Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Methods and detection limits in tracking a genetically modifiedPseudomonas sp. released in the pine phyllosphere

Methods and detection limits in tracking a genetically modifiedPseudomonas sp. released in the... Annals of Microbiology, 58 (1) 163-167 (2008) Methods and detection limits in tracking a genetically modified Pseudomonas sp. released in the pine phyllosphere 1 2 1 Sara ALBERGHINI , Andrea BATTISTI , Andrea SQUARTINI * 1 2 Dipartimento di Biotecnologie Agrarie, Dipartimento di Agronomia Ambientale e Produzioni Vegetali, Università di Padova, Viale dell’Università 16, 35020 Legnaro, Padova, Italy Received 15 November 2007 / Accepted 31 January 2008 Abstract - A method suitable to detect the presence and follow the fate of specific bacteria released on the phyllosphere of conifer trees was devised, tested, and optimised. The procedure was set up using a biocontrol strain that had shown effectiveness and per- sistence in greenhouse trials against insect pests. The microorganism used is based on a Pseudomonas sp., originally isolated from Pinus nigra and carries the cry9a toxin gene from Bacillus thuringiensis. In order to assess its detectability, specific primers were designed, and the most suitable protocol for DNA isolation from bacteria colonising pine needles was defined upon an experimental comparison of various methods. Different conditions of physical pre-treatments and their combinations with commercially available kits protocols were tested. The most sensitive monitoring (about 10 released cells) was achieved by a procedure based on vortexing in a suspension of glass beads followed by the use of microcolumns designed for a soil DNA extraction kit. The application can be rec- ommended in biosafety studies of released GMMs as well as in ecological surveys of phyllosphere microbiota. Key words: Pseudomonas sp., GMM, detection limits, phyllosphere, Pinus. INTRODUCTION moreover, are mostly relative to herbaceous crops (Donegan et al., 1991). The phyllosphere of conifer trees to Being able to keep track of microorganisms deliberately our knowledge has not yet been investigated in terms of released into the environment is an acknowledged priority release and detectability of engineered microorganisms. from both scientific and normative standpoints. Both the Also as concerns its normal resident prokaryotic microbio- detection of GMMs and that of non-recombinant strains can ta, only limited information is available yet (Yoshimura, benefit from the availability of monitoring strategies for the 1982). The present paper wishes therefore to address the scopes of biosafety and efficiency of application. The impor- issue of microbial detection in this poorly known habitat. tance of microbe-tracking and rescuing protocols has also Defining methods to detect GMMs in phyllosphere will be of been stressed at political level in Europe, through the increasing interest in the future as different projects are guidelines issued at both EU and national levels (Nuti et al., planning the use of introduced heterologous traits in bacte- 1994). Long-term approaches on risk assessment have ria to be tested for the biological control of insect defolia- been undertaken through joint programs, which have yield- tors in forest environments. ed comprehensive data covering several fields (Jansson et We previously described the construction of a biocontrol al., 2000; Nuti et al., 2003; Corich et al,. 2007). Of partic- strain based on a natural phyllospheric isolate of ular importance is the issue of detection limit, the numeri- Pseudomonas sp. which has been endowed with the Cry9a cal threshold per sampled habitat volume, below which the gene from Bacillus thuringiensis galleriae (Alberghini et al., presence of the target organism is overlooked. As in many 2005). The GMM proved effective against the the greater other instances, specific DNA amplification via PCR has wax moth Galleria mellonella and the pine processionary become one of the protocols of choice for such tasks caterpillar Thaumetopoea pityocampa. The latter was chal- (Cullen et al., 1998). Gene dosage issues and replicon sta- lenged in greenhouse trials carried out for over 100 days on bility can affect the sensitivity of this approach (Corich et potted Pinus mugo (Alberghini et al., 2006). The toxin al., 1991; Corich et al. 2001a; Corich et al. 2001b). gene, carried on a broad host range plasmid vector, was While many different studies have addressed the mon- cloned under the control of a regulated synthetic promoter, itoring of GMM released in soil (Hirsch 1996; van Veen et assembled by aligning the consensus of several strong bac- al., 1997; Naseby and Lynch, 1998; Miethling and Tebbe terial promoters (Giacomini et al., 1994). The presence of 2004), much less explored until now is the leaf environ- this unique sequence allows to design primers suitable for ment (Lindow and Brandl, 2003). The few data available the unambiguous PCR-based detection of the construct in the environment. In the present report we devised and optimised a protocol to isolate bacteria from gymnosperm * Corresponding author. E-mail: squart@unipd.it 164 S. Alberghini et al. tree leaves and assessed its detection limits in tracing the Set-up and optimisation of a protocol for bacterial quantitative presence of specific bacterial genes by poly- DNA rescue from phyllosphere. In order to select the merase chain reaction. most efficient procedure to be used for DNA isolation from pine microbial epiphytes, we spiked untreated pine needles with known amounts of Pseudomonas Clb01 pDBCRY9a MATERIALS AND METHODS cells and processed the material in parallel using two differ- ent resuspension devices and then extracting the resulting Bacterial strains and growth conditions. The wild-type samples with two environmental DNA extraction kits. Four Pseudomonas sp. strain Clb01 (16S rDNA sequence protocol combinations were carried out as follows: (1) - Genbank accession: AY574283, top homologies to Aliquots of 2 g (fresh weight) of Pinus mugo needles were Pseudomonas lutea and Pseudomonas graminis), isolated transferred to 50 ml falcon tubes containing 0.8 g of ster- from the phyllosphere of Pinus nigra on Mount Calbarina ilised glass beads (size 425-600 µm, Sigma Chemical Co. S. (Padova, Northern Italy, 11°43’E 45°16’N, 200 m) and Louis MO, USA), and 10 ml of sterile PBS (0.2 g/l KCl; 8 g/l used as a host for the gene encoding the Cry9Aa entomo- NaCl; 0.24 g/l KH PO ; 1.44 g/l Na HPO ; pH 7.2) to which 2 4 2 4 cidal toxin from Bacillus thuringiensis spp. galleriae, yield- 10 ml of a Pseudomonas sp. Clb01 pDBCRY9a suspension ing the derivative Clb01 pDBCRY9A, was grown as previ- (5.44 x 10 cells/ml in PBS) were added. The tubes were ously described (Alberghini et al., 2005). Cellular concen- vortexed for 3 min. The resulting liquid suspension was trations in working solutions were determined microscopi- pipetted in clean tubes and centrifuged at 5000 x g for 10 cally in a Thoma counting chamber (Thoma Fein Optik, Bad min. The pellet was extracted by an Ultra Clean Soil DNA Kit Blankenburg, Germany). (Mobio Laboratories, Inc., Solana Beach, CA, USA) and resuspended in 100 µl of sterile distilled water. (2) - The Foliar adherence tests. In order to assess whether same starting amount of needles was mixed with the same strong affinity between pine leaf cuticle and bacterial sur- bacterial