Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

In silico characterization of a novel dehalogenase (DehHX) from the halophile Pseudomonas halophila HX isolated from Tuz Gölü Lake, Turkey: insights into a hypersaline-adapted dehalogenase

In silico characterization of a novel dehalogenase (DehHX) from the halophile Pseudomonas... Ann Microbiol (2017) 67:371–382 DOI 10.1007/s13213-017-1266-2 ORIGINAL ARTICLE In silico characterization of a novel dehalogenase (DehHX) from the halophile Pseudomonas halophila HX isolated from Tuz Gölü Lake, Turkey: insights into a hypersaline-adapted dehalogenase 1 2 3 1 Mohamed Faraj Edbeib & Roswanira Abdul Wahab & Yilmaz Kaya & Fahrul Huyop Received: 6 October 2016 /Accepted: 7 April 2017 /Published online: 2 May 2017 Springer-Verlag Berlin Heidelberg and the University of Milan 2017 Abstract Halogenated compounds represent potential long- presence of acidic residues, which accounts for the uncom- term threats to human well-being and health and, therefore, monly low pI seen in DehHX and explains the mechanism of the quest for microorganisms capable of degrading these haz- adaptation that contributes to the exceptional halotolerance of ardous substances merits urgent consideration. We have iso- the enzyme. The excess surface acidic residues were beneficial lated a novel dehalogenase-producing bacterium from the hy- in enhancing the water-binding capacity, a crucial feature for persaline environment of Tuz Gölü Lake, Turkey and subse- preserving the stability and solubility of DehHX in highly sa- quently identified this isolate as Pseudomonas halophila HX. line conditions. In summary, we suggest that bio-prospecting Under optimal culture conditions (pH 8.0, 15% NaCl, 30 °C, for halogenated compound-degrading microorganisms in high- 200 rpm, 96 h culture time), the strain almost completely de- ly saline environments is a practical and safe strategy for the graded (99.3%) 2,2-dichloropropionic acid (20 mM). The bioremediation of contaminated coastal areas. dehalogenase gene (dehHX) of the bacterium was amplified . . by PCR, and the deduced amino acid sequence of the Keywords Biodegradation 2,2-Dichloropropionic acid DehHX was found to belong to a Group I dehalogenase and Pseudomonas halophila Halostable dehalogenase to share an 82% sequence identity to the dehalogenase DehI of Pseudomonas putida strain PP3. Interestingly, the pI of DehHX was more acidic (pI 3.89) than those of the non- Introduction halophilic dehalogenases (average measured pI 5.95). Homology-based structural modeling revealed that the surface Halogenated compounds liberated by natural and/or industrial of DehHX was unusually negatively charged due to the higher processes generally contain high concentrations of four ha- − − − lides, i.e., fluoride (F ), chloride (Cl ), bromide (Br ), and iodide (I ), all of which are well-known environmental pollut- Electronic supplementary material The online version of this article (doi:10.1007/s13213-017-1266-2) contains supplementary material, ants (Slater et al. 1995). While there are more than 5000 types which is available to authorized users. of naturally occurring halogenated hydrocarbons (Gribble 2009), the ever increasing number of manufacturing activities * Roswanira Abdul Wahab and cases of illegal dumping of halogenated compounds into roswanira@kimia.fs.utm.my water bodies (Oren et al. 1992) further increase their presence * Fahrul Huyop in the environment. An estimated 5% of the highly halogenat- fahrul@utm.my ed industrial effluents released into the environment enter sa- line or hypersaline water systems (Lefebvre et al. 2012), with Department of Biotechnology and Medical Engineering, Faculty of 2,2-dichloropropionic acid (2,2-DCP) (also known as Biosciences and Medical Engineering, Universiti Teknologi Malaysia (UTM), 81310 Johor Bahru, Malaysia Dalapon), a highly toxic and recalcitrant biocide, being one of the commonly found contaminants (Häggblom et al. 2000; Department of Chemistry, Faculty of Science, Universiti Teknologi Malaysia (UTM), 81310 Johor Bahru, Malaysia Van Pée and Unversucht 2003). Most worrying is the persis- tence of 2,2-DCP in the environment, suggesting that this Agricultural Biotechnology Department, Faculty of Agriculture, Ondokuz Mayis University, Samsun, Turkey compound has the potential to pose long-term risks to both 372 Ann Microbiol (2017) 67:371–382 environmental and human health (Birnbaum and Fenton and the availability of electron acceptors, such as oxygen 2003; Hayes et al. 2006;Qing Li et al. 2006). 2,2-DCP that (Tang et al. 2006; Uribe-Jongbloed and Bishop 2007; originates from man-made effluents has been discovered in Haritash and Kaushik 2009; Ortega-Calvo and Gschwend food sources, especially those caught in marine environments, 2010). Likewise, the distribution and abundance of a given such as fishes and prawns that constitute a substantial propor- type of extreme environment can also influence biota spe- tion of the human diet (Duarte et al. 2009). An added factor to cialization and microbial evolution (Ve Habitatlar 2002). consider is that the natural bioaccumulation process further Since little is known about dehalogenase-producing halo- concentrates such pollutants in marine food sources, making philes and given their innate stability in highly saline envi- the situation even worse (Besseling et al. 2013;Chua etal. ronments, the characterization of their bioremediation ca- 2014). Concerted efforts that focus on microbial prospecting pacities and a better understanding of the mechanism(s) in search of dehalogenase-producing bacteria to Bclean up^ employed in this process are essential. Although several halogen-polluted water bodies (Wang et al. 2011) and marine other microbial dehalogenation mechanisms have been environments are therefore urgently needed. identified, including thiolytic, oxidative, and reductive The aim of this study was to bio-prospect in hypersaline mechanisms, hydrolytic dehalogenation is the most com- habitats harboring unique and ancient halophilic microbes mon mechanism described (Kurihara and Esaki 2008; capable of surviving or thriving in halogen-contaminated Fetzner 2010). To date, isolation studies focusing on marine or