Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Inhibition of TOR signalling in lea1 mutant induces apoptosis in Saccharomyces cerevisiae

Inhibition of TOR signalling in lea1 mutant induces apoptosis in Saccharomyces cerevisiae The target of rapamycin, TOR, maintains cell growth and proliferation under vivid environmental conditions by orchestrating wide array of growth-related process. In addition to environmental conditions, e.g., nutrient and stress, TOR also governs cellular response to varied intracellular cues including perturbed intracellular mRNA levels which may arise due to altered regulation of mRNA processing at splicing or turnover levels. The purpose of this study is to explore the role of TOR signalling in growth of cells with accumulated unprocessed RNA. Growth analysis of lea1Δ (splicing deficient) was carried out under varied conditions leading to nitrogen starvation. The expression of TORC1 and TORC2 marker genes was examined in this delete strain. Sensitivity of the lea1Δ towards oxidative agents was observed. Apoptosis was analyzed in caffeine-treated lea1Δ cells. The hypersensitivity of lea1Δ cells towards caffeine is outcome of highly perturbed TOR signalling. The growth defect is independent of PKC pathway. Cells with accumulated unprocessed RNA experience high oxidative stress that induces apoptosis. An inad- equate TOR signalling in lea1Δ cells substantiates the effect of oxidative stress induced by accumulated RNA to the extent of inducing cell death via apoptosis. . . . . Keywords RNA accumulation Oxidative stress Reactive oxygen species Caffeine Splicing Introduction (Wullschleger et al. 2006; De Virgilio and Loewith 2006; Adami et al. 2007). An elaborate understanding of the func- TOR is essentially a central regulator of growth across eukary- tion of TORC1 complex has been made possible by the use of otes (Loewith and Hall 2011). Thorough mechanistic under- inhibitors, e.g., rapamycin and caffeine which mimic nutrient standing of TOR signalling has always been sought for devel- starvation-like conditions and display remarkably similar opment of efficient therapeutic interventions against diseases global gene expression profile in Saccharomyces cerevisiae resulting from dysregulated TOR signalling. Under diverse (Loewith et al. 2002; Urban et al. 2007; Wanke et al. 2008; environmental conditions, TOR optimizes cell growth by reg- Lempiäinen et al. 2009). An activated TORC1 promotes cell ulating several key cellular growth-related processes such as growth through active protein and ribosome biosynthesis transcription, translation, and autophagy (Cardenas et al. (Powers and Walter 1999; Morita et al. 2015). Conversely, 1999;Becket al. 1999). The precise regulation of cell growth the inhibition of TORC1 activity leads to sequestration of involves its ability to sense and respond to both extracellular various transcription factors in the cytoplasm required to in- and relatively less studied intracellular cues. TOR manages duce the expression of nitrogen catabolite response genes growth homeostasis through two highly conserved complexes (GAP1), retrograde pathway genes (CIT2), and stress- TOR complex I (TORC1) and TOR complex II (TORC2) responsive genes (SOD2) (Crespo et al. 2002; Inoki et al. 2005; Loewith and Hall 2011). TORC2 primarily regulates actin cytoskeleton to maintain polarized nature of cell growth * Rekha Puria (Fadri et al. 2005; Kamada et al. 2005;He et al. 2013;Niles rpuria@gbu.ac.in; rpuria@gmail.com and Powers 2014). Further studies underscore the association of TOR signalling with vesicular trafficking system (Puria School of Biotechnology, Gautam Buddha University, Greater et al. 2008; Kingsbury and Cardenas 2016). Noida, Gautam Budh Nagar 201312, India In addition, to extracellular conditions, recent studies have School of Life Sciences, Jawaharlal Nehru University, New appreciated the emanating role of TOR signalling to different Delhi, India 342 Ann Microbiol (2019) 69:341–352 intracellular conditions. Class C vps mutants with defective support cell growth. Thereby, an inhibition of TOR signalling amino acid homeostasis have highly compromised TOR sig- in lea1Δ will reduce cell growth and survival. nalling (Stanfel et al. 2009; Loewith and Hall 2011). Further TOR signalling is also influenced by effectors of cross-talking pathways. Interestingly, the role of TOR signalling has also Material and methods been seen in cells with perturbed RNA levels which may arise due to defective RNA degradation or processing. TOR signal- Strains, medium, and growth conditions ling controls mRNA turnover in yeast (Albig and Decker 2001; Munchel et al. 2011). However, the mechanism is intri- Strain used in this study was isogenic with JK9-3d (MATa cate as the rate of decay of multiple RNAs is highly variable leu2-3,112 ura3-52 rme1 trp1 his4) (Heitman et al. 1991a). under different stress conditions. During nutrient depletion or LEA1 gene was disrupted with URA3 marker by PCR-based upon exposure to rapamycin, multiple RNAs are destabilized short homology recombination method. tor1Δ and rom2Δ but not decayed at the same rate (Albig and Decker 2001). The strains were disrupted with G418. Lithium acetate TE method role of CK2 kinase in mediating stress response at the level of was used for all transformations in this study (Gietz et al. pre-mRNA processing has been demonstrated (Bergkessel 1995). Primers used in this study are listed in Table 1. et al. 2011). Global protein kinase and phosphatase interaction Yeast cells were grown in YPD medium (1% yeast extract, network in yeast identified several potential substrates/ 2% peptone, and 2% glucose), synthetic dextrose (SD) medi- regulators of TOR complex including Sky1, a conserved um (2% glucose, 0.17% yeast nitrogen base (YNB) without Ser/Thr kinase that phosphorylates pre-mRNA splicing fac- amino acids and ammonium sulfate, 0.5% ammonium sul- tors of SR family (Siebel et al. 1999). Stresses that lead to fate), synthetic low ammonia dextrose (SLAD) (2% glucose, TORC1 inactivation caused rapid loss of RPG pre-mRNA 0.17% YNB without amino acids and ammonium sulfate, transcripts (Bergkessel et al. 2011). Apparently, since RP 0.05 mM ammonium sulfate), and YNB proline medium genes are rich in introns, TOR signalling may possess a direct (2% glucose, 0.17% YNB, and 0.1% proline). SD medium role in transcriptional processing of Ribi regulon, genes re- was supplied with various amino acids on the basis of auxot- quired for ribosome biogenesis in yeast. Recently, Heintz rophies in strains. Medium was supplemented with caffeine et al. have shown relationship between TOR signalling and (20 mM, 10 mM, 5 mM, and 2 mM), sorbitol (1 M), adenine splicing wherein loss of Sfa1 splicing factor suppresses life (20 mM), H O (1.5 mM and 2.5 mM), dithiothreitol (DTT) 2 2 span extension conferred by decreased TORC1 signalling (1 mM), glutathione reduced (GSH) (10 mM), and N-acetyl (Heintz et al. 2016). Since regulation at the level of pre- cysteine (NAC) (30 mM) for different experiments conducted mRNA processing contributes specifically and dynamically in this study. All the chemicals used in this study were pur- to the regulation of gene expression program under wide chased from Sigma-Aldrich, HiMedia, and Biochem. range of environmental challenges may have a bigger role in guiding cell growth at the level of pre-mRNA processing. Previously, genome-wide screen searching for genes that Growth assays when mutated in combination with tor1Δ reduce fitness or ren- der cells inviable resulted in identification of several genes For growth analysis, strains were grown in rich medium and associated with ribosomal and mitochondrial functions, vesicle selectable medium until stationary phase and subsequently docking and fusion, protein transport, microautophagy, and diluted to OD = 0.05 in a 96-well plate. Growth of cells vacuolar inheritance, including spliceosome complex gene was measured at 600 nm at intervals of 2 h for 16 h using LEA1 (Zurita-Martinez et al. 2007). LEA1 (looks exceptionally synergy H1 multimode plate reader (BioTek). For cell viabil- like U2A’) is highly conserved across metazoans, is a specific ity, after completion of 16 h, cells were serially diluted 10-fold component of U2snRNP, and is crucial for efficient first step of and plated on YPD agar plates lacking caffeine. Cell viability splicing in vivo. It plays an essential role in spliceosome as- was demonstrated by measuring colony-forming units (CFU) sembly with U2 snRNA base pairing with both the pre-mRNA after 3 days of incubation at 30 °C. For spot test, cells were branch point sequence and U6 snRNA. Cells lacking LEA1 grown overnight in rich medium to OD = 1 and collected at harbored low levels of various mRNA and accumulated pre- equal density in log phase (∼ 0.2 OD) prior to spotting. mRNA to different levels (Caspary and Séraphin 1998; Subsequently, 5-fold serially diluted cells in liquid-rich medi- Dreumont and Séraphin 2013). The anticipated prevalence of um (YPD) were spotted in 5 μL drops on solid medium with unspliced RNAs in lea1Δ and its synthetic sick interaction with and without caffeine. Cells were allowed to form colonies at tor1Δ persuaded us to directly investigate impact of unspliced 30 °C for 2–3 days prior to image acquisition. RNA/RNA load on TOR signalling. We envisaged that accu- Sensitivity to oxidizing agent hydrogen peroxide (H O ) 2 2 mulation of pre-transcripts in lea1Δ cells may lead to intracel- and reducing agents DTT, GSH, and NAC was determined lular stress conditions that require active TOR signalling to by growing WT and lea1Δ cells for 16 h (H O ) and 48 h 2 2 Ann Microbiol (2019) 69:341–352 343 Table 1 Primersused in thisstudy S. no. Primer name Sequence Purpose 1. RPLEA1F AACTACAGGACTTGGAAAATATCAGTTTTT Used in construction of lea1 mutant ATAAGCAATAGCGGCATCAGAGCAGATTG 2. RPLEA1R TTTTTTTTTAAGTCATTGAACAGTCGCACT Used in construction of lea1 mutant AACCAAAAGACGTTTACAATTTCCTGATG CGG 3. LEA1FC TCGCATACTCTGCATCCAAC Used in check PCR of lea1 mutant 4. URA3RC CTGGCGGATAATGCCTTTAG Used in check PCR of lea1 mutant 5. ACT1F AGTTGCCCCAGAAGAACACC Used as reference gene in qRT-PCR analysis 6. ACT1R TACCGGCAGATTCCAAACCC Used as reference gene in qRT-PCR analysis 7. GAP1F AGGGTTTGCCAAGTGTTTGTC TORC1 marker gene expression 8. GAP1R AACGCAATAAGACCGAATGC TORC1 marker gene expression 9. CIT2F GCCAAAGAAGAGAGCTTCCA TORC1 marker gene expression 10. CIT2R GGCAAAGCGTATTCAGGGTA TORC1 marker gene expression 11. SOD2F GGTTCCAACTCAAGCGCAAG TORC1 marker gene expression 12. SOD2R ACCCGTTCAAACCTGATGCA TORC1 marker gene expression 13. RPS26AF GCCAAAGAAGAGAGCTTCCA TORC1 marker gene expression 14. RPS26AR CTGGCGTGAATAGCACAAGA TORC1 marker gene expression 15. CMK2F GTCTAAACGGCCACCCTGTA TORC2 marker gene expression 16. CMK2R CCTGCAATGCCTTCTTCAAT TORC2 marker gene expression 17. DIA1F TAAGAACGGCAGACGAACCT TORC2 marker gene expression 18. DIA1R TCCAAATCCCTGTGTCCTTC TORC2 marker gene expression 19. NCW2F GAGAGACGTCAAGCGGAATC TORC2 marker gene expression 21. NCW2R GATGAGGATCCCGAAGATGA TORC2 marker gene expression 22. MCA1F CTCCTCCACCTAACCAGCAG Check apoptosis in lea1 mutant 23. MCA1R GGGTGGACCGTACATATTGG Check apoptosis in lea1 mutant (DTT, GSH, and NAC) in SD medium at 30 °C. SD media PCR experiments were performed in triplicate. Graph pad was supplemented with 2.5 mM concentration of H O . prism 5.0 was used for further analysis of real-time data. 2 2 Microscopy Quantitative real-time PCR Vacuolar morphology Total RNA from strains was isolated using RNeasy mini kit as per manufacturer’s instructions (QIAGEN). Total RNA was FM4-64 (excitation/emission: 488/585–610 