suspension described above in a stomacher bag face components would occur, an overnight culture of and treated in a Circulator Stomacher mod. 400 apparatus Pseudomonas sp. Clb01 was centrifuged and resuspended (Seward Ltd, Worthing, UK) for 4 min at 260 rpm. The in 10 ml 0.85% NaCl to yield a cell concentration of 2.5 x whole liquid phase was centrifuged and extracted as above 10 cells/ml (assessed by a counting chamber under light with an Ultra Clean Soil DNA kit. (3) and (4) - The identical microscopy, as described above). The suspension was procedures described for protocols (1) and (2) respectively divided in two 5 ml aliquots transferred in 50 ml falcon were carried out but the pellets were extracted by an Ultra tubes, to each of which 1 g (fresh weight) of untreated Clean Water DNA Kit (Mobio Laboratories, Inc.) and resus- Pinus mugo pine needles was added. From one of the pended in 50 µl of sterile distilled water. (5), (6), (7), (8) - tubes, the needles were withdrawn after 10 s and the cells The same procedures described in (1), (2), (3), (4) were -2 remaining in suspension were counted again by carried out at a 10 dilution of the Pseudomonas cell sus- microscopy. The second tube was vortexed for 1 min, after pension. The purified DNA and its serial dilutions were used which cells in suspension were counted as above. as templates for specific PCR amplification of Pseudomonas sp. Clb01 as described in the previous section. Primer design and PCR amplification for selective As a protocol variation, we proceeded by wetting the tracking of GMM. To monitor the presence of the geneti- needles (2 g) with a bacterial cell suspension (2.14 x 10 cally modified Pseudomonas released in the phyllosphere cells/ml), withdrawing them, measuring by subtraction the by a molecular approach, we designed a primer pair spe- volume of liquid adhering to the needles (0.7 ml/g fresh cific for the plasmid pDBCRY9A. The first primer (Syn weight), and then drying the needles under a laminar hood GGTATAATATGCGCCATTAAGC) was based on the unique to have the added bacteria sticking to the surface. This sequence of our synthetic promoter pSyn. The second material was then subjected to the following alternative (Btcry GCAACATCATCAGATGCACA) was tailored on a extraction procedures: (9) - needles were ground under liq- downstream portion of the Bacillus thuringiensis cry9a uid nitrogen by mortar and pestle, and 0.7 g of the result- sequence (GenBank X58120) cloned in the construct. ing powder were extracted with the above-mentioned Ultra For amplifications, in first instance, in order to identify Clean Soil DNA kit. (10) - Alternatively, needles with adher- the detection limit from pure isolates, 4 ml of a liquid cul- ing bacteria were treated as in protocol #1, omitting the ture containing 2.5 x 10 cells/ml (counted in a Thoma addition of bacteria in suspension and using 20 ml of PBS. chamber under light microscopy) were lysed. Cells were (11) - The same method used for protocol #11 was used centrifuged at 13000 x g and lysed by resuspending the but, instead of proceeding with kit extraction, the cen- pellet in 50 µl of lysis buffer (0.25% SDS, 0.05 M NaOH) in trifuged pellet was resuspended in 0.9 ml of 0.05 M NaOH an Eppendorf tube, followed by stirring for 60 s on a vortex 0.25% SDS and lysed at 95 °C for 15 min. and heating at 95 °C for 15 min. Serial tenfold dilutions of the lysate were made. PCR was carried out in a 25 µl reac- tion volume, with the following program: initial denatura- RESULTS AND DISCUSSION tion at 94 °C for 1 min; 30 cycles at 94 °C for 1 min, 51 °C for 45 s, and 72 °C for 50 s; and a final extension at 72 °C Foliar adherence tests for 5 min. The PCR reaction mixture contained 20 mM Tris- Many strategies exist for bacterial leaf colonisation (Beattie HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl , 0.2 mM of each and Lindow, 1999). Epiphytic bacteria are exposed to dATP, dCTP, dGTP and dTTP, 0.2 µM of each primer, and meteorological effects such as wind, rainwater runoff and 0.5 U Taq DNA Polymerase, recombinant (InVitrogen Life drifting, which challenge their persistence on leaves. On Technologies). Serial dilutions of the product were analysed conifer needles and other xerophytic vegetation, a waxy by 1% agarose gel electrophoresis. hydrophobic cuticle is found. Bacterial colonisation may be Ann. Microbiol., 58 (1), 163-167 (2008) 165 strengthened by specific surface interactions mediated by fact that the target region is borne on plasmid pDBCRY9a, compatible surface components. In this test, we aimed at which is a derivative of pRL497, whose origin of replication assessing whether a strong affinity would be manifest in is that of replicon RSF1010, an IncQ broad host range vec- short exposures between bacterial suspensions and leaf tor with a copy number of about 30 elements per cell surfaces. As the direct approach of counting bacteria (Barth, 1979) The use of a plasmid-borne target gene with remaining on needles by microscopy would be inaccurate a reasonably high dosage, rather than a chromosomal one, due to insufficient resolution of the visualisation method on is in this sense advantageous as regards the sensitivity of such heterogeneous surfaces, we devised an indirect detection. The 200 genomes in our case correspond method based on subtraction. This was done by dipping approximately to 200 x 30 = 6000 copies of the target needles in bacterial suspensions and counting cells remain- gene. ing in suspension after needle removal. The results did not Plasmid construct stability is an important aspect in show any significant difference between direct counts these studies. In the present case our previous data (Corich before and after contact with the needles (t test, t = 0.12, et al., 1996) are available on the stability, in gram negative d.f. = 28, p = 0.90) and even after vortexing (t test, t = bacteria, of the vector containing the same synthetic pro- 1.22, d.f. = 26, p = 0.23). Therefore, notwithstanding the moter used for pDBCRY9a. Bacteria were grown for 70 gen- epiphytic habitat of isolation of Pseudomonas sp. Clb01, erations in the absence of antibiotic selective pressure and under our experimental conditions, we can exclude strong the plasmid was retained at a rate higher than 99%. adhesion to needles in the short term. This information is important in interpreting the dynamics of Pseudomonas Detection limits in protocols of extraction from persistence in the subsequent experiments, when the con- leaves with known amounts of target struct was released on the pine canopy by spraying cell cul- In order to elect the most effective procedure to isolate ture suspensions and its presence monitored over time. bacteria from pine leaves, four different protocols, varying in method of stirring and extraction kit, were tested using Detection limit in pure culture two different starting amounts of Pseudomonas cells added Prior to tracking the tagged microorganism on plant nee- to the pine needles, for a total of eight combinations. dles amidst the resident epiphytic community, we set the Knowing the number of cells added, the volumes of buffer limits of its PCR-based visibility in pure conditions. The pro- in which we resuspended the extracted DNA, and the cedure is therefore assumed to be net of the negative aliquots taken in the PCR reaction, including two tenfold effects produced by: (a) technical losses during the release