enumeration of fecal bacteria and plete experimental design was shown in Fig. 1. cholesterol concentration. Feces were homogenized in sterile PBS (pH 7.2), serially 6 8 Effect of probiotic fermented milk on serum lipid diluted, followed by plating of appropriate dilutions (10 –10 ) profile on MRS agar for fecal bacteria count on MRS. The plates were incubated at 37 °C for 24–48 h. The colonies were sub- Blood samples were collected from the orbital venous plexus, jected to morphological and biochemical analysis. using a capillary tube from overnight-fasted rats at regular The feces were homogenized in chloroform methanol (2:1) intervals. At the end of the experiment, all fasting experimen- mixture in accordance with the method described by Folch et al. tal rats were sacrificed and blood was collected from the heart (1957). Amount of cholesterol excreted in feces was estimated by cardiac puncture. Serum was collected by centrifuging the by using enzymatic colorimetric kits as per instructions of the blood samples at 4000×g for 10 min at 4 °C and was then manufacturer (Span Diagnostics Pvt. Ltd., Surat, India). The stored at − 80 °C. Serum parameters including TC, TG, and kits were based on enzymatic colorimetric methods. Table 1 Composition of standard S. no. Component Standard diet (SD) High-cholesterol diet (HCD) diet and high-cholesterol diet (g/100 g ratio) 1 Starch 53.200 51.325 2 Casein 20.000 20.000 3 Sucrose 10.000 10.000 4 Soybean oil 7.000 7.000 5 Cellulose 5.000 5.000 6 Vitamin mixture 1.000 1.000 7 Mineral mixture 3.500 3.500 8 Methionine 0.300 0.300 9 Cholesterol – 1.500 10 Sodium cholate – 0.375 486 Ann Microbiol (2019) 69:483–494 Fig. 1 Experimental design VLDL-C TC TGs Lipid LDL-C analysis HDL-C Serum SD group Lactobacilli Rats count Feces HCD group Cholesterol Histology HCD + Milk Aorta analysis HCD rats group CAT SOD HCD + 5957 Anoxidave Kidney group enzymes GPx Lipid HCD +5897 peroxidaon group Liver CAT SOD Anoxidave 3 Months treatment, n=6 enzymes GPx Lipid Inflammatory peroxidaon IL-6 cytokines TNF-α Real -me Bile acid CYP7A1 synthesis HMG-CoA Cholesterol synthesis Effect of probiotic-fermented milk consumption measuring the rate of oxidation of NADPH, using cumene on liver parameters hydroperoxide as a substrate (Paglia and Valentine 1967). The enzyme activity was calculated using an extinction coef- 3 −1 −1 At the end of the experiment, liver tissues were carefully re- ficient of 6.22 × 10 M cm , and 1 unit was defined as moved, washed with phosphate buffer saline, blotted dry, and 1 mmol of NADPH oxidized per min. Results are expressed processed for biochemical measurements. One gram of liver as units/mg of total protein for liver enzymes. tissue was homogenized in 10 volume of ice-cold phosphate Lipid peroxidation was assayed by monitoring thiobarbitu- buffer (50 mM, pH − 7.4), using a homogenizer. The liver ric acid reactive substances (TBARS) level using previously homogenate was centrifuged at 3000×g at 4 °C for 15 min, described method (Kaushal and Kansal 2012). and the supernatant was analyzed for antioxidative enzyme HMGR (3-hydroxy-3-methyl-glutaryl-coenzyme A reduc- activities, lipid peroxidation, and HMG-CoA reductase (3-hy- tase) activity in the liver was estimated by HMG-CoA droxy-3-methyl-glutaryl-coenzyme A reductase) activity. Reductase Assay Kit (Sigma-Aldrich, USA). Total proteins in liver tissue were estimated by using the meth- Hepatic lipids including TC and TG levels were deter- od described by Lowry et al. (1951). For estimation of hepatic mined using enzymatic colorimetric kits as per instructions TC and TGs, liver tissue was homogenized in 2 mL of of the manufacturer (Span Diagnostics Pvt. Ltd., Surat, India). chloroform:methanol (2:1) mixture in accordance with the The gene expression of CYP71A (cholesterol 7 alpha- method described by Folch et al. (1957). For gene expression, hydroxylase) and pro-inflammatrory cytokines (TNF-α, liver tissue was stored in RNA later (Sigma, USA) at − 80 °C IL-6) was measured in liver tissue. until use. Total RNA was isolated from liver tissue using TRIzol The antioxidant activities of catalase (CAT), superoxide reagent (Sigma-Aldrich, USA). The quality of isolated RNA dismutase (SOD), and glutathione peroxidase (GPx) were de- was analyzed by agarose gel electrophoresis (in 1.5% 80 V for termined in the liver. CAT activity was measured spectropho- 1 h). RNA was quantified by NanoQuant, Infinite M200Pro, tometrically by analyzing the rate of H O decomposition at Tecan. Purity of RNA was assessed based on readings at 260/ 2 2 240 nm (Aebi 1984). One unit of CAT corresponds to degra- 280 nm, and the samples with acceptable purity (i.e., ratio 1.8– dation