nm) dye was used quantified at A and A /A ratio with Nanodrop spectro- 260 280 230 to stain vacuolar membrane of Saccharomyces cerevisiae photometer (Thermo Scientific) and integrity of total RNA (Vida and Emr 1995). Overnight grown primary culture was was assessed by denaturing agarose gel. One-microgram diluted into fresh YPD medium and grown up to exponential RNAwas used to synthesize cDNA by quantitect reverse tran- phase (O.D =0.5–0.6). Harvested cells were suspended 600nm scriptase kit (QAIGEN) and RNase-free DNase was also used in 100 μL SD medium supplemented with FM4-64 (1.6 μM) to avoid any genomic DNA contamination. Quantitative real- and incubated at 30 °C for 20 min. Cultures were treated with time PCR (qRT-PCR) using a two-step SYBR green reverse caffeine and cells were removed and washed at interval of 0 h, transcriptase PCR kit (QAIGEN) with primers listed in the 1h, and2hwithfreshYPD andresuspendedin 25 μLof Table 1 was carried in Bio-Rad CFX96™ real-time PCR ma- YNB medium. Cells were placed on poly-L-lysine-coated chine (Bio-Rad Laboratories Inc., New Delhi, India). Melt slides and observed under inverted fluorescence microscope curve analysis was generated at the end of each PCR to verify (Nikon eclipse ×60 objective lens) using red filter. that a single DNA species was amplified. The following cy- cling parameters were used: denaturation at 95 °C for 5 min, followed by 40 amplification cycles denaturing at 95 °C for Actin morphology 10 s, annealing at 60 °C for 30 s. ACT1 was amplified as the reference gene to calculate fold change for genes of interest Actin morphology was visualized by using dye Alexa Fluor and to assure equal loading of the sample. All quantitative 488 phalloidin. Exponential phase (OD =0.5–0.6) cells 600nm 344 Ann Microbiol (2019) 69:341–352 were treated with caffeine (20 mM). WT and caffeine-treated Results cells were taken out after 0 h and 3 h. Cells were harvested, washed with 1X PBS, and fixed with 4% paraformaldehyde lea1Δ exhibits hypersensitivity towards caffeine for 60 min at 30 °C. After two washes of 1X PBS, cells were resuspended in 100 μL PBS. Glycine (0.1 M) and Triton-100 The mechanism of action of rapamycin and caffeine is signif- (0.1%) were used to lyse the cell wall. One microliter of Alexa icantly different. Inside the cell, rapamycin first complexes Fluor 488 phalloidin (excitation/emission: 495/518 nm) was with Fkbp12 to specifically bind to FRB domain of Tor kinase added and incubated for 60 min at room temperature in dark. and inhibit its activity (Heitman et al. 1991b). However, caf- After one wash of PBS, cells were visualized under Nikon feine directly hits the activity of Tor kinase (Reinke et al. 2004; confocal microscope with 100X. All images were analyzed Kuranda et al. 2006; Wanke et al. 2008). In addition to with NIS software 4.0 of microscopy. rapamycin-specific responses, it also affects a diverse array of cellular responses related to cell growth, DNA metabolism, and cell cycle progression, most likely by acting as low-affinity Nuclear morphology ATP analog (Reinke et al. 2004). Initially to elaborate on TOR signalling in cells lacking LEA1, lea1Δ strain was exposed to Nuclear morphology was envisaged by fluorescence mi- inhibitory concentrations of both rapamycin and caffeine. No croscopy following DAPI staining. Log phase cells were any sensitivity of this mutant was observed in rapamycin but a treated with caffeine (10 mM) for 0 h and 6 h respectively high sensitivity was observedinpresenceofcaffeinein and same log phase cells were treated with H O enriched media (YPD) (Fig. 1a). WT cells and lea1Δ cells 2 2 (2.5 mM)for 0 h and2hrespectively. The cells were exposed to caffeine were monitored for their growth in stainedfor 30minwith5 μg/mL DAPI (excitation/emis- 10 mM caffeine for 16 h in YPD and declined survival of sion (nm): 358/461). The cells were then washed with lea1Δ in caffeine was supported by observed 4-fold reduction PBS and stained nuclei were photographed under fluores- in CFU/mL in YPD (Fig. 1b). This sensitivity was also con- cence microscope with a 60X objective (Nikon Eclipse firmed by dilution spotting of log phase cells in plates supple- microscope). mented with 10 mM caffeine (Fig. 1c). Similar growth defect was also observed in synthetic dextrose media supplemented with caffeine (5 mM, 8 mM) and rapamycin (5 nM) (Fig. 1d). Propidium iodide staining Up to 8-fold reduction in growth of lea1Δ was observed after 16 h of exposure to 8 mM caffeine in defined media (Fig. 1e). Cell permeability and nuclear DNA staining by propidium Further decreased growth of lea1Δ cells was observed in iodide (PI) staining method were performed as previously poor nitrogen conditions. lea1Δ showed reduced growth in described (Ocampo and Barrientos 2011; Zhang et al. SLAD and YNB proline (SD-pro.) (Fig. 1f, g). Apparently, 2018). For PI staining, exponential phase cells were treat- lack of Lea1 sensitizes cells to caffeine and nitrogen starvation ed with caffeine (10 mM) for 4 h and fixed with 4% probably through rapamycin-resistant function of TOR kinase. paraformaldehyde for 30 min at 30 °C. After washing two times with PBS, the same log phase cells (500 μL) lea1Δ cells have altered TOR signalling in caffeine were resuspended in PBS. To analyze permeability and viability with PI, these exponential phase cells were incu- To investigate the involvement of TOR signalling in lea1Δ, bated with PI (Sigma-Aldrich) for 30 min at 30 °C in the we looked at the transcriptional outputs of TOR complexes dark. The fluorescence microscope (Nikon Eclipse) was TORC1 and TORC2 in lea1Δ cells treated with caffeine. The used to observe the cells with 60X objective (excitation TORC1 complex comprises of Tco89, Lst8, Kog1, and either 510–70 nm). Tor1 or Tor2 and is considered as rapamycin sensitive (Loewith et al. 2002; De Virgilio and Loewith 2006).The TORC2 complex comprises of Tor2, Avo1, Avo2, Avo3, Statistical analysis Bit61, and Lst8 and is largely considered as rapamycin insen- sitive (Jacinto et al. 2004; Wullschleger et al. 2006). In agree- Averages of data are presented with means ± SD from at ment with known inhibitory effects of caffeine on TOR sig- least three independent experiments. The p values were nalling, an induced expression of low-affinity amino acid calculated using Student’s t test, one-way ANOVA. All transporter gene GAP1,stress gene SOD2, and retrograde re- the mean values of the experiments were analyzed by the sponse gene CIT2 was observed in WT strain. Further a re- post-Tukey test. The significant difference was considered duced expression of ribosome biogenesis gene, RPS26A,sup- when probability *p between 0.05 and 0.01, **p ≤ 0.01, ported suppression of protein synthesis in cells treated with and ***p ≤ 0.0001. caffeine (Bonawitz et al. 2007). Intriguingly, lea1Δ itself Ann Microbiol (2019) 69:341–352 345 Fig. 1 lea1Δ cells are hypersensitive to caffeine. lea1Δ cells are Absorbance and e viability after 16 h of growth in synthetic dextrose sensitive towards caffeine but not to rapamycin in comparison with media in caffeine (5 mM and 8 mM) and rapamycin (5 nM). lea1Δ WT. a Growth analysis in YPD, YPD supplemented with caffeine exhibits reduced growth in low nitrogen sources. f Dilution spotting and (10 mM), and YPD supplemented with rapamycin (5 nM). b Viability g absorbance (after 16 h) of WT and lea1Δ in synthetic dextrose media of cells exposed to caffeine and rapamycin after 16 h. c Dilution spotting without uracil (SD-URA), synthetic low ammonium dextrose (SLAD) of lea1Δ and WT strain on YPD alone, YPD plates supplemented with media, and synthetic dextrose with proline (SD-pro) 10 mM caffeine, and YPD plates supplemented with 5 nM rapamycin. d showed activation of stress-induced TORC1-mediated func- influence TORC1-mediated functions, a highly induced ex- tions (Fig. 2a). While GAP1, SOD2,and CIT2 were approxi- pression of NCW2, DIA1,and CMK2 in comparison to WT mately induced by 2-fold, 2.15-fold, and 1.15-fold, expression suggested an affected TORC2 function in caffeine-treated of RPS26A was reduced by up to 3-fold in comparison to lea1Δ cells in our set of conditions (Fig. 2b). All marker genes caffeine-treated WT cells. Similar observations were made lack introns except RPS26A. Further validation of a highly with TORC2 marker genes. Though caffeine is known to perturbed TOR signalling as a consequence of removal of 346 Ann Microbiol (2019) 69:341–352 (P value ≤ 0.03) (P value ≤ 0.008) (P value ≤ 0.002) *** 0.06 * *** * *** 2.0 0.6 1.5 0.04 0.4 1.0 0.02 0.2 0.5 0.00 0.0 0 0.0 (P value ≤ 0.006) (P value ≤ 0.001) ** ** 0.8 2.0 ** ** 0.6 1.5 0.4 1.0 0.2 1 0.5 0.0 0.0 DIC FM4-64 DIC FM4-64 Merged Actin DIC Merged Actin DIC T(0h) T(0h) T(1h) T(4h) T(2h) WT lea1Δ WT lea1∆ *** *** WT lea1Δ WT lea1Δ 80 *** 0 0 012 04 Time(hours) Time(hours) Fig. 2 TOR signalling in lea1 Δ. Expression profile of TORC marker caffeine for 1 h. c Vacuolar morphology by staining with FM4-64 after 1 h genes. a Expression of TORC1 marker genes (GAP1, RPS26A, SOD2, and2hofgrowth inpresenceof caffeine(20 mM). d Actin morphology and CIT2). b Expression of TORC2 marker genes (CMK2, DIA1,and by Alexa Fluor 488 phalloidin after 4 h of growth in presence of caffeine NCW2) in WT control and lea1Δ cells untreated or treated with 20 mM (20 mM), in lea1Δ and WT strain LEA1 was conceded by analyzing vacuolar morphology and lea1Δ cells showed no any significant defect in endocytosis. actin polarization. For studying the vacuolar morphology, we At T0 h, both WT and lea1Δ had 1–3 prominent vacuoles as performed fluorescence microscopy of caffeine-treated and predominant phenotype. Further, no major difference in vac- caffeine-untreated cells with lipophytic dye FM4-64 which uolar morphology was observed in WT control cells after 120′ incorporates into plasma membrane and serves as an exposure to caffeine. However, in about 60% of caffeine- endocytic marker that localizes to vacuolar membrane (Vida treated lea1Δ cells, vacuoles appeared as single large spheres, and Emr 1995;Müller etal. 2007). Around 200 cells were as class D vps mutants of vesicle trafficking pathway (Fig. 2c). scored after 60′ and 120′ of caffeine treatment. WT and Vacuoles are storehouse of amino acids and large vacuoles WT (YPD) WT (CAFF) lea1 (YPD) lea1 (CAFF) WT (YPD) Wt(YPD) WT (CAFF) Wt(CAFF) lea1 (YPD) lea1 (YPD) lea1 (CAFF') lea1 (CAFF') WT(YPD) WT(CAFF) WT (YPD) lea1 (YPD) WT (CAFF) lea1 (CAFF) lea1 (YPD) lea1 (CAFF) WT (YPD) WT (CAFF) WT (YPD) lea 1 (YPD) lea1 (CAFF) WT (CAFF) lea1 (YPD) lea1 (CAFF) GAP1/ACT1 CIT2/ACT1 % of enlarged vacuoles RPS26A/ACT1 SOD2/ACT1 NCW2/ACT1 Actin depolarization (% of cells) CMK2/ACT1 DIA1/ACT1 Ann Microbiol (2019) 69:341–352 347 suggest lea1Δ are probably more nutrient deprived/stressed pathway and activates the Rho1p-Pkc1p signalling pathway compared to WT cells. Next studies were also performed to (Kuranda et al. 2006). This suggests that caffeine sensitivity examine the effect of caffeine on actin morphology of lea1Δ of lea1Δ is largely independent of PKC pathway. strain. In yeast, actin is organized into actin cables and cortical actin patches which are largely accumulated in bud tip to lea1Δ cells exhibit hypersensitivity to oxidizing agent ensure normal daughter cell formation (Martin and Arkowitz H O 2 2 2014). TORC2 is absolute required for maintenance of polar- ized cell growth in budding yeast (Gaubitz et al. 2015). lea1Δ lea1Δ cells are deficient in splicing, resulting in differential cells treated with caffeine upon staining showed altered actin levels of accrual of various RNAs. We randomly selected polarization. Actin was seen