Access the full text.
Sign up today, get DeepDyve free for 14 days.
T. Horii, Ryosuke Kobayashi, Mika Kimura, S. Morita, I. Hatada (2020)
Calcium-Free and Cytochalasin B Treatment Inhibits Blastomere Fusion in 2-Cell Stage Embryos for the Generation of Floxed Mice via Sequential ElectroporationCells, 9
C. Gurumurthy, Aidan O’Brien, R. Quadros, J. Adams, P. Alcaide, Shinya Ayabe, J. Ballard, S. Batra, Marie-Claude Beauchamp, Kathleen Becker, Guillaume Bernas, D. Brough, F. Carrillo-Salinas, W. Chan, Hanying Chen, Ruby Dawson, Victoria Demambro, Jinke D’Hont, K. Dibb, J. Eudy, Lin Gan, Jing Gao, A. Gonzales, A. Guntur, Huiping Guo, Donald Harms, Anne Harrington, Kathryn Hentges, N. Humphreys, S. Imai, H. Ishii, M. Iwama, E. Jonasch, Michelle Karolak, B. Keavney, Nay-Chi Khin, M. Konno, Yuko Kotani, Y. Kunihiro, Imayavaramban Lakshmanan, C. Larochelle, C. Lawrence, Lin Li, V. Lindner, Xian-de Liu, G. López-Castejón, A. Loudon, Jenna Lowe, Loydie Jerome-Majeweska, T. Matsusaka, Hiromi Miura, Y. Miyasaka, B. Morpurgo, Katherine Motyl, Y. Nabeshima, K. Nakade, T. Nakashiba, Kenichi Nakashima, Y. Obata, Sanae Ogiwara, M. Ouellet, Leif Oxburgh, Sandra Piltz, I. Pinz, M. Ponnusamy, D. Ray, Ronald Redder, C. Rosen, Nikki Ross, Mark Ruhe, L. Ryzhova, Ane Salvador, S. Alam, R. Sedláček, Karan Sharma, Chad Smith, K. Staes, L. Starrs, F. Sugiyama, Satoru Takahashi, Tomohiro Tanaka, A. Trafford, Y. Uno, L. Vanhoutte, Frederique Vanrockeghem, Brandon Willis, Christian Wright, Y. Yamauchi, Xin Yi, K. Yoshimi, Xuesong Zhang, Yu Zhang, M. Ohtsuka, Satyabrata Das, D. Garry, T. Hochepied, Paul Thomas, J. Parker-Thornburg, Antony Adamson, A. Yoshiki, Jean-François Schmouth, A. Golovko, W. Thompson, K. Lloyd, J. Wood, M. Cowan, T. Mashimo, S. Mizuno, Hao Zhu, P. Kasparek, L. Liaw, J. Miano, G. Burgio (2021)
Response to correspondence on “Reproducibility of CRISPR-Cas9 methods for generation of conditional mouse alleles: a multi-center evaluation”Genome Biology, 22
J. Concordet, M. Haeussler (2018)
CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screensNucleic Acids Research, 46
Flox= 3,304 bps (only loxP3' integrated=3,264 bps) WT=none EcoRI NheI
Tomomi Aida, Keiho Chiyo, T. Usami, Harumi Ishikubo, Risa Imahashi, Yusaku Wada, Kenji Tanaka, Tetsushi Sakuma, Takashi Yamamoto, Kohichi Tanaka (2015)
Cloning-free CRISPR/Cas system facilitates functional cassette knock-in in miceGenome Biology, 16
Kornel Labun, Tessa Montague, M. Krause, Y. Cleuren, Håkon Tjeldnes, Eivind Valen (2019)
CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editingNucleic Acids Research, 47
(2018)
CLICK: one-step generation of conditional knockout miceBMC Genomics, 19
Bin Gu, Eszter Posfai, J. Rossant (2018)
Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryosNature Biotechnology, 36
Ye Liu, Yubin Du, Wen Xie, Fan Zhang, D. Forrest, Chengyu Liu (2018)
Generation of Conditional Knockout Mice by Sequential Insertion of Two loxP Sites In Cis Using CRISPR/Cas9 and Single-Stranded DNA Oligonucleotides.Methods in molecular biology, 1874
R. Quadros, Hiromi Miura, Donald Harms, H. Akatsuka, Takehito Sato, Tomomi Aida, Ronald Redder, G. Richardson, Y. Inagaki, D. Sakai, S. Buckley, P. Seshacharyulu, S. Batra, M. Behlke, S. Zeiner, Ashley Jacobi, Y. Izu, W. Thoreson, L. Urness, S. Mansour, M. Ohtsuka, C. Gurumurthy (2017)
Easi-CRISPR: a robust method for one-step generation of mice carrying conditional and insertion alleles using long ssDNA donors and CRISPR ribonucleoproteinsGenome Biology, 18
P. Mali, Luhan Yang, K. Esvelt, J. Aach, M. Guell, James DiCarlo, J. Norville, G. Church (2013)
RNA-Guided Human Genome Engineering via Cas9Science, 339
Bangmei Wang, Kunyu Li, Amy Wang, M. Reiser, T. Saunders, R. Lockey, Jia-Wang Wang (2015)
Highly efficient CRISPR/HDR-mediated knock-in for mouse embryonic stem cells and zygotes.BioTechniques, 59 4
Liren Wang, Yanjiao Shao, Yuting Guan, Liang Li, Lijuan Wu, Fangrui Chen, Meizhen Liu, Huaqing Chen, Yanlin Ma, Xueyun Ma, Ming-Yu Liu, Dali Li (2015)
Large genomic fragment deletion and functional gene cassette knock-in via Cas9 protein mediated genome editing in one-cell rodent embryosScientific Reports, 5
Nickolas Auclair, A. Sané, Léna Ahmarani, N. Patey, J. Beaulieu, N. Peretti, S. Spahis, E. Levy (2021)
Sar1b mutant mice recapitulate gastrointestinal abnormalities associated with chylomicron retention diseaseJournal of Lipid Research, 62
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations
Renjie Shang, Haifeng Zhang, P. Bi (2020)
Generation of mouse conditional knockout alleles in one step using the i-GONAD methodGenome Research, 31
T. Horii, S. Morita, Mika Kimura, Naomi Terawaki, Mihiro Shibutani, I. Hatada (2017)
Efficient generation of conditional knockout mice via sequential introduction of lox sitesScientific Reports, 7
S. Ménoret, A. Cian, L. Tesson, S. Remy, C. Usal, J. Boulé, C. Boix, S. Fontanière, A. Crénéguy, T. Nguyen, Lucas Brusselle, R. Thinard, D. Gauguier, J. Concordet, Y. Cherifi, A. Fraichard, C. Giovannangeli, I. Anegon (2015)
Homology-directed repair in rodent zygotes using Cas9 and TALEN engineered proteinsScientific Reports, 5
Jonathan Wilde, Tomomi Aida, Ricardo Rosario, Tobias Kaiser, Peimin Qi, Martin Wienisch, Qiangge Zhang, Steven Colvin, G. Feng (2021)
Efficient embryonic homozygous gene conversion via RAD51-enhanced interhomolog repairCell, 184
(2021)
Rapid generation of conditional knockout mice using the CRISPR-Cas9 system and electroporation for neuroscience researchMol Brain, 14
H. Nishizono, Yuki Hayano, Y. Nakahata, Y. Ishigaki, R. Yasuda (2021)
Rapid generation of conditional knockout mice using the CRISPR-Cas9 system and electroporation for neuroscience researchMolecular Brain, 14
Luqing Zhang, Ruirui Jia, Norberto Palange, Achim Satheka, Jacques Togo, Y. An, Mabwi Humphrey, Luying Ban, Yan Ji, Honghong Jin, Xuechao Feng, Yaowu Zheng (2015)
Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9PLoS ONE, 10
Hui Yang, Haoyi Wang, C. Shivalila, A. Cheng, Linyu Shi, R. Jaenisch (2013)
One-Step Generation of Mice Carrying Reporter and Conditional Alleles by CRISPR/Cas-Mediated Genome EngineeringCell, 154
Y. Miyasaka, Y. Uno, K. Yoshimi, Y. Kunihiro, Takuji Yoshimura, Tomohiro Tanaka, Harumi Ishikubo, Y. Hiraoka, Norihiko Takemoto, Takao Tanaka, Yoshihiro Ooguchi, P. Skehel, Tomomi Aida, J. Takeda, T. Mashimo (2018)
Additional file 11: of CLICK: one-step generation of conditional knockout mice
Lauren Danahy (2017)
Publisher's NoteHyperfine Interactions, 131
S. Mizuno, Tra Dinh, Kanako Kato, Saori Mizuno-Iijima, Y. Tanimoto, Yoko Daitoku, Yoshikazu Hoshino, M. Ikawa, Satoru Takahashi, F. Sugiyama, K. Yagami (2014)
Simple generation of albino C57BL/6J mice with G291T mutation in the tyrosinase gene by the CRISPR/Cas9 systemMammalian Genome, 25
Simon Tröder, Lena Ebert, Linus Butt, Sonja Assenmacher, B. Schermer, B. Zevnik (2018)
An optimized electroporation approach for efficient CRISPR/Cas9 genome editing in murine zygotesPLoS ONE, 13
J. Oliveros, M. Franch, D. Tabas-Madrid, David San-León, L. Montoliu, P. Cubas, F. Pazos (2016)
Breaking-Cas—interactive design of guide RNAs for CRISPR-Cas experiments for ENSEMBL genomesNucleic Acids Research, 44
Masakazu Hashimoto, T. Takemoto (2015)
Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editingScientific Reports, 5
Hiromi Miura, R. Quadros, C. Gurumurthy, M. Ohtsuka (2017)
Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donorsNature Protocols, 13
C. Gurumurthy, O. AidanR., Brien, R. Quadros, J. Adams, P. Alcaide, Shinya Ayabe, J. Ballard, S. Batra, Marie-Claude Beauchamp, Kathleen Becker, Guillaume Bernas, D. Brough, F. Carrillo-Salinas, W. Chan, Hanying Chen, Ruby Dawson, Victoria Demambro, D. Jinke, Hont, K. Dibb, J. Eudy, Lin Gan, Jing Gao, A. Gonzales, A. Guntur, Huiping Guo, Donald Harms, Anne Harrington, Kathryn Hentges, N. Humphreys, S. Imai, H. Ishii, M. Iwama, E. Jonasch, Michelle Karolak, B. Keavney, Nay-Chi Khin, M. Konno, Yuko Kotani, Y. Kunihiro, Imayavaramban Lakshmanan, C. Larochelle, C. Lawrence, Lin Li, V. Lindner, Xian-de Liu, G. López-Castejón, A. Loudon, Jenna Lowe, L. Jerome-Majewska, T. Matsusaka, Hiromi Miura, Y. Miyasaka, B. Morpurgo, Katherine Motyl, Y. Nabeshima, K. Nakade, T. Nakashiba, Kenichi Nakashima, Y. Obata, Sanae Ogiwara, M. Ouellet, Leif Oxburgh, Sandra Piltz, I. Pinz, M. Ponnusamy, D. Ray, Ronald Redder, C. Rosen, Nikki Ross, Mark Ruhe, L. Ryzhova, Ane Salvador, S. Alam, R. Sedláček, Karan Sharma, Chad Smith, K. Staes, L. Starrs, F. Sugiyama, Satoru Takahashi, Tomohiro Tanaka, A. Trafford, Y. Uno, L. Vanhoutte, Frederique Vanrockeghem, Brandon Willis, Christian Wright, Y. Yamauchi, Xin Yi, K. Yoshimi, Xuesong Zhang, Yu Zhang, M. Ohtsuka, Satyabrata Das, D. Garry, T. Hochepied, Paul Thomas, J. Parker-Thornburg, Antony Adamson, A. Yoshiki, Jean-François Schmouth, A. Golovko, W. Thompson, K. Lloyd, J. Wood, M. Cowan, T. Mashimo, S. Mizuno, Hao Zhu, P. Kasparek, L. Liaw, J. Miano, G. Burgio (2019)