hypersaline environments. Halophiles are salt- enzyme-producing bacteria from the hypersaline Tuz loving microorganisms that thrive under extreme salt con- Gölü Lake (Turkey) have focused on microbes producing ditions (up to 35% NaCl) (Castillo-Carvajal et al. 2014). enzymes such as amylases, cellulases, caseinases, Such exceptional microorganisms have been found in sev- gelatinases, lipases, catalases, and oxidases (Birbir et al. eral locations throughout the world, such as the Dead Sea, 2007), with the exception of dehalogenases. Several strains Israel (Wei et al. 2015), Lake Urmia, Iran (Mehrshad et al. of Pseudomonas sp. capable of degrading hydrocarbons 2015), the solar salterns, Tunisia (Baati et al. 2010), the and halogenated compounds (Chandra et al. 2013)have Tuzkoy salt mine, Turkey (Birbir et al. 2004), the hypersa- been successfully isolated, but none were found to be line environments in southern Spain (Sanchez-Porro et al. halotolerant. To the best of our knowledge, this is the first 2003), the Dagong Brine Well, China (Xiang et al. 2008), report detailing a dehalogenase-producing halotolerant and the Great Salt Lake, USA. In terms of salt tolerance, bacterium from Tuz Gölü Lake. We describe an aerobic these microorganisms can be categorized into five major and halotolerant 2,2-DCP-degrading bacterium identified classes based on the concentration of NaCl required for their as Pseudomonas halophila that produces a dehalogenase growth: (1) non-halophiles, < 0.2 M (approx. 1%) NaCl; (2) called DehHX. For this dehalogenase to competently func- tion under highly saline conditions, we anticipated that spe- mild halophiles, 0.2–0.5 M (approx. 1–3%)NaCl; (3)mod- erate halophiles, 0.5–2.5 M (approx. 3–15%) NaCl; (4) bor- cial adaptive features would be present in the protein of the derline extreme halophiles, 1.5–4.0 M (approx. 9–23%) halophilic bacterium. Hence, in addition to isolating a NaCl; (5) extreme halophiles, 2.5–5.2 M (approx. 15– halotolerant bacterium we investigated the haloadaptative 32%) NaCl (Kushner and Kamekura 1988). Several species mechanism within the protein of the P. halophila that gives of dehalogenase-producing bacteria have been isolated DehHX its halotolerant property. from a variety of halogen-contaminated marine environ- ments (Chiba et al. 2009;Novaketal. 2014; Zhang et al. 2014;Mengetal. 2015). Aquatic environments are among Materials and methods the most important long-term reservoirs of highly haloge- nated organic pollutants (Zanaroli et al. 2015;Matturroet al. Samples and reagents 2016). Consequently, such sites are also excellent environ- ments for isolating halogen-degrading microorganisms, Water samples were collected aseptically from the shallow suggesting that the application of these well-adapted micro- shores (average depth 0.2 m) of the halogen-contaminated organisms for cleaning up halogen-contaminated marine or hypersaline lake Tuz Gölü, near the Van area in Turkey (39° hypersaline environments (Oren 2010) may prove possible. 2′ 50″ N; 33° 26′ 1″ E). The 2,2-DCP was obtained from According to literature, the rate and extent of microbial- Sigma-Aldrich (St. Louis, MO), and solutions of 2,2-DCP assisted degradation of pollutants are profoundly influenced were filter sterilized through a 0.2-μm nylon membrane disc by several geochemical and physical parameters, including (Hybond N; Amersham, Little Chalfont, UK) before use. temperature (Mohn and Stewart 2000; Eriksson et al. 2001; All types of media used in this study were prepared using Haritash and Kaushik 2009), salinity (Kästner et al. 1998; distilled water. Organic solvents and other chemical re- Díaz et al. 2002; Badejo et al. 2013), nutrients (Dibble and agents were procured from Sigma-Aldrich and were of an- Bartha 1979;Chenet al. 2008; Tejeda-Agredano et al. 2010), alytical purity. Ann Microbiol (2017) 67:371–382 373 Media preparation Biochemical characterization The experiment involved the preparation of two different Assessments of the physiological and biochemical properties stock solutions. The first stock solution contained basal of the bacterial strain, namely, Gram staining, motility test, −1 salts, such as NaH PO ·2H O (10.0 g l ), K HPO · carbohydrate fermentation, and gelatine hydrolysis (Kloos 2 4 2 2 4 −1 −1 3H O (42.5 g l ), and (NH ) SO (25.0 g l ), and the et al. 1974), were done according to the Bergey’sManual of 2 4 2 4 second stock solution contained trace metal salts, such as Determinative for Bacteriology (Garrity et al. 2012). After an − 1 − 1 MgSO (2.0 g l ), FeSO ·7H O (120.0 g l ), overnight incubation in a halophilic broth, oxidase and cata- 4 4 2 −1 −1 MnSO ·4H O (30.0 g l ), ZnSO ·H O(30gl ), lase activities were determined by an oxidation reaction car- 4 2 4 2 −1 CoCl ·6H O(10 gl ), and nitrilotriacetic acid (1.0 g ried out using 1% (w/v) tetramethylenediamine (Faller and 2 2 −1 l ), dissolved in distilled water (Hareland et al. 1975). Schleifer 1981) prepared in a 2.5% (w/v) hydrogen peroxide The growth medium consisted of 2,2-DCP (20 mM) and solution, and the formation of gas and bubbles, respectively, was autoclaved (121 °C, 15 psi, 15 min) before the addi- was evaluated (Colwell and Grigorova 1987). Other biochem- tion of various concentrations of filter-sterilized solutions ical tests also included methyl red, indole production, the −1 of NaCl (0, 150, 250, and 300 g·l ). The high salt con- Voges–Proskauer reaction, urease production, citrate utiliza- centration in the liquid growth medium was to ensure the tion, and nitrate reduction (Colwell and Grigorova 1987). selective growth of only halotolerant strains capable of utilizing 2,2-DCP as the sole source of carbon and energy. PCR amplification of 16S rDNA The pH of the growth medium was adjusted to pH 8 ± 0.2, and incubation was at 30 °C with shaking at 200 rpm for 5 Genomic DNA extraction was carried out using the Wizard days. Genomic DNA Extraction kit reagent (Promega, Madison, A pure colony of the halophilic microorganism was isolat- WI) as per the manufacturer’s protocol. Upon purification, ed using a minimal medium [1.5% (w/v) Oxoid bacteriologi- the DNA concentration was ascertained and the DNA stored cal agar No. 1 (Oxoid Ltd., Basingstoke, UK, as