scattered on periphery or over seven genes with introns and analyzed levels of pretranscripts whole cell surface in about 80% of cells instead of being by amplifying with forward primers from intron and reverse clustered in bud region (Fig. 2d).Infactasobservedinprevi- primer from exon region (I/E). Three genes MUD1, VPS29, ous study, an altered chitin distribution was observed in and YSF3 showed substantial increase in levels of caffeine-treated lea1 mutant cells (results not shown). Taken pretranscripts in presence of caffeine in lea1Δ cells. This sug- together, these results revealed that exposure of lea1Δ cells to gests that caffeine accrue the intracellular stress in lea1Δ caffeine results in highly perturbed TOR signalling with im- through accumulation of unprocessed RNA (data not shown). pact on both TORC1- and TORC2-mediated functions. Cell exploits elaborate RNA surveillance mechanism to prevent accumulation of aberrant RNAs and ensure integral Caffeine sensitivity of lea1Δ is largely independent expression of protein-encoding genes, e.g., increased RNA of PKC pathway stability induces reactive oxygen species-dependent apoptosis (Mazzoni et al. 2003). On the basis of prior information and Mutants of PKC1 pathway also exhibit sensitivity towards our observation, that strains lacking LEA1 contains reduced caffeine as tor1Δ. However, unlike tor1Δ, the sensitivity of levels of U2SnRNA and they have impaired pre-mRNA splic- these mutants can be rescued by addition of excess sorbitol ing that results in accumulation of unprocessed RNA, we en- or adenine. In order to visualize the contribution of PKC path- visaged that the persistence of unspliced RNAs in lea1Δ cells way in caffeine sensitivity of lea1Δ, the growth of lea1Δ strain may sensitize these cells towards oxidizing agent. The in- was analyzed in caffeine supplemented with 1 M sorbitol and creased expression of SOD2 mentioned above actually sup- 20 mM adenine (Fig. 3). WT and rom2Δ mutant showed no ports the enhanced oxidative stress experienced by splicing- defect in 5 mM caffeine supplemented with 1 M sorbitol. deficient lea1Δ cells. H O is an established oxidative agent 2 2 Whereas rom2Δ, GDP/GTP exchange factor, PKC pathway and is known to increase ROS production at lower concentra- component exhibited improved survival in caffeine in presence tions (Kamada et al. 2005; Pereira et al. 2012). Thus, to inves- of sorbitol and adenine, no significant rescue was observed in tigate the consequences of loss of LEA1 on oxidative stress growth of lea1Δ and tor1Δ. These results of rom2Δ confirm the tolerance, cell growth was observed in presence of oxidative previous studies that Rom2p inhibits the Ras/cAMP signalling agent H O at 1.5 mM and 2.5 mM concentrations. In 2 2 Fig. 3 Effect of addition of sorbitol and adenine on caffeine sensitivity of lea1Δ. Serial dilutions of WT, lea1Δ, tor1Δ, and rom2Δ strains were spotted on YPD plates containing 2 mM, 5mM, and10 mM caffeine and supplemented with either 1 M sorbitol or 20 mM adenine. Growth was monitored after 2days at 30 °C 348 Ann Microbiol (2019) 69:341–352 comparison to WTcells, lea1Δ cells exhibited hypersensitivity This result showed that cell death in lea1Δ mutant is also con- to H O .Interestingly, tor1Δ exhibited insensitivity to H O tributed by loss of integrity of plasma membrane. 2 2 2 2 (Fig. 4a). Yeast nuclei exposed to ROS are known to become less compact and appear larger and more diffused. Similar diffused and punctate fragmented nuclei were observed in Discussion about 70% of lea1Δ cells compared to 50% in control WT population after 2 h of exposure to H O (Fig. 4b). Further, The levels of RNA are precisely regulated inside the cell, to 2 2 no significant nuclear disintegration was observed in tor1Δ safeguard the cell growth. Although role of TOR signalling in cells in presence or absence of caffeine. Probably inhibition cell growth that is regulation is well established, the associa- of TOR1-mediated signalling alone does not lead to oxidative tion of TOR signalling with accumulated unprocessed RNA is stress sensitizing cells to H O . Reduced cell growth resulting known largely through indirect evidences only. Moreover, no 2 2 from increased ROS generated by H O can well be prevented direct studies have been performed previously to illustrate role 2 2 by addition of anti-oxidant substances such as dithiothreitol of TOR signalling in growth of cells with defects in RNA (DTT). As anticipated, the addition of anti-oxidants rescued splicing. almost 100% of the cells (Fig. 4c). The mutant cells with In the present study, the altered TOR signalling by higher ROS get quenched by the addition of DTT, L- caffeine in lea1Δ clearly demonstrates that cells lacking glutathione-reduced (GSH), and N-acetyl cysteine (NAC) LEA1 can sense and respond to environmental conditions. which allowed their better survival (Sariki et al. 2016). The lea1Δ exhibits exacerbated expression of TORC1 Further substantiation to our hypothesis on role of oxidative marker genes (GAP1, SOD2,and CIT2). This implies role stress in lea1Δ growth defect came from combinatorial of additional stress generated by deletion of LEA1 to be growth studies of cells exposed to both H O and sub- responsible for their reduced survival in caffeine com- 2 2 inhibitory concentration of caffeine (Fig. 4d). pared to wild-type strain. The highly reduced expression of RPG transcripts explains slow growth (splicing defi- ciency) of lea1Δ strain compared to WT strain. SOD2 is Caffeine promotes oxidative stress-induced apoptosis known to have an antioxidant function by catalyzing the in lea1Δ disproportionation of superoxide anion to H O and is 2 2 essential for defense against oxygen radicals generated ROS are key regulators of yeast apoptosis (regulated cell at mitochondrial respiratory chain (Fukai and Ushio- death). Earlier studies have demonstrated the existence of func- Fukai 2011). Intriguingly, induced expression of SOD2 tional apoptotic machinery in unicellular organisms that re- gene provided us the initial evidence of the additional spond to oxidative stress. Caspase-like protease (Yca1/Mca1) oxidative stress faced by splicing deficient lea1Δ strain. mediates cell death triggered by oxygen stress, salt stress, or Noteworthy, recent studies have shown that the role of chronological aging (Madeo et al. 1997; Farrugia and Balzan TORC2 on regulation of actin polarization is mediated 2012). Mca1 is essentially required for apoptosis induced by through reactive oxygen species (ROS) produced from increased mRNA stability (Mazzoni et al. 2005). Quantitative mitochondrial and non-mitochondrial sources (Niles and RT-PCR of MCA1 in caffeine-treated and caffeine-untreated Powers 2014). The heightened TORC2 expression along WT and lea1Δ cells unveiled an induced and equivalent ex- with depolarized actin distribution indicates accumulation pression of MCA1 in caffeine-treated control and caffeine- of ROS in caffeine-treated lea1Δ cells.Thereby,expres- untreated lea1Δ cells which means that suppression of TOR sion of TORC1 and TORC2 marker genes guided our signalling by caffeine induces oxidative stress to the levels studies towards role of additional oxidative stress experi- induced in cells lacking LEA1. However, the expression of enced by lea1Δ. MCA1 in caffeine-treated lea1Δ cells was enhanced (Fig. 5a). Lack of LEA1 remarkably affects accumulation of pre- An extended support to expression results was obtained by mRNA. Stabilized RNAs generated in yeast mutants in microscopic examination of DAPI-stained DNA of lea1Δ mRNA decapping pathway such as lsm1, lsm4, dcp1, and cells. Highly fragmented enlarged diffused nuclei indicative dcp2 trigger apoptosis (Mazzoni et al. 2005; Mazzoni and of regulated cell death was observed in more than 50% of Falcone 2011;Rajuet al. 2015). However, the specific mech- caffeine-treated lea1Δ cells (Fig. 5b). Again, tor1Δ did not ex- anism coordinating RNA stability and apoptosis remains un- hibit any nuclear disintegration suggesting caffeine sensitivity known. Further, oxidizing agents, e.g., H O and acetic acid at 2 2 of tor1Δ does not result in apoptosis. In support of apoptosis in low doses, are also known to induce apoptosis (Liang et al. lea1Δ mutant, propidium iodide (PI) staining was also done and 2008). No direct link of TOR signalling, accumulated unpro- % of PI-positive cells was counted after 4-h incubation of caf- cessed RNA, and regulated cell death is known except that feine (10 mM). In lea1Δ mutant, 70% cells were PI positive as yeast protein expression profile generated during acetic acid- compared to WT where 42% cells were PI positive (Fig. 5c). induced apoptosis indicates casual involvement of TOR Ann Microbiol (2019) 69:341–352 349 (P value ≤ 0. 0001) 1.4 WT 1.2 lea1∆ 1 tor1∆ *** *** 0.8 0.6 0.4 0.2 SD-URA H O (1.5 mM) H O (2.5 mM) 2 2 2 2 DAPI (P value ≤ 0. 0004) DAPI WT lea1∆ tor1∆ T(0h) *** T(2h) Time(hours) WT tor1∆ lea1∆ c d (P value ≤ 0. 0001) (P value ≤ 0. 004) 0.7 2.5 WT lea1∆ WT lea1Δ 0.6 2 0.5 0.4 1.5 0.3 0.2 *** *** 0.1 0.5 Fig. 4 lea1Δ cells are hypersensitive to oxidative stress. a Growth curve DAPI-stained cells. c Effect of antioxidants 1 mM DTT, 10 mM L- of WT, lea1Δ,and tor1Δ in presence of SD-URA and H O at 1.5 mM glutathione reduced (GSH), and 30 mM N-acetyl cysteine (NAC) on 2 2 and 2.5 mM concentrations after 16 h. b DAPI staining of WT, lea1Δ,and growth of lea1Δ in comparison to WT control. d Simultaneous exposure tor1Δ mutant at 2 mM conc. of H O at 0 h and 2 h. Statistical analysis of to caffeine and H O reduces growth of lea1Δ 2 2 2 2 O.D.(600nm) O.D.(600nm) O.D.(600nm) %of cells with fragmented nuclei 350 Ann Microbiol (2019) 69:341–352 DAPI (P value ≤ 0.006) WT lea1∆ T(0h) *** T(4h) Time (hours) tor1∆ lea1∆ WT Propidium Iodide DIC DIC Propidium Iodide (P value ≤ 0.0001) T(0h) WT lea1∆ T(4h) Time (hours) lea1∆ WT Fig. 5 Caffeine induces apoptosis in lea1Δ cells. a Induced expression of with fragmented nuclei. c Propidium iodide (PI) staining in lea1Δ and yeast metacaspase MCA1. b Nuclear disintegration in WT, lea1Δ,and WT after 4-h incubation of caffeine. Statistical analysis of PI-positive tor1Δ after 0-h and 4-h incubation of caffeine. Statistical analysis of cells cells in both strains. CAFF caffeine, WT wild type pathway (Almeida et al. 2009). The hypersensitivity of lea1Δ conditions but also emphasizes on crucial role of TOR signal- to H O , the induced expression of MCA1, and nuclear frag- ling in appropriately responding to intracellular stress/s gen- 2 2 mentation of lea1 mutant provided sufficient evidence to con- erated by defective splicing. The high conservation of TOR clude that accumulated RNA leads to oxidative stress that signalling and RNA processing across eukaryotes strongly subsequently results in caspase-dependent cell death. suggests that mechanistic insights acquired here will be broad- The heightened sensitivity of lea1 mutant cells towards ly applicable and further investigation can be done to capitu- oxidizing agent upon inhibition of TOR signalling via caffeine late insights into link of TOR signalling with pre-mRNA shows that oxidative stress induced by accumulated RNA is processing. exacerbated in cells with compromised TOR signalling, which Acknowledgements Initial work contribution of Shubhi Sahni is highly ultimately results in reduced growth and survival through in- acknowledged. We are highly thankful to Dr. Maria E. Cardenas for duced apoptosis. Interestingly, this mechanism is specifically providing us Jk9-3d strain. induced by unprocessed RNA, as tor1Δ does not exhibit any nuclear fragmentation suggestive of apoptosis irrespective