Reproducibility of CRISPR-Cas9 methods for generation of conditional mouse alleles: a multi-center evaluationGenome Biology, 20
Bin Gu, Eszter Posfai, M. Gertsenstein, J. Rossant (2020)
Efficient Generation of Large‐Fragment Knock‐In Mouse Models Using 2‐Cell (2C)‐Homologous Recombination (HR)‐CRISPRCurrent Protocols in Mouse Biology, 10
D. Shola, Chingwen Yang, Chiayun Han, Rada Norinsky, Ruben Peraza (2021)
Generation of Mouse Model (KI and CKO) via Easi-CRISPR.Methods in molecular biology, 2224
Denise Lanza, Angelina Gaspero, I. Lorenzo, L. Liao, P. Zheng, Ying Wang, Yu Deng, Chonghui Cheng, Chuansheng Zhang, J. Seavitt, F. DeMayo, Jianming Xu, M. Dickinson, A. Beaudet, J. Heaney (2018)
Comparative analysis of single-stranded DNA donors to generate conditional null mouse allelesBMC Biology, 16
V. Chu, Timm Weber, Robin Graf, T. Sommermann, Kerstin Petsch, U. Sack, P. Volchkov, K. Rajewsky, Ralf Kühn (2016)
Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotesBMC Biotechnology, 16
A. Raveux, S. Vandormael-Pournin, M. Cohen-Tannoudji (2017)
Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygoteScientific Reports, 7
Wenning Qin, S. Dion, Peter Kutny, Yingfan Zhang, A. Cheng, Nathaniel Jillette, A. Malhotra, A. Geurts, Yi-Guang Chen, Haoyi Wang (2015)
Efficient CRISPR/Cas9-Mediated Genome Editing in Mice by Zygote Electroporation of NucleaseGenetics, 200
Background: The discovery of the CRISPR‑ Cas9 system and its applicability in mammalian embryos has revolution‑ ized the way we generate genetically engineered animal models. To date, models harbouring conditional alleles (i.e. two loxP sites flanking an exon or a critical DNA sequence of interest) are amongst the most widely requested project type that are challenging to generate as they require simultaneous cleavage of the genome using two guides in order to properly integrate the repair template. An approach, using embryo sequential electroporation has been reported in the literature to successfully introduce loxP sites on the same allele. Here, we describe a modification of this sequential electroporation procedure that demonstrated the production of conditional allele mouse models for eight different genes via one of two possible strategies: either by consecutive sequential electroporation (strategy A) or non‑ consec‑ utive sequential electroporation (strategy B). This latest strategy originated from using the by‑product produced when using consecutive sequential electroporation (i.e. mice with a single targeted loxP site) to complete the project. Results: By using strategy A, we demonstrated successful generation of conditional allele models for three different genes (Icam1, Lox, and Sar1b), with targeting efficiencies varying between 5 and 13%. By using strategy B, we gener ‑ ated five conditional allele models (Loxl1, Pard6a, Pard6g, Clcf1, and Mapkapk5), with targeting efficiencies varying between 3 and 25%. Conclusion: Our modified electroporation‑based approach, involving one of the two alternative strategies, allowed the production of conditional allele models for eight different genes via two different possible paths. This reproduc‑ ible method will serve as another reliable approach in addition to other well‑ established methodologies in the litera‑ ture for conditional allele mouse model generation. Keywords: CRISPR, Electroporation, Conditional, loxP, Zygotes Background The discovery of the CRISPR-Cas9 system and its applica - bility in mammalian embryos has revolutionized the way we generate genetically engineered animal models. The generation of models relies on the delivery of CRISPR- *Correspondence: jean‑francois.schmouth.chum@ssss.gouv.qc.ca Cas9 components in embryos that results in induction Centre de recherche du CHUM, Université de Montréal, Montréal, Canada of double strand DNA breaks at predefined-specific sites Full list of author information is available at the end of the article © The Author(s) 2022. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visithttp:// creat iveco mmons. org/ licen ses/ by/4. 0/. The Creative Commons Public Domain Dedication waiver (http:// creat iveco mmons. org/ publi cdoma in/ zero/1. 0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Bernas et al. BMC Biotechnology (2022) 22:14 Page 2 of 15 in the genome [1]. Intrinsic mammalian DNA repair This makes it less appealing to centralized core facilities mechanisms are then used to either ablate exons or since these constructs are generally provided by com- insert random mutations such as insertions and deletions mercial vendors, are expensive, and in limited supply. (indels), via the non-homologous end joining (NHEJ) As a transgenic core facility, we have successfully used pathway, or introduce specific DNA repair templates, the Easi-CRISPR method. However, we have also expe- harboring point mutations, targeted reporters or condi- rienced limitations with this approach. For example, syn- tional alleles via the homology dependent repair (HDR) thesis of the required lssDNA construct by commercial pathway [2]. In rodent production, the delivery process vendors is usually restricted to less than 2 kb, rendering relies on two main approaches, either by microinjection this approach unsuitable for projects targeting multiple (into the pronucleus or nucleus) or by electroporation. or large exons. In addition, in some instances, sequence The microinjection procedure consists of microinjecting complexity hinders lssDNA synthesis, further restricting CRISPR-Cas9 components either into the cytoplasm or the flexibility of this approach. Finally, the high price of directly into one of the two pronuclei of 1-cell embryos or commercially-produced lssDNA constructs (provided in one or both nuclei of 2-cell embryos [3, 4]. This approach limited amount) makes this approach less appealing for has the advantage of being highly versatile as it can be projects where budget is a limiting factor. applied to generate any type of model. However, it relies An alternative method has been described where elec- on the use of expensive microscopy setups and highly troporation is used to incorporate the CRISPR-Cas9 trained personnel. For these reasons, microinjection is components and two short single strand oligonucleo- mainly used by centralized core facilities and is usually tides (ssODNs) into mouse zygotes in order to integrate offered as a service. On the other hand, electroporation the loxP sites at a specific locus. This is achieved by two consists of using an electrical current to open up pores in rounds of electroporation, one at the one cell stage (1-day embryo membranes to allow the entry of CRISPR-Cas9 fertilized embryo) and the second round performed 24 h components [5, 6]. This approach has the advantage of later, at the two cells stage. The electroporated embryos being less technically challenging and does not require are then implanted into pseudopregrant females and the expensive microscopy setups, making it more appealing resulting pups are characterized for proper incorporation to individual laboratories. The drawback of this approach of the two loxP sites [10]. is that its widespread applicability is restricted to classical In the current manuscript, we have adapted this knockout and point mutation alleles as the size of DNA method to both a consecutive sequential (strategy A) and constructs that can be incorporated through the opened non-consecutive sequential (strategy B) electroporation pore is limited. method to generate novel mouse models with conditional To date, models harbouring conditional alleles (i.e. two alleles. We demonstrate that the use of two ssODNs loxP sites flanking an exon or a critical DNA sequence in consecutive and non-consecutive sequential elec- of interest) are amongst the most widely requested pro- troporation to introduce loxP sites is a reliable and flex - ject that are challenging to generate as they require ible method that should be considered as an alternative the simultaneous cleavage of two guides in order to approach to other methods currently used. Moreover, we properly integrate the repair template. One published have successfully applied this modified approach to the approach to generate these types of alleles is the Easi- generation of animal models with loxP sites several kbs CRISPR method, which employs a long single stranded apart or with sequences that were too complex for com- DNA (lssDNA) repair template that is injected concur- mercial synthesis; two limitations that would have oth- rently with the CRISPR-Cas9 components in mouse erwise made these projects impossible using a lssDNA pronucleus zygotes [7, 8]. This allows the incorporation as a repair template. Moreover, this method provides of two loxP sites surrounding the desired sequence, at budgetary flexibility when considering the guide and a specific locus in the genome. The microinjection pro - repair template choices as well as highlights two different cedure is performed on 1-day fertilized embryos that path (strategy A and