of 1 μmol of H O per min. SOD activity was mea- 2.0) were quantified and used for reverse transcription. One 2 2 sured according to the method of Marklund and Marklund microgram of total RNA was used to prepare cDNA by using (1974), and the unit activity was defined as the amount of RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher). enzyme that causes 50% inhibition of pyrogallol autoxidation The prepared cDNA was stored at − 20 °C until further use. under experimental conditions. GPx activity was assayed by Quantitative real-time PCR (ABI PRISM 7700 Sequence Ann Microbiol (2019) 69:483–494 487 Detection System, Applied Biosystems) was used to assess at 3000×g at 4 °C for 15 min, and the supernatant was sub- the relative expression of CYP7A1, TNF-α, and IL-6 using jected to further analysis for the antioxidative enzyme activi- the SYBR Green method. Primers used in the present study ties and lipid peroxidation as described above for the liver. were as follows: Total protein in kidney tissue was estimated by the method described by Lowry et al. (1951). β-actin: Forward- CGTGGGCCGCCCTAGGCACCA, and Reverse- TTGGCCTTAGGGTTCAGGGGGG; Statistical analysis All experimental data were presented as the (Ewaschuk et al. 2007) mean ± SEM. ANOVA test was performed to determine the TNF-α: Forward: ATGAGCACAGAAAGCATGATC, effect of significance followed by the Tukey test using Reverse- TACAGGCTTGTCACTCGAATT; GraphPad Prism5.0. Significance was acknowledged at a (Ewaschuk et al. 2007) minimum P < 0.05. IL-6: Forward- CACAAAGCCAGAGTCCTTCAGAG and Reverse- CTAGGTTTGCCGAGTAGATCTC; (Ewaschuk et al. 2007) Results CYP7A1: Forward- ATCTTGGCATGGCCCTGA and Reverse- GAGCATCTCCTGCCTCTC (Kumar et al. Probiotic growth and their cholesterol assimilation 2013). Amplification condition included initial denatur- ability ation at 95 °C for 10 min, followed by annealing temper- ature at 60 °C for 30 s. Amplification was carried out for The growth rates of LR 5957 and LR 5897 cultured in MRS 45 cycles. β-actin was used for normalization. The supplemented with and without cholesterol at different time ΔΔCT method was used to calculate the relative points were presented in Fig. 2a. The optical density of probi- mRNA expression of genes. otic suspension grown on cholesterol at 600 nm after 18 h was 1.68 and 1.69 for LR 5957 and LR 5897 respectively, and the values get slightly decreased to 1.66 and 1.65 in the absence of Effect of probiotic-fermented milk on oxidative status cholesterol. But overall, both cultures have inherent mecha- of kidney nisms to grow on cholesterol without any significant effect on growth rate. Both the growing cultures were also found to be Kidney tissues were carefully removed, washed with phos- successful in their in vitro cholesterol-lowering ability phate buffer saline, blotted dry, and processed for biochemical (Fig. 2b). Specifically, after 18 h of incubation, LR 5957 and measurements. A total of 1 g tissue was homogenized in 10 LR 5897 removed 62.2 ± 2.45% and 59.8 ± 2.31% of choles- volumes of ice-cold phosphate buffer (50 mM, pH − 7.4), terol respectively from MRS Broth by their cholesterol assim- using a homogenizer. Kidney homogenate was centrifuged ilating property. Resting cells of LR 5957 and LR 5897 have Fig. 2 Growth profiles of ab LR5957 (a) and LR5897 (b)in medium containing cholesterol (w), without cholesterol (W/O) and cholesterol removal by growing, resting, and dead LR5957 and LR5897 (c) c 488 Ann Microbiol (2019) 69:483–494 also found to remove the cholesterol, i.e., 14.7 ± 0.74% and lipids as compared with HCD-fed group. On 90th day, serum 17.1 ± 1.03% respectively but much less than growing cells. TC, TGs, and LDL-C were significantly reduced in PFM-fed Although, dead cells were also found to remove cholesterol groups by 1.33-, 1.42-, and 1.43-fold in LR 5957 and 1.53-, from broth but the cholesterol removal ability was lowest 1.50-, and 1.8-fold in LR 5897, respectively as compared with among all studied growth phases, and it was found to HCD group. However, the group which was fed milk along be 7.5 ± 0.79% and 5.8 ± 0.29% for LR 5957 and LR with HCD showed a significant reduction only in serum TG 5897 respectively. levels (1.24-fold) compared to HCD group. These findings are very important, as LDL-C is the chief culprit in coronary heart Effect of probiotic-fermented milk on body weight disease. On the contrary, both the probiotics LR 5957 and LR in hypercholesterolemic rats 5897 successfully restored the HDL-C levels up to 1.23- and 1.31-fold respectively compared to HCD group. But, no such Body weight of all the experimental rats was noted down effects were seen in milk-fed group. Since serum VLDL-C