of Author contribution This study was designed by PK and RP. presence of caffeine. The positive PI staining in lea1Δ cells Experiments were performed by PK and analyzed along with VN, DK, AKM, and RP. PK and RP wrote the manuscript. PK completed all the upon caffeine treatment also shows that caffeine promotes cell figures. All the results and final version of manuscript were reviewed by death in lea1Δ mutant via destroying the integrity of plasma all the authors. membrane because in dead cells, PI can penetrate the plasma membranes. Our studies demonstrate that role of TOR in RNA Funding This work was supported by research grant to RP from SERB, processing/splicing may not be limited to direct function of Department of Science and Technology, Govt. of India (grant no. SR/FT/ LS-93/2010). Pavan is thankful to SERB for fellowship. various splicing factors under diverse environmental % of cells with fragmented nuclei % of PI positive cells Ann Microbiol (2019) 69:341–352 351 Gaubitz C, Oliveira T, Prouteau M et al (2015) Molecular basis of the Compliance with ethical standards rapamycin insensitivity of target of rapamycin complex 2. Mol Cell 58:977–988. https://doi.org/10.1016/j.molcel.2015.04.031 Conflict of interest The authors declare that they have no conflict of Gietz RD, Schiestl RH, Willems AR, Woods RA (1995) Studies on the interest. transformation of intact yeast cells by the LiAc/SS-DNA/PEG pro- cedure. Yeast 11:355–360. https://doi.org/10.1002/yea.320110408 Research involving human participants and/or animals (if He Y, Li D, Cook SL et al (2013) Mammalian target of rapamycin and applicable) N/A Rictor control neutrophil chemotaxis by regulating Rac/Cdc42 ac- tivity and the actin cytoskeleton. Mol Biol Cell 24:3369–3380. Informed consent Yes https://doi.org/10.1091/mbc.E13-07-0405 Heintz C, Doktor TK, Lanjuin A et al (2016) Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans. Publisher’sNote Springer Nature remains neutral with regard to jurisdic- tional claims in published maps and institutional affiliations. Nature 541:102–106. https://doi.org/10.1038/nature20789 Heitman J, Movva NR, Hall MN (1991a) Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 253:905–909 Heitman J, Movva NR, Hiestand PC, Hall MN (1991b) FK 506-binding protein proline rotamase is a target for the immunosuppressive agent References FK 506 in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 88: 1948–1952 Adami A, García-Alvarez B, Arias-Palomo E et al (2007) Structure of Inoki K, Ouyang H, Li Y, Guan K-L (2005) Signaling by target of TOR and its complex with KOG1. Mol Cell 27:509–516. https://doi. rapamycin proteins in cell growth control. Microbiol Mol Biol org/10.1016/j.molcel.2007.05.040 Rev 69:79–100. https://doi.org/10.1128/MMBR.69.1.79-100.2005 Albig AR, Decker CJ (2001) The target of rapamycin signaling pathway Jacinto E, Loewith R, Schmidt A et al (2004) Mammalian TOR complex regulates mRNA turnover in the yeast Saccharomyces cerevisiae. 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat MolBiolCell12:3428–34383 Cell Biol 6:1122–1128. https://doi.org/10.1038/ncb1183 Almeida B, Ohlmeier S, Almeida AJ et al (2009) Yeast protein expression Kamada Y, Fujioka Y, Suzuki NN et al (2005) Tor2 directly phosphory- profile during acetic acid-induced apoptosis indicates causal in- lates the AGC kinase Ypk2 to regulate actin polarization. Mol Cell volvement of the TOR pathway. Proteomics 9:720–732. https:// Biol 25:7239–7248. https://doi.org/10.1128/MCB.25.16.7239- doi.org/10.1002/pmic.200700816 7248.2005 Beck T, Schmidt A, Hall MN (1999) Starvation induces vacuolar Kingsbury JM, Cardenas ME (2016) Vesicular trafficking systems impact targeting and degradation of the tryptophan permease in yeast. J TORC1-controlled transcriptional programs in Saccharomyces Cell Biol 146:1227–1238 cerevisiae. G3(Bethesda) 6:641–652. https://doi.org/10.1534/g3. Bergkessel M, Whitworth GB, Guthrie C (2011) Diverse environmental 115.023911 stresses elicit distinct responses at the level of pre-mRNA processing Kuranda K, Leberre V, Sokol S et al (2006) Investigating the caffeine in yeast. RNA 17:1461–1478. https://doi.org/10.1261/rna.2754011 effects in the yeast Saccharomyces cerevisiae brings new insights Bonawitz ND, Chatenay-Lapointe M, Pan Y, Shadel GS (2007) Reduced into the connection between TOR, PKC and Ras/cAMP signalling TOR signaling extends chronological life span via increased respi- pathways. Mol Microbiol 61:1147–1166. https://doi.org/10.1111/j. ration and upregulation of mitochondrial gene expression. Cell 1365-2958.2006.05300.x Metab 5:265–277. https://doi.org/10.1016/j.cmet.2007.02.009 Lempiäinen H, Uotila A, Urban J et al (2009) Sfp1 interaction with Cardenas ME, Cutler NS, Lorenz MC et al (1999) The TOR signaling TORC1 and Mrs6 reveals feedback regulation on TOR signaling. cascade regulates gene expression in response to nutrients. Genes Mol Cell 33:704–716. https://doi.org/10.1016/j.molcel.2009.01.034 Dev 13:3271–3279. https://doi.org/10.1101/gad.13.24.3271 Liang Q, Li W, Zhou B (2008) Caspase-independent apoptosis in yeast. Caspary F, Séraphin B (1998) The yeast U2A’/U2B complex is required Biochim Biophys Acta Mol Cell Res 1783:1311–1319. https://doi. for pre-spliceosome formation. EMBO J 17:6348–6358. https://doi. org/10.1016/j.bbamcr.2008.02.018 org/10.1093/emboj/17.21.6348 Loewith R, Hall MN (2011) Target of rapamycin (TOR) in nutrient sig- Crespo JL, Powers T, Fowler B, Hall MN (2002) The TOR-controlled naling and growth control. Genetics 189:1177–1201. https://doi.org/ transcription activators GLN3, RTG1, and RTG3 are regulated in 10.1534/genetics.111.133363 response to intracellular levels of glutamine. Proc Natl Acad Sci U S Loewith R, Jacinto E, Wullschleger S et al (2002) Two TOR complexes, A 99:6784–6789. https://doi.org/10.1073/pnas.102687599 only one of which is rapamycin sensitive, have distinct roles in cell De Virgilio C, Loewith R (2006) The TOR signalling network from yeast growth control. Mol Cell. https://doi.org/10.1016/S1097-2765(02) to man. Int J Biochem Cell Biol 38:1476–1481. https://doi.org/10. 00636-6 1016/j.biocel.2006.02.013 Madeo F, Fröhlich E, Fröhlich KU (1997) A yeast mutant showing diag- Dreumont N, Séraphin B (2013) Rapid screening of yeast mutants with nostic markers of early and late apoptosis. J Cell Biol 139:729–734. reporters identifies new splicing phenotypes. FEBS J 280:2712– https://doi.org/10.1083/jcb.139.3.729 2726. https://doi.org/10.1111/febs.12277 Martin SG, Arkowitz RA (2014) Cell polarization in budding and fission Fadri M, Daquinag A, Wang S et al (2005) The pleckstrin homology yeasts. FEMS Microbiol Rev 38:228–253. https://doi.org/10.1111/ domain proteins Slm1 and Slm2 are required for actin cytoskeleton 1574-6976.12055 organization in yeast and bind phosphatidylinositol-4,5- Mazzoni C, Falcone C (2011) mRNA stability and control of cell prolif- bisphosphate and TORC2. Mol Biol Cell 16:1883–1900. https:// eration: figure 1. Biochem Soc Trans 39:1461–1465. https://doi.org/ doi.org/10.1091/mbc.E04-07-0564 10.1042/BST0391461 Farrugia G, Balzan R (2012) Oxidative stress and programmed cell death Mazzoni C, Herker E, Palermo V et al (2005) Yeast caspase 1 links in yeast. Front Oncol 2:64. https://doi.org/10.3389/fonc.2012.00064 messenger RNA stability to apoptosis in yeast. EMBO Rep 6: 1076–1081. https://doi.org/10.1038/sj.embor.7400514 Fukai T, Ushio-Fukai M (2011) Superoxide dismutases: role in redox signaling, vascular function, and diseases. Antioxid Redox Signal Mazzoni C, Mancini P, Verdone L et al (2003) A truncated form of 15:1583–1606. https://doi.org/10.1089/ars.2011.3999 KlLsm4p and the absence of factors involved in mRNA decapping 352 Ann Microbiol (2019) 69:341–352 trigger apoptosis in yeast. Mol Biol Cell 14:721–729. https://doi.org/ with Ssd1p to maintain cellular integrity in Saccharomyces cerevisiae. J Biol Chem 279:14752–14762. https://doi.org/10. 10.1091/mbc.E02-05-0258 Morita M, Gravel S-P, Hulea L et al (2015) mTOR coordinates protein 1074/jbc.M313062200 synthesis, mitochondrial activity and proliferation. Cell Cycle 14: Sariki SK, Sahu PK, Golla U et al (2016) Sen1, the homolog of human 473–480. https://doi.org/10.4161/15384101.2014.991572 Senataxin, is critical for cell survival through regulation of redox Müller J, Mettbach U, Menzel D, Samaj J (2007) Molecular dissection of homeostasis, mitochondrial function, and the TOR pathway in endosomal compartments in plants. Plant Physiol 145:293–304. Saccharomyces cerevisiae. FEBS J 283:4056–4083. https://doi. https://doi.org/10.1104/pp.107.102863 org/10.1111/febs.13917 Munchel SE, Shultzaberger RK, Takizawa N, Weis K (2011) Dynamic Siebel CW, Feng L, Guthrie C, Fu XD (1999) Conservation in budding profiling of mRNA turnover reveals gene-specific and system-wide yeast of a kinase specific for SR splicing factors. Proc Natl Acad Sci regulation of mRNA decay. Mol Biol Cell 22:2787–2795. https:// USA96:5440–5445 doi.org/10.1091/mbc.E11-01-0028 Stanfel MN, Shamieh LS, Kaeberlein M, Kennedy BK (2009) The TOR Niles BJ, Powers T (2014) TOR complex 2-Ypk1 signaling regulates pathway comes of age. Biochim Biophys Acta Gen Subj 1790: actin polarization via reactive oxygen species. Mol Biol Cell 25: 1067–1074. https://doi.org/10.1016/j.bbagen.2009.06.007 3962–3972. https://doi.org/10.1091/mbc.E14-06-1122 Urban J, Soulard A, Huber A et al (2007) Sch9 is a major target of Ocampo A, Barrientos A (2011) Quick and reliable assessment of chro- TORC1 in Saccharomyces cerevisiae. Mol Cell 26:663–674. nological life span in yeast cell populations by flow cytometry. https://doi.org/10.1016/j.molcel.2007.04.020 Mech Ageing Dev 132:315–323. https://doi.org/10.1016/j.mad. Vida TA, Emr SD (1995) A new vital stain for visualizing vacuolar 2011.06.007 membrane dynamics and endocytosis in yeast. J Cell Biol 128: Pereira C, Bessa C, Saraiva L (2012) Endocytosis inhibition during H O 779–792 -induced apoptosis in yeast. FEMS Yeast Res 12:755–760. https:// Wanke V, Cameroni E, Uotila A et al (2008) Caffeine extends yeast doi.org/10.1111/j.1567-1364.2012.00825.x lifespan by targeting TORC1. Mol Microbiol 69:277–285. https:// Powers T, Walter P (1999) Regulation of ribosome biogenesis by the doi.org/10.1111/j.1365-2958.2008.06292.x rapamycin-sensitive TOR-signaling pathway in Saccharomyces Wullschleger S, Loewith R, Hall MN (2006) TOR signaling in growth cerevisiae. Mol Biol Cell 10:987–1000 and metabolism. Cell 124:471–484. https://doi.org/10.1016/j.cell. Puria R, Zurita-Martinez SA, Cardenas ME (2008) Nuclear translocation 2006.01.016 of Gln3 in response to nutrient signals requires Golgi-to-endosome Zhang N, Fan Y, Li C et al (2018) Cell permeability and nuclear DNA trafficking in Saccharomyces cerevisiae. Proc Natl Acad Sci 105: staining by propidium iodide in basidiomycetous yeasts. Appl 7194–7199. https://doi.org/10.1073/pnas.0801087105 Microbiol Biotechnol 102:4183–4191. https://doi.org/10.1007/ Raju KK, Natarajan S, Kumar NS et al (2015) Role of cytoplasmic s00253-018-8906-8 deadenylation and mRNA decay factors in yeast apoptosis. FEMS Zurita-Martinez SA, Puria R, Pan X et al (2007) Efficient Tor signaling Yeast Res 15. https://doi.org/10.1093/femsyr/fou006 requires a functional class C Vps protein complex in Saccharomyces Reinke A, Anderson S, McCaffery JM et al (2004) TOR complex 1 cerevisiae. Genetics 176:2139–2150. https://doi.org/10.1534/ includes a novel component, Tco89p (YPL180w), and cooperates genetics.107.072835 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

Inhibition of TOR signalling in lea1 mutant induces apoptosis in Saccharomyces cerevisiae

Download PDF
12 pages

Loading next page...