the solidify- at −20 °C until further use. PCR amplification of the 16S ing agent)]. The medium was sterilized [121 °C, 15 psi, rDNA was carried out in a mixture (50 μl) that contained 15 min] prior to addition of a filter-sterilized solution of 2,2- 0.1 μl of 27F primer (25 μM), 1 μl of 1492R primer DCP (20 mM). A single colony growing on the minimal me- (25 μM), 1 μl dNTPs (10 mM total), 4.0 μlMgCl dium was selected and subcultured onto fresh plates contain- (25 mM), 5.0 μl of 10× PCR buffer, 0.5 μl Taq polymerase ing 2,2-DCP (20 mM) as the only carbon source and subse- (Stratagene Ltd., Cambridge, UK), and 0.5 μl of DNA tem- quently incubated for 5 days at 30 °C. plate (104 ng). The PCR reactions were performed in an Eppendorf Master Cycler Nexus Gradient thermal cycler (Hamburg, Germany) using the following cycling program: Field emission scanning electron microscopy an initial denaturation of 1 min at 94 °C, followed by 30 cycles of denaturation (95 °C, 30 s), annealing (55 °C, 40 s), and The morphological characteristics of a single bacterial cul- extension (72 °C, 1 min), with a final extension of 10 min at ture were assessed using field emission scanning electron 72 °C. The bacterial 16S rDNA universal primers 27F (5′- microscopy. The bacterial cells were incubated for 24 h in a AGAGATTGATCCTGGCTCTG-3′) and 1492R, (5′-GGTT halophilic broth prepared according to Dundas (1977). The TCCTTGTTACGACAT-3′) were synthesized by First Base bacterial culture was harvested by centrifugation (5000 g for laboratories Co., Ltd (Selangor, Malaysia). The PCR products 15 min) and washed twice using distilled water. The sample were purified and sequenced by First Base Laboratory Co., was fixed in 2.5% (w/v) glutaraldehyde for 1 h and then Ltd., and the taxonomic analysis was conducted using the washed once with distilled water prior to the final fixing GenBank BLAST program in the NCBI database (Altschul treatment in 1–4% (w/v) osmium tetroxide for 1 h. The et al. 1997). The software MEGA version 6 was used for sample was dehydrated by immersion (10 min) in a series aligning and evaluating the similarity between the 16S of ethanol/water solutions with increasing percentages of rDNA sequences, and the resultant tree topology was evalu- ethanol (25, 50, 75, 95, and 100% v/v) (Moran and Coats ated by bootstrap analysis of the neighbor-joining method 2012). The sample was placed onto an aluminum foil disc (Tamura et al. 2013). and dried in a Leica EM CPD300 critical point dryer (Leica Microsystems GmbH, Wetzlar, Germany) prior to coating Determining optimum growth conditions with platinum and examination under a Hitachi SU5020 FES electron microscope (magnification 11000 ×; acceler- The culture conditions (i.e., 2,2-DCP concentration, pH, tem- ating voltage 2000 V) with an SE(L) detector set at a work- perature, agitation rate, medium salinity) that may affect bac- ing distance of 16.2 mm. terial growth rate were evaluated using minimal media. For 374 Ann Microbiol (2017) 67:371–382 assessing the effect of concentration and pH, we prepared Material 1 for the strategy scheme of amplifying the full solutions containing different concentrations of 2,2-DCP sequence of dehHX). PCR amplification was carried out in a (20, 30, 40 mM) and solutions at different pH (6.0, 7.0, 8.0, thermal cycler (Eppendorf Master Cycler Nexus Gradient; 9.0, 10.0). The pH of each solution was adjusted using HCl Eppendorf)) using the following PCR conditions: an initial (1 M) or NaOH (1 M). The effect of temperature was assessed denaturation for 5 min at 94 °C, followed by 30 cycles of at 10, 20, 30, 45, and 40 °C, respectively. The effect of shaking denaturation (94 °C, 30 s), primer annealing (58 °C, 40 s), rate was assessed at agitation speeds ranging from 150 to and extension (72 °C, 1 min), with a final extension for 250 rpm, with intervals of 25 rpm. The effect of medium 5 min at 72 °C. First Base Laboratories sequenced the PCR salinity was evaluated in growth media containing varying product. −1 concentrations of NaCl (0, 150, 250, and 300 g l . Bacterial growth was monitored by measuring the turbidity of the Amino acid composition and analysis growth culture using a Pye-Unicam SP1750 series spectro- photometer (Pye Unicam, Cambridge, UK). Experiments to The frequency of occurrence of each amino acid residue in determine the optimal 2,2-DCP concentration, pH, tempera- DehHX and other non-halophilic members of the Group I ture, agitation rate, and salinity were based on the bacterial dehalogenases was calculated using MEGA 6 (Tamura et al. growth rate measured over a 5-day incubation period. 2013). Outputs were exported into an Excel spreadsheet to calculate the average number of each amino acid, and the 2,2-DCP depletion monitored by high-performance liquid results were plotted onto an Excel worksheet. The overall chromatography average of hydropathicity value for each protein was calculat- ed using ProtParam (Gasteiger et al. 2005). Bacterial cells cultured under the ascertained optimal condi- tions were harvested at 24-h intervals and centrifuged (2000 g Structural analysis of DehHX for 10 min) to remove the insoluble particles. The supernatants were collected and subsequently filtered through a 0.2-μm The DehHX structure was built using SWISS-MODEL soft- membrane (Toyo Roshi Ltd., Tokyo, Japan). The high- ware (Biasini et al. 2014) with DehI as the template. The initial performance liquid chromatography (HPLC) system (Waters DehHX structure was subjected to structural evaluation using Alliance 2690 HPLC Separations Module; Agilent the software packages VERIFY-3D (Liithy et al. 1992), PRO- Technologies, Santa Clara, CA) had two components—acap- CHECK (Laskowski et al. 1993), and ERRAT (Colovos and illary Hi-Plex H column (300 × 7.7 mm, 5 μm) and a photo- Yeates 1993), respectively. The model was subjected to mo- diode array detector. The mobile phase was 0.005 M H SO . lecular dynamics refinement using the parallel version of 2 4 A negative control sample lacking the bacterial inoculation GROMACS 4.5.1 and the Gromos96 53a6 force field, run was run in parallel in each assay. Each 20-μl sample was run on an Ubuntu computer having a 1.6-GHz processor and a through the column