values in all experimental groups were 1/5 part of TGs, there- 1 day before the start of experiment (Table 2), and the average body weight was 150 g. As the treatment period goes forward, fore the trend in VLDL-C levels was similar to TGs level. body weight increased steadily in each group but the increase The effect of fermented milk on AI and CRI are shown in was more pronounced in HCD-fed groups. The body weight Table 3. There was a 6.4-fold increase in atherogenic index significantly increased in HCD-fed group compared with con- (AI) and 4.1-fold increase in coronary artery risk index (CRI) trol group (41.1% increase vs control group) was observed by in HCD rats compared with SD rats. Milk and fermented milk the end of 90th day, but it was significantly less in LR 5957 with LR 5957 and LR 5897 significantly reduced AI and CRI (21.2%) and LR 5897 (21.7%) PFM groups as compared to values than those of HCD group. Administration of LR 5957– HCD treatment group whereas no obvious significant change fermented milk significantly causes 1.7-fold and 1.6-fold re- duction in the AI and CRI, whereas administration of LR was observed in group fed milk alone compared with HCD group. 5897–fermented milk causes 1.6-fold and 1.7-fold significant reductions in the AI and CRI respectively. Milk administration Effect of probiotic-fermented milk on serum lipid also significantly decreased AI and CRI by 1.3-fold in HCD rats. profile, AI, and CRI in hypercholesterolemic rats Serum lipid profile, AI, and CRI were estimated four times in Effect of fermented milk on feces the blood samples obtained from all the experimental rats in in hypercholesterolemic rats the total duration of the study with 30 days interval (Table 3). Serum TC, TG, HDL-C, LDL-C, and VLDL-C levels among The effects of probiotics on fecal bacteria count on MRS and different groups did not differ on 0 day, and estimated values cholesterol excretion in feces are shown in Table 4. were in the range of 66.15–89.93, 80.57–99.13, 29.26–34.56, At 0 day, the colony-forming unit on MRS of all groups 25.16–39.62, and 16.53–19.75 mg/dL respectively (Table 3). ranged from 8.5 to 8.9 log cfu/g. The colony-forming unit on Rats fed on SD have showed no significant difference in se- MRS in SD group remained constant, while progressive de- rum lipid levels during the entire study period. But, in rats fed crease was seen in HCD-fed animals as the days progressed. on HCD, the increase in serum lipid (TC, TGs, LDL-C and On 90th day of experimental period, the colony-forming unit VLDL-C) levels were dramatic on the 30th day, which further on MRS significantly decreased by 1.3-fold in HCD group increased on 60th and 90th day of experiment. On the 90th compared with the SD group while the colony-forming unit day, compared with the SD group, the HCD group showed on MRS was restored in different treatment groups by 1.35- 2.4-fold increase in TC, 1.3-fold increase in TGs, and nearly fold in both PFM groups (LR 5957 and LR 5897) and 6-fold increase in LDL-C. However, administration of PFM to by 1.2-fold in milk group as compared to HCD-fed HCD rats significantly attenuated the elevated levels of serum group. Table 2 Effect of PFM on body BW(g) SD HCD HCD + MILK HCD + 5957 HCD + 5897 weight 0 day 144.2 ± 3.67 156.7 ± 6.24 159.5 ± 6.05 153.3 ± 6.18 156.2 ± 5.02 30th day 181.0 ± 4.45 224.5 ± 10.58 225.5 ± 6.09 216.0 ± 14.94 217.2 ± 4.55 ### * * 60th day 243.5 ± 12.57 313.3 ± 9.23 288.2 ± 12.05 270.8 ± 8.70 269.0 ± 7.16 ### ** *** 90th day 272.2 ± 7.53 384.0 ± 7.64 344.0 ± 13.37 302.5 ± 9.92 300.5 ± 15.24 # ## ### * ** Data expressed as mean ± SEM (n =6). P <0.05, P < 0.01, and P < 0.001 vs SD. P <0.05, P <0.01, *** and P < 0.001 vs HCD group Ann Microbiol (2019) 69:483–494 489 Table 3 Effect of PFM on serum lipid profile Serum lipids Days SD HCD HCD + MILK HCD + 5957 HCD + 5897 (mg/dL) TC 0 Initial range: 66.1–89.9 mg/dL ### ** *** 30 80.2 ± 1.76 162.1 ± 3.47 136.1 ± 7.00 122.1 ± 8.39 110.1 ± 7.85 ### ** *** 60 75.1 ± 4.29 173.8 ± 6.16 150.5 ± 12.81 134.1 ± 8.15 115.0 ± 6.24 ### *** *** 90 78.4 ± 3.66 188.2 ± 5.01 165.5 ± 9.76 141.1 ± 4.23 122.5 ± 5.66 HDL-C 0 Initial range: 29.2–34.5 mg/dL ### * 30 30.7 ± 0.78 15.5 ± 0.88 17.4 ± 0.30 18.5 ± 0.40 18.8 ± 0.40 ### * 60 32.2 ± 0.67 18.8 ± 1.69 19.5 ± 0.70 21.1 ± 0.94 24.0 ± 1.39 ### * * 90 32.6 ± 0.87 18.8 ± 0.84 21.4 ± 1.07 23.2 ± 2.01 24.7 ± 1.34 TGs 0 Initial range: 80.5–99.1 mg/dL ### * 30 97.3 ± 4.25 128.9 ± 8.11 119.7 ± 3.31 110.8 ± 3.66 106.6 ± 4.21 ### * *** *** 60 105.8 ± 5.71 147.4 ± 6.90 123.2 ± 3.59 112.3 ± 4.23 104.5 ± 1.83 ### ** *** *** 90 124.2 ± 7.88 168.8 ± 4.30 135.3 ± 3.59 118.9 ± 5.29 112.4 ± 3.91 VLDL-C 0 Initial range: 16.5–19.7 mg/dL ### * 