 
/lp/springer-journals/inhibition-of-tor-signalling-in-lea1-mutant-induces-apoptosis-in-mTPGnDiUtF

References (51)

Publisher
Springer Journals
Copyright
Copyright © 2019 by Università degli studi di Milano
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Mycology; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/s13213-018-1422-3
Publisher site
See Article on Publisher Site

Abstract

The target of rapamycin, TOR, maintains cell growth and proliferation under vivid environmental conditions by orchestrating wide array of growth-related process. In addition to environmental conditions, e.g., nutrient and stress, TOR also governs cellular response to varied intracellular cues including perturbed intracellular mRNA levels which may arise due to altered regulation of mRNA processing at splicing or turnover levels. The purpose of this study is to explore the role of TOR signalling in growth of cells with accumulated unprocessed RNA. Growth analysis of lea1Δ (splicing deficient) was carried out under varied conditions leading to nitrogen starvation. The expression of TORC1 and TORC2 marker genes was examined in this delete strain. Sensitivity of the lea1Δ towards oxidative agents was observed. Apoptosis was analyzed in caffeine-treated lea1Δ cells. The hypersensitivity of lea1Δ cells towards caffeine is outcome of highly perturbed TOR signalling. The growth defect is independent of PKC pathway. Cells with accumulated unprocessed RNA experience high oxidative stress that induces apoptosis. An inad- equate TOR signalling in lea1Δ cells substantiates the effect of oxidative stress induced by accumulated RNA to the extent of inducing cell death via apoptosis. . . . . Keywords RNA accumulation Oxidative stress Reactive oxygen species Caffeine Splicing Introduction (Wullschleger et al. 2006; De Virgilio and Loewith 2006; Adami et al. 2007). An elaborate understanding of the func- TOR is essentially a central regulator of growth across eukary- tion of TORC1 complex has been made possible by the use of otes (Loewith and Hall 2011). Thorough mechanistic under- inhibitors, e.g., rapamycin and caffeine which mimic nutrient standing of TOR signalling has always been sought for devel- starvation-like conditions and display remarkably similar opment of efficient therapeutic interventions against diseases global gene expression profile in Saccharomyces cerevisiae resulting from dysregulated TOR signalling. Under diverse (Loewith et al. 2002; Urban et al. 2007; Wanke et al. 2008; environmental conditions, TOR optimizes cell growth by reg- Lempiäinen et al. 2009). An activated TORC1 promotes cell ulating several key cellular growth-related processes such as growth through active protein and ribosome biosynthesis transcription, translation, and autophagy (Cardenas et al. (Powers and Walter 1999; Morita et al. 2015). Conversely, 1999;Becket al. 1999). The precise regulation of cell growth the inhibition of TORC1 activity leads to sequestration of involves its ability to sense and respond to both extracellular various transcription factors in the cytoplasm required to in- and relatively less studied intracellular cues. TOR manages duce the expression of nitrogen catabolite response genes growth homeostasis through two highly conserved complexes (GAP1), retrograde pathway genes (CIT2), and stress- TOR complex I (TORC1) and TOR complex II (TORC2) responsive genes (SOD2) (Crespo et al. 2002; Inoki et al. 2005; Loewith and Hall 2011). TORC2 primarily regulates actin cytoskeleton to maintain polarized nature of cell growth * Rekha Puria (Fadri et al. 2005; Kamada et al. 2005;He et al. 2013;Niles rpuria@gbu.ac.in; rpuria@gmail.com and Powers 2014). Further studies underscore the association of TOR signalling with vesicular trafficking system (Puria School of Biotechnology, Gautam Buddha University, Greater et al. 2008; Kingsbury and Cardenas 2016). Noida, Gautam Budh Nagar 201312, India In addition, to extracellular conditions, recent studies have School of Life Sciences, Jawaharlal Nehru University, New appreciated the emanating role of TOR signalling to different Delhi, India 342 Ann Microbiol (2019) 69:341–352 intracellular conditions. Class C vps mutants with defective support cell growth. Thereby, an inhibition of TOR signalling amino acid homeostasis have highly compromised TOR sig- in lea1Δ will reduce cell growth and survival. nalling (Stanfel et al. 2009; Loewith and Hall 2011). Further TOR signalling is also influenced by effectors of cross-talking pathways. Interestingly, the role of TOR signalling has also Material and methods been seen in cells with perturbed RNA levels which may arise due to defective RNA degradation or processing. TOR signal- Strains, medium, and growth conditions ling controls mRNA turnover in yeast (Albig and Decker 2001; Munchel et al. 2011). However, the mechanism is intri- Strain used in this study was isogenic with JK9-3d (MATa cate as the rate of decay of multiple RNAs is highly variable leu2-3,112 ura3-52 rme1 trp1 his4) (Heitman et al. 1991a). under different stress conditions. During nutrient depletion or LEA1 gene was disrupted with URA3 marker by PCR-based upon exposure to rapamycin, multiple RNAs are destabilized short homology recombination method. tor1Δ and rom2Δ but not decayed at the same rate (Albig and Decker 2001). The strains were disrupted with G418. Lithium acetate TE method role of CK2 kinase in mediating stress response at the level of was used for all transformations in this study (Gietz et al. pre-mRNA processing has been demonstrated (Bergkessel 1995). Primers used in this study are listed in Table 1. et al. 2011). Global protein kinase and phosphatase interaction Yeast cells were grown in YPD medium (1% yeast extract, network in yeast identified several potential substrates/ 2% peptone, and 2% glucose), synthetic dextrose (SD) medi- regulators of TOR complex including Sky1, a conserved um (2% glucose, 0.17% yeast nitrogen base (YNB) without Ser/Thr kinase that phosphorylates pre-mRNA splicing fac- amino acids and ammonium sulfate, 0.5% ammonium sul- tors of SR family (Siebel et al. 1999). Stresses that lead to fate), synthetic low ammonia dextrose (SLAD) (2% glucose, TORC1 inactivation caused rapid loss of RPG pre-mRNA 0.17% YNB without amino acids and ammonium sulfate, transcripts (Bergkessel et al. 2011). Apparently, since RP 0.05 mM ammonium sulfate), and YNB proline medium genes are rich in introns, TOR signalling may possess a direct (2% glucose, 0.17% YNB, and 0.1% proline). SD medium role in transcriptional processing of Ribi regulon, genes re- was supplied with various amino acids on the basis of auxot- quired for ribosome biogenesis in yeast. Recently, Heintz rophies in strains. Medium was supplemented with caffeine et al. have shown relationship between TOR signalling and (20 mM, 10 mM, 5 mM, and 2 mM), sorbitol (1 M), adenine splicing wherein loss of Sfa1 splicing factor suppresses life (20 mM), H O (1.5 mM and 2.5 mM), dithiothreitol (DTT) 2 2 span extension conferred by decreased TORC1 signalling (1 mM), glutathione reduced (GSH) (10 mM), and N-acetyl (Heintz et al. 2016). Since regulation at the level of pre- cysteine (NAC) (30 mM) for different experiments conducted mRNA processing contributes specifically and dynamically in this study. All the chemicals used in this study were pur- to the regulation of gene expression program under wide chased from Sigma-Aldrich, HiMedia, and Biochem. range of environmental challenges may have a bigger role in guiding cell growth at the level of pre-mRNA processing. Previously, genome-wide screen searching for genes that Growth assays when mutated in combination with tor1Δ reduce fitness or ren- der cells inviable resulted in identification of several genes For growth analysis, strains were grown in rich medium and associated with ribosomal and mitochondrial functions, vesicle selectable medium until stationary phase and subsequently docking and fusion, protein transport, microautophagy, and diluted to OD = 0.05 in a 96-well plate. Growth of cells vacuolar inheritance, including spliceosome complex gene was measured at 600 nm at intervals of 2 h for 16 h using LEA1 (Zurita-Martinez et al. 2007). LEA1 (looks exceptionally synergy H1 multimode plate reader (BioTek). For cell viabil- like U2A’) is highly conserved across metazoans, is a specific ity, after completion of 16 h, cells were serially diluted 10-fold component of U2snRNP, and is crucial for efficient first step of and plated on YPD agar plates lacking caffeine. Cell viability splicing in vivo. It plays an essential role in spliceosome as- was demonstrated by measuring colony-forming units (CFU) sembly with U2 snRNA base pairing with both the pre-mRNA after 3 days of incubation at 30 °C. For spot test, cells were branch point sequence and U6 snRNA. Cells lacking LEA1 grown overnight in rich medium to OD = 1 and collected at harbored low levels of various mRNA and accumulated pre- equal density in log phase (∼ 0.2 OD) prior to spotting. mRNA to different levels (Caspary and Séraphin 1998; Subsequently, 5-fold serially diluted cells in liquid-rich medi- Dreumont and Séraphin 2013). The anticipated prevalence of um (YPD) were spotted in 5 μL drops on solid medium with unspliced RNAs in lea1Δ and its synthetic sick interaction with and without caffeine. Cells were allowed to form colonies at tor1Δ persuaded us to directly investigate impact of unspliced 30 °C for 2–3 days prior to image acquisition. RNA/RNA load on TOR signalling. We envisaged that accu- Sensitivity to oxidizing agent hydrogen peroxide (H O ) 2 2 mulation of pre-transcripts in lea1Δ cells may lead to intracel- and reducing agents DTT, GSH, and NAC was determined lular stress conditions that require active TOR signalling to by growing WT and lea1Δ cells for 16 h (H O ) and 48 h 2 2 Ann Microbiol (2019) 69:341–352 343 Table 1 Primersused in thisstudy S. no. Primer name Sequence Purpose 1. RPLEA1F AACTACAGGACTTGGAAAATATCAGTTTTT Used in construction of lea1 mutant ATAAGCAATAGCGGCATCAGAGCAGATTG 2. RPLEA1R TTTTTTTTTAAGTCATTGAACAGTCGCACT Used in construction of lea1 mutant AACCAAAAGACGTTTACAATTTCCTGATG CGG 3. LEA1FC TCGCATACTCTGCATCCAAC Used in check PCR of lea1 mutant 4. URA3RC CTGGCGGATAATGCCTTTAG Used in check PCR of lea1 mutant 5. ACT1F AGTTGCCCCAGAAGAACACC Used as reference gene in qRT-PCR analysis 6. ACT1R TACCGGCAGATTCCAAACCC Used as reference gene in qRT-PCR analysis 7. GAP1F AGGGTTTGCCAAGTGTTTGTC TORC1 marker gene expression 8. GAP1R AACGCAATAAGACCGAATGC TORC1 marker gene expression 9. CIT2F GCCAAAGAAGAGAGCTTCCA TORC1 marker gene expression 10. CIT2R GGCAAAGCGTATTCAGGGTA TORC1 marker gene expression 11. SOD2F GGTTCCAACTCAAGCGCAAG TORC1 marker gene expression 12. SOD2R ACCCGTTCAAACCTGATGCA TORC1 marker gene expression 13. RPS26AF GCCAAAGAAGAGAGCTTCCA TORC1 marker gene expression 14. RPS26AR CTGGCGTGAATAGCACAAGA TORC1 marker gene expression 15. CMK2F GTCTAAACGGCCACCCTGTA TORC2 marker gene expression 16. CMK2R CCTGCAATGCCTTCTTCAAT TORC2 marker gene expression 17. DIA1F TAAGAACGGCAGACGAACCT TORC2 marker gene expression 18. DIA1R TCCAAATCCCTGTGTCCTTC TORC2 marker gene expression 19. NCW2F GAGAGACGTCAAGCGGAATC TORC2 marker gene expression 21. NCW2R GATGAGGATCCCGAAGATGA TORC2 marker gene expression 22. MCA1F CTCCTCCACCTAACCAGCAG Check apoptosis in lea1 mutant 23. MCA1R GGGTGGACCGTACATATTGG Check apoptosis in lea1 mutant (DTT, GSH, and NAC) in SD medium at 30 °C. SD media PCR experiments were performed in triplicate. Graph pad was supplemented with 2.5 mM concentration of H O . prism 5.0 was used for further analysis of real-time data. 2 2 Microscopy Quantitative real-time PCR Vacuolar morphology Total RNA from strains was isolated using RNeasy mini kit as per manufacturer’s instructions (QIAGEN). Total RNA was FM4-64 (excitation/emission: 488/585–610 nm) dye was used quantified at A and A /A ratio with Nanodrop spectro- 260 280 230 to stain vacuolar membrane of Saccharomyces cerevisiae photometer (Thermo Scientific) and integrity of total RNA (Vida and Emr 1995). Overnight grown primary culture was was assessed by denaturing agarose gel. One-microgram diluted into fresh YPD medium and grown up to exponential RNAwas used to synthesize cDNA by quantitect reverse tran- phase (O.D =0.5–0.6). Harvested cells were suspended 600nm scriptase kit (QAIGEN) and RNase-free DNase was also used in 100 μL SD medium supplemented with FM4-64 (1.6 μM) to avoid any genomic DNA contamination. Quantitative real- and incubated at 30 °C for 20 min. Cultures were treated with time PCR (qRT-PCR) using a two-step SYBR green reverse caffeine and cells were removed and washed at interval of 0 h, transcriptase PCR kit (QAIGEN) with primers listed in the 1h, and2hwithfreshYPD andresuspendedin 25 μLof Table 1 was carried in Bio-Rad CFX96™ real-time PCR ma- YNB medium. Cells were placed on poly-L-lysine-coated chine (Bio-Rad Laboratories Inc., New Delhi, India). Melt slides and observed under inverted fluorescence microscope curve analysis was generated at the end of each PCR to verify (Nikon eclipse ×60 objective lens) using red filter. that a single DNA species was amplified. The following cy- cling parameters were used: denaturation at 95 °C for 5 min, followed by 40 amplification cycles denaturing at 95 °C for Actin morphology 10 s, annealing at 60 °C for 30 s. ACT1 was amplified as the reference gene to calculate fold change for genes of interest Actin morphology was visualized by using dye Alexa Fluor and to assure equal loading of the sample. All quantitative 488 phalloidin. Exponential phase (OD =0.5–0.6) cells 600nm 344 Ann Microbiol (2019) 69:341–352 were treated with caffeine (20 mM). WT and caffeine-treated Results cells were taken out after 0 h and 3 h. Cells were harvested, washed with 1X PBS, and fixed with 4% paraformaldehyde lea1Δ exhibits hypersensitivity towards caffeine for 60 min at 30 °C. After two washes of 1X PBS, cells were resuspended in 100 μL PBS. Glycine (0.1 M) and Triton-100 The mechanism of action of rapamycin and caffeine is signif- (0.1%) were used to lyse the cell wall. One microliter of Alexa icantly different. Inside the cell, rapamycin first complexes Fluor 488 phalloidin (excitation/emission: 495/518 nm) was with Fkbp12 to specifically bind to FRB domain of Tor kinase added and incubated for 60 min at room temperature in dark. and inhibit its activity (Heitman et al. 1991b). However, caf- After one wash of PBS, cells were visualized under Nikon feine directly hits the activity of Tor kinase (Reinke et al. 2004; confocal microscope with 100X. All images were analyzed Kuranda et al. 2006; Wanke et al. 2008). In addition to with NIS software 4.0 of microscopy. rapamycin-specific responses, it also affects a diverse array of cellular responses related to cell growth, DNA metabolism, and cell cycle progression, most likely by acting as low-affinity Nuclear morphology ATP analog (Reinke et al. 2004). Initially to elaborate on TOR signalling in cells lacking LEA1, lea1Δ strain was exposed to Nuclear morphology was envisaged by fluorescence mi- inhibitory concentrations of both rapamycin and caffeine. No croscopy following DAPI staining. Log phase cells were any sensitivity of this mutant was observed in rapamycin but a treated with caffeine (10 mM) for 0 h and 6 h respectively high sensitivity was observedinpresenceofcaffeinein and same log phase cells were treated with H O enriched media (YPD) (Fig. 1a). WT cells and lea1Δ cells 2 2 (2.5 mM)for 0 h and2hrespectively. The cells were exposed to caffeine were monitored for their growth in stainedfor 30minwith5 μg/mL DAPI (excitation/emis- 10 mM caffeine for 16 h in YPD and declined survival of sion (nm): 358/461). The cells were then washed with lea1Δ in caffeine was supported by observed 4-fold reduction PBS and stained nuclei were photographed under fluores- in CFU/mL in YPD (Fig. 1b). This sensitivity was also con- cence microscope with a 60X objective (Nikon Eclipse firmed by dilution spotting of log phase cells in plates supple- microscope). mented with 10 mM caffeine (Fig. 1c). Similar growth defect was also observed in synthetic dextrose media supplemented with caffeine (5 mM, 8 mM) and rapamycin (5 nM) (Fig. 1d). Propidium iodide staining Up to 8-fold reduction in growth of lea1Δ was observed after 16 h of exposure to 8 mM caffeine in defined media (Fig. 1e). Cell permeability and nuclear DNA staining by propidium Further decreased growth of lea1Δ cells was observed in iodide (PI) staining method were performed as previously poor nitrogen conditions. lea1Δ showed reduced growth in described (Ocampo and Barrientos 2011; Zhang et al. SLAD and YNB proline (SD-pro.) (Fig. 1f, g). Apparently, 2018). For PI staining, exponential phase cells were treat- lack of Lea1 sensitizes cells to caffeine and nitrogen starvation ed with caffeine (10 mM) for 4 h and fixed with 4% probably through rapamycin-resistant function of TOR kinase. paraformaldehyde for 30 min at 30 °C. After washing two times with PBS, the same log phase cells (500 μL) lea1Δ cells have altered TOR signalling in caffeine were resuspended in PBS. To analyze permeability and viability with PI, these exponential phase cells were incu- To investigate the involvement of TOR signalling in lea1Δ, bated with PI (Sigma-Aldrich) for 30 min at 30 °C in the we looked at the transcriptional outputs of TOR complexes dark. The fluorescence microscope (Nikon Eclipse) was TORC1 and TORC2 in lea1Δ cells treated with caffeine. The used to observe the cells with 60X objective (excitation TORC1 complex comprises of Tco89, Lst8, Kog1, and either 510–70 nm). Tor1 or Tor2 and is considered as rapamycin sensitive (Loewith et al. 2002; De Virgilio and Loewith 2006).The TORC2 complex comprises of Tor2, Avo1, Avo2, Avo3, Statistical analysis Bit61, and Lst8 and is largely considered as rapamycin insen- sitive (Jacinto et al. 2004; Wullschleger et al. 2006). In agree- Averages of data are presented with means ± SD from at ment with known inhibitory effects of caffeine on TOR sig- least three independent experiments. The p values were nalling, an induced expression of low-affinity amino acid calculated using Student’s t test, one-way ANOVA. All transporter gene GAP1,stress gene SOD2, and retrograde re- the mean values of the experiments were analyzed by the sponse gene CIT2 was observed in WT strain. Further a re- post-Tukey test. The significant difference was considered duced expression of ribosome biogenesis gene, RPS26A,sup- when probability *p between 0.05 and 0.01, **p ≤ 0.01, ported suppression of protein synthesis in cells treated with and ***p ≤ 0.0001. caffeine (Bonawitz et al. 2007). Intriguingly, lea1Δ itself Ann Microbiol (2019) 69:341–352 345 Fig. 1 lea1Δ cells are hypersensitive to caffeine. lea1Δ cells are Absorbance and e viability after 16 h of growth in synthetic dextrose sensitive towards caffeine but not to rapamycin in comparison with media in caffeine (5 mM and 8 mM) and rapamycin (5 nM). lea1Δ WT. a Growth analysis in YPD, YPD supplemented with caffeine exhibits reduced growth in low nitrogen sources. f Dilution spotting and (10 mM), and YPD supplemented with rapamycin (5 nM). b Viability g absorbance (after 16 h) of WT and lea1Δ in synthetic dextrose media of cells exposed to caffeine and rapamycin after 16 h. c Dilution spotting without uracil (SD-URA), synthetic low ammonium dextrose (SLAD) of lea1Δ and WT strain on YPD alone, YPD plates supplemented with media, and synthetic dextrose with proline (SD-pro) 10 mM caffeine, and YPD plates supplemented with 5 nM rapamycin. d showed activation of stress-induced TORC1-mediated func- influence TORC1-mediated functions, a highly induced ex- tions (Fig. 2a). While GAP1, SOD2,and CIT2 were approxi- pression of NCW2, DIA1,and CMK2 in comparison to WT mately induced by 2-fold, 2.15-fold, and 1.15-fold, expression suggested an affected TORC2 function in caffeine-treated of RPS26A was reduced by up to 3-fold in comparison to lea1Δ cells in our set of conditions (Fig. 2b). All marker genes caffeine-treated WT cells. Similar observations were made lack introns except RPS26A. Further validation of a highly with TORC2 marker genes. Though caffeine is known to perturbed TOR signalling as a consequence of removal of 346 Ann Microbiol (2019) 69:341–352 (P value ≤ 0.03) (P value ≤ 0.008) (P value ≤ 0.002) *** 0.06 * *** * *** 2.0 0.6 1.5 0.04 0.4 1.0 0.02 0.2 0.5 0.00 0.0 0 0.0 (P value ≤ 0.006) (P value ≤ 0.001) ** ** 0.8 2.0 ** ** 0.6 1.5 0.4 1.0 0.2 1 0.5 0.0 0.0 DIC FM4-64 DIC FM4-64 Merged Actin DIC Merged Actin DIC T(0h) T(0h) T(1h) T(4h) T(2h) WT lea1Δ WT lea1∆ *** *** WT lea1Δ WT lea1Δ 80 *** 0 0 012 04 Time(hours) Time(hours) Fig. 2 TOR signalling in lea1 Δ. Expression profile of TORC marker caffeine for 1 h. c Vacuolar morphology by staining with FM4-64 after 1 h genes. a Expression of TORC1 marker genes (GAP1, RPS26A, SOD2, and2hofgrowth inpresenceof caffeine(20 mM). d Actin morphology and CIT2). b Expression of TORC2 marker genes (CMK2, DIA1,and by Alexa Fluor 488 phalloidin after 4 h of growth in presence of caffeine NCW2) in WT control and lea1Δ cells untreated or treated with 20 mM (20 mM), in lea1Δ and WT strain LEA1 was conceded by analyzing vacuolar morphology and lea1Δ cells showed no any significant defect in endocytosis. actin polarization. For studying the vacuolar morphology, we At T0 h, both WT and lea1Δ had 1–3 prominent vacuoles as performed fluorescence microscopy of caffeine-treated and predominant phenotype. Further, no major difference in vac- caffeine-untreated cells with lipophytic dye FM4-64 which uolar morphology was observed in WT control cells after 120′ incorporates into plasma membrane and serves as an exposure to caffeine. However, in about 60% of caffeine- endocytic marker that localizes to vacuolar membrane (Vida treated lea1Δ cells, vacuoles appeared as single large spheres, and Emr 1995;Müller etal. 2007). Around 200 cells were as class D vps mutants of vesicle trafficking pathway (Fig. 2c). scored after 60′ and 120′ of caffeine treatment. WT and Vacuoles are storehouse of amino acids and large vacuoles WT (YPD) WT (CAFF) lea1 (YPD) lea1 (CAFF) WT (YPD) Wt(YPD) WT (CAFF) Wt(CAFF) lea1 (YPD) lea1 (YPD) lea1 (CAFF') lea1 (CAFF') WT(YPD) WT(CAFF) WT (YPD) lea1 (YPD) WT (CAFF) lea1 (CAFF) lea1 (YPD) lea1 (CAFF) WT (YPD) WT (CAFF) WT (YPD) lea 1 (YPD) lea1 (CAFF) WT (CAFF) lea1 (YPD) lea1 (CAFF) GAP1/ACT1 CIT2/ACT1 % of enlarged vacuoles RPS26A/ACT1 SOD2/ACT1 NCW2/ACT1 Actin depolarization (% of cells) CMK2/ACT1 DIA1/ACT1 Ann Microbiol (2019) 69:341–352 347 suggest lea1Δ are probably more nutrient deprived/stressed pathway and activates the Rho1p-Pkc1p signalling pathway compared to WT cells. Next studies were also performed to (Kuranda et al. 2006). This suggests that caffeine sensitivity examine the effect of caffeine on actin morphology of lea1Δ of lea1Δ is largely independent of PKC pathway. strain. In yeast, actin is organized into actin cables and cortical actin patches which are largely accumulated in bud tip to lea1Δ cells exhibit hypersensitivity to oxidizing agent ensure normal daughter cell formation (Martin and Arkowitz H O 2 2 2014). TORC2 is absolute required for maintenance of polar- ized cell growth in budding yeast (Gaubitz et al. 2015). lea1Δ lea1Δ cells are deficient in splicing, resulting in differential cells treated with caffeine