dilution steps, we can specify also the theoretical number procedure due to incomplete transfer to the target surface; of genomes present in the virtual case of 100% recovery (b) runoff and other forms of post-release displacement; efficiency. The specific PCR detection of our GMM construct (c) partial efficiency of extraction procedures from the envi- was obtained by using the ad-hoc primer pair encompass- ronmental substrate; (d) inhibition of amplification by co- ing the unique synthetic promoter and the cry9a gene from purified chemicals affecting polymerase performance; (e) B. thuringiensis cloned downstream. Such detection non-specific competition by increasing amounts of DNA method is unambiguous also when used in the environment templates from alternative biota. By performing serial dilu- as the first target sequence (assembled by oligonucleotide tions of the template, and coupling the procedure with synthesis) is virtually absent elsewhere in nature accurate cell counts in a Thoma chamber, we were able to (Giacomini et al., 1994). The results (Table 1) list cases evaluate the minimum number of cells yielding a visible when positive (gel-visible) amplification was obtained. amplicon in gel electrophoresis. Such limit turned out to be The MoBio Power Soil DNA extraction kit performed bet- 2 x 10 genomes, confirming the fact that, in ideal condi- ter than the kit designed for aqueous samples, independ- tions, the presence of our target organism can be assessed ently of the method of suspension, although the band from from as few as 200 cells. This sensitivity is also due to the the stomacher protocol (prot. no.6) was slightly fainter than TABLE 1 - Results of comparative extraction from pine needles (2 g) mixed with known amounts of Pseudomonas sp. Clb01 cells in liquid suspension Protocol Method Starting Number of Number of Number of (#) cell (n.) genomes/PCR* genomes/PCR* genomes/PCR* -1 -2 (dil. 10 ) (dil. 10 ) 9 8 7 6 1 Glass beads + soil kit 5.44 x 10 1.088 x 10 (+++) 1.088 x 10 (+) 1.088 x 10 (+) 9 8 7 6 2 Stomacher + soil kit 5.44 x 10 1.088 x 10 (+++) 1.088 x 10 (++) 1.088 x 10 (+) 9 8 7 6 3 Glass beads + H O kit 5.44 x 10 1.088 x 10 (+) 1.088 x 10 (+++) 1.088 x 10 (++) 9 8 7 6 4 Stomacher + H O kit 5.44 x 10 1.088 x 10 (+++) 1.088 x 10 (++) 1.088 x 10 (+) 6 5 4 3 5 Glass beads + soil kit 5.44 x 10 1.088 x 10 (+) 1.088 x 10 (-) 1.088 x 10 (-) 6 5 4 3 6 Stomacher + soil kit 5.44 x 10 1.088 x 10 (+) 1.088 x 10 (-) 1.088 x 10 (-) 6 5 4 3 7 Glass beads + H O kit 5.44 x 10 1.088 x 10 (-) 1.088 x 10 (-) 1.088 x 10 (-) 6 5 4 3 8 Stomacher + H O kit 5.44 x 10 1.088 x 10 (-) 1.088 x 10 (-) 1.088 x 10 (-) Protocol numbers: see description in Materials and Methods. * Number of genomes theoretically expected to be present in a single PCR reaction in situation of 100% recovery. Boldface: cases from which PCR yielded a visible amplicon product in gel electrophoresis. (+) Signs: intensity of the stained band on a structured scale; (+++): strong, (++): medium, (+): faint signal. Tests were replicat- ed three times, yielding constant results. 166 S. Alberghini et al. that given by the glass beads (no.5). The nominal detection (Table 1). However with adhering cells, sensitivity was 5 5 limit was 1.088 x 10 genomes. There is a reduction of lower, as 40 cycles were necessary to detect 6 x 10 nom- more than 500 times compared with the limit from pure cul- inally expected genomes. As one of the reasons which may ture (2 x 10 ). As expected this difference may be inter- affect sensitivity was supposedly a loss occurring during preted as due to various factors affecting efficiency. One of absorptions and elution steps of the soil kit, we assessed these is presumably the release of enzyme-inhibitory ter- whether omitting the kit and bringing the cells straight to pens from conifer needles during stirring. Other critical lysis after glass bead vortexing and a single centrifugation steps may be inherent in the microcolumn passages in the would increase sensitivity. As Table 2 shows, we were able kits. Several reports in the literature show variable results. to reveal 3.3 x 10 presumed genomes. However, in this 5 0 -2 Schena et al. (2002) found a limit of 10 cells/ml to reveal procedure, high concentrations (10 through 10 dilutions) Aureobasidium pullulans in grape washings. Picard et al. failed to amplify, suggesting that omitting the kit purifica- (1992) report 10 cells as the lower end of the sensitivity tion step does not remove Taq polymerase-inhibiting com- range for an MPN PCR technique to detect bacteria in soil. pounds carried over from pine needles. The suspicion that In order to evaluate extraction sensitivity starting from co-centrifuged compounds were responsible for PCR failure a situation more comparable to a real phyllospheric coloni- was confirmed by performing a series of PCRs with a posi- sation, instead of simply mixing cells in suspension with the tive control DNA (purified from a colony) mixed with leaf material prior to extraction, Pseudomonas cells were decreasing amounts of the templates from protocols # 10 allowed to stick to the pine needles by wetting them in sus- and # 11. As expected, templates from the glass pensions with known amounts of bacteria/ml, withdrawing bead/direct lysis procedure were able to inhibit control -2 the needles, measuring the amount of liquid retained and amplification unless diluted below to 10 (data not shown). allowing the needles to dry under a laminar flow hood. Our results can be compared with those from similar Subsequently, three extraction procedures were tested and tests on gymnosperm plants (Charity and Klimaszewska, sensitivity quantified as above. The protocols used in this 2005) in which needles of Pinus radiata were spiked with case included grinding in liquid nitrogen with mortar and cells of Agrobacterium tumefaciens to be searched by PCR pestle, followed by extraction with the MoBio soil DNA with virD primers. However after genomic extraction from extraction kit (protocol # 9). In comparison we tested the the plant material, notwithstanding the purification with same glass beads + soil kit procedure which had given the Bio101 columns, the authors found a detection limit not 9 10 best results in the previous tests (protocol # 10), and a lower than 10 -10 cells per gram of needle tissue, corre- 8 9 shorter version of it in which, after vortexing with glass sponding to 2 x 10 – 2 x 10 cells per extraction. beads, the centrifuged material was brought directly to a In our case, upon optimising the protocols we could lysis step instead of being extracted with the kit (protocol achieve a very high sensitivity enabling a limit of 10 cells # 11). In addition to the standard 35-cycle PCR, a longer to be detected (Protocol # 11, Table 2), which is within the run with 40 cycles was also tested for protocols # 10 and order of magnitude of the limit that we had recorded in # 11. Results are shown in Table 2. pure culture. In any event, as a methodological consider- It may be observed that, as regards the liquid nitrogen ation on the chosen strategy, we can add that rather than procedure (9), all reactions turned negative, presumably aiming at the highest level of detection and using corre- due to copious inhibitory organic compounds resulting from spondingly lengthier approaches such as in-situ hybridisa- ground leaves. Protocol (10), based on the same steps as tion or immunolocalisation