strategy B) leading to the success- are then implanted in pseudopregnant females, and the ful generation of the desired conditional knockout mouse resulting pups are characterized for proper loxP sites model. integration. A similar approach, named CRISPR with lssDNA inducing conditional knockout allele (CLICK), Results has been reported and uses lssDNA repair templates Applying consecutive or non‑consecutive sequential to generate conditional allele by electroporation [9]. electroporations to generate novel conditional alleles: This method, although successful in generating condi - a roadmap tional alleles with repair templates of up to 1.4 kb, has To date, the Easi-CRISPR method, employing a com- the drawback of requiring a large amount of lssDNA. bination of two guide RNAs complexed with the Cas9 B ernas et al. BMC Biotechnology (2022) 22:14 Page 3 of 15 protein along with a lssDNA repair template, seems to This modified procedure was extended to the four be the most widely adapted method for generating con- remaining projects highlighted in Table 1. These included ditional alleles. The method has been proven to be robust two projects where the Easi-CRISPR method failed to and reliable for generating conditional alleles for most produce animals containing the desired alleles (Sar1b genes and was successfully applied for two previously and Loxl1, Table 1 and Additional file 1). In this case, generated models in our laboratory (data not shown) three positive animals were obtained that contained par- [8]. However, during the course of our work, we real- tial construct integrations at the targeted site (one for ized some limitations of this approach that precluded its Sar1b and two for Loxl1, Additional file 1) and five ani - applicability to all loci (details see Table 1). Specifically, mals were obtained that contained random construct the Easi-CRISPR method was unusable for four out of integrations (three for Sar1b and two for Loxl1, Addi- eight projects (details see Table 1). The projects involv - tional file 1). Random and partial integration screening ing Icam1 and Clcf1 were incompatible with the Easi- strategies for Sar1b and Loxl1 are detailed in Additional CRISPR approach due to the distance between both loxP files 2 and 3. The Sar1b partially integrated construct sites, requiring a targeting construct greater than 2 kb. contained a properly targeted loxP site on one side of the Moreover, Easi-CRISPR could not be successfully applied desired exon and a 14 base pairs deletion on the oppo- to the projects involving Lox and Pard6g due to the high site side. The Loxl1 partial integration consisted of a sequence complexity surrounding the targeting region. sequence inversion in the 3′homology arm of the repair To circumvent these limitations, we used a modified ver - template along with a 40 base pairs deletion for one ani- sion of the electroporation conditions reported by Troder mal and a properly targeted loxP site on one side of the et al. along with the sequential electroporation method desired exon with no indels on the opposite side. This lat - reported by Horii et al. (details see “Methods” section) ter observation suggested a difference in guide cleaving [10, 11]. The rationale that we have used for each project efficiency for this project. Interestingly, these two phe - is summarized in Fig. 1. In short, we employed a strategy nomena of random and partial integrations have been to generate conditional alleles according to two possi- previously reported in the literature for projects using ble scenarios; (1) by consecutive sequential electropora- lssDNA [7, 12]. We extended our consecutive and non- tion (strategy A); or (2) by non-consecutive sequential consecutive electroporation strategies to the two remain- electroporation (strategy B). The first attempt for each ing projects that had no limitation for using lssDNA as project was via consecutive sequential electroporation a repair template (Pard6a and Mapkapk5, Table 1). For (Strategy A, blue rectangle Box, Fig. 1). We rationalized these two projects, the consideration of cost and syn- that this approach was the shortest path to success if it thesis turnover time for the generation of a lssDNA worked. If it failed, we investigated whether or not any construct weighed against the possibility of obtaining a pups resulting from the initial consecutive sequential partial integration model, prompted us to instead invest electroporation session could be usable for the non-con- in short ssODNs. Our rationale also took into considera- secutive sequential electroporation approach (Strategy B, tion the fact that in most cases, a single properly targeted grey rectangle Box, Fig. 1). loxP site animal with wild-type sequence on the opposite Table 1 Details of the conditional allele targeting projects Gene name Strain Targeted exons Distance between both loxP Limitations Plan used sites (in base pairs) for project completion Icam1 C57BL/6J 4 to 7 2926 Distance between both loxP sites** Strategy A Lox C57BL/6J 2 522 Sequence complexity*** Strategy A Sar1b C57BL/6N 2 608 None Strategy A Loxl1 C57BL/6J 2 617 None Strategy B Pard6a C57BL/6J 2 543 None Strategy B Pard6g* C57BL/6J 1 1463–1492 Sequence complexity*** Strategy B Clcf1 C57BL/6N 3 2509 Distance between both loxP sites** Strategy B Mapkapk5 C57BL/6J 6 1000 None Strategy B *Pups properly targeted with loxP sites in the up position from two different guides **Megamer, IDT ***Megamer could not be synthesized Bernas et al. BMC Biotechnology (2022) 22:14 Page 4 of 15 Project design Successful germline transmission, breedto N2 Strategy A 24 hrs Strategy B N2 X N2 ♀ ♂ Non-consecuve Sequenal electroporaon ConsecuveSequenal electroporaon loxP sites integraoncharacterizaon loxP sites integraon characterizaon In trans, confirm that In cis, proceedto N1 In trans, start In cis, proceedto N1 the other targengsite breeding over again breeding is wild-type No, start over No germline Yes, proceed to No germline Successful Successful again N1 breeding germline transmission, germline transmission, transmission, start over transmission, start over projectcompleted again again projectcompleted No germline transmission, start over again Fig. 1 Decision tree highlighting the different options leading to successful conditional allele generation. A decision tree representing the different options leading to successful conditional allele generation is represented. The project success is based on two different scenarios depending on the initial electroporation outcomes, either by consecutive sequential electroporation (Strategy A) or non‑ consecutive sequential electroporation (Strategy B) site could be obtained leading us to a strategy B alterna- on each day). The embryo survival rate using these condi - tive (non-consecutive sequential electroporation). Essen- tions was 86%, where 86 2-cells stage embryos out of 100 tially, in this case, we reasoned that one properly targeted were implanted in four pseudopregnant females. How- loxP site was better than none. ever, the percentage of live born animals using this pro- These limitations and challenges prompted us to try cedure was low, with only three pups born out of three the sequential electroporation approach reported by gestations and none of them surviving past the first week Horii et al. [10]. We initially applied this strategy using of birth (details see Table 2). These results prompted us the electroporation conditions described by Troder et al., to consider modifying the reagent concentrations used in which used 4 μM Cas9: 4 μM Guide: 10 μM DNA repair our electroporation procedure. Considering that the Cas9 template concentration [11]. This method was used for protein remains active for more than 24 h after electropo- the Icam1 project with a resulting final concentration of ration in embryos, and the fact that 2-cells stage embryos 8 μM Cas9: 8 μM Guide: 20 μM DNA repair template have a similar volume as 1-cell stage embryos, we ration- over two electroporation sessions (4 μM: 4 μM: 10 μM alized that keeping a final concentration at 4 μM Cas9: Table 2 Details of the results obtained for the Icam1 project using two different reagent concentrations Gene name Procedure Reagent Number of Number of Number Number of Number of Percentage of live concentration embryos embryos of gestations pups born born animals (%)* (per session, μM) electroporated implanted surgeries Icam1 Consecutive 4:4:10 100 86 4 3 3 3 sequential electropora‑ tion Icam1 Consecutive 2:2:5 100 81 4 4 18 22 sequential electropora‑ tion *Calculated by dividing the number of pups born by the number of implanted embryos B ernas et al. BMC Biotechnology (2022) 22:14 Page 5 of 15 4 μM Guide: 10 μM DNA repair template would be opti- sequential electroporation sessions were performed for mal for cleavage efficiency and pups viability (i.e. 2 μM: each selected guide pairs as described in the methods 2 μM; 5 μM on each day). We performed a second round section. Briefly, RNP complexes formed by the associa - of electroporation for the Icam1 project, with the rea- tion of one of the two selected pgRNA with the purified gent concentrations mentioned above. This resulted in an Cas9 protein were electroporated in 1-cell stage embryos embryo survival rate similar to the one obtained with the along with the corresponding repair template (Strategy A, initial concentration previously used (81 2-cells embryos Fig. 1). Electroporated embryos were recovered and left out of 100 electroporated). However, in this case, the to develop to the 2-cells stage overnight at 37 °C under percentage of live born animals was higher, with 18 pups 5% CO . 