30 19.4 ± 0.85 25.7 ± 1.62 23.9 ±0.66 21.56 ±0.94 22.17 ±0.73 ### *** *** 60 21.1 ± 1.14 29.4 ± 1.38 24.6 ±0.71 23.48 ±1.03 22.46 ± 0.84 ### ** *** *** 90 24.8 ± 1.57 33.6 ± 0.87 27.0 ± 0.72 23.43 ± 1.01 23.78 ± 1.05 LDL-C 0 Initial range: 25.16–39.62 mg/dL ### ** *** 30 30.0 ± 1.92 120.8 ± 3.04 94.64 ± 7.11 81.4 ± 8.54 70.0 ± 8.43 ### * ** 60 21.7 ± 3.53 125.5 ± 6.44 106.3 ± 12.90 90.4 ± 8.64 70.0 ± 6.46 ### *** *** 90 20.9 ± 4.71 135.7 ± 4.84 106.9 ± 8.39 94.3 ± 4.48 75.2 ± 5.38 AI 0 Initial range – 1.4 to 1.8 ### ** ** *** 30 1.6 ± 0.05 9.5 ± 0.67 6.7 ± 0.35 5.6 ± 0.52 4.8 ± 0.44 ### ** *** 60 1.3 ± 0.14 8.4 ± 0.67 6.7 ± 0.72 5.6 ± 0.52 3.8 ± 0.39 ### ** *** *** 90 1.4 ± 0.10 9.0 ± 0.41 6.7 ± 0.38 5.3 ± 0.58 3.9 ± 0.28 CRI 0 Initial range − 2.4 to 2.8 ### ** *** *** 30 2.6 ± 0.05 10.6 ± 0.67 7.7 ± 0.35 6.6 ± 0.52 5.8 ± 0.44 ### ** *** 60 2.3 ± 0.14 9.4 ± 0.67 7.7 ± 0.72 6.4 ± 0.52 0.9 ± 0.39 ### ** *** *** 90 2.4 ± 0.10 10.0 ± 0.41 7.7 ± 0.38 6.3 ± 0.586 4.9 ± 0.28 # ## ### * ** *** Data expressed as mean ± SEM (n =6). P <0.05, P < 0.01, and P < 0.001 vs SD. P <0.05, P <0.01, and P < 0.001 vs HCD group In addition, the feeding of cholesterol for 90 days to Cholesterol excretion increased significantly by 1.7-fold the experimental rats resulted in progressive increase in and 1.8-fold in fermented milk groups as compared to cholesterol excretion in feces (4-fold vs SD group). HCD group. Table 4 Effect of PFM on fecal bacterial count on MRS and cholesterol Fecal parameters Days SD HCD HCD + milk HCD + 5957 HCD + 5897 Fecal bacterial count on MRS 0 Initial range: 8.5–8.9 log cfu/g ### ** *** *** 30 8.8 ± 0.03 7.8 ± 0.02 8.9 ± 0.02 9.0 ± 0.03 9.0 ± 0.00 ### *** *** *** 60 8.8 ± 0.06 7.6 ± 0.07 8.5 ± 0.01 9.1 ± 0.02 9.1 ± 0.02 ### *** *** *** 90 8.9 ± 0.03 6.7 ± 0.02 8.7 ± 0.02 9.1 ± 0.04 9.1 ± 0.02 Fecal cholesterol 0 Initial range: 2.7–9.6 mg/dL # * ** 30 5.7 ± 0.96 13.2 ± 1.64 19.6 ± 2.04 21.2 ± 0.96 23.3 ± 0.82 ## * * 60 5.3 ± 1.21 18.1 ± 2.74 27.3 ± 1.93 29.5 ± 1.68 29.6 ± 2.96 # * * 90 5.2 ± 0.71 21.5 ± 1.50 30.5 ± 3.06 38.3 ± 4.36 38.9 ± 5.38 # ## ### * ** *** Data expressed as mean ± SEM (n =6). P <0.05, P < 0.01, and P < 0.001 vs SD. P <0.05, P <0.01, and P < 0.001 vs HCD group 490 Ann Microbiol (2019) 69:483–494 Effect of probiotic-fermented milk on different liver by supplementation of PFM with LR 5957 and PFM with LR parameters 5897 TC by 2.0 and 1.9 respectively; TGs were decreased by 1.4-fold in both PFM with LR 5957 and PFM with LR 5897 Effect of fermented milk on different liver parameters is compared with HCD-fed group. shown in Fig. 3. The effect of HCD consumption on the activity key regu- After 90 days of treatment, the activities of liver antioxida- lator of cholesterol biosynthesis, HMG-CoA, in the liver was tive enzymes (CAT, SOD, GPx) were performed and the re- determined in experimental rats and shown in Fig. 3g. The sults indicate the decrease in activities of CAT, SOD, and GPx enzyme activity was significantly decreased in HCD group by 2.3-, 2.7-, and 3.3-fold in animals of HCD group compared by 1.8-fold compared to SD group; however, 3-fold decrease to SD group (Fig. 3). But, animal fed on HCD along with in the activity was observed in probiotic treatment groups as fermented milk with LR 5957 and LR 5897 showed a signif- compared to HCD group. Although the activity was found to icant increase in CAT activity by 2- and 2.1-fold, SOD activity decrease in milk group, the effect was not significant as com- by 2- and 1.6-fold, and GPx activity by 2.2- and 2.6-fold pared with HCD group. respectively as compared to HCD group. No significant dif- Estimation of hepatic mRNA expression of CYP7A1, the ferences were observed in the case of the group fed with milk rate-limiting enzyme of bile acid synthesis expression along with HCD. (Fig. 3h) showed that CYP7A1 mRNA expression is signifi- In the case of lipid peroxidation (Fig. 3d), rats showed a cantly increased in HCD-fed group compared with SD group. significant reduction in levels of TBARS by 1.7-, 2.1-, and PFM significantly (P < 0.05) decreases mRNA expression 1.2-fold in the groups fed with milk, PFM with LR 5957, and compared to HCD group. PFM with LR 5897, respectively. The gene expression analysis of proinflammatory cyto- TC and TG levels (Fig. 3e, f) were significantly elevated in kines (TNF-α and IL-6) was estimated in the liver (Fig. 3i, the liver of HCD-fed experimental rats by 3.2- and 2.7-fold j). TNF-α and IL-6 content was elevated significantly in HCD compared with SD group. This increase in TC was inhibited group by 5.7-fold and 4-fold respectively compared to SD Fig. 3 Effect of milk and probiotic-fermented milk on different liver