microscopy, we preferred, as protocol (1), revealed the target at a theoretical number of shown above, to assess the boundaries of detection by genomes similar to that assessed with the suspensions using simple PCR+electrophoresis-based techniques, as TABLE 2 - Results of extractions from pine needles on which known amounts of Pseudomonas sp. Clb01 cells had been allowed to dry Protocol (#) Method Dilution No. genomes/PCR PCR 35 cycles PCR 40 cycles 0 7 9Liquid N 10 2.09 x 10 (-) n.d. -1 6 + soil kit 10 2.09 x 10 (-) n.d. -2 5 10 2.09 x 10 (-) n.d. -3 4 10 2.09 x 10 (-) n.d. -4 3 10 2.09 x 10 n.d. n.d. 0 7 10 Glass beads 10 6.0x10 (++) (+++) -1 6 + soil kit 10 6.0x10 (+) (++) -2 5 10 6.0x10 (-) (+) -3 4 10 6.0 x 10 (-) (-) -4 3 10 6.0 x 10 n.d. (-) 0 6 11 Glass beads 10 3.3 x 10 (-) (-) -1 5 +direct lysis 10 3.3 x 10 (-) (-) -2 4 10 3.3 x 10 (-) (-) -3 3 10 3.3x10 (+) (+++) -4 2 10 3.3x10 n.d. (+) Protocol numbers: description in Materials and Methods. Symbols as in Table 1, n.d.: not determined. The meanings of boldface text and (+) signs are as in Table 1. Tests were replicated three times, yielding constant results. Ann. Microbiol., 58 (1), 163-167 (2008) 167 these can be more efficiently proposed and applied for the Corich V., Giacomini A., Basaglia M., Vendramin E., Vian P., Carlot M., Basaglia M., Squartini A., Casella S., Nuti M.P. routine analysis of large numbers of samples in the aver- (2001a). Aspects of marker/reporter stability and selectivity age laboratory involved in broad-scale environmental mon- in soil microbiology. Microb. Ecol., 41: 333-340. itoring. Corich V., Giacomini A., Carlot M., Simon R., Tichy H.V., In conclusion, the method that can be recommended Squartini A. Nuti M.P. (2001b). Comparative strain-typing of for routine analyses of tagged bacteria from the canopy of Rhizobium leguminosarum bv. viciae natural populations. Can. J. of Microbiol., 47: 580-584. gymnosperms is the protocol combining glass beads and the MoBio power soil DNA extraction kit (Protocol # 1). Corich V., Giacomini A., Vendramin E., Vian P., Carlot M., Concheri G., Polone E., Casella S., Nuti M.P., Squartini A. Besides the goal of detecting specific microorganisms, (2007). Long term evaluation of field-released genetically or the results of their horizontal gene transfer to other bac- modified rhizobia. Environ. Biosafety Res., 6: 167-181. teria (reviewed by Heuer and Smalla, 2007), the methods Cullen D.W., Nicholson P.S., Mendum T.A., Hirsch P.R. (1998). presented here can be applied to study the whole epiphyt- Monitoring genetically-modified rhizobia in field soils using ic bacterial community, whose genome pools are available the polymerase chain reaction. J. Appl. Microbiol. 84: 1025- in the very same lysate and suitable for other PCR-based 1034 investigation by appropriate primers. Donegan K., Matyac C., Seidler R., Porteous A. (1991). Our future work, capitalising on the use of the methods Evaluation of methods for sampling, recovery, and enumer- ation of bacteria applied to the phylloplane. Appl Environ hereby described, is focusing on the monitoring of Microbiol., 57: 51-56. Pseudomonas sp. pDBCRY9a upon its release on the Giacomini A., Ollero F.J., Squartini A., Nuti M.P. (1994). canopy of pine trees in a long term biocontrol trial against Construction of multipurpose gene cartridges based on a insect defoliators. novel synthetic promoter for high-level gene expression in Gram-negative bacteria. Gene, 144: 17-24. Acknowledgments Heuer H., Smalla K. (2007) Horizontal gene transfer between Sara Alberghini was the recipient of a post-doctoral grant bacteria. Environ. Biosafety Res. 6: 3- 13 from the University of Padova. This work was supported in Hirsch P.R. (1996). Population dynamics of indigenous and part by an Italian National MURST-PRIN Grant and by funds genetically modified rhizobia in the field. New Phytol., 133: 159-171 from the Veneto Region Forest Protection Project. Jansson J., Van Elsas J.D., Bailey M. (Eds.) (2000) Tracking genetically engineered microorganisms, Landes Biosciences, Georgetown TX USA. REFERENCES Lindow S.E., Brandl M.T. (2003) Microbiology of the Phyllosphere. Appl. Environ. Microbiol. 69: 1875–1883. Alberghini S., Filippini R., Marchetti E., Dindo M.L., Shevelev A.B., Battisti A., Squartini A. (2005). Construction of a Miethling R., Tebbe C. (2004) Resilience of a soil-established, Pseudomonas sp. derivative carrying the Cry9Aa gene from genetically modified Sinorhizobium meliloti inoculant to soil Bacillus thuringiensis and proposal of new standard criteria to management practices. Appl. Soil Ecol., 25:161-167. assess entomocidal properties of bacteria. Res Microbiol. Naseby D.C., Lynch J.M. (1998) Impact of wild type and geneti- 156: 690-699. cally modified Pseudomonas fluorescens on soil enzyme Alberghini S., Filippini R., Shevelev A.B., Battisti A., Squartini A. activities and microbial population structure in the rhizos- (2006). Extended plant protection by an epiphytic phere of pea. Mol. Ecol., 7:617-625. Pseudomonas sp. derivative carrying the cry9Aa gene from Nuti M.P., Russo A., Toffanin A., Casella S., Corich V., Squartini Bacillus thuringiensis galleriae against the pine processionary A., Giacomini A., Peruch U., Basaglia M. (2003) What did we moth Thaumetopoea pityocampa. Biocontrol Science and learn from 24 field releases of GMMs in Italy? In: Lelley T., Technol., 16: 709-715. Balasz E., Tepfer M. (Eds.) Ecological Impact of GMO Barth P.T. (1979). RP4 and R300B as wide-host-range plasmid Dissemination in Agro-Ecosystems, Facultas Verlags, Vienna, cloning vehicles. in: Plasmids of Medical, Environmental and pp.45-54. Commercial Importance (Timmis K.N., and Pühler A., Eds.) Nuti M.P., Squartini A., Giacomini A. (1994). European pp. 399-410 Elsevier, Amsterdam, Community regulation for the use and release of genetically Beattie G.A., Lindow SE (1999). Bacterial colonization of leaves: modified organisms (GMOs) in the environment. In: O’Gara A spectrum of strategies. Phytopathol., 89: 353-359. F., Dowling D., Boesten B. (Eds.) Molecular Ecology of Rhizosphere Microorganisms. VCH Publ., Weinheim, Charity J.A., Klimaszewska K. (2005). Persistence of Germany, pp. 165-173 Agrobacterium tumefaciens in transformed conifers. Environ. Biosafety Res., 4: 167-177. Picard C., Ponsonnet C., Paget E., Nesme X., Simonet P. (1992). Detection and enumeration of bacteria in soil by direct DNA Corich V., Giacomini A., Ollero F.J., Squartini A., Nuti M.P. extraction and polymerase chain reaction. Appl Environ (1991). Pulsed-field electrophoresis in contour clamped Microbiol. 58: 2717-2722. homogeneous electric field (CHEF) for the fingerprinting of Rhizobium sp. FEMS Microbiol. Lett., 83: 193-198. Schena L., Finetti Sialer M., Gallitelli D. (2002). Molecular detec- tion of strain L47 of Aureobasidium pullulans, a biocontrol Corich V., Bosco F., Giacomini A., Basaglia M., Squartini A., Nuti agent of postharvest diseases. Plant Dis. 86: 54-60. M.P. (1996). Fate of genetically modified Rhizobium legumi- nosarum biovar viciae during long-term storage of commer- Yoshimura F. (1982). Phylloplane bacteria in a pine forest. Can. cial inoculants, J. Appl. Bacteriol., 81: 319-328. J. Microbiol., 28: 580-592. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

Methods and detection limits in tracking a genetically modifiedPseudomonas sp. released in the pine phyllosphere

Download PDF
5 pages

Loading next page...