2-cells stage embryos were electroporated with born out of four gestations (Table 2). Hence, these results the second RNP complex along with the corresponding prompted us to apply the same reagent concentrations repair template before being implanted in pseudopreg- for each of our projects going forward. nant females (0.5 dpc) (Strategy A, Fig. 1). Applying consecutive or non‑consecutive sequential electroporation strategies to generate novel conditional Applying consecutive or non‑consecutive sequential allele: project design electroporations to generate novel conditional allele: For each project, the design relied on the selection and properly targeted pups characterization use of two annealed RNA guides, referred here as pgRNA The resulting pups were characterized using a genotyp - (crRNA-tracrRNA formulation) and symmetric short ing approach previously described in the literature with single strand oligonucleotides (ssODNs) as repair tem- primer series exemplified in Fig. 2 [8]. Briefly, six prim - plates that contained 60 base pairs homology arms on ers were routinely designed for each project. These com - each side, and a loxP sequence in between (repair tem- prised two pairs, mapping outside the ssODN homology plate details, see Additional file 5). Sequence length arms used to insert the loxP site either in the Up (5′ of between both homology arms varied depending on the targeted exon(s)) or Dn (3′ of the targeted exon(s)) whether a single loxP site (34 base pairs) or an associated positions (Fig. 2, primers 1–3, Up; primers 4–6, Dn). Two adjacent EcoRI or NheI restriction sites (40 base pairs) additional primers were designed with overlaps between was incorporated along the loxP sequence. The repair the genomic DNA sequence adjacent to the loxP inser- templates were designed to correspond to the targeting tion site (20 base pairs) and a portion (15 base pairs) of strand, complementary to the Cas9 selected guide and the loxP site itself (Fig. 2, primers 2 and 5). These last its associated PAM site sequence, with an exception for primers were designed to be used as a pair with one the Loxl1 project, where repair templates of both orien- primer pointing in the forward and the other in the tations in the Dn position (3′ of the targeted exon) were reverse orientation. A complete primer list for each pro- used to complete the project (Additional file 5). ject is found in Additional file 7. Literature review and gene structure analyses were per- Our standard genotyping strategy consisted of using formed for each individual project to select exons that the long loxP site overlapping primers 2 and 5 (Fig. 2, were predicted to have the most detrimental effect on upper panel) as an initial screening step to identify any the protein product when deleted. In silico guide cutting positive animals containing both loxP sites in cis (on the surveys were performed for each candidate exon using same allele). Animals were also investigated by using three different softwares (CRISPOR (http:// crisp or. tefor. primers 2–6 and 1–5 combinations in separate PCR reac- net/ crisp or. py), CHOPCHOP (https:// chopc hop. cbu. uib. tions (Fig. 2, lower panels). Positive PCR products from no/) and Breaking-Cas (https:// bioin fogp. cnb. csic. es/ these last reactions were then send for sequencing using tools/ break ingcas/)) on selected genomic DNA regions either primer 1 or 6 depending on the initial primer pairs as described in the methods section [13–15]. A total of used (red primers Fig. 2, lower panels). In some instance, three guide cutting pairs were selected for each indi- primers 3 and 4 were used for further validation. This lat - vidual project. crRNAs corresponding to the top-rank- est screening strategy was applied to all of the described ing guide pair, cutting on each side of the candidate(s) projects except for the one involving Pard6g that required exon(s), were ordered from IDT along with the two cor- a different approach since it was impossible to obtain a responding ssODN repair templates. The remaining two full-length PCR product between the targeted exon due pairs for each projects were kept in proviso. Complete to high sequence complexity (genotyping strategy, see lists of the different crRNA and corresponding repair Additional file 4). Using this screening method, we were templates are highlighted in Additional files 5 and 6. In able to recover pups with both loxP sites in cis for a total some instances, an additional crRNA pair was ordered of three projects (details see Table 3) with an average and used in the initial sequential electroporation proce- integration rate of 8% (range from 5 to 13%). Germline dure (Pard6a and Pard6g, Additional file 6). Consecutive Bernas et al. BMC Biotechnology (2022) 22:14 Page 6 of 15 Primers: 2-5 Icam1 Lox Sar1b 4,000 bps - 3,000 bps - Flox in cis= 3,039 bps WT or in trans = none 2,000 bps - 1 23 45 6 EcoRI NheI Icam1 Exon4 Exon 3’UTR Chr9 LoxP up LoxP dn 25 3,039 bps 1 3,304 bps 5 2 3,210 bps 6 Primers: 2-6 Primers: 1-5 4,000 bps - 4,000 bps - Flox= 3,210 bps (onlyloxP5’ Flox= 3,304 bps (onlyloxP3’ 3,000 bps - 3,000 bps - integrated=3,264 bps) integrated=3,170 bps) 2,000 bps - 2,000 bps - WT=none WT=none PAM Protospacer PAM Protospacer …TCCAACTCATACTGAGTGGCAGCCT… …GCCATGTCTAGTAAAATCTACGTTA … …AGGTTGAGTATGACTCACCGTCGGA… …CGGTACAGATCATTTTAGATGCAAT … 1 6 Fig. 2 Consecutive sequential electroporation was successfully applied to generate Icam1 floxed animals. Schematic representation highlighting the primer positions and genotyping strategy used for characterization of Icam1 floxed F0 animals. PCR results from primers 2–5 combination are depicted in the upper middle panel. PCR results and sequencing alignment from primers 1–5 combination are depicted in the lower left panel. PCR results and sequencing alignment from primers 2–6 combination are depicted in the lower right panel. Primers used for sequencing are highlighted in red. The same strategy was applied to complete a total of three different projects (Icam1, Lox , Sar1b) Table 3 Details of the projects successfully completed using the consecutive sequential electroporation procedure Gene name Procedure Number of Number of Number Number of Number of Percentage Number Targeting embryos embryos of gestations pups born of live born of pups efficiency electroporated implanted surgeries animals (%)* properly (%)** targeted Icam1 Consecutive 309 252 10 7 24 10 2 8 sequential electropora‑ tion Lox Consecutive 159 140 5 4 22 16 1 5 sequential electropora‑ tion Sar1b Consecutive 196 128 5 2 8 6 1 13 sequential electropora‑ tion *Calculated by dividing the number of pups born by the number of implanted embryos **Calculated by dividing the number of properly targeted pups by the total number of pups born C57bl6 H2O C57bl6 H2O C57bl6 H2O B ernas et al. BMC Biotechnology (2022) 22:14 Page 7 of 15 transmission was confirmed for two of these projects 3 to 25%). Data from the Loxl1 project were used to using the same genotyping strategy. compare the targeting efficiency when using ssODNs The remaining five projects were completed using the corresponding to the targeting versus non-targeting non-consecutive sequential electroporation strategy. In strand for insertion of the second loxP site (details see this case, we focused our investigation on finding posi - Table 4). Interestingly, in this case, the ssODN corre- tive pups with a single loxP site integration on one side sponding to the non-targeting strand gave us a greater and wild-type sequence on the other side (Fig. 3A). This efficiency, with a value of 6%, when compared to the was achieved by using positive PCR products from the ssODN corresponding to the targeting strand that only same 2–6 or 1–5 primer pairs described previously and resulted in 3% efficiency. Hence, these results suggest sequencing these PCR products with either primer 1 or that, for conditional allele model generation using two 6 depending on the initial primer pairs used (Fig. 3A). ssODNs, the choice between using the targeting ver- In this case, the sequencing results informed us as to sus non-targeting strand as a repair template should be whether or not the insertion site that failed to incorpo- determined empirically as repair efficiency using either rate the loxP site was exempt of indels. If this was the one of these strands appear to be context dependent. case, an additional primer, overlapping the genomic Germline transmission was confirmed in all five pro - DNA sequence adjacent to the loxP insertion site and a jects using the same genotyping strategy as the one portion of the loxP site itself in opposite direction to the described in Fig. 3B. one initially designed was used to confirm the integrity The PCR products from primer pairs 2–6 and 1–5 were of the inserted loxP site (primer 7, Fig. 3A). In this case, also used to assess independent loxP site targeting effi - PCR products from primers pairs 1–7 and 2–3 were ciency between the electroporations performed at either sent for sequencing using primers 1 and 3 respectively. the 1-cell or 2-cells stage in the resulting pups from the Pups that were exempt of indels in the site that failed initial consecutive sequential electroporation procedure to incorporate a loxP site on one side and had proper for each project (Table 5). Interestingly, the loxP targeting integration of the loxP site on the other side were bred efficiency in pups for the projects completed using Strat - for germline transmission. The resulting N1 animals egy A showed no statistical differences, with an average were sequence verified as described above and bred to of 27 ± 7% at the 1-cell stage and 32 ± 7% at the 2-cells N2 before being intercrossed to produce embryos that stage (T-Test, P = 0.42). Whereas, the loxP targeting effi - were used to incorporate the missing loxP site (Strategy ciency in pups for the projects completed using Strategy B, Fig. 1). We reasoned that using this strategy would B showed significant statistical differences, with an aver - increase the likelihood to obtain the properly targeted age of 24 ± 7% at the 1-cell stage and 7 ± 4% at the 2-cells allele as 25% of the embryos would be homozygotes stage (T-Test, P < 0.05). These results raise the possibil - with a single loxP site on both allele, 50% would be ity that for all the projects completed using Strategy B, heterozygotes with a single loxP site on one out of two improving the targeting efficiency at the 2-cells stage may alleles, and 25% would be wild-type. For each project, have increased the likelihood of completing these pro- electroporation on 1-cell stage embryos was performed jects using consecutive sequential electroporation. using the material to incorporate the missing loxP site Furthermore, chromosomal deletions that are caused as described above before being implanted in pseudo- by simultaneous guide cleavage activity inducing double pregnant females (0.5 dpc). The resulting pups were strand DNA breaks at two different positions on a chro - investigated for proper loxP targeting as described pre- mosome have been reported using sequential electropo- viously, with priority given to pups showing positive ration, with an incidence varying between 9 and 38% bands using the 2–5 primer pairs (Fig. 3B). Using this [10]. We did not systematically investigate this incidence strategy, we were able to obtain properly targeted pups during the course of our work as we mainly focused on for the remaining five projects (details see Table 4), identifying cis targeted animals. However, we were able with a targeting efficiency averaging 11% (ranging from to observe this phenomenon in some instances at a rate (See figure on next page.) Fig. 3 Non‑ consecutive sequential electroporation was successfully applied to generate Clcf1 floxed animals. A Schematic representation highlighting the primer positions and genotyping strategy used for characterization of Clcf1 F0 animals. PCR results from primers 2–6 combination are depicted in the upper‑right panel. The sequencing results using primers 3 and 6 are highlighted below. PCR results from primers 1–7 combination are depicted in the lower panel. The sequencing results using primer 1 are highlighted below. B Schematic representation highlighting the primer positions and genotyping strategy used for characterization of Clcf1 floxed F0 animals. PCR results from primers 2–5 combination are depicted in the upper middle panel. PCR results and sequencing alignment from primers 1–5 combination are depicted in the lower left panel. PCR results and sequencing alignment from primers 2–6 combination are depicted in the lower right panel. Primers used for sequencing are highlighted in red. The same strategy was applied to complete a total of four different projects (Loxl1, Pard6a, Clcf1, Mapkap5) Bernas et al. BMC Biotechnology (2022) 22:14 Page 8 of 15 A. Primers: 2-6 Protospacer PAM …TGTCCCTTTGGCCTGTTGAGGAGGA… Size: Flox= 2,753 bps (onlyloxP5’ 3,000 bps- …ACAGGGAAACCGGACAACTCCTCCT… integrated=2,719 bps) 2,000 bps- WT=none 13 26 7 Clcf1 Exon23 Exon3 ’UTR Chr19 LoxP up Primers: 1-7 Size: 500bp - 400bp- LoxP5’= 365 bps 300bp- WT=none 200bp- Protospacer PAM …TGTCCCTTTGGCCTGTTGAGGAGGA… …ACAGGGAAACCGGACAACTCCTCCT… Primers: 2-5 Loxl1 B. Pard6a Clcf1 Mapkap5 3,000 bps - Flox in cis= 2,615 bps 2,000 bps - 1,500 bps - WT or in trans=none 1,000 bps - 1 2 3 4 56 Clcf1 Exon23 Exon3 ’UTR Chr19 LoxP up LoxP dn 997 bps 3 531 bps 1 4 6 15 2,906 bps 25 2,615 bps 2 2,753 bps 6 3,044 bps Primers: 1-5 (seq 3) Primers: 2-6 (seq 4) Flox= 2,906 bps (onlyloxP3’ 3,000 bps - 3,000 bps - Flox= 2,753 bps (onlyloxP5’ 2,000 bps - 2,000 bps - integrated=2,872 bps) 1,500 bps - integrated=2,719 bps) 1,500 bps - 1,000 bps - WT=none 1,000 bps - WT=none Protospacer PAM PAM Protospacer …TGTCCCTTTGGCCTGTTGAGGAGGA… …TCCATTAGTCCCATCAGGGGCCCTCACC… …ACAGGGAAACCGGACAACTCCTCCT… …AGGTAATCAGGGTAGTCCCCGGGAGTGG… Fig. 3 (See legend on previous page.) C57bl6 H2O C57bl6 H2O C57bl6 H2O C57bl6 H2O C57bl6 H2O B ernas et al. BMC Biotechnology (2022) 22:14 Page 9 of 15 ‑ ‑ ‑ ‑ ‑ ‑ ‑ ‑ ‑ ‑ Table 4 Details of the projects successfully completed using the non consecutive sequential electroporation procedure Gene name Procedure loxP site inserted Number of Number of Number Number of Number of Percentage of Number of Targeting embryos embryos of gestations pups born live born animal pups properly efficiency electroporated implanted surgeries (%)* targeted (%)** Loxl1 Non consecutive 1st loxP site 393 305 13 10 26 9 2 8 sequential electropo ration 2nd loxP site (target 264 227 9 6 34 15 1 3 ing strand) 2nd loxP site (non 136 132 6 3 17 13 1 6 targeting strand) Pard6a Non consecutive 1st loxP site 210 107 4 4 9 8 1 11 sequential electropo ration 2nd loxP site 147 114 5 5 30 26 4 13 Pard6g Non consecutive 1st loxP site 212 173 7 7 26 15 2 8 sequential electropo ration 2nd loxP site 180 146 6 4 21 14 5 24 Clcf1 Non consecutive 1st loxP site 102 80 3 2 8 10 2 25 sequential electropo ration 2nd loxP site 243 196 7 3 24 12 3 13 Mapkapk5 Non consecutive 1st loxP site 165 138 6 5 17 12 1 6 sequential electropo ration 2nd loxP site 159 145 7 6 36 25 3 8 *Calculated by dividing the number of pups born by the number of implanted embryos **Calculated by dividing the number of properly targeted pups by the total number of pups born Bernas et al. BMC Biotechnology (2022) 22:14 Page 10 of 15 Table 5 Details of the 1‑ cell or 2‑ cells targeting rate for each individual project Gene name Procedure Number of Number of pups Targeting Number of pups Targeting Deletion pups born with a loxP site frequency at the with a loxP sites frequency at the between targeted at the 1‑ cell stage (%)* targeted at the 2‑ cells stage (%)* exon(s)** 1‑ cell stage 2‑ cells stage Icam1 Consecutive 24 7 29 6 25 NA sequential elec‑ troporation Lox Consecutive 22 3 14 10 45 NA sequential elec‑ troporation Sar1b Consecutive 8 3 38 2 25 NA sequential elec‑ troporation Loxl1 Non‑ consecutive 26 1 4 5 19 3 sequential elec‑ troporation Pard6a Non‑ consecutive 9 3 33 0 0 1 sequential elec‑ troporation Pard6g Non‑ consecutive 26 9 35 1 4 NA sequential elec‑ troporation Clcf1 Non‑ consecutive 8 3 38 0 0 NA sequential elec‑ troporation Mapkapk5 Non‑ consecutive 17 2 12 2 12 4 sequential elec‑ troporation *Calculated by dividing the number of properly targeted pups by the total number of pups born **Estimate only, based on various PCR combinations varying between 11 and 24%, which is similar to what has repair templates tend to be too long and too complex for been reported previously (Table 5). simple synthesis, making them less appealing to small platform facilities. The Easi- CRISPR method, with its Discussion reported efficient targeting (varying between 8.5 and The development of novel CRISPR-Cas9 methodolo - 100%) and ease of design, was our first method of choice gies has improved the efficiency of generating rodent when a large number of conditional allele projects were models. Small insertion and exon deletion models are requested at our facility [7, 8]. However, it became evi- easily generated, however, generating conditional allele dent that this method could not be applied to all of our models remains a daunting endeavor. Every transgenic projects. Indeed, two of them required targeting con- core facility functions differently and adapts their meth - structs outside the 2 kb lssDNA range (Megamer, IDT) ods according to their resources at hand. In our case, all and two others targeted regions that were too complex to of our services are based on a custom turnkey format; be synthesized as a lssDNA construct (Megamer, IDT). where a researcher come to us with their favorite gene to Furthermore, we faced challenges for two of our ongoing be targeted and we use our expertise to design the pro- projects with the Easi-CRISPR method that resulted in ject. We provide the reagents, produce as well as charac- five instances of random construct integration and three terize the animal model up to the N1 stage. Hence, to be other instances of partial construct integration. usable, a method must be flexible, efficient, robust and It is noteworthy that Horii et al. reported a 20% tetra- economical. ploidization phenomenon by electrofusion during the Several methods have been described in the literature second round of electroporation [10], a phenomenon that 2+ to generate novel conditional allele models with varying was recently shown to be inhibited either by Ca -free or efficiencies. Well established methodologies have relied Cytochalasin B treatments [22]. We did not observe this on double stranded DNA as donor templates requir- phenomenon using our electroporation conditions and ing extensive homology arms with a targeting efficiency we hypothesize that this phenomenon is linked to the generally reported between 1 and 10% [2, 16–21]. These electroporator used and differences in electroporation B ernas et al. BMC Biotechnology (2022) 22:14 Page 11 of 15 conditions. Hence, it is important to keep in mind that an alternative to other already established methods. the success of the targeting procedure described in our We also believe that this approach will be of interest to study is highly dependent on the fine tuning of electropo - smaller platforms with limited resources for produc- ration conditions. ing large DNA constructs or provide an opportunity to The use of two ssODNs to generate conditional re-visit projects that were not completed using other alleles has been the subject of controversy in the trans- approaches. One of the main advantages of our method genic community which is partly due to the difficulties is the relatively inexpensive cost and synthesis turnover for other groups to reproduce the targeting efficiency time of ssODNs in comparison to lssDNA templates. obtained in the original publication [23, 24]. This appears This provides greater flexibility as more than one guides- to be true when using simultaneous injection of all the repair template combination can be ordered and tested different components as exemplified by the results from for proper targeting in live animals. This is generally not a consortium of 20 transgenic facilities (including ours) the case when using a lssDNA template as guide cleavage reporting a targeting efficiency of less than 1% regard - efficiencies are generally determined in pre-implantation less of the formulation used or delivery method [25]. It embryos and the repair template is designed based on is noteworthy that the material used for the Icam1 pro- the two most efficient guides (one in Up and one in Dn ject highlighted in this manuscript was also used by our position). This approach is based on the assumption that group in the study reported by Gurumurthy et al. [25]. guide cutting efficiency alone dictates the targeting out - Gurumurthy et al. also compared the simultaneous injec- come with limited flexibility on the repair template orien - tion of two ssODNs to other approaches such as the Easi- tation. However, our results suggest that at least for one CRISPR method that was used to complete four different of our projects, the repair template orientation appears to projects, with an average targeting efficiency of ~ 13% be critical for targeting efficiency. (ranging from 8 to 18%). These results are comparable to New methodologies using the CRISPR-Cas9 tool are the targeting rate of the consecutive sequential electropo- being published constantly. These new methodologies ration approach reported in the current manuscript (8%, allow us to circumvent some of the limitations initially with a range from 5 to 13%) [25]. Furthermore, the same observed for some of the projects highlighted in this article reported a method similar to our non-consecutive study. One of these limitations is the size limit for syn- sequential electroporation procedure; where a first loxP thesis of commercially available lssDNA that was limited site is introduced in embryos by microinjection, and the to 2 kb (Megamer, IDT). It has been recently reported second loxP site is introduced via a second microinjec- that lssDNA up to 3.5 kb spanning repetitive sequences tion session with embryos derived from the mouse strain have been developed using the CRISPR-Clipped Long containing the first loxP site (referred as second loxP site ssDNA via Incising Plasmid (CRISPR-CLIP) approach in the next generation) [25, 26]. This method was applied [27]. Although interesting, this method still depends on to seven loci that were all successfully flanked with loxP the establishment of the CRISPR-CLIP approach in an sites with a targeting efficiency of 14 ± 6% for the first individual laboratory which represents as substantial loxP site insertion and 27 ± 32% for the second loxP site investment in comparison to the ease and flexibility of insertion [25]. Again, these numbers are comparable to ordering short ssODN from commercially available ven- our non-consecutive sequential electroporation target- dors. Of note, two commercial vendors (Genscript and ing rate with an average of 11 ± 8% for the first loxP site Genwiz) now offer lssDNA constructs of up to 4 and insertion and an average of 11 ± 7% for the second loxP 10 kb, respectively. These new possibilities provide a new site insertion. avenue to overcome the previously mentioned size limit, In summary, the current study highlights an approach but also represents a substantial monetary investment that allows the generation of novel conditional allele in comparison to the cost of short ssODN. Embryo elec- models according to two independent possible paths, troporation is becoming routinely used in transgenic core either via the consecutive or non-consecutive sequential facilities as it allows for the manipulation of large num- electroporation procedure, with an estimated turnover bers of embryos with relatively high editing efficiency. It time varying between 4 and 10 months depending on was recently demonstrated that combining electropora- the outcome of the initial consecutive sequential elec- tion with an in vitro fertilization (IVF) procedure allowed troporation attempt. This method was applied to eight the generation of a Camk1 conditional allele mouse different projects, proving its reliability and flexibility. model within two consecutive generations [28]. This Furthermore, the fact that this method relies on elec- approach, when used in our non-consecutive electropo- troporation rather than microinjection, will certainly ration procedure, would reduce production time from be of interest to individual laboratories that do not have 10 months to approximately 125 days. However, produc- access to microinjection set-ups. It is meant to represent ing embryos through an IVF procedure implies that the Bernas et al. BMC Biotechnology (2022) 22:14 Page 12 of 15 founder animal obtained is a male, which limits the sys- exons and exons inducing frameshifts were preferentially tematic applicability of this approach to all future projects selected. When possible, exons including 5′ and 3′ regu- completed using non-consecutive sequential electropo- latory regions were avoided. Once the selection process ration. Another study has shown recently that gener- was completed, in silico guide cutting surveys were con- ating conditional allele models by electroporating two ducted on genomic DNA located at least 100 base pairs ssODNs in utero was possible. This method, streamlines away from the selected exons. Surveys were conducted the current procedure by bypassing the ex vivo embryo with the three-following software: CRISPOR (http:// crisp handling steps [29]. This report, although exciting, has or. tefor. net/ crisp or. py), CHOPCHOP (https:// chopc hop. reported the generation of properly targeted animals in cbu. uib. no/) and Breaking-Cas (https:// bioin fogp. cnb. hybrid mouse strains only, which could be considered a csic. es/ tools/ break ingcas/) [13–15]. Guide with good limitation when taking into consideration the number of predicted cleavage activity in all three software and fall- backcrosses that would be required to bring these tar- ing within regions containing low sequence complexity geted alleles onto a pure background. Embryos of inbred were retained for the procedure. strains were demonstrated to