upon staining showed altered actin levels of accrual of various RNAs. We randomly selected polarization. Actin was seen scattered on periphery or over seven genes with introns and analyzed levels of pretranscripts whole cell surface in about 80% of cells instead of being by amplifying with forward primers from intron and reverse clustered in bud region (Fig. 2d).Infactasobservedinprevi- primer from exon region (I/E). Three genes MUD1, VPS29, ous study, an altered chitin distribution was observed in and YSF3 showed substantial increase in levels of caffeine-treated lea1 mutant cells (results not shown). Taken pretranscripts in presence of caffeine in lea1Δ cells. This sug- together, these results revealed that exposure of lea1Δ cells to gests that caffeine accrue the intracellular stress in lea1Δ caffeine results in highly perturbed TOR signalling with im- through accumulation of unprocessed RNA (data not shown). pact on both TORC1- and TORC2-mediated functions. Cell exploits elaborate RNA surveillance mechanism to prevent accumulation of aberrant RNAs and ensure integral Caffeine sensitivity of lea1Δ is largely independent expression of protein-encoding genes, e.g., increased RNA of PKC pathway stability induces reactive oxygen species-dependent apoptosis (Mazzoni et al. 2003). On the basis of prior information and Mutants of PKC1 pathway also exhibit sensitivity towards our observation, that strains lacking LEA1 contains reduced caffeine as tor1Δ. However, unlike tor1Δ, the sensitivity of levels of U2SnRNA and they have impaired pre-mRNA splic- these mutants can be rescued by addition of excess sorbitol ing that results in accumulation of unprocessed RNA, we en- or adenine. In order to visualize the contribution of PKC path- visaged that the persistence of unspliced RNAs in lea1Δ cells way in caffeine sensitivity of lea1Δ, the growth of lea1Δ strain may sensitize these cells towards oxidizing agent. The in- was analyzed in caffeine supplemented with 1 M sorbitol and creased expression of SOD2 mentioned above actually sup- 20 mM adenine (Fig. 3). WT and rom2Δ mutant showed no ports the enhanced oxidative stress experienced by splicing- defect in 5 mM caffeine supplemented with 1 M sorbitol. deficient lea1Δ cells. H O is an established oxidative agent 2 2 Whereas rom2Δ, GDP/GTP exchange factor, PKC pathway and is known to increase ROS production at lower concentra- component exhibited improved survival in caffeine in presence tions (Kamada et al. 2005; Pereira et al. 2012). Thus, to inves- of sorbitol and adenine, no significant rescue was observed in tigate the consequences of loss of LEA1 on oxidative stress growth of lea1Δ and tor1Δ. These results of rom2Δ confirm the tolerance, cell growth was observed in presence of oxidative previous studies that Rom2p inhibits the Ras/cAMP signalling agent H O at 1.5 mM and 2.5 mM concentrations. In 2 2 Fig. 3 Effect of addition of sorbitol and adenine on caffeine sensitivity of lea1Δ. Serial dilutions of WT, lea1Δ, tor1Δ, and rom2Δ strains were spotted on YPD plates containing 2 mM, 5mM, and10 mM caffeine and supplemented with either 1 M sorbitol or 20 mM adenine. Growth was monitored after 2days at 30 °C 348 Ann Microbiol (2019) 69:341–352 comparison to WTcells, lea1Δ cells exhibited hypersensitivity This result showed that cell death in lea1Δ mutant is also con- to H O .Interestingly, tor1Δ exhibited insensitivity to H O tributed by loss of integrity of plasma membrane. 2 2 2 2 (Fig. 4a). Yeast nuclei exposed to ROS are known to become less compact and appear larger and more diffused. Similar diffused and punctate fragmented nuclei were observed in Discussion about 70% of lea1Δ cells compared to 50% in control WT population after 2 h of exposure to H O (Fig. 4b). Further, The levels of RNA are precisely regulated inside the cell, to 2 2 no significant nuclear disintegration was observed in tor1Δ safeguard the cell growth. Although role of TOR signalling in cells in presence or absence of caffeine. Probably inhibition cell growth that is regulation is well established, the associa- of TOR1-mediated signalling alone does not lead to oxidative tion of TOR signalling with accumulated unprocessed RNA is stress sensitizing cells to H O . Reduced cell growth resulting known largely through indirect evidences only. Moreover, no 2 2 from increased ROS generated by H O can well be prevented direct studies have been performed previously to illustrate role 2 2 by addition of anti-oxidant substances such as dithiothreitol of TOR signalling in growth of cells with defects in RNA (DTT). As anticipated, the addition of anti-oxidants rescued splicing. almost 100% of the cells (Fig. 4c). The mutant cells with In the present study, the altered TOR signalling by higher ROS get quenched by the addition of DTT, L- caffeine in lea1Δ clearly demonstrates that cells lacking glutathione-reduced (GSH), and N-acetyl cysteine (NAC) LEA1 can sense and respond to environmental conditions. which allowed their better survival (Sariki et al. 2016). The lea1Δ exhibits exacerbated expression of TORC1 Further substantiation to our hypothesis on role of oxidative marker genes (GAP1, SOD2,and CIT2). This implies role stress in lea1Δ growth defect came from combinatorial of additional stress generated by deletion of LEA1 to be growth studies of cells exposed to both H O and sub- responsible for their reduced survival in caffeine com- 2 2 inhibitory concentration of caffeine (Fig. 4d). pared to wild-type strain. The highly reduced expression of RPG transcripts explains slow growth (splicing defi- ciency) of lea1Δ strain compared to WT strain. SOD2 is Caffeine promotes oxidative stress-induced apoptosis known to have an antioxidant function by catalyzing the in lea1Δ disproportionation of superoxide anion to H O and is 2 2 essential for defense against oxygen radicals generated ROS are key regulators of yeast apoptosis (regulated cell at mitochondrial respiratory chain (Fukai and Ushio- death). Earlier studies have demonstrated the existence of func- Fukai 2011). Intriguingly, induced expression of SOD2 tional apoptotic machinery in unicellular organisms that re- gene provided us the initial evidence of the additional spond to oxidative stress. Caspase-like protease (Yca1/Mca1) oxidative stress faced by splicing deficient lea1Δ strain. mediates cell death triggered by oxygen stress, salt stress, or Noteworthy, recent studies have shown that the role of chronological aging (Madeo et al. 1997; Farrugia and Balzan TORC2 on regulation of actin polarization is mediated 2012). Mca1 is essentially required for apoptosis induced by through reactive oxygen species (ROS) produced from increased mRNA stability (Mazzoni et al. 2005). Quantitative mitochondrial and non-mitochondrial sources (Niles and RT-PCR of MCA1 in caffeine-treated and caffeine-untreated Powers 2014). The heightened TORC2 expression along WT and lea1Δ cells unveiled an induced and equivalent ex- with depolarized actin distribution indicates accumulation pression of MCA1 in caffeine-treated control and caffeine- of ROS in caffeine-treated lea1Δ cells.Thereby,expres- untreated lea1Δ cells which means that suppression of TOR sion of TORC1 and TORC2 marker genes guided our signalling by caffeine induces oxidative stress to the levels studies towards role of additional oxidative stress experi- induced in cells lacking LEA1. However, the expression of enced by lea1Δ. MCA1 in caffeine-treated lea1Δ cells was enhanced (Fig. 5a). Lack of LEA1 remarkably affects accumulation of pre- An extended support to expression results was obtained by mRNA. Stabilized RNAs generated in yeast mutants in microscopic examination of DAPI-stained DNA of lea1Δ mRNA decapping pathway such as lsm1, lsm4, dcp1, and cells. Highly fragmented enlarged diffused nuclei indicative dcp2 trigger apoptosis (Mazzoni et al. 2005; Mazzoni and of regulated cell death was observed in more than 50% of Falcone 2011;Rajuet al. 2015). However, the specific mech- caffeine-treated lea1Δ cells (Fig. 5b). Again, tor1Δ did not ex- anism coordinating RNA stability and apoptosis remains un- hibit any nuclear disintegration suggesting caffeine sensitivity known. Further, oxidizing agents, e.g., H O and acetic acid at 2 2 of tor1Δ does not result in apoptosis. In support of apoptosis in low doses, are also known to induce apoptosis (Liang et al. lea1Δ mutant, propidium iodide (PI) staining was also done and 2008). No direct link of TOR signalling, accumulated unpro- % of PI-positive cells was counted after 4-h incubation of caf- cessed RNA, and regulated cell death is known except that feine (10 mM). In lea1Δ mutant, 70% cells were PI positive as yeast protein expression profile generated during acetic acid- compared to WT where 42% cells were PI positive (Fig. 5c). induced apoptosis indicates casual involvement of TOR Ann Microbiol (2019) 69:341–352 349 (P value ≤ 0. 0001) 1.4 WT 1.2 lea1∆ 1 tor1∆ *** *** 0.8 0.6 0.4 0.2 SD-URA H O (1.5 mM) H O (2.5 mM) 2 2 2 2 DAPI (P value ≤ 0. 0004) DAPI WT lea1∆ tor1∆ T(0h) *** T(2h) Time(hours) WT tor1∆ lea1∆ c d (P value ≤ 0. 0001) (P value ≤ 0. 004) 0.7 2.5 WT lea1∆ WT lea1Δ 0.6 2 0.5 0.4 1.5 0.3 0.2 *** *** 0.1 0.5 Fig. 4 lea1Δ cells are hypersensitive to oxidative stress. a Growth curve DAPI-stained cells. c Effect of antioxidants 1 mM DTT, 10 mM L- of WT, lea1Δ,and tor1Δ in presence of SD-URA and H O at 1.5 mM glutathione reduced (GSH), and 30 mM N-acetyl cysteine (NAC) on 2 2 and 2.5 mM concentrations after 16 h. b DAPI staining of WT, lea1Δ,and growth of lea1Δ in comparison to WT control. d Simultaneous exposure tor1Δ mutant at 2 mM conc. of H O at 0 h and 2 h. Statistical analysis of to caffeine and H O reduces growth of lea1Δ 2 2 2 2 O.D.(600nm) O.D.(600nm) O.D.(600nm) %of cells with fragmented nuclei 350 Ann Microbiol (2019) 69:341–352 DAPI (P value ≤ 0.006) WT lea1∆ T(0h) *** T(4h) Time (hours) tor1∆ lea1∆ WT Propidium Iodide DIC DIC Propidium Iodide (P value ≤ 0.0001) T(0h) WT lea1∆ T(4h) Time (hours) lea1∆ WT Fig. 5 Caffeine induces apoptosis in lea1Δ cells. a Induced expression of with fragmented nuclei. c Propidium iodide (PI) staining in lea1Δ and yeast metacaspase MCA1. b Nuclear disintegration in WT, lea1Δ,and WT after 4-h incubation of caffeine. Statistical analysis of PI-positive tor1Δ after 0-h and 4-h incubation of caffeine. Statistical analysis of cells cells in both strains. CAFF caffeine, WT wild type pathway (Almeida et al. 2009). The hypersensitivity of lea1Δ conditions but also emphasizes on crucial role of TOR signal- to H O , the induced expression of MCA1, and nuclear frag- ling in appropriately responding to intracellular stress/s gen- 2 2 mentation of lea1 mutant provided sufficient evidence to con- erated by defective splicing. The high conservation of TOR clude that accumulated RNA leads to oxidative stress that signalling and RNA processing across eukaryotes strongly subsequently results in caspase-dependent cell death. suggests that mechanistic insights acquired here will be broad- The heightened sensitivity of lea1 mutant cells towards ly applicable and further investigation can be done to capitu- oxidizing agent upon inhibition of TOR signalling via caffeine late insights into link of TOR signalling with pre-mRNA shows that oxidative stress induced by accumulated RNA is processing. exacerbated in cells with compromised TOR signalling, which Acknowledgements Initial work contribution of Shubhi Sahni is highly ultimately results in reduced growth and survival through in- acknowledged. We are highly thankful to Dr. Maria E. Cardenas for duced apoptosis. Interestingly, this mechanism is specifically providing us Jk9-3d strain. induced by unprocessed RNA, as tor1Δ does not exhibit any nuclear fragmentation suggestive of apoptosis irrespective of Author contribution This study was designed by PK and RP. presence of caffeine. The positive PI staining in lea1Δ cells Experiments were performed by PK and analyzed along with VN, DK, AKM, and RP. PK and RP wrote the manuscript. PK completed all the upon caffeine treatment also shows that caffeine promotes cell figures. All the results and final version of manuscript were reviewed by death in lea1Δ mutant via destroying the integrity of plasma all the authors. membrane because in dead cells, PI can penetrate the plasma membranes. Our studies demonstrate that role of TOR in RNA Funding This work was supported by research grant to RP from SERB, processing/splicing may not be limited to direct function of Department of Science and Technology, Govt. of India (grant no. SR/FT/ LS-93/2010). Pavan is thankful to SERB for fellowship. various splicing factors under diverse environmental % of cells with fragmented nuclei % of PI positive cells Ann Microbiol (2019) 69:341–352 351 Gaubitz C, Oliveira T, Prouteau M et al (2015) Molecular basis of the Compliance with ethical standards rapamycin insensitivity of target of rapamycin complex 2. Mol Cell 58:977–988. https://doi.org/10.1016/j.molcel.2015.04.031 Conflict of interest The authors declare that they have no conflict of Gietz RD, Schiestl RH, Willems AR, Woods RA (1995) Studies on the interest. transformation of intact yeast cells by the LiAc/SS-DNA/PEG pro- cedure. Yeast 11:355–360. https://doi.org/10.1002/yea.320110408 Research involving human participants and/or animals (if He Y, Li D, Cook SL et al (2013) Mammalian target of rapamycin and applicable) N/A Rictor control neutrophil chemotaxis by regulating Rac/Cdc42 ac- tivity and the actin cytoskeleton. Mol Biol Cell 24:3369–3380. Informed consent Yes https://doi.org/10.1091/mbc.E13-07-0405 Heintz C, Doktor TK, Lanjuin A et al (2016) Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans. Publisher’sNote Springer Nature remains neutral with regard to jurisdic- tional claims in published maps and institutional affiliations. Nature 541:102–106. https://doi.org/10.1038/nature20789 Heitman J, Movva NR, Hall MN (1991a) Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 253:905–909 Heitman J, Movva NR, Hiestand PC, Hall MN (1991b) FK 506-binding protein proline rotamase is a target for the immunosuppressive agent References FK 506 in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 88: 1948–1952 Adami A, García-Alvarez B, Arias-Palomo E et al (2007) Structure of Inoki K, Ouyang H, Li Y, Guan K-L (2005) Signaling by target of TOR and its complex with KOG1. Mol Cell 27:509–516. https://doi. rapamycin proteins in cell growth control. Microbiol Mol Biol org/10.1016/j.molcel.2007.05.040 Rev 69:79–100. https://doi.org/10.1128/MMBR.69.1.79-100.2005 Albig AR, Decker CJ (2001) The target of rapamycin signaling pathway Jacinto E, Loewith R, Schmidt A et al (2004) Mammalian TOR complex regulates mRNA turnover in the yeast Saccharomyces cerevisiae. 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat MolBiolCell12:3428–34383 Cell Biol 6:1122–1128. https://doi.org/10.1038/ncb1183 Almeida B, Ohlmeier S, Almeida AJ et al (2009) Yeast protein expression Kamada Y, Fujioka Y, Suzuki NN et al (2005) Tor2 directly phosphory- profile during acetic acid-induced apoptosis indicates causal in- lates the AGC kinase Ypk2 to regulate actin polarization. Mol Cell volvement of the TOR pathway. Proteomics 9:720–732. https:// Biol 25:7239–7248. https://doi.org/10.1128/MCB.25.16.7239- doi.org/10.1002/pmic.200700816 7248.2005 Beck T, Schmidt A, Hall MN (1999) Starvation induces vacuolar Kingsbury JM, Cardenas ME (2016) Vesicular trafficking systems impact targeting and degradation of the tryptophan permease in yeast. J TORC1-controlled transcriptional programs in Saccharomyces Cell Biol 146:1227–1238 cerevisiae. G3(Bethesda) 6:641–652. https://doi.org/10.1534/g3. Bergkessel M, Whitworth GB, Guthrie C (2011) Diverse environmental 115.023911 stresses elicit distinct responses at the level of pre-mRNA processing Kuranda K, Leberre V, Sokol S et al (2006) Investigating the caffeine in yeast. RNA 17:1461–1478. https://doi.org/10.1261/rna.2754011 effects in the yeast Saccharomyces cerevisiae brings new insights Bonawitz ND, Chatenay-Lapointe M, Pan Y, Shadel GS (2007) Reduced into the connection between TOR, PKC and Ras/cAMP signalling TOR signaling extends chronological life span via increased respi- pathways. Mol Microbiol 61:1147–1166. https://doi.org/10.1111/j. ration and upregulation of mitochondrial gene expression. Cell 1365-2958.2006.05300.x Metab 5:265–277. https://doi.org/10.1016/j.cmet.2007.02.009 Lempiäinen H, Uotila A, Urban J et al (2009) Sfp1 interaction with Cardenas ME, Cutler NS, Lorenz MC et al (1999) The TOR signaling TORC1 and Mrs6 reveals feedback regulation on TOR signaling. cascade regulates gene expression in response to nutrients. Genes Mol Cell 33:704–716. https://doi.org/10.1016/j.molcel.2009.01.034 Dev 13:3271–3279. https://doi.org/10.1101/gad.13.24.3271 Liang Q, Li W, Zhou B (2008) Caspase-independent apoptosis in yeast. Caspary F, Séraphin B (1998) The yeast U2A’/U2B complex is required Biochim Biophys Acta Mol Cell Res 1783:1311–1319. https://doi. for pre-spliceosome formation. EMBO J 17:6348–6358. https://doi. org/10.1016/j.bbamcr.2008.02.018 org/10.1093/emboj/17.21.6348 Loewith R, Hall MN (2011) Target of rapamycin (TOR) in nutrient sig- Crespo JL, Powers T, Fowler B, Hall MN (2002) The TOR-controlled naling and growth control. Genetics 189:1177–1201. https://doi.org/ transcription activators GLN3, RTG1, and RTG3 are regulated in 10.1534/genetics.111.133363 response to intracellular levels of glutamine. Proc Natl Acad Sci U S Loewith R, Jacinto E, Wullschleger S et al (2002) Two TOR complexes, A 99:6784–6789. https://doi.org/10.1073/pnas.102687599 only one of which is rapamycin sensitive, have distinct roles in cell De Virgilio C, Loewith R (2006) The TOR signalling network from yeast growth control. Mol Cell. https://doi.org/10.1016/S1097-2765(02) to man. Int J Biochem Cell Biol 38:1476–1481. https://doi.org/10. 00636-6 1016/j.biocel.2006.02.013 Madeo F, Fröhlich E, Fröhlich KU (1997) A yeast mutant showing diag- Dreumont N, Séraphin B (2013) Rapid screening of yeast mutants with nostic markers of early and late apoptosis. J Cell Biol 139:729–734. reporters identifies new splicing phenotypes. FEBS J 280:2712– https://doi.org/10.1083/jcb.139.3.729 2726. https://doi.org/10.1111/febs.12277 Martin SG, Arkowitz RA (2014) Cell polarization in budding and fission Fadri M, Daquinag A, Wang S et al (2005) The pleckstrin homology yeasts. FEMS Microbiol Rev 38:228–253. https://doi.org/10.1111/ domain proteins Slm1 and Slm2 are required for actin cytoskeleton 1574-6976.12055 organization in yeast and bind phosphatidylinositol-4,5- Mazzoni C, Falcone C (2011) mRNA stability and control of cell prolif- bisphosphate and TORC2. Mol Biol Cell 16:1883–1900. https:// eration: figure 1. Biochem Soc Trans 39:1461–1465. https://doi.org/ doi.org/10.1091/mbc.E04-07-0564 10.1042/BST0391461 Farrugia G, Balzan R (2012) Oxidative stress and programmed cell death Mazzoni C, Herker E, Palermo V et al (2005) Yeast caspase 1 links in yeast. Front Oncol 2:64. https://doi.org/10.3389/fonc.2012.00064 messenger RNA stability to apoptosis in yeast. EMBO Rep 6: 1076–1081. https://doi.org/10.1038/sj.embor.7400514 Fukai T, Ushio-Fukai M (2011) Superoxide dismutases: role in redox signaling, vascular function, and diseases. Antioxid Redox Signal Mazzoni C, Mancini P, Verdone L et al (2003) A truncated form of 15:1583–1606. https://doi.org/10.1089/ars.2011.3999 KlLsm4p and the absence of factors involved in mRNA decapping 352 Ann Microbiol (2019) 69:341–352 trigger apoptosis in yeast. Mol Biol Cell 14:721–729. https://doi.org/ with Ssd1p to maintain cellular integrity in Saccharomyces cerevisiae. J Biol Chem 279:14752–14762. https://doi.org/10. 10.1091/mbc.E02-05-0258 Morita M, Gravel S-P, Hulea L et al (2015) mTOR coordinates protein 1074/jbc.M313062200 synthesis, mitochondrial activity and proliferation. Cell Cycle 14: Sariki SK, Sahu PK, Golla U et al (2016) Sen1, the homolog of human 473–480. https://doi.org/10.4161/15384101.2014.991572 Senataxin, is critical for cell survival through regulation of redox Müller J, Mettbach U, Menzel D, Samaj J (2007) Molecular dissection of homeostasis, mitochondrial function, and the TOR pathway in endosomal compartments in plants. Plant Physiol 145:293–304. Saccharomyces cerevisiae. FEBS J 283:4056–4083. https://doi. https://doi.org/10.1104/pp.107.102863 org/10.1111/febs.13917 Munchel SE, Shultzaberger RK, Takizawa N, Weis K (2011) Dynamic Siebel CW, Feng L, Guthrie C, Fu XD (1999) Conservation in budding profiling of mRNA turnover reveals gene-specific and system-wide yeast of a kinase specific for SR splicing factors. Proc Natl Acad Sci regulation of mRNA decay. Mol Biol Cell 22:2787–2795. https:// USA96:5440–5445 doi.org/10.1091/mbc.E11-01-0028 Stanfel MN, Shamieh LS, Kaeberlein M, Kennedy BK (2009) The TOR Niles BJ, Powers T (2014) TOR complex 2-Ypk1 signaling regulates pathway comes of age. Biochim Biophys Acta Gen Subj 1790: actin polarization via reactive oxygen species. Mol Biol Cell 25: 1067–1074. https://doi.org/10.1016/j.bbagen.2009.06.007 3962–3972. https://doi.org/10.1091/mbc.E14-06-1122 Urban J, Soulard A, Huber A et al (2007) Sch9 is a major target of Ocampo A, Barrientos A (2011) Quick and reliable assessment of chro- TORC1 in Saccharomyces cerevisiae. Mol Cell 26:663–674. nological life span in yeast cell populations by flow cytometry. https://doi.org/10.1016/j.molcel.2007.04.020 Mech Ageing Dev 132:315–323. https://doi.org/10.1016/j.mad. Vida TA, Emr SD (1995) A new vital stain for visualizing vacuolar 2011.06.007 membrane dynamics and endocytosis in yeast. J Cell Biol 128: Pereira C, Bessa C, Saraiva L (2012) Endocytosis inhibition during H O 779–792 -induced apoptosis in yeast. FEMS Yeast Res 12:755–760. https:// Wanke V, Cameroni E, Uotila A et al (2008) Caffeine extends yeast doi.org/10.1111/j.1567-1364.2012.00825.x lifespan by targeting TORC1. Mol Microbiol 69:277–285. https:// Powers T, Walter P (1999) Regulation of ribosome biogenesis by the doi.org/10.1111/j.1365-2958.2008.06292.x rapamycin-sensitive TOR-signaling pathway in Saccharomyces Wullschleger S, Loewith R, Hall MN (2006) TOR signaling in growth cerevisiae. Mol Biol Cell 10:987–1000 and metabolism. Cell 124:471–484. https://doi.org/10.1016/j.cell. Puria R, Zurita-Martinez SA, Cardenas ME (2008) Nuclear translocation 2006.01.016 of Gln3 in response to nutrient signals requires Golgi-to-endosome Zhang N, Fan Y, Li C et al (2018) Cell permeability and nuclear DNA trafficking in Saccharomyces cerevisiae. Proc Natl Acad Sci 105: staining by propidium iodide in basidiomycetous yeasts. Appl 7194–7199. https://doi.org/10.1073/pnas.0801087105 Microbiol Biotechnol 102:4183–4191. https://doi.org/10.1007/ Raju KK, Natarajan S, Kumar NS et al (2015) Role of cytoplasmic s00253-018-8906-8 deadenylation and mRNA decay factors in yeast apoptosis. FEMS Zurita-Martinez SA, Puria R, Pan X et al (2007) Efficient Tor signaling Yeast Res 15. https://doi.org/10.1093/femsyr/fou006 requires a functional class C Vps protein complex in Saccharomyces Reinke A, Anderson S, McCaffery JM et al (2004) TOR complex 1 cerevisiae. Genetics 176:2139–2150. https://doi.org/10.1534/ includes a novel component, Tco89p (YPL180w), and cooperates genetics.107.072835

Journal

Annals of Microbiology – Springer Journals

Published: Jan 5, 2019

There are no references for this article.