 
/lp/springer-journals/methods-and-detection-limits-in-tracking-a-genetically-oh9s2tWhYc

References (29)

Publisher
Springer Journals
Copyright
Copyright © 2008 by University of Milan and Springer
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Fungus Genetics; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/BF03179462
Publisher site
See Article on Publisher Site

Abstract

Annals of Microbiology, 58 (1) 163-167 (2008) Methods and detection limits in tracking a genetically modified Pseudomonas sp. released in the pine phyllosphere 1 2 1 Sara ALBERGHINI , Andrea BATTISTI , Andrea SQUARTINI * 1 2 Dipartimento di Biotecnologie Agrarie, Dipartimento di Agronomia Ambientale e Produzioni Vegetali, Università di Padova, Viale dell’Università 16, 35020 Legnaro, Padova, Italy Received 15 November 2007 / Accepted 31 January 2008 Abstract - A method suitable to detect the presence and follow the fate of specific bacteria released on the phyllosphere of conifer trees was devised, tested, and optimised. The procedure was set up using a biocontrol strain that had shown effectiveness and per- sistence in greenhouse trials against insect pests. The microorganism used is based on a Pseudomonas sp., originally isolated from Pinus nigra and carries the cry9a toxin gene from Bacillus thuringiensis. In order to assess its detectability, specific primers were designed, and the most suitable protocol for DNA isolation from bacteria colonising pine needles was defined upon an experimental comparison of various methods. Different conditions of physical pre-treatments and their combinations with commercially available kits protocols were tested. The most sensitive monitoring (about 10 released cells) was achieved by a procedure based on vortexing in a suspension of glass beads followed by the use of microcolumns designed for a soil DNA extraction kit. The application can be rec- ommended in biosafety studies of released GMMs as well as in ecological surveys of phyllosphere microbiota. Key words: Pseudomonas sp., GMM, detection limits, phyllosphere, Pinus. INTRODUCTION moreover, are mostly relative to herbaceous crops (Donegan et al., 1991). The phyllosphere of conifer trees to Being able to keep track of microorganisms deliberately our knowledge has not yet been investigated in terms of released into the environment is an acknowledged priority release and detectability of engineered microorganisms. from both scientific and normative standpoints. Both the Also as concerns its normal resident prokaryotic microbio- detection of GMMs and that of non-recombinant strains can ta, only limited information is available yet (Yoshimura, benefit from the availability of monitoring strategies for the 1982). The present paper wishes therefore to address the scopes of biosafety and efficiency of application. The impor- issue of microbial detection in this poorly known habitat. tance of microbe-tracking and rescuing protocols has also Defining methods to detect GMMs in phyllosphere will be of been stressed at political level in Europe, through the increasing interest in the future as different projects are guidelines issued at both EU and national levels (Nuti et al., planning the use of introduced heterologous traits in bacte- 1994). Long-term approaches on risk assessment have ria to be tested for the biological control of insect defolia- been undertaken through joint programs, which have yield- tors in forest environments. ed comprehensive data covering several fields (Jansson et We previously described the construction of a biocontrol al., 2000; Nuti et al., 2003; Corich et al,. 2007). Of partic- strain based on a natural phyllospheric isolate of ular importance is the issue of detection limit, the numeri- Pseudomonas sp. which has been endowed with the Cry9a cal threshold per sampled habitat volume, below which the gene from Bacillus thuringiensis galleriae (Alberghini et al., presence of the target organism is overlooked. As in many 2005). The GMM proved effective against the the greater other instances, specific DNA amplification via PCR has wax moth Galleria mellonella and the pine processionary become one of the protocols of choice for such tasks caterpillar Thaumetopoea pityocampa. The latter was chal- (Cullen et al., 1998). Gene dosage issues and replicon sta- lenged in greenhouse trials carried out for over 100 days on bility can affect the sensitivity of this approach (Corich et potted Pinus mugo (Alberghini et al., 2006). The toxin al., 1991; Corich et al. 2001a; Corich et al. 2001b). gene, carried on a broad host range plasmid vector, was While many different studies have addressed the mon- cloned under the control of a regulated synthetic promoter, itoring of GMM released in soil (Hirsch 1996; van Veen et assembled by aligning the consensus of several strong bac- al., 1997; Naseby and Lynch, 1998; Miethling and Tebbe terial promoters (Giacomini et al., 1994). The presence of 2004), much less explored until now is the leaf environ- this unique sequence allows to design primers suitable for ment (Lindow and Brandl, 2003). The few data available the unambiguous PCR-based detection of the construct in the environment. In the present report we devised and optimised a protocol to isolate bacteria from gymnosperm * Corresponding author. E-mail: squart@unipd.it 164 S. Alberghini et al. tree leaves and assessed its detection limits in tracing the Set-up and optimisation of a protocol for bacterial quantitative presence of specific bacterial genes by poly- DNA rescue from phyllosphere. In order to select the merase chain reaction. most efficient procedure to be used for DNA isolation from pine microbial epiphytes, we spiked untreated pine needles with known amounts of Pseudomonas Clb01 pDBCRY9a MATERIALS AND METHODS cells and processed the material in parallel using two differ- ent resuspension devices and then extracting the resulting Bacterial strains and growth conditions. The wild-type samples with two environmental DNA extraction kits. Four Pseudomonas sp. strain Clb01 (16S rDNA sequence protocol combinations were carried out as follows: (1) - Genbank accession: AY574283, top homologies to Aliquots of 2 g (fresh weight) of Pinus mugo needles were Pseudomonas lutea and Pseudomonas graminis), isolated transferred to 50 ml falcon tubes containing 0.8 g of ster- from the phyllosphere of Pinus nigra on Mount Calbarina ilised glass beads (size 425-600 µm, Sigma Chemical Co. S. (Padova, Northern Italy, 11°43’E 45°16’N, 200 m) and Louis MO, USA), and 10 ml of sterile PBS (0.2 g/l KCl; 8 g/l used as a host for the gene encoding the Cry9Aa entomo- NaCl; 0.24 g/l KH PO ; 1.44 g/l Na HPO ; pH 7.2) to which 2 4 2 4 cidal toxin from Bacillus thuringiensis spp. galleriae, yield- 10 ml of a Pseudomonas sp. Clb01 pDBCRY9a suspension ing the derivative Clb01 pDBCRY9A, was grown as previ- (5.44 x 10 cells/ml in PBS) were added. The tubes were ously described (Alberghini et al., 2005). Cellular concen- vortexed for 3 min. The resulting liquid suspension was trations in working solutions were determined microscopi- pipetted in clean tubes and centrifuged at 5000 x g for 10 cally in a Thoma counting chamber (Thoma Fein Optik, Bad min. The pellet was extracted by an Ultra Clean Soil DNA Kit Blankenburg, Germany). (Mobio Laboratories, Inc., Solana Beach, CA, USA) and resuspended in 100 µl of sterile distilled water. (2) - The Foliar adherence tests. In order to assess whether same