be properly targeted using this approach, however, it remains to be proven that CRISPR‑Cas9 reagents this method could results in properly targeted live ani- The Cas9 protein (Integrated DNA technologies (IDT, mals before considering its usage in transgenic facilities. catalog number 1081058), custom crRNA (IDT, Alt- TM Finally, we note the addition of RAD51 purified protein R crRNA) and generic tracrRNA (IDT, catalog num- along with the CRISPR-Cas9 reagents has recently been ber 1072533) were prepared as previously described [11, shown to significantly increase homozygous knockin 31]. Briefly, 50 uM crRNA-tracrRNA annealed complex in mouse embryos [30]. Hence, it would be interesting (pgRNA) were formed by mixing an equimolar ratio of to investigate whether or not this homozygous knockin each component that were incubated 5 min at 95 °C and improvement has any influence on cis loxP targeting rate allowed to cool down to room temperature for 10 min. A in our consecutive sequential electroporation procedure. complete list of guides used for each project is detailed in Additional file 6. Conclusions In this work, we have refined the sequential electropora - Preparation of CRISPR‑Cas9 electroporation mixes tion procedure described by Horii et al. resulting in the The Cas9 RNP complex was assembled as previously production of conditional allele models for eight differ - described [11, 31]. Briefly, 40 μmoles of Cas9 pro - ent genes via two different possible paths. We believe that tein (IDT, 1081058) was incubated with 40 μmoles of our strategies, demonstrated to be reproducible for eight assembled pgRNA and incubated for 10 min at room different loci, should be considered as an alternative to temperature. The RNP complex was combined in 20 μl other well-established methodologies in the literature for Opti-MEM at a final concentration of 2 μM (Ther - conditional allele mouse model generation. moFisher Scientific catalog number 31985070) along with 5 μM of repair template (custom Ultramer ssDNA, Methods IDT). Repair template details are highlighted in Addi- Animals tional file 5. C57BL/6N embryos were produced from males and females purchased from Charles River laborato- ries, whereas C57BL/6J embryos were produced from Zygote preparation males and females purchased from Jackson Laboratory. Prepubescent 3 weeks old C57BL/6N or C57BL/6J Hsd:ICR (CD-1) female mice from Envigo + were used females were superovulated 67 h prior zygote collection for embryo transfers. All mice were maintained in the by 5 IU intraperitoneal injection of pregnant mare serum pathogen-free Centre de Recherche du Centre Hospi- gonadotrophin (Genway Biotech Inc, GWB-2AE30A) fol- talier de l’Université de Montréal (CRCHUM) animal lowed 47–48 h later with 5 IU of human chorionic gon- facility on a 6:30 AM to 6:30 PM light cycle, 21–26 °C adotrophin (Sigma-Aldrich, CG10-1VL) before being with 40–60% relative humidity, and had food and water mated. Fertilized 1-cell stage embryos were collected and ad libitum. kept in embryomax KSOM advance media (Millipore Guide selection process Sigma cat number MR-101-D) at 37 °C under 5% C O Literature reviews and gene structure analyses were per- until electroporation (performed between 70 and 73 h formed for each project. When appropriate, the same after injection of pregnant mare serum gonadotrophin). exons used in previously published classical models were selected for loxP sites integration. The ATG containing B ernas et al. BMC Biotechnology (2022) 22:14 Page 13 of 15 Consecutive sequential electroporation procedure In vitro Cre recombination assay The consecutive sequential electroporations were per - Ear biopsies from 21 days old mice of the appropriate formed as previously described [11]. Briefly, 1-cell genotype were digested using the DNeasy Blood and embryos were washed in batch of 50 through 5 drops of Tissue Kits from Qiagen (Cat number 69504). The puri - M2 media before being washed in a single drop of Opti- fied DNA was quantified using a Nanodrop spectrom - MEM. The embryos were transferred to the 20 ul first eter and the DNA concentration for each sample was Cas9-RNP-ssODN mix. The solution was transferred adjusted to 35 ng/μl. A volume of 5 μl of genomic DNA to a pre-warmed 1 mm cuvette (BioRad). Electropora- (175 ng) in a total reaction volume of 25 μl, includ- tion was carried out using a Gene Pulser XCell elec- ing 1–2 units of NEB Cre recombinase (Cat number troporator with the following conditions: 30 V, 3 ms M0298S) and its supplied buffer was incubated over - pulse duration, 2 pulse 100 ms interval. Electroporated night at 37 °C. A volume of 3.5 μl of the Cre reaction embryos were flush recovered from the cuvette and was then used for PCR amplification using the high- washed in three drops of embryomax KSOM advance fidelity enzyme Q5 (NEB, M0530L) as described above. media before being incubated overnight at 37 °C under 5% CO . Embryos that developed to the 2-cell stage Abbreviations were subsequently electroporated approximately 21 h NHEJ: Non‑homologous end joining; HDR: Homology dependent repair; after the first electroporation with the second Cas9- Indels: Insertions and deletions; lssDNA: Long single stranded DNA; CLICK: CRISPR with lssDNA inducing conditional knockout allele; ssODN: Short single RNP-ssODN mix as described above. These 2-cell elec - strand oligonucleotide; CRISPR‑ CLIP: CRISPR‑ Clipped Long ssDNA via Incising troporated embryos were recovered and washed in Plasmid; CRCHUM: Centre de Recherche du Centre Hospitalier de l’Université embryomax KSOM advance media before being incu- de Montréal. bated at least 1 h at 37 °C under 5% CO prior implan- tation in pseudopregnant females (0.5 dpc). Supplementary Information The online version contains supplementary material available at https:// doi. org/ 10. 1186/ s12896‑ 022‑ 00744‑8. Non‑consecutive sequential electroporation procedure For non-consecutive sequential electroporation proce- Additional file 1. Details of the projects that were not completed using dure embryos were collected from intercross between the Easi‑ CRISPR procedure. Table highlighting the details of the projects N2 males and females with one properly targeted loxP that were not completed using the Easi‑ CRISPR procedure. site. 1-cell embryos collection and electroporation were Additional file 2. The Easi-CRISPR procedure resulted in random and partial Sar1b floxed construct integration. Figure highlighting the fact that performed as described in the consecutive sequential the Easi-CRISPR procedure resulted in random and partial Sar1b floxed electroporation section. RNP complexes and repair construct integration. template concentrations were adjusted to 4 μM and Additional file 3. The Easi-CRISPR procedure resulted in random and 10 μM respectively. 1-cell stage electroporated embryos partial Loxl1 floxed construct integration. Figure highlighting the fact that the Easi-CRISPR procedure resulted in random and partial Loxl1 floxed were incubated at least 1 h at 37 °C under 5% CO prior construct integration. implantation in pseudopregnant females (0.5 dpc). Additional file 4. Non‑ consecutive sequential electroporation was suc‑ cessfully applied to generate Pard6g floxed animals. Figure highlighting Genotyping the strategy used to confirm the generation of Pard6g floxed animals. Ear biopsies from 21 days old mice were digested in Additional file 5. Repair template details for all eight projects. Table highlighting the repair template details for all eight projects. MyTaq Extract PCR kit according to the manufacturer Additional file 6. Guide sequence details for all eight projects. Table (Bioline, Cat number BIO-21126). PCR amplification highlighting the guide sequence details for all eight projects. was performed using the high-fidelity enzyme Q5 from Additional file 7. PCR oligo details for all eight projects. Table highlight ‑ New England Biolab (NEB, Cat number M0530L) or the ing the PCR oligo details for all eight projects. Platinum SuperFi DNA polymerase from ThermoFisher Additional file 8. PCR condition details for all eight projects. Table high‑ (Cat number 123551010) for hard to amplify locus lighting the PCR condition details for all eight projects. (Lox). Amplification was performed with locus specific primers detailed in Additional file 4, 8 [8]. The PCR Acknowledgements products obtained were sent for sequencing at the Cen- We thank the principal investigators that agreed on sharing the data related to tre d’expertise et de service de génome Québec (CHU- their specific projects. We also thank Jon Neumann from UC Irvine for sharing the in vitro Cre recombination assay as well as Dr. Christine Vande Velde, and Ste-Justine, Montréal, Canada). Sequence alignments Dr. Greg Fitzharris for aid in manuscript preparation. were analyzed using the Snapgene software (https:// www. snapg ene. com/). Author contributions GB and JFS designed the projects. HJ, CL and EL contributed to reagents. GB, MO, AB, and JFS contributed to the electroporation sessions, mouse models generation and characterization process. GB contributed to the figures and Bernas et al. BMC Biotechnology (2022) 22:14 Page 14 of 15 data interpretations. JFS performed all data analyses and wrote the manu‑ 9. Miyasaka Y, Uno Y, Yoshimi K, Kunihiro Y, Yoshimura T, Tanaka T, Ishikubo script. All authors read and approved the final manuscript. H, Hiraoka Y, Takemoto N, Tanaka T, et al. CLICK: one‑step generation of conditional knockout mice. BMC Genomics. 2018;19:318. Funding 10. Horii T, Morita S, Kimura M, Terawaki N, Shibutani M, Hatada I. Efficient This work was funded by the Multiple Sclerosis Society of Canada (operating generation of conditional knockout mice via sequential introduction of grant EGID 3322 to CL). The funding body played no roles in the design of the lox sites. Sci Rep. 2017;7:7891. study, collection, analysis, and interpretation of data as well as in writing the 11. Troder SE, Ebert LK, Butt L, Assenmacher S, Schermer B, Zevnik B. An manuscript. optimized electroporation approach for efficient CRISPR/Cas9 genome editing in murine zygotes. PLoS ONE. 2018;13:e0196891. Availability of data and materials 12. Lanza DG, Gaspero A, Lorenzo I, Liao L, Zheng P, Wang Y, Deng Y, Cheng The datasets used and/or analysed during the current study are available from C, Zhang C, Seavitt JR, et al. Comparative analysis of single‑stranded DNA the corresponding author on reasonable request. donors to generate conditional null mouse alleles. BMC Biol. 2018;16:69. 13. Concordet JP, Haeussler M. CRISPOR: intuitive guide selection for CRISPR/ Cas9 genome editing experiments and screens. Nucleic Acids Res. Declarations 2018;46:W242–5. 14. Labun K, Montague TG, Krause M, Torres Cleuren YN, Tjeldnes H, Valen Ethics approval and consent to participate E. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome All animal care and procedures performed in this study were approved by editing. Nucleic Acids Res. 2019;47:W171–4. the CRCHUM animal care committee in accordance with the guidelines from 15. Oliveros JC, Franch M, Tabas‑Madrid D, San‑León D, Montoliu L, the Canadian Council on Animal Care in science (CCAC); protocol number Cubas P, Pazos F. Breaking‑ Cas‑interactive design of guide RNAs for N17026JFSrs. CRISPR‑ Cas experiments for ENSEMBL genomes. Nucleic Acids Res. 2016;44:W267‑271. Consent for publication 16. Aida T, Chiyo K, Usami T, Ishikubo H, Imahashi R, Wada Y, Tanaka KF, Not applicable. Sakuma T, Yamamoto T, Tanaka K. Cloning‑free CRISPR/Cas system facili‑ tates functional cassette knock‑in in mice. Genome Biol. 2015;16:87. Competing interests 17. Raveux A, Vandormael‑Pournin S, Cohen‑ Tannoudji M. Optimization of The authors declare that they have no competing interests. the production of knock‑in alleles by CRISPR/Cas9 microinjection into the mouse zygote. Sci Rep. 2017;7:42661. Author details 18. Chu VT, Weber T, Graf R, Sommermann T, Petsch K, Sack U, Volchkov P, Centre de recherche du CHUM, Université de Montréal, Montréal, Canada. Rajewsky K, Kühn R. Efficient generation of Rosa26 knock ‑in mice using Département de Neurosciences, Université de Montréal, Montréal, Canada. CRISPR/Cas9 in C57BL/6 zygotes. BMC Biotechnol. 2016;16:4. Centre de recherche du CHU Ste‑ Justine, Université de Montréal, Montréal, 19. Ménoret S, De Cian A, Tesson L, Remy S, Usal C, Boulé JB, Boix C, Canada. Département de Pharmacologie et physiologie, Université de Mon‑ Fontanière S, Crénéguy A, Nguyen TH, et al. Homology‑ directed repair tréal, Montréal, Canada. Département de Nutrition, Université de Montréal, in rodent zygotes using Cas9 and TALEN engineered proteins. Sci Rep. Montréal, Canada. 2015;5:14410. 20. Wang L, Shao Y, Guan Y, Li L, Wu L, Chen F, Liu M, Chen H, Ma Y, Ma X, et al. Received: 13 January 2022 Accepted: 5 April 2022 Large genomic fragment deletion and functional gene cassette knock‑in via Cas9 protein mediated genome editing in one‑ cell rodent embryos. Sci Rep. 2015;5:17517. 21. Zhang L, Jia R, Palange NJ, Satheka AC, Togo J, An Y, Humphrey M, Ban L, Ji Y, Jin H, et al. Large genomic fragment deletions and insertions in References mouse using CRISPR/Cas9. PLoS ONE. 2015;10:e0120396. 1. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church 22. Horii T, Kobayashi R, Kimura M, Morita S, Hatada I. Calcium‑free and GM. RNA‑ guided human genome engineering via Cas9. Science. cytochalasin B treatment inhibits blastomere fusion in 2‑ cell stage 2013;339:823–6. embryos for the generation of floxed mice via sequential electroporation. 2. Wang B, Li K, Wang A, Reiser M, Saunders T, Lockey RF, Wang JW. Highly Cells. 2020;9:1088. efficient CRISPR/HDR‑mediated knock ‑in for mouse embryonic stem 23. Yang H, Wang H, Shivalila CS, Cheng AW, Shi L, Jaenisch R. One‑step cells and zygotes. Biotechniques. 2015;59:201–2, 204, 206–8. generation of mice carrying reporter and conditional alleles by CRISPR/ 3. Mizuno S, Dinh T T, Kato K, Mizuno‑Iijima S, Tanimoto Y, Daitoku Y, Cas‑mediated genome engineering. Cell. 2013;154:1370–9. Hoshino Y, Ikawa M, Takahashi S, Sugiyama F, Yagami K. Simple genera‑ 24. Gurumurthy CB, O’Brien AR, Quadros RM, Adams J Jr, Alcaide P, Ayabe tion of albino C57BL/6J mice with G291T mutation in the tyrosinase S, Ballard J, Batra SK, Beauchamp MC, Becker KA, et al. Response to cor‑ gene by the CRISPR/Cas9 system. Mamm Genome Off J Int Mamm respondence on “Reproducibility of CRISPR‑ Cas9 methods for generation Genome Soc. 2014;25:327–34. of conditional mouse alleles: a multi‑ center evaluation.” Genome Biol. 4. Gu B, Posfai E, Rossant J. Efficient generation of targeted large inser ‑ 2021;22:99. tions by microinjection into two‑ cell‑stage mouse embryos. Nat 25. Gurumurthy CB, O’Brien AR, Quadros RM, Adams J Jr, Alcaide P, Ayabe Biotechnol. 2018;36:632–7. S, Ballard J, Batra SK, Beauchamp MC, Becker KA, et al. Reproducibility 5. Qin W, Dion SL, Kutny PM, Zhang Y, Cheng AW, Jillette NL, Malhotra A, of CRISPR‑ Cas9 methods for generation of conditional mouse alleles: a Geurts AM, Chen YG, Wang H. Efficient CRISPR/Cas9‑mediated genome multi‑ center evaluation. Genome Biol. 2019;20:171. editing in mice by zygote electroporation of nuclease. Genetics. 26. Liu Y, Du Y, Xie W, Zhang F, Forrest D, Liu C. Generation of conditional 2015;200:423–30. knockout mice by sequential insertion of two loxP sites In Cis using 6. Hashimoto M, Takemoto T. Electroporation enables the efficient mRNA CRISPR/Cas9 and single‑stranded DNA oligonucleotides. Methods Mol delivery into the mouse zygotes and facilitates CRISPR/Cas9‑based Biol (Clifton, NJ ). 2019;1874:191–210. genome editing. Sci Rep. 2015;5:11315. 27. Shola DTN, Yang C, Han C, Norinsky R, Peraza RD. Generation of mouse 7. Quadros RM, Miura H, Harms DW, Akatsuka H, Sato T, Aida T, Redder R, model (KI and CKO) via Easi‑ CRISPR. Methods Mol Biol (Clifton, NJ ). Richardson GP, Inagaki Y, Sakai D, et al. Easi‑ CRISPR: a robust method for 2021;2224:1–27. one‑step generation of mice carrying conditional and insertion alleles 28. Nishizono H, Hayano Y, Nakahata Y, Ishigaki Y, Yasuda R. Rapid genera‑ using long ssDNA donors and CRISPR ribonucleoproteins. Genome tion of conditional knockout mice using the CRISPR‑ Cas9 system and Biol. 2017;18:92. electroporation for neuroscience research. Mol Brain. 2021;14:148. 8. Miura H, Quadros RM, Gurumurthy CB, Ohtsuka M. Easi‑ CRISPR for 29. Shang R, Zhang H, Bi P. Generation of mouse conditional knockout alleles creating knock‑in and conditional knockout mouse models using long in one step using the i‑ GONAD method. Genome Res. 2021;31:121–30. ssDNA donors. Nat Protoc. 2018;13:195–215. B ernas et al. BMC Biotechnology (2022) 22:14 Page 15 of 15 30. Wilde JJ, Aida T, Del Rosario RCH, Kaiser T, Qi P, Wienisch M, Zhang Q, Colvin S, Feng G. Efficient embryonic homozygous gene conversion via RAD51‑ enhanced interhomolog repair. Cell. 2021;184:3267‑3280.e3218. 31. Auclair N, Sané AT, Ahmarani L, Patey N, Beaulieu JF, Peretti N, Spahis S, Levy E. Sar1b mutant mice recapitulate gastrointestinal abnor‑ malities associated with chylomicron retention disease. J Lipid Res. 2021;62:100085. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in pub‑ lished maps and institutional affiliations. Re Read ady y to to submit y submit your our re researc search h ? Choose BMC and benefit fr ? Choose BMC and benefit from om: : fast, convenient online submission thorough peer review by experienced researchers in your field rapid publication on acceptance support for research data, including large and complex data types • gold Open Access which fosters wider collaboration and increased citations maximum visibility for your research: over 100M website views per year At BMC, research is always in progress. Learn more biomedcentral.com/submissions
BMC Biotechnology – Springer Journals
Published: May 12, 2022
Keywords: CRISPR; Electroporation; Conditional; loxP; Zygotes
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.