alpha-hydroxylase) (h); TNF-α (tumor necrosis factor alpha) (i); and parameters, i.e., catalase (CAT) (a); superdisoxide dismutase (SOD) (b); IL-6 (Interleukin-6) (j) in rats. Data expressed as mean ± SEM (n =6). # ## ### * ** glutathione peroxidase (GPx) (c); lipid peroxidation (d); hepatic lipids, P <0.05, P < 0.01, and P < 0.001 vs SD. P <0.05, P <0.01, and *** i.e., total cholesterol and triacylglycerol (TGs) (e and f); HMG-CoA P < 0.001 vs HCD group enzyme activity (g); mRNA expression of CYP7A1 (cholesterol 7 Ann Microbiol (2019) 69:483–494 491 group; whereas, milk and PFM significantly decreased TNF-α elevated cholesterol in body due to their cost effective and levels in the liver compared to HCD group. However, the safety properties (Huang et al. 2013). Among probiotics, significant decrease in IL-6 was observed only in probiotic- Lactobacillus and Bifidobacterium species have been well fermented milk. These results suggest that probiotic- studied for their hypolipidemic effects in animal and human fermented milk inhibit the production of inflammatory cyto- subjects. Choi and Chang (2015) showed that LAB strains can kines in the liver and thereby reduced inflammation. remove the cholesterol in vitro at different growth stages. We have observed similar results as both the lactobacilli strains, Effect of fermented milk on antioxidative enzyme LR 5957 and LR 5897, successfully removed the cholesterol activities and lipid peroxidation in kidney in vitro in different growth stages (growing, resting, dead). of hypercholesterolemic rats Increase in body weight is one of the major complications observed in hypercholesterolemia. Probiotics have shown to As shown in Fig. 4a–c, significant decrease in CAT, SOD, and be effective in such conditions. A 4-week study showed that GPx activities by 2.1-, 4-, and 3.1-fold respectively and in- supplementation of VSL#3 reduced weight gain in healthy crease in lipid peroxidation by 4-fold were observed in HCD young men consuming a high-fat and high-energy diet treated rats as compared to SD rats. Both probiotic LR 5957 (Osterberg et al. 2015). Similarly in another study, researchers and LR 5897 supplementation showed a significant elevation have showed that Lactobacillus rhamnosus, CGMCC1 3724, in CAT activity (1.1-fold) compared to HCD group. However, helps obese women to achieve sustainable weight loss in the case of SOD, only LR 5957 showed significant 1.3-fold (Sanchez et al. 2014). In our study, we have observed similar increase in activity compared to HCD group. There was no kind of phenotype in rats fed with LR 5957– and LR 5897– statistically significant increase in GPx activity in milk and fermented milk compared to HCD. This indicates the success- PFM treatment groups compared to HCD group. Further, sig- ful hypocholesterolemic effects of strains investigated. nificant decrease was observed in total lipid peroxidation in all To lower the incidences of CVD, it is important to reduce supplementation groups, and the effects were more pro- the serum/plasma cholesterol levels in hypercholesterolemic nounced in the rats that received PMF and results are shown patients. In current study, the serum TC, TG, LDL and HDL in Fig. 4d. concentrations were significantly reduced upon feeding fermented milk which was not observed in other feeding groups. Michael et al. (2017) showed that probiotics can lower Discussion cholesterol due to the presence of bile salt hydrolase activity. Zhang et al. (2017) showed that probiotic-fermented soymilk Several epidemiological, clinical, genetic and animal with mixture of Bifidobacterium bifidum, Lactobacillus casei, and L. plantarum remarkably reduced serum TC, TG, and studies showed that elevated level of cholesterol in blood is correlated with increased risk of cardiovascular dis- LDL and increased HDL level in mice fed on HFD for 6 weeks. Al-Sheraji et al. (2012) found an increased HDL eases. Hypercholesterolemia is one of the major risk factors contributing to the severity of many cardiovascular diseases levels induced by consumption of yoghurt, which was and remains a primary cause of death worldwide (Gielen and fermented with B. pseudocatenulatum G4 and B. longum Landmesser 2014). The Wistar rats have been selected for the BB536. Oral administration of L. fermentum RS-2 increases study, and hypercholesterolemia was created by feeding high- intestinal lactobacilli count and reduces coliform count in cholesterol diet containing 0.375% sodium cholate in addition streptozotocin-induced diabetic rats (Kumar et al. 2017). In to 1.5% cholesterol (Kalyan et al. 2018). As natural health current study, we have analyzed lactobacilli in rat feces. It remedy, probiotics have gained special attention to treat demonstrated that the lactobacilli counts were decreased in # ## Fig. 4 Effect of milk and probiotic fermented milk on kidney parameters, expressed as mean ± SEM (n =6). P < 0.05, P < 0.01, and ### * ** *** i.e., catalase (CAT) (a), superdisoxide dismutase (SOD) (b), glutathione P <0.001 vs SD. P <0.05, P <0.01, and P <0.001 vs peroxidase (GPx) (c), and lipid peroxidation (d)inrats. Data HCD group 492 Ann Microbiol (2019) 69:483–494 HCD-fed group, implying that the high-cholesterol diet inter- to the liver. Our results further indicate that strong anti- feres with the intestinal microbiota. But feeding of fermented inflammatory- and antioxidative-enhancing activity of the milk product has successfully ameliorated the number of lactic two probiotics could potentially ameliorate the tissue damage acid bacterial in the intestine and exerted beneficial effects. associated with hypocholesterolemia. The activities of antiox- One plausible mechanism by which probiotic bacteria can idative enzymes (CAT, SOD, and GPx) and levels of TBARS influence plasma cholesterol levels is assimilation of choles- were imbalanced in rats fed only on HCD. A recent study by terol onto the plasma membrane of bacteria or cell walls, and Kumar et al. (2017) reported the role of probiotics in restoring then excreted via feces, which results in the inhibition of cho- the activity of antioxidative enzyme which may protect against lesterol resorption in intestine. Similar kind of observation was the oxidative stress developed in streptozotocin diabetic rats. reported by Huang et al. (2013). They showed that Lb. TNF-α and IL-6 are potent pro-inflammatory cytokine pro- plantarum Lp09 and Lp45 strains facilitate increasing amount duced by macrophages/monocytes. Previous studies have in- of cholesterol excretion in feces and thus causes in lowering dicated that probiotics inhibited cell inflammatory signaling cholesterol level in blood. Various other studies also demon- intestinal epithelium (Menard et al. 2004; Yan et al. 2007). strated that probiotic administration increases fecal lipid excre- Zhang et al. (2017) reported that soymilk fermented with pro- tion in mice fed on high-fat diet (Yonejima et al. 2013). In biotic mixture reduced expression of TNF-α and reduces he- current study, we also found that LR 5957 and LR 5897 sup- patic inflammation. Hung et al. (2016) also reported that pro- plementation increases significant excretion of cholesterol in biotic NTU101 decreases the mRNA expression of TNF-α feces in rats fed on cholesterol diet. Probiotics have also been and IL-6. The present study supports this conclusion. shown to lower cholesterol levels by regulating its metabo- lism. Generally, cholesterol biosynthesis and bile acid synthe- Summary and conclusion sis are the two pathways that can describe the cholesterol me- tabolism in the liver. Awell-known regulatory enzyme, HMG- In current study, we analyzed the hypocholesterolemic effects CoA reductase, in the cholesterol synthesis pathway catalyzes of two Lactobacillus rhamnosus probiotic strains, LR 5957 the synthesis of mevalonate from HMG-CoA (Goldstein and and LR 5897. The initial in vitro assays preliminarily showed Brown 1990) and is regulated at the posttranscriptional level. the cholesterol removal activity of LR 5957 and LR 5897 in A hypercholesterolemic diet decreases cholesterol biosynthe- MRS Broth under different growth stages. In in vivo investi- sis in the liver as high levels of circulatory cholesterol inhibit gations, we observed that consumption of LR 5957– and LR HMG-CoA reductase expression (Brown and Goldstein 5897–fermented milk significantly reduced different charac- 1986). A similar kind of result was noticed in the present study teristics of hypercholesterolemia including HCD-induced that supports that the supplementation of the standard diets body weight, hyperlipidemia, and hepatic lipids. Probiotics with cholesterol had an inhibitory effect on the HMG-CoA also increase cholesterol excretion in feces. The studied reductase activity. This negative effect of HCD was signifi- fermented milk helped to maintain healthy liver and kidney cantly ameliorated by probiotic supplementation. The other by modulating the oxidative and inflammatory responses. enzyme, cholesterol 7 α-hydroxylase, is the rate-limiting step Overall, consumption of milk fermented with Lactobacillus in bile acid synthesis. Its transcription and activity are rhamnosus strains, LR 5957 and LR 5897, may help to cure increased by endogenous and dietary cholesterols. Kumar the diet-induced hypercholesterolemia. et al. (2013) showed that dietary cholesterol supplementation upregulated CYP7A1 mRNA expression resulted in rats fed Acknowledgements The authors are grateful to ICAR-National Dairy on HCD and which was found downregulated in L. rhamnosus Research Institute, Karnal, for providing funding and laboratory facilities GG plus aloe vera gel–treated group. This change could rep- to carry out this work. resent a compensatory mechanism used to maintain cellular cholesterol levels. As expected, ingestion of a HCD resulted in Compliance with ethical standards obvious elevations of hepatic cholesterol and TG contents in Conflict of interest The authors declare that they have no conflict of HCD group and eventually resulted in an unhealthy liver (Liu interest. et al. 2017). The reduction in liver cholesterol and TG content in PFM groups proved that the cholesterol was reduced, not re- Ethical statement The study was approved by the Institute Animal distributed between blood and the liver. Supportingly, a recent Ethical Committee (IAEC) (IAEC No. 101/16 dated 21.04.2016) of study showed that LP96 supplementation reduces liver TC and Indian Council of Agriculture Research-National Dairy Research Institute. TG in rats fed on high-cholesterol diet compared with the Informed consent was obtained from all individual participants in- model group (Liu et al. 2017). These observations further in- cluded in the study. dicated that serum lipid levels in probiotic-fed groups were actually reduced by decreasing the metabolism or absorption Publisher’snote Springer Nature remains neutral with regard to jurisdic- of intestinal lipids rather than just being redirected from blood tional claims in published maps and institutional affiliations. Ann Microbiol (2019) 69:483–494 493 Kumar M, Shruti R, Ravinder N, Hemalatha RA, Sudarshan V, Ramagoni References R (2013) Probiotic Lactobacillus rhamnosus GG and aloe vera gel improve lipid profiles in hypercholesterolemic rats. Nutrition 29(3): Aebi H (1984) [13] Catalase in vitro. Methods Enzymol 105:121–126 574–579 Al-Sheraji SH, Ismail A, Manap MY, Mustafa S, Yusof RM, Hassan FA Kumar N, Tomar SK, Thakur K, Singh AK (2017) The ameliorative (2012) Hypocholesterolaemic effect of yoghurt containing effects of probiotic Lactobacillus fermentum strain RS-2 on alloxan Bifidobacterium pseudocatenulatum G4 or Bifidobacterium longum induced diabetic rats. J Funct Foods 28:275–284 BB536. Food Chem 135(2):356–361 Levine GN, Keaney JF, Vita JA (1995) Cholesterol reduction in cardio- AOAC (1990) Official methods of analysis, 16th edn. Association of vascular disease—clinical benefits and possible mechanisms. N Official Agricultural Chemists, Washington, DC Engl J Med 332(8):512–521 Boers M, Nurmohamed MT, Doelman CJ, Lard LR, Verhoeven Liong MT, Shah NP (2005) Acid and bile tolerance and choles- AC, Voskuyl AE, Huizinga TW, Van de Stadt RJ, Dijkmans terol removal ability of lactobacilli strains. J Dairy Sci 88(1): BA, van der Linden S (2003) Influence of glucocorticoids 55–66 and disease activity on total and high density lipoprotein Liu CS, Lin CC, Li TC (1999) The relation of white blood cell cholesterol in patients with rheumatoid arthritis. Ann Rheum counts and athero- genic index ratio of LDL-cholesterol to Dis 62:842–845 HDL-cholesterol in Taiwan school children. Acta Paediatr Brown MS, Goldstein JL (1986) A receptor-mediated pathway for cho- Taiwanica 40:319–324 lesterol homeostasis. Science 232(4746):34–47 Choi EA, Chang HC (2015) Cholesterol-lowering effects of a putative Liu Y, Zhao F, Liu J, Wang H, Han X, Zhang Y, Yang Z (2017) probiotic strain Lactobacillus plantarum EM isolated from kimchi. Selection of cholesterol-lowering lactic acid bacteria and its LWT-Food Sci Technol 62(1):210–217 effects on rats fed with high-cholesterol diet. Curr Microbiol Coppack SW (2001) Pro-inflammatory cytokines and adipose tissue. 74(5):623–631 Proc Nutr 60(3):349–356 Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein mea- Dai C, Zhao DH, Jiang M (2012) VSL# 3 probiotics regulate the intestinal surement with the Folin phenol reagent. J Biol Chem 193(1): epithelial barrier in vivo and in vitro via the p38 and ERK signaling 265–275 pathways. Int J Mol Med 29(2):202–208 Marklund S, Marklund G (1974) Involvement of the superoxide anion Ewaschuk J, Endersby R, Thiel D, Diaz H, Backer J, Ma M, Churchill T, radical in the autoxidation of pyrogallol and a convenient assay for Madsen K (2007) Probiotic bacteria prevent hepatic damage and superoxide dismutase. FEBS J 47(3):469–474 maintain colonic barrier function in a mouse model of sepsis. Menard S, Candalh C, Bambou JC, Terpend K, Cerf-Bensussan N, Hepatology 46(3):841–850 Heyman M (2004) Lactic acid bacteria secrete metabolites retaining Folch J, Lees M, Sloane-Stanley GH (1957) A simple method for the anti-inflammatory properties after intestinal transport. Gut 53(6): isolation and purification of total lipids from animal tissues. J Biol 821–828 Chem 226(1):497–509 Michael DR, Davies TS, Moss JW, Calvente DL, Ramji DP, Marchesi JR, Friedewald WT, Levy RI, Fredrickson DS (1972) Estimation of the con- Pechlivanis A, Plummer SF, Hughes TR (2017) The anti- centration of low-density lipoprotein cholesterol in plasma, without cholesterolaemic effect of a consortium of probiotics: an acute study use of the preparative ultracentrifuge. Clin Chem 18(6):499–502 in C57BL/6J mice. Sci Rep 7(1):2883 Gielen S, Landmesser U (2014) The year in cardiology 2013: cardiovas- Osterberg KL, Boutagy NE, McMillan RP, Stevens JR, Frisard cular disease prevention. Eur Heart J 35(5):307–312 MI, Kavanaugh JW, Hulver MW (2015) Probiotic supple- Goldstein JL, Brown MS (1990) Regulation of the mevalonate pathway. mentation attenuates increases in body mass and fat mass Nature 343(6257):425 during high-fat diet in healthy young adults. Obesity HuangY, WangX,WangJ,WuF,Sui Y, Yang L, Wang Z 23(12):2364–2370 (2013) Lactobacillus plantarum strains as potential probiotic Paglia DE, Valentine WN (1967) Studies on the quantitative and qualita- cultures with cholesterol-lowering activity. J Dairy Sci 96(5): tive characterization of erythrocyte glutathione peroxidase. J Lab 2746–2753 Clin Med 70(1):158–169 Hung SC, Tseng WT, Pan TM (2016) Lactobacillus paracasei subsp. Salaj R, Štofilová J, Šoltesová A, Hertelyová Z, Hijová E, Bertková I, paracasei NTU 101 ameliorates impaired glucose tolerance induced Strojný L, Kružliak P, Bomba A (2013) The effects of two by a high-fat, high-fructose diet in Sprague-Dawley rats. J Funct Lactobacillus plantarum strains on rat lipid metabolism receiving a Foods 24:472–481 high fat diet. Sci World J 2013:135142 Kalyan S, Meena S, Kapila S, Sowmya K, Kumar R (2018) Evaluation of Saliganti V, Kapila R, Sharma R, Kapila S (2015) Feeding probiotic goat milk fat and goat milk casein fraction for anti- Lactobacillus rhamnosus (MTCC 5897) fermented milk to suckling hypercholesterolaemic and antioxidative properties in hypercholes- mothers alleviates ovalbumin-induced allergic sensitisation in mice terolaemic rats. Int Dairy J 84:23–27 offspring. Br J Nutr 114(8):1168–1179 Kaushal D, Kansal VK (2012) Probiotic dahi containing Sanchez M, Darimont C, Drapeau V, Emady-Azar S, Lepage M, Lactobacillus acidophilus and Bifidobacteriumbifidum allevi- Rezzonico E, Ngom-Bru C, Berger B, Philippe L, Ammon- ates age-inflicted oxidative stress and improves expression Zuffrey C, Leone P (2014) Effect of Lactobacillus of biomarkers of ageing in mice. Mol Biol Rep 39(2): rhamnosus CGMCC1. 3724 supplementation on weight loss 1791–1799 and maintenance in obese men and women. Br J Nutr Kemgang TS, Kapila S, Shanmugam VP, Reddi S, Kapila R (2016) 111(8):1507–1519 Fermented milk with probiotic Lactobacillus rhamnosus S1K3 Sharma R, Kapila R, Dass G, Kapila S (2014) Improvement in (MTCC5957) protects mice from salmonella by enhancing immune Th1/Th2 immune homeostasis, antioxidative status and resis- and nonimmune protection mechanisms at intestinal mucosal level. J Nutr Biochem 30:62–73 tance to pathogenic E coli on consumption of probiotic Lactobacillus rhamnosus fermentedmilkinaging mice.Age Kimoto H, Ohmomo S, Okamoto T (2002) Cholesterol removal from 36(4):9686 media by lactococci. J Dairy Sci 85(12):3182–3188 494 Ann Microbiol (2019) 69:483–494 Xiao JZ, Kondo S, Takahashi N, Miyaji K, Oshida K, Hiramatsu in feces of KK-A y mice. Biosci Biotechnol Biochem 77(11): 2312–2315 A, Iwatsuki K, Kokubo S, Hosono A (2003) Effects of milk products fermented by Bifidobacteriumlongum on blood Yoo SR, Kim YJ, Park DY, Jung UJ, Jeon SM, Ahn YT, Choi MS (2013) lipids in rats and healthy adult male volunteers. J Dairy Probiotics L. plantarum and L. curvatus in combination alter hepatic Sci 86(7):2452–2461 lipid metabolism and suppress diet-induced obesity. Obesity 21(12): Yan F, Cao H, Cover TL, Whitehead R, Washington MK, Polk 2571–2578 DB (2007) Soluble proteins produced by probiotic bacteria Zhang XL, Wu YF, Wang YS, Wang XZ, Piao CH, Liu JM, Wang YH regulate intestinal epithelial cell survival and growth. (2017) The protective effects of probiotic-fermented soymilk on Gastroenterology 132(2):562–575 high-fat diet-induced hyperlipidemia and liver injury. J Funct Yonejima Y, Ushida K, Mori Y (2013) Lactobacillus gasseri NT Foods 30:220–227 decreased visceral fat through enhancement of lipid excretion
Annals of Microbiology – Springer Journals
Published: Jan 7, 2019
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.