starting amount of needles was mixed with the same strong affinity between pine leaf cuticle and bacterial sur- bacterial suspension described above in a stomacher bag face components would occur, an overnight culture of and treated in a Circulator Stomacher mod. 400 apparatus Pseudomonas sp. Clb01 was centrifuged and resuspended (Seward Ltd, Worthing, UK) for 4 min at 260 rpm. The in 10 ml 0.85% NaCl to yield a cell concentration of 2.5 x whole liquid phase was centrifuged and extracted as above 10 cells/ml (assessed by a counting chamber under light with an Ultra Clean Soil DNA kit. (3) and (4) - The identical microscopy, as described above). The suspension was procedures described for protocols (1) and (2) respectively divided in two 5 ml aliquots transferred in 50 ml falcon were carried out but the pellets were extracted by an Ultra tubes, to each of which 1 g (fresh weight) of untreated Clean Water DNA Kit (Mobio Laboratories, Inc.) and resus- Pinus mugo pine needles was added. From one of the pended in 50 µl of sterile distilled water. (5), (6), (7), (8) - tubes, the needles were withdrawn after 10 s and the cells The same procedures described in (1), (2), (3), (4) were -2 remaining in suspension were counted again by carried out at a 10 dilution of the Pseudomonas cell sus- microscopy. The second tube was vortexed for 1 min, after pension. The purified DNA and its serial dilutions were used which cells in suspension were counted as above. as templates for specific PCR amplification of Pseudomonas sp. Clb01 as described in the previous section. Primer design and PCR amplification for selective As a protocol variation, we proceeded by wetting the tracking of GMM. To monitor the presence of the geneti- needles (2 g) with a bacterial cell suspension (2.14 x 10 cally modified Pseudomonas released in the phyllosphere cells/ml), withdrawing them, measuring by subtraction the by a molecular approach, we designed a primer pair spe- volume of liquid adhering to the needles (0.7 ml/g fresh cific for the plasmid pDBCRY9A. The first primer (Syn weight), and then drying the needles under a laminar hood GGTATAATATGCGCCATTAAGC) was based on the unique to have the added bacteria sticking to the surface. This sequence of our synthetic promoter pSyn. The second material was then subjected to the following alternative (Btcry GCAACATCATCAGATGCACA) was tailored on a extraction procedures: (9) - needles were ground under liq- downstream portion of the Bacillus thuringiensis cry9a uid nitrogen by mortar and pestle, and 0.7 g of the result- sequence (GenBank X58120) cloned in the construct. ing powder were extracted with the above-mentioned Ultra For amplifications, in first instance, in order to identify Clean Soil DNA kit. (10) - Alternatively, needles with adher- the detection limit from pure isolates, 4 ml of a liquid cul- ing bacteria were treated as in protocol #1, omitting the ture containing 2.5 x 10 cells/ml (counted in a Thoma addition of bacteria in suspension and using 20 ml of PBS. chamber under light microscopy) were lysed. Cells were (11) - The same method used for protocol #11 was used centrifuged at 13000 x g and lysed by resuspending the but, instead of proceeding with kit extraction, the cen- pellet in 50 µl of lysis buffer (0.25% SDS, 0.05 M NaOH) in trifuged pellet was resuspended in 0.9 ml of 0.05 M NaOH an Eppendorf tube, followed by stirring for 60 s on a vortex 0.25% SDS and lysed at 95 °C for 15 min. and heating at 95 °C for 15 min. Serial tenfold dilutions of the lysate were made. PCR was carried out in a 25 µl reac- tion volume, with the following program: initial denatura- RESULTS AND DISCUSSION tion at 94 °C for 1 min; 30 cycles at 94 °C for 1 min, 51 °C for 45 s, and 72 °C for 50 s; and a final extension at 72 °C Foliar adherence tests for 5 min. The PCR reaction mixture contained 20 mM Tris- Many strategies exist for bacterial leaf colonisation (Beattie HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl , 0.2 mM of each and Lindow, 1999). Epiphytic bacteria are exposed to dATP, dCTP, dGTP and dTTP, 0.2 µM of each primer, and meteorological effects such as wind, rainwater runoff and 0.5 U Taq DNA Polymerase, recombinant (InVitrogen Life drifting, which challenge their persistence on leaves. On Technologies). Serial dilutions of the product were analysed conifer needles and other xerophytic vegetation, a waxy by 1% agarose gel electrophoresis. hydrophobic cuticle is found. Bacterial colonisation may be Ann. Microbiol., 58 (1), 163-167 (2008) 165 strengthened by specific surface interactions mediated by fact that the target region is borne on plasmid pDBCRY9a, compatible surface components. In this test, we aimed at which is a derivative of pRL497, whose origin of replication assessing whether a strong affinity would be manifest in is that of replicon RSF1010, an IncQ broad host range vec- short exposures between bacterial suspensions and leaf tor with a copy number of about 30 elements per cell surfaces. As the direct approach of counting bacteria (Barth, 1979) The use of a plasmid-borne target gene with remaining on needles by microscopy would be inaccurate a reasonably high dosage, rather than a chromosomal one, due to insufficient resolution of the visualisation method on is in this sense advantageous as regards the sensitivity of such heterogeneous surfaces, we devised an indirect detection. The 200 genomes in our case correspond method based on subtraction. This was done by dipping approximately to 200 x 30 = 6000 copies of the target needles in bacterial suspensions and counting cells remain- gene. ing in suspension after needle removal. The results did not Plasmid construct stability is an important aspect in show any significant difference between direct counts these studies. In the present case our previous data (Corich before and after contact with the needles (t test, t = 0.12, et al., 1996) are available on the stability, in gram negative d.f. = 28, p = 0.90) and even after vortexing (t test, t = bacteria, of the vector containing the same synthetic pro- 1.22, d.f. = 26, p = 0.23). Therefore, notwithstanding the moter used for pDBCRY9a. Bacteria were grown for 70 gen- epiphytic habitat of isolation of Pseudomonas sp. Clb01, erations in the absence of antibiotic selective pressure and under our experimental conditions, we can exclude strong the plasmid was retained at a rate higher than 99%. adhesion to needles in the short term. This information is important in interpreting the dynamics of Pseudomonas Detection limits in protocols of extraction from persistence in the subsequent experiments, when the con- leaves with known amounts of target struct was released on the pine canopy by spraying cell cul- In order to elect the most effective procedure to isolate ture suspensions and its presence monitored over time. bacteria from pine leaves, four different protocols, varying in method of stirring and extraction kit, were tested using Detection limit in pure culture two different starting amounts of Pseudomonas cells added Prior to tracking the tagged microorganism on plant nee- to the pine needles, for a total of eight combinations. dles amidst the resident epiphytic community, we set the Knowing the number of cells added, the volumes of buffer limits of its PCR-based visibility in pure conditions. The pro- in which we resuspended the extracted DNA, and the cedure is therefore assumed to be net of the negative aliquots taken in the PCR reaction, including two tenfold effects produced by: (a) technical losses during the release dilution steps, we can specify also the theoretical number procedure due to incomplete transfer to the target surface; of genomes present in the virtual case of 100% recovery (b) runoff and other forms of post-release displacement; efficiency. The specific PCR detection of our GMM construct (c) partial efficiency of extraction procedures from the envi- was obtained by using the ad-hoc primer pair encompass- ronmental substrate; (d) inhibition of amplification by co- ing the unique synthetic promoter and the cry9a gene from purified chemicals affecting polymerase performance; (e) B. thuringiensis cloned downstream. Such detection non-specific competition by increasing amounts of DNA method is unambiguous also when used in the environment templates from alternative biota. By performing serial dilu- as the first target sequence (assembled by oligonucleotide tions of the template, and coupling the procedure with synthesis) is virtually absent elsewhere in nature accurate cell counts in a Thoma chamber, we were able to (Giacomini et al., 1994). The results (Table 1) list cases evaluate the minimum number of cells yielding a visible when positive (gel-visible) amplification was obtained. amplicon in gel electrophoresis. Such limit turned out to be The MoBio Power Soil DNA extraction kit performed bet- 2 x 10 genomes, confirming the fact that, in ideal condi- ter than the kit designed for aqueous samples, independ- tions, the presence of our target organism can be assessed ently of the method of suspension, although the band from from as few as 200 cells. This sensitivity is also due to the the stomacher protocol (prot. no.6) was slightly fainter than TABLE 1 - Results of comparative extraction from pine needles (2 g) mixed with known amounts of Pseudomonas sp. Clb01 cells in liquid suspension Protocol Method Starting Number of Number of Number of (#) cell (n.) genomes/PCR* genomes/PCR* genomes/PCR* -1 -2 (dil. 10 ) (dil. 10 ) 9 8 7 6 1 Glass beads + soil kit 5.44 x 10 1.088 x 10 (+++) 1.088 x 10 (+) 1.088 x 10 (+) 9 8 7 6 2 Stomacher + soil kit 5.44 x 10 1.088 x 10 (+++) 1.088 x 10 (++) 1.088 x 10 (+) 9 8 7 6 3 Glass beads + H O kit 5.44 x 10 1.088 x 10 (+) 1.088 x 10 (+++) 1.088 x 10 (++) 9 8 7 6 4 Stomacher + H O kit 5.44 x 10 1.088 x 10 (+++) 1.088 x 10 (++) 1.088 x 10 (+) 6 5 4 3 5 Glass beads + soil kit 5.44 x 10 1.088 x 10 (+) 1.088 x 10 (-) 1.088 x 10 (-) 6 5 4 3 6 Stomacher + soil kit 5.44 x 10 1.088 x 10 (+) 1.088 x 10 (-) 1.088 x 10 (-) 6 5 4 3 7 Glass beads + H O kit 5.44 x 10 1.088 x 10 (-) 1.088 x 10 (-) 1.088 x 10 (-) 6 5 4 3 8 Stomacher + H O kit 5.44 x 10 1.088 x 10 (-) 1.088 x 10 (-) 1.088 x 10 (-) Protocol numbers: see description in Materials and Methods. * Number of genomes theoretically expected to be present in a single PCR reaction in situation of 100% recovery. Boldface: cases from which PCR yielded a visible amplicon product in gel electrophoresis. (+) Signs: intensity of the stained band on a structured scale; (+++): strong, (++): medium, (+): faint signal. Tests were replicat- ed three times, yielding constant results. 166 S. Alberghini et al. that given by the glass beads (no.5). The nominal detection (Table 1). However with adhering cells, sensitivity was 5 5 limit was 1.088 x 10 genomes. There is a reduction of lower, as 40 cycles were necessary to detect 6 x 10 nom- more than 500 times compared with the limit from pure cul- inally expected genomes. As one of the reasons which may ture (2 x 10 ). As expected this difference may be inter- affect sensitivity was supposedly a loss occurring during preted as due to various factors affecting efficiency. One of absorptions and elution steps of the soil kit, we assessed these is presumably the release of enzyme-inhibitory ter- whether omitting the kit and bringing the cells straight to pens from conifer needles during stirring. Other critical lysis after glass bead vortexing and a single centrifugation steps may be inherent in the microcolumn passages in the would increase sensitivity. As Table 2 shows, we were able kits. Several reports in the literature show variable results. to reveal 3.3 x 10 presumed genomes. However, in this 5 0 -2 Schena et al. (2002) found a limit of 10 cells/ml to reveal procedure, high concentrations (10 through 10 dilutions) Aureobasidium pullulans in grape washings. Picard et al. failed to amplify, suggesting that omitting the kit purifica- (1992) report 10 cells as the lower end of the sensitivity tion step does not remove Taq polymerase-inhibiting com- range for an MPN PCR technique to detect bacteria in soil. pounds carried over from pine needles. The suspicion that In order to evaluate extraction sensitivity starting from co-centrifuged compounds were responsible for PCR failure a situation more comparable to a real phyllospheric coloni- was confirmed by performing a series of PCRs with a posi- sation, instead of simply mixing cells in suspension with the tive control DNA (purified from a colony) mixed with leaf material prior to extraction, Pseudomonas cells were decreasing amounts of the templates from protocols # 10 allowed to stick to the pine needles by wetting them in sus- and # 11. As expected, templates from the glass pensions with known amounts of bacteria/ml, withdrawing bead/direct lysis procedure were able to inhibit control -2 the needles, measuring the amount of liquid retained and amplification unless diluted below to 10 (data not shown). allowing the needles to dry under a laminar flow hood. Our results can be compared with those from similar Subsequently, three extraction procedures were tested and tests on gymnosperm plants (Charity and Klimaszewska, sensitivity quantified as above. The protocols used in this 2005) in which needles of Pinus radiata were spiked with case included grinding in liquid nitrogen with mortar and cells of Agrobacterium tumefaciens to be searched by PCR pestle, followed by extraction with the MoBio soil DNA with virD primers. However after genomic extraction from extraction kit (protocol # 9). In comparison we tested the the plant material, notwithstanding the purification with same glass beads + soil kit procedure which had given the Bio101 columns, the authors found a detection limit not 9 10 best results in the previous tests (protocol # 10), and a lower than 10 -10 cells per gram of needle tissue, corre- 8 9 shorter version of it in which, after vortexing with glass sponding to 2 x 10 – 2 x 10 cells per extraction. beads, the centrifuged material was brought directly to a In our case, upon optimising the protocols we could lysis step instead of being extracted with the kit (protocol achieve a very high sensitivity enabling a limit of 10 cells # 11). In addition to the standard 35-cycle PCR, a longer to be detected (Protocol # 11, Table 2), which is within the run with 40 cycles was also tested for protocols # 10 and order of magnitude of the limit that we had recorded in # 11. Results are shown in Table 2. pure culture. In any event, as a methodological consider- It may be observed that, as regards the liquid nitrogen ation on the chosen strategy, we can add that rather than procedure (9), all reactions turned negative, presumably aiming at the highest level of detection and using corre- due to copious inhibitory organic compounds resulting from spondingly lengthier approaches such as in-situ hybridisa- ground leaves. Protocol (10), based on the same steps as tion or immunolocalisation microscopy, we preferred, as protocol (1), revealed the target at a theoretical number of shown above, to assess the boundaries of detection by genomes similar to that assessed with the suspensions using simple PCR+electrophoresis-based techniques, as TABLE 2 - Results of extractions from pine needles on which known amounts of Pseudomonas sp. Clb01 cells had been allowed to dry Protocol (#) Method Dilution No. genomes/PCR PCR 35 cycles PCR 40 cycles 0 7 9Liquid N 10 2.09 x 10 (-) n.d. -1 6 + soil kit 10 2.09 x 10 (-) n.d. -2 5 10 2.09 x 10 (-) n.d. -3 4 10 2.09 x 10 (-) n.d. -4 3 10 2.09 x 10 n.d. n.d. 0 7 10 Glass beads 10 6.0x10 (++) (+++) -1 6 + soil kit 10 6.0x10 (+) (++) -2 5 10 6.0x10 (-) (+) -3 4 10 6.0 x 10 (-) (-) -4 3 10 6.0 x 10 n.d. (-) 0 6 11 Glass beads 10 3.3 x 10 (-) (-) -1 5 +direct lysis 10 3.3 x 10 (-) (-) -2 4 10 3.3 x 10 (-) (-) -3 3 10 3.3x10 (+) (+++) -4 2 10 3.3x10 n.d. (+) Protocol numbers: description in Materials and Methods. Symbols as in Table 1, n.d.: not determined. The meanings of boldface text and (+) signs are as in Table 1. Tests were replicated three times, yielding constant results. Ann. Microbiol., 58 (1), 163-167 (2008) 167 these can be more efficiently proposed and applied for the Corich V., Giacomini A., Basaglia M., Vendramin E., Vian P., Carlot M., Basaglia M., Squartini A., Casella S., Nuti M.P. routine analysis of large numbers of samples in the aver- (2001a). Aspects of marker/reporter stability and selectivity age laboratory involved in broad-scale environmental mon- in soil microbiology. Microb. Ecol., 41: 333-340. itoring. Corich V., Giacomini A., Carlot M., Simon R., Tichy H.V., In conclusion, the method that can be recommended Squartini A. Nuti M.P. (2001b). Comparative strain-typing of for routine analyses of tagged bacteria from the canopy of Rhizobium leguminosarum bv. viciae natural populations. Can. J. of Microbiol., 47: 580-584. gymnosperms is the protocol combining glass beads and the MoBio power soil DNA extraction kit (Protocol # 1). Corich V., Giacomini A., Vendramin E., Vian P., Carlot M., Concheri G., Polone E., Casella S., Nuti M.P., Squartini A. Besides the goal of detecting specific microorganisms, (2007). Long term evaluation of field-released genetically or the results of their horizontal gene transfer to other bac- modified rhizobia. Environ. Biosafety Res., 6: 167-181. teria (reviewed by Heuer and Smalla, 2007), the methods Cullen D.W., Nicholson P.S., Mendum T.A., Hirsch P.R. (1998). presented here can be applied to study the whole epiphyt- Monitoring genetically-modified rhizobia in field soils using ic bacterial community, whose genome pools are available the polymerase chain reaction. J. Appl. Microbiol. 84: 1025- in the very same lysate and suitable for other PCR-based 1034 investigation by appropriate primers. Donegan K., Matyac C., Seidler R., Porteous A. (1991). Our future work, capitalising on the use of the methods Evaluation of methods for sampling, recovery, and enumer- ation of bacteria applied to the phylloplane. Appl Environ hereby described, is focusing on the monitoring of Microbiol., 57: 51-56. Pseudomonas sp. pDBCRY9a upon its release on the Giacomini A., Ollero F.J., Squartini A., Nuti M.P. (1994). canopy of pine trees in a long term biocontrol trial against Construction of multipurpose gene cartridges based on a insect defoliators. novel synthetic promoter for high-level gene expression in Gram-negative bacteria. Gene, 144: 17-24. Acknowledgments Heuer H., Smalla K. (2007) Horizontal gene transfer between Sara Alberghini was the recipient of a post-doctoral grant bacteria. Environ. Biosafety Res. 6: 3- 13 from the University of Padova. This work was supported in Hirsch P.R. (1996). Population dynamics of indigenous and part by an Italian National MURST-PRIN Grant and by funds genetically modified rhizobia in the field. New Phytol., 133: 159-171 from the Veneto Region Forest Protection Project. Jansson J., Van Elsas J.D., Bailey M. (Eds.) (2000) Tracking genetically engineered microorganisms, Landes Biosciences, Georgetown TX USA. REFERENCES Lindow S.E., Brandl M.T. (2003) Microbiology of the Phyllosphere. Appl. Environ. Microbiol. 69: 1875–1883. Alberghini S., Filippini R., Marchetti E., Dindo M.L., Shevelev A.B., Battisti A., Squartini A. (2005). Construction of a Miethling R., Tebbe C. (2004) Resilience of a soil-established, Pseudomonas sp. derivative carrying the Cry9Aa gene from genetically modified Sinorhizobium meliloti inoculant to soil Bacillus thuringiensis and proposal of new standard criteria to management practices. Appl. Soil Ecol., 25:161-167. assess entomocidal properties of bacteria. Res Microbiol. Naseby D.C., Lynch J.M. (1998) Impact of wild type and geneti- 156: 690-699. cally modified Pseudomonas fluorescens on soil enzyme Alberghini S., Filippini R., Shevelev A.B., Battisti A., Squartini A. activities and microbial population structure in the rhizos- (2006). Extended plant protection by an epiphytic phere of pea. Mol. Ecol., 7:617-625. Pseudomonas sp. derivative carrying the cry9Aa gene from Nuti M.P., Russo A., Toffanin A., Casella S., Corich V., Squartini Bacillus thuringiensis galleriae against the pine processionary A., Giacomini A., Peruch U., Basaglia M. (2003) What did we moth Thaumetopoea pityocampa. Biocontrol Science and learn from 24 field releases of GMMs in Italy? In: Lelley T., Technol., 16: 709-715. Balasz E., Tepfer M. (Eds.) Ecological Impact of GMO Barth P.T. (1979). RP4 and R300B as wide-host-range plasmid Dissemination in Agro-Ecosystems, Facultas Verlags, Vienna, cloning vehicles. in: Plasmids of Medical, Environmental and pp.45-54. Commercial Importance (Timmis K.N., and Pühler A., Eds.) Nuti M.P., Squartini A., Giacomini A. (1994). European pp. 399-410 Elsevier, Amsterdam, Community regulation for the use and release of genetically Beattie G.A., Lindow SE (1999). Bacterial colonization of leaves: modified organisms (GMOs) in the environment. In: O’Gara A spectrum of strategies. Phytopathol., 89: 353-359. F., Dowling D., Boesten B. (Eds.) Molecular Ecology of Rhizosphere Microorganisms. VCH Publ., Weinheim, Charity J.A., Klimaszewska K. (2005). Persistence of Germany, pp. 165-173 Agrobacterium tumefaciens in transformed conifers. Environ. Biosafety Res., 4: 167-177. Picard C., Ponsonnet C., Paget E., Nesme X., Simonet P. (1992). Detection and enumeration of bacteria in soil by direct DNA Corich V., Giacomini A., Ollero F.J., Squartini A., Nuti M.P. extraction and polymerase chain reaction. Appl Environ (1991). Pulsed-field electrophoresis in contour clamped Microbiol. 58: 2717-2722. homogeneous electric field (CHEF) for the fingerprinting of Rhizobium sp. FEMS Microbiol. Lett., 83: 193-198. Schena L., Finetti Sialer M., Gallitelli D. (2002). Molecular detec- tion of strain L47 of Aureobasidium pullulans, a biocontrol Corich V., Bosco F., Giacomini A., Basaglia M., Squartini A., Nuti agent of postharvest diseases. Plant Dis. 86: 54-60. M.P. (1996). Fate of genetically modified Rhizobium legumi- nosarum biovar viciae during long-term storage of commer- Yoshimura F. (1982). Phylloplane bacteria in a pine forest. Can. cial inoculants, J. Appl. Bacteriol., 81: 319-328. J. Microbiol., 28: 580-592.

Journal

Annals of Microbiology – Springer Journals

Published: Jan 13, 2010

There are no references for this article.