at a flow rate of 0.6 ml/min and a temper- quad-core processor (Van Der Spoel et al. 2005). The system ature of 30 °C. A calibration curve was prepared using a series volume, temperature (30 K), and number of particles for the of varying concentrations of 2,2-DCP solutions. ensemble were held constant. The relative electrostatic surface potential of the model was calculated by APBS (Lerner and PCR amplification of the halostable dehalogenase gene Carlson 2006) in PyMOL (DeLano 2002). (dehHX) Amplification of the partial sequence of dehHX was done Results using the dehI-F (5′-ACGCTGCGGGTGCCATGGGT-3′) and dehI-r (5′-TACTTTGGATTGCCATAGTT-3′) primers. Characterization of a new bacterium capable of using The amplified fragment was later sequenced and aligned using 2.2-DCP as the sole carbon source MultAlin software (Corpet 1988). Alignment with several other sequences of known Group I dehalogenases maintained By incubating a water sample from the hypersaline lake Tuz by GenBank revealed that the partial sequence of dehHX was Gölü in minimal medium containing NaCl (25%, w/v) and highly similar to that of dehI (accession no. AY138113). 20 mM 2,2-DCP, we were able to isolate a new halotolerant Based on the terminal regions of the dehI sequence, primers bacterium that could use 2,2-DCP as the sole carbon source. dehHX-F (5′-ATGACCAACCCGTATTTTCC-3′)and After incubating the newly isolated bacterium at 30 °C for 5 dehHX-R (5′-AATCGGTCACTGGCTATCG-3′) were de- days on agar containing 2,2-DCP, we isolated pure colonies signed using the software Primer 3 (v. 0.4.0) (Untergasser (red in color and approx. 2–4 mm in diameter). Interestingly, et al. 2012) and the primers then synthesized at First BASE no colonies were observed in the medium which did not contain Laboratories (Fig. 1; see also Electronic Supplementary 2,2-DCP. The isolates were Gram-negative, rod-shaped Ann Microbiol (2017) 67:371–382 375 1 ATGACCAACCCGTATTTTCCGCAGGCGAGCCAGCTGGATGTGGAAACCGAAAGCACCTAT Fig. 1 Amplification strategy to >>>dehHX-F>>> obtain the full sequence of the dehalogenase gene of 61 GAAGATGTGGAACTGACCGCGCGCGTGCCGTGGGTGGCGTTTGGCTGCCGCGTGCTGGCG Pseudomonas halophila HX (dehHX). The complete dehI sequence was obtained from the 121 ACCTTTCCGGGCTATGCGCCGCTGTGGGAACGCTGCGGGTGCCATGGGTTACCGAATAT NCBI database (accession no. >>>dehI-F>>> AJ133460.1). The dehHX coding region is shown in bold, and the 181 GCGGAACAGGCGGCGGATGAACTGCGCGAAGAAAGCGTGGTGAACGTGGGCCCGCTGCCG start and stop codons are shaded. Primers used to amplify the 241 AACGCGGATGAAGAACTGTGGCATGCGTTTTTTGATGATGGCGAAGTGGAAGATGTGGAA fragment and the complete dehHX sequence are underlined and labeled 301 GAAGTGACCTATGCGTTTAACTATGGCAATCCAAAGTAGATGAAACCATTACCGCGCTG <<<dehI-r1<<< 361 AGCGAAAGCACCCAGATGCGCCCGGTGGGCGGCGCGGAAGTGAACAGCGAACTGGAAGCG 421 AGCATTCCGGATGGCAAACCGGATGGCATGGATCCGACCGCGCCGCTGGTGGATGCGACC 481 AAAGCGAGCACCGAAGTGCAGGGCGATGAAAAAGAAGTGATTACCGCGTCCTTGCGCATC <<<dehI-r2<<< 541 GGCCCGGCGAGCGATTTTCAGGCGCTGTTTAACTGGCCGGATGTGCTGCAGGTGGTGACC 601 GATGAAGTGCTGGCGCCGGTGGCGGATACCGAACAGTATGATGCGGATAGCCGCGAACTG 661 GTGACCGATGCGCCGGAACTGGTGGAAGGCCTGCCGGGCAGCGCGGGCGTGCAGCGCAGC 721 GAACTGATGAGCATGCTGACCCCGAACGAAGAAGCGGGCCTGACCGGCGTGCTGTTTACC 781 TATCAGCGCTTTATTGCGGATATTACCATTAGCATTATTCATATTACCGAATGCCTGGAT 841 GGCGCGGAAGCGGCGAGCGATAGCCAGTGACCGATT <<<dehHX-R<<< microorganisms with an average cell size of 0.7 × 1.9 μm. They to P. halophila DSM 3050 (GenBank accession no NR- grew optimally at pH 7.9 and were extremely halotolerant, 117120.1) (Fig. 2). We named the new isolate P. halophila HX. being able to grow on media supplemented with NaCl concen- trations up to 25% (w/v). The isolates were motile with high catalase and oxidase activities. They digested gelatine, casein, Optimum growth conditions for P. halophila HX and citrate substrates although they were, unable to utilize man- nitol and glucose. Additionally, they were not capable of reduc- The optimum growth conditions for the P. halophila HX iso- ing nitrate to nitrite. Interestingly, their biochemical properties lates were assessed by varying several parameters, including (Table 1) were similar to those previously described for P. 2,2-DCP concentration (10–30 mM), pH (6.0–9.0), tempera- halophila DSM3050(Sorokinetal. 2006). ture (10–35 °C), and agitation rate (150–250 rpm). The opti- mum conditions that rendered the highest growth of P. halophila HX after 96 h of incubation time were 30 °C, Identification of the isolated bacterium as a P. halophila strain according to its 16S rDNA gene sequence pH 8.0, and an agitation rate of 200 rpm. These optimal con- ditions were subsequently applied for the culturing of P. halophila HX in growth media containing increasing con- The 16S rDNA gene sequence (GenBank accession no. centrations of NaCl using only 2,2-DCP as the sole carbon and KR071871) of the bacterium was obtained as a continuous energy source. Figure 3 shows the growth curves for stretch of 1450 bp, and the sequence was found to be almost P. halophila HX monitored at varying concentrations of identical (99%) to those of other P. halophila strains. We con- NaCl. The bacterium grew well in the highly concentrated structed a phylogenetic tree using 16S rDNA gene sequences, media and tolerated NaCl concentrations as high as 25% and the result indicated that the new bacterium is a close relative 376 Ann Microbiol (2017) 67:371–382 Table 1 Comparison of the main Feature P. halophila strain HX P. halophila strain DSM 3050 (Sorokin et al. 2006) morphological and biochemical characteristics for Pseudomonas halophila HX and P. halophila Shape Fat Rods Rods DSM 3050 Size (μm) 0.67–0.81 × 1.58–2.22 0.8–1.0 × 1.5–5.0 Pigmentation Reddish Reddish-brown Gram straining _ _ Motility + + Facultative anaerobe _ _ Oxidase activity + + Catalase activity + ND NaCl range 0–4.27 M (25% w/v)1.5–4.5 M (26% w/v) Temp range (°C) 10–35 4–37 pH range 7–96.7–8.5 Abilitytodigest starch _ _ Abilitytodigest gelatin + + Ability to digest casein + + Ability to digest citrate + ND Nitrate reduction _ _ Ability to digest lactose _ ND Ability to digest mannitol _ ND Abilitytodigest glucose _ ND G + C content (mol%) 58 61 Source Tuz Gölü Lake (Turkey) Great Salt Lake (Utah, USA) +, positive reaction; −, negative reaction; ND, not determined −1 (w/v) (250 g l , 4.27 M) and demonstrated a constant cell residual 2,2-DCP in the growth medium remained relatively sta- doubling time of 25.4 ± 0.6 h. ble during the stationary phase (72–96 h), but decreased precip- itously during the starvation phase (>96 h; Fig. 4). Measuring 2,2-DCP depletion by HPLC Sequencing of dehalogenase gene dehHX The nearly complete depletion of 2,2-DCP (99.3%) in the growth medium containing 25% (w/v) NaCl as compared to the negative To confirm the presence of a dehalogenase gene (dehHX)inthe control after a 96-h incubation confirmed that the P. halophila isolated P. halophila HX, we amplified a fragment of the gene by HX isolate was capable of utilizing 2,2-DCP as the carbon source. PCR. The electrophoresed amplified DNA product (503 bp) was Rapid consumption of the compound occurred mainly within the similarinsizetothatidentifiedbyHill andcolleagues(1999). exponential growth phase (24–72 h). The concentration of Alignment of the dehHX fragment sequence with those of other Fig. 2 Neighbor-joining phylogeny tree for the P. halophila HX isolate. Scale bar represents 0.01% substitution per site. The accession number for each bacterium is obtained from NCBI and presented in parenthesis Ann Microbiol (2017) 67:371–382 377 Fig. 3 Growth curves for P. halophila HX cultured in medium containing various concentrations of NaCl. Vertical bars Standard deviation of the mean Group I dehalogenases, i.e., dehI of Pseudomonas putida strain summed average percentage (12.2%) for dehalogenases from PP3 (Schmidberger et al. 2008), DL-DEX of Pseudomonas sp. non-halophilic species. Although His can be considered to be a 113 (Nardi-Dei et al. 1997), dehE of Rhizobium sp. RC1 positively charged molecule, the percentage of His in DehHX (Stringfellow et al. 1997), and HadD of Pseudomonas putida (1.7%) was found to be comparable with that of the non- AJ1(Barthetal. 1992), revealed that dehHX has the highest halophilic dehalogenases (2.5%). In addition, the overall aver- sequence identity (83.1%) with dehI (Table 2). age of hydropathicity for the DehHX was −0.31, indicating it Considering the significant similarity between the dehHX was more hydrophilic than the non-halophilic homologs, name- fragment and the dehI gene, the subsequent step to amplify the ly, DehI (−0.09), DehE (−0.15), and HadD (−0.19). complete dehHX sequence based on the dehI sequence Interestingly, the higher number of negatively charged res- seemed possible. In this study, the complete dehHX sequence idues found in the DehHX relative to dehalogenases from the (approx. 900 bp) was successfully amplified and isolated non-halophilic bacteria strongly suggests that the surface po- using the dehHX fragment as the template with primers con- tential of DehHX is negative, as expected. Correspondingly, structed from the dehI sequence. The full dehHX sequence and the DehHX model structure generated in this study corrobo- its deduced amino acid sequence were deposited in the NCBI rates our hypothesis. The results revealed an unusually large GenBank (accession no. KR297065). Pertinently, pairwise distribution of negatively charged (acidic) residues over the alignment of the deduced DehHX amino acid sequence with surface of the DehHX protein. The anomaly seen here, there- that of DehI revealed an 82% identity. fore, explains the observably overall negative surface electro- Subsequent comparative analysis of the DehHX sequence static potential of DehHX (Fig. 6). with those of other Group I dehalogenases revealed that the DehHX amino acid composition was distinctly unlike those of other taxa (Fig. 5) as the DehHX contained a substantially Discussion higher number of acidic residues, i.e., 8.27% Asp and 12.06% Glu versus an average of 5.5% Asp and 7% Glu in the amino The increasing demand for more eco-friendly solutions to acid sequences of the non-halophiles. Similarly, the percentages clean up saline and hypersaline environments contaminated of positively charged residues, i.e., Lys and Arg, were signifi- with halogenated compounds has resulted in the scientific cantly lower in DehHX (1.3 and 2.7%, respectively) than the community turning their attention towards the halophilic dehalogenase-producing microorganisms over their non- 20 1.4 halophilic counterparts. The rationale behind this choice is 1.2 that such microorganisms have evolved unique cellular enzy- matic machinery that allows them to thrive in extreme saline 0.8 environments. In our study, we isolated, identified, and char- 0.6 8 acterized a novel halotolerant dehalogenase, DehHX, pro- 0.4 duced by P. halophila. Subsequent in silico assessments of 0.2 the DehHX protein provided useful insights into the physio- logical haloadaptation mechanisms which render P. halophila 0 0 024 48 72 96 Time (hour) HX well-adapted for survival in highly saline environments. 2,2-DCP Growth Since halophilic enzymes are defined in terms of the Fig. 4 Relationship between the concentration of 2,2-dichloropropionic halophily of the organism in which they are found or based acid (2,2-DCP) and the exponential and stationary portions of the growth on their salt requirements for activity, stability, or solubility curve of P. halophila HX in liquid minimal medium supplemented with 25% (w/v) NaCl and 2,2-DCP (20 mM) (Madern et al. 2000), the results of our study show that the 2,2-DCP Concentraton (mM) Absorbance 600nm 378 Ann Microbiol (2017) 67:371–382 Table 2 Multiple sequence Gene Identity (%) Source Accession number alignment of a fragment of the dehalogenase gene of P. halophila dehI 83.1 Pseudomonas putida strain PP3 AJ133460.1 HX (dehHX)with other Group I dehalogenase genes 52 Pseudomonas sp. 113 U97030 D,L-dex dehE 61.3 Rhizobium sp. RC1 Y15517 HadD 49.4 Pseudomonas putida strain AJ1 M81841 isolated P. halophila is well-adapted to using 2,2-DCP as its sole ranged from 6.95 to 8.15) on other microbes isolated from Tuz source of carbon, as evident from the almost complete depletion Gölü Lake (Zeki Camur and Mutlu 1996). The preference of of the compound (99.3%) after 96 h of incubation. These results P. halophila HX for slightly alkaline conditions can be attributed thus affirm the positive as well as competent utilization of the to the naturally high NaCl content in the thalassohaline Tuz Gölü substance by P. halophila HX. Remarkably, the growth of the Lake (Litchfield and Gillevet 2002;Oren 2008), although more bacterium was still observable in culture medium containing up neutral pH values have also been recorded (Oren 2002). to 40 mM of 2,2-DCP; beyond this concentration its viability Remarkably, this lake is both naturally alkaline and highly saline began to decline, presumably due to the increased toxicity of because of the seasonal evaporation periods that cause an ex- the compound (Bagherbaigi et al. 2013). Assessment of the effect tremely complex surface accumulation of alkaline soil within of salinity on the bacterium revealed that P. halophila HX is the ecosystem (Litchfield and Gillevet 2002;Oren 2008; exceptionally halotolerant, a quality not generally observed in Steadman and McMahon 2011). In addition to elevating the bacteria of the Pseudomonas family. These results reveal the pH, this phenomenon increases the concentration of NaCl in P. halophila HX was able to retain its viability even at high salt the lake (Litchfield and Gillevet 2002;Oren 2008), thereby fur- concentrations [25% (w/v) NaCl] and efficiently utilize the 2,2- ther enhancing the osmotic pressure difference between the DCP as its sole carbon source. Based on these characteristics, the aquatic life and the environment. A noteworthy point to highlight utilization of the bacterium as a potentially bioremediation agent here is the ability of DehHX from P. halophila HX to efficiently for cleaning up hypersaline or marine environments contaminat- degrade 2,2-DCP under highly alkaline and saline conditions. ed with halogenated compounds is feasible. The efficacy of the bacterium to degrade such toxic compound Since the efficacy of P. halophila HX to carry out bioremedi- as 2,2-DCP is unlike those seen in other non-halotolerant ation processes could be influenced by various factors, optimiza- dehalogenase-producing bacteria in which maximal catalyzing tion of the physical conditions related to microbial-assisted bio- activities are normally observed at neutral or slightly basic con- remediation processes is necessary (Ventosa 2006). In the case of ditions (Abdul Hamid et al. 2015; Liu et al. 2016). Hence, our the effect of pH, our results reveal that the growth of P. halophila study results suggest that DehHX has potential value for the self- HX reached the optimum state between pH 6.0 and 9.0, a finding cleaning and bioremediation of alkaline and saline environments which is in agreement with that of an earlier study (optimum pH polluted with halogenated hydrocarbons. Fig. 5 Bar graph comparing the numbers of each amino acid in the dehalogenase DehHX and the average number of each amino acid in dehalogenases from non- halophilic bacteria. Black bar DehHX, white bar Group I dehalogenases, including DehE from Rhizobium sp., DehI from Pseudomonas putida PP3, DL- DEX from Pseudomonas sp. 113, 7 and HadD from Pseudomonas putida strain AJ1 Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln Arg Ser Thr Val Trp Tyr Amino Acid Composition (%) Ann Microbiol (2017) 67:371–382 379 Fig. 6 Surface electrostatic potentials of three dehalogenases. a DehHX from P. halophila HX, b DehI from P. putida strain PP3, c DL-DEX from P. sp. 113. The electrostatic energy is reported in units of kT. Red Negative potential, blue positive potential We also examined the effect of temperature because the tem- development of this trait may be due to the heterogeneity of perature of a system can influence the equilibrium position of an the Tuz Gölü Lake habitat (Sorokin et al. 2006). The salinity enzyme–enzyme-catalyzed reaction, as well as the activity and of the lake fluctuates regularly in space and time, hence pre- stability of the enzyme (Mohamad et al. 2015). Our results dem- dominantly favoring the survival of euryhaline microorgan- onstrate that P. halophila HX was viable between 10 °C and isms (Sorokin et al. 2006). The increased oligotrophy and high 35 °C, which is similar to the temperature range reported in an salinity conditions in Tuz Gölü Lake indicate that the non- earlier study involving P. halophila DSM3050 isolated from the halophilic dehalogenases would not be able to survive in such GreatSaltLakeinthe USA(4–37 °C) (Ventosa et al. 1998). The environments as highly saline conditions could potentially slight variation in the optimal growth temperatures between alter protein folding of their enzymes and disrupt their active these two P. halophila strains is possibly due to their adaptation conformation. Moreover, changes in the hydrophobic and to living in different habitats. In the case of P. halophila electrostatic interactions that accompany fluctuations in salin- DSM3050, the temperature range of the Great Salt Lake can ity could also contribute to the structural destabilization and varyfrom26°Cinmid-Julyto4°Cduringthe springtime consequent inactivation of enzymes (Sorokin et al. 2006). (Crosman and Horel 2009), while the temperature fluctuations Although the average salinity of Tuz Gölü Lake is consider- in theupper regionsofthe TuzGölü Lakewater arebetween ably higher than 35% (w/v) NaCl, we noted that increasing the 12 °C and 37 °C during the summer/spring (Altınetal. 2012). concentration of NaCl in the growth medium of P. halophila to Hence, it can be inferred that the possible reason for the differ- beyond 25% (w/v) adversely affected the bacterium and ences in the optimal pH for these two P. halophila strainsisthe prevented its multiplication. This outcome may have been due substantial temperature variation between their two habitats. to the lack of carbon-containing nutrients other than 2,2-DCP. We also assessed the effect of agitation speed on the growth of An earlier report corroborates our observation, hence signifying P. halophila HX and found that agitation speeds between 150 the importance of nutrient availability for the survival and prop- and 250 rpm were appropriate to maintain the necessary amount agation of such bacteria in saline environments (Sorokin et al. of dissolved oxygen in the P. halophile HX growth medium. This 2006). However, the relatively broad salinity range preferred by is an important aspect to be considered when cultivating batch P. halophila HX suggests that this bacterium may be a suitable cultures of bacteria as a suitable agitation speed would conse- bioremediation agent for many saline environments, such as quently improve bacterial growth by ensuring that the bacterial seawater [3.5% (w/v) NaCl] polluted with halogenated culture suspension remains properly aerated and the nutrients hydrocarbons. sufficiently distributed and available. Furthermore, bacterial set- It is wide accepted that a highly saline environment can tlement to the bottom of the flask can result in increased cell significantly impact the solubility and stability of a protein death due to the lack of nutrient availability and should be and consequently its functionality (Oren 2008). Under such averted in order to result in the production of higher amounts conditions, the protein becomes dehydrated as water becomes of dehalogenase to catalyze the dehalogenation of 2,2-DCP. less available owing to the phenomenon of water molecules The ability of P. halophila HX to tolerate concentrations of being locked within ionic lattices (Mevarech et al. 2000). This −1 NaCl as high as 25% (w/v) (250 g l , 4.27 M) with a cell locking phenomenon causes the unfolding of the dehydrated doubling time of 25.4 ± 0.6 h is relatively similar to charac- hydrophobic residues located on the surface of the enzyme teristics reported for P. halophila DSM 3050 [up to 26.2% and subsequent clumping with other protein molecules, −1 (w/v) 262 g l , 4.5 M] (Sorokin et al. 2006). Interestingly, resulting in disruption of the protein’s stability. To counter such P. halophila HX grew well in all culture broths containing undesirable changes, the negatively charged surface of the NaCl concentrations as high as 25% (w/v). Unlike halophiles, DehHX protein, which is unusually rich in acidic residues, halotolerant microorganisms can grow well in a non-saline may have arisen as an evolutionary adaptive mechanism to environment, as was also observed for P. halophila HX. The allow the acidic residues to interact and bind with the remaining 380 Ann Microbiol (2017) 67:371–382 (PYO.ZRT.1911.15.001). MFE thanks the Libyan Government for the water molecules in the surrounding saline environment. scholarship award (Libyan Ministry of Higher Education Scholarship Additionally, the decreased hydrophobicity in DehHX (related Program No. 700/2007). to the high concentrations of surface acidic residues) is another excellent adaptation of the dehalogenase to better compete with ions for water molecules. This adaptative mechanism helps the References DehHX dehalogenase to improve its solubilization and hydra- tion (Frolow et al. 1996;Britton etal. 2006; Karan et al. 2012) Abdul Hamid AA, Tengku Abdul Hamid TH, Abdul Wahab R, Omar in such environments. Earlier studies that reported on the crystal MSS, Huyop F (2015) An S188V mutation alters substrate specificity structures of halophilic enzymes also demonstrated the pres- of non-stereospecific α-Haloalkanoic acid Dehalogenase E (DehE). ence of exceptionally high numbers of surface acidic amino PLoS One 10:e0121687. doi:10.1371/journal.pone.0121687 acids (Frolow et al. 1996; Madern et al. 2000). AltınTB, Barak B, Altın BN (2012) Change in precipitation and temper- ature amounts over three decades in central Anatolia, Turkey. Atmos Clim Sci 2:107. doi:10.4236/acs.2012.21013 Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Conclusions Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new gener- ation of protein database search programs. Nucleic Acids Res 25: 3389–3402. doi:10.1093/nar/25.17.3389 The results of this study highlight the isolation of a novel Baati H, Amdouni R, Gharsallah N, Sghir A, Ammar E (2010) Isolation and halotolerant bacterium, P. halophila HX, from Tuz Gölü characterization of moderately halophilic bacteria from Tunisian solar Lake which produces a dehalogenase, i.e., DehHX. DehHX saltern. Curr Microbiol 60:157–161. doi:10.1007/s00284-009-9516-6 from P. halophila HX is the first ever Group 1 haloalkanoic Badejo AC, Badejo AO, Shin KH, Chai YG (2013) A gene expression dehalogenase isolated from a hypersaline environment. The study of the activities of aromatic ring-cleavage dioxygenases in Mycobacterium gilvum PYR-GCK to changes in salinity and pH bacterium was found to almost completely degrade 2,2-DCP during pyrene degradation. PLoS One 8:e58066. doi:10.1371/ after 96 h of incubation (99%) and to utilize this compound as journal.pone.0058066 the sole carbon and energy source. Correspondingly, our ho- Bagherbaigi S, Gicana RG, Lamis RJ, Nemati M, Huyop F (2013) mology modeling study strongly suggests that P. halophila Characterisation of Arthrobacter sp. S1 that can degrade α and β- HX has evolutionarily adapted to the extreme hypersaline haloalkanoic acids isolated from contaminated soil. Ann Microbiol 63:1363–1369. doi:10.1007/s13213-012-0595-4 and alkaline environment of Lake Tuz Gölü, as inferred from Barth PT, Bolton L, Thomson JC (1992) Cloning and partial sequencing of an the unique DehHX protein generated in this study, which operon encoding two Pseudomonas putida haloalkanoate showed the presence of an exceptionally high number of sur- dehalogenases of opposite stereospecificity. J Bacteriol 174:2612–2619 face acidic residues, in contrary to the non-haloterant Besseling E, Wegner A, Foekema EM, van den Heuvel-Greve MJ, dehalogenases. It is worth mentioning here that the unusually Koelmans AA (2013) Effects of Microplastic on fitness and PCB bioaccumulation by the lugworm Arenicola marina (L.) Environ Sci high number of surface acidic residues on the DehHX protein Technol 47:593–600. doi:10.1021/es302763x suggest that this dehalogenase has a higher water-binding ca- Biasini M, Bienert S, Waterhouse A, Arnold K, Studer G, Schmidt T, pacity and therefore can remain sufficiently hydrated under Kiefer F, Cassarino TG, Bertoni M, Bordoli L, Schwede T (2014) highly saline and alkaline conditions. The findings in the in SWISS-MODEL: modelling protein tertiary and quaternary struc- ture using evolutionary information. Nucleic Acids Res 42:W252– silico study corroborate the efficiency of DehHX to degrade W258. doi:10.1093/nar/gku340 nearly all of the 2,2-DCP, even when this substance is present Birbir M, Ogan A, Calli B, Mertoglu B (2004) Enzyme characteristics of at very high percentages of NaCl in the growth medium. extremely Halophilic Archaeal Community in Tuzkoy Salt Mine, Correspondingly, our findings confirm our hypothesis that Turkey. World J Microbiol Biotechnol 20:613–621. doi:10.1023/ B:WIBI.0000043185.06176.b8 P. halophila has adapted well to living under such conditions. Birbir M, Calli B, Mertoglu B, Bardavid RE, Oren A, Ogmen MN, Ogan In general, we have shown that bio-prospecting for halogen- A (2007) Extremely halophilic Archaea from Tuz Lake, Turkey, and degrading microorganisms in highly saline environments is the adjacent Kaldirim and Kayacik salterns. World J Microbiol not only feasible, but potentially a more practical as well as Biotechnol 23:309–316. doi:10.1007/s11274-006-9223-4 eco-friendly strategy for cleaning up contaminated coastal Birnbaum LS, Fenton SE (2003) Cancer and developmental exposure to endocrine disruptors. Environ Health Perspect 111:389–394 areas. The findings reported here further provide useful in- Britton KL, Baker PJ, Fisher M, Ruzheinikov S, Gilmour DJ, Bonete MJ, sights into the engineering and tailoring of specific proteins Ferrer J, Pire C, Esclapez J, Rice DW (2006) Analysis of protein that could function under extreme industrial and environmen- solvent interactions in glucose dehydrogenase from the extreme hal- tal conditions. ophile Haloferax mediterranei. Proc Natl Acad Sci U S A 103: 4846–4851. doi:10.1073/pnas.0508854103 Castillo-Carvajal LC, Sanz-Martín JL, Barragán-Huerta BE (2014) Acknowledgments The Fundamental Research Grant Scheme from Biodegradation of organic pollutants in saline wastewater by halo- the Ministry of Higher Education Malaysia (FRGS philic microorganisms: a review. Environ Sci Pollut Res 21:9578– R.J130000.7826.4F649) and the Research University Grant Scheme from 9588. doi:10.1007/s11356-014-3036-z the Ministry of Education, Malaysia (GUP Q.J130000.2545.09H95) from Chandra S, Sharma R, Singh K, Sharma A (2013) Application of biore- the Universiti Teknologi, Malaysia supported this work. YK would like to mediation technology in the environment contaminated with thank Ondokuz Mayiz University for joint financial support of the project Ann Microbiol (2017) 67:371–382 381 petroleum hydrocarbon. Ann Microbiol 63:417–431. doi:10.1007/ Hareland WA, Crawford RL, Chapman PJ, Dagley S (1975) s13213-012-0543-3 Metabolic function and properties of 4hydroxyphenylacetic Chen J, Wong MH, Wong YS, Tam NFY (2008) Multi-factors on biodeg- acid 1-hydroxylase from Pseudomonas acidovorans.J radation kinetics of polycyclic aromatic hydrocarbons (PAHs) by Bacteriol 121:272–285 Sphingomonas sp. a bacterial strain isolated from mangrove sediment. Haritash AK, Kaushik CP (2009) Biodegradation aspects of polycyclic Mar Pollut Bull 57:695–702. doi:10.1016/j.marpolbul.2008.03.013 aromatic hydrocarbons (PAHs): a review. J Hazard Mater 169:1–15. doi:10.1016/j.jhazmat.2009.03.137 Chiba Y, Yoshida T, Ito N, Nishimura H, Imada C, Yasuda H, Sako Y (2009) Isolation of a bacterium possessing a haloacid dehalogenase Hayes TB, Case P, Chui S, Chung D, Haeffele C, Haston K, Lee M, Mai VP, from a marine sediment core. Microbes Environ 24:276–279. doi: Marjuoa Y, Parker J, Tsui M (2006) Pesticide mixtures, endocrine dis- 10.1264/jsme2.ME09123 ruption, and amphibian declines: are we underestimating the impact? Chua EM, Shimeta J, Nugegoda D, Morrison PD, Clarke BO (2014) Environ Health Perspect 114:40–50. doi:10.1289/ehp.8051 Assimilation of polybrominated diphenyl ethers from microplastics Hill KE, Marchesi JR, Weightman AJ (1999) Investigation of two evolu- by the marine amphipod, Allorchestes compressa. Environ Sci tionarily unrelated halocarboxylic acid dehalogenase gene families. Technol 48:8127–8134. doi:10.1021/es405717z J Bacteriol 181:2535–2547 Colovos C, Yeates TO (1993) Verification of protein structures: patterns Karan R, Capes MD, DasSarma S (2012) Function and biotechnology of of nonbonded atomic interactions. Protein Sci 2:1511–1519. doi:10. extremophilic enzymes in low water activity. Aquat Biosyst 8:1. doi: 1002/pro.5560020916 10.1186/2046-9063-8-4 Colwell RR, Grigorova R (eds) (1987) Current methods for classification Kästner M, Breuer-Jammali M, Mahro B (1998) Impact of inoculation and identification of microorganisms. Methods in microbiology, vol. protocols, salinity, and pH on the degradation of polycyclic aromatic 19. CABI, Wallingford. doi:10.1002/jobm.3620290610 hydrocarbons (PAHs) and survival of PAH-degrading bacteria intro- Corpet F (1988) Multiple sequence alignment with hierarchical clustering. duced into soil. Appl Environ Microbiol 64:359–362 Nucleic Acids Res 16:10881–10890. doi:10.1093/nar/16.22.10881 Kloos WE, Tornabene TG, Schleifer KH (1974) Isolation and character- Crosman ET, Horel JD (2009) MODIS-derived surface temperature of the ization of Micrococci from human skin, including two new species: Great salt Lake. Remote Sens Environ 113:73–81. doi:10.1016/j.rse. Micrococcus lylae and Micrococcus kristinae. Int J Syst Bacteriol 2008.08.013 24:79–101. doi:10.1099/00207713-24-1-79 DeLano WL (2002) Pymol: an open-source molecular graphics tool. Kurihara T, Esaki N (2008) Bacterial hydrolytic dehalogenases and relat- CCP4 Newsl Protein Crystallogr 40:82–92 ed enzymes: occurrences, reaction mechanisms, and applications. Díaz MP, Boyd KG, Grigson SJW, Burgess JG (2002) Biodegradation of Chem Rec 8:67–74 crude oil across a wide range of salinities by an extremely halotolerant Kushner D, Kamekura M (1988) Physiology of halophilic eubacteria. In: bacterial consortium MPD-M, immobilized onto polypropylene fi- Rodriguez-Valera F (ed)Halophilic bacteria, vol. 1. CRC Press, bers. Biotechnol Bioeng 79:145–153. doi:10.1002/bit.10318 Boca Raton, pp 87–103 Dibble JT, Bartha R (1979) Effect of environmental parameters on the Laskowski RA, MacArthur MW, Moss DS, Thornton JM (1993) biodegradation of oil sludge. Appl Environ Microbiol 37:729–739 PROCHECK: a program to check the stereochemical quality of protein Duarte CM, Holmer M, Olsen Y, Soto D, Marbà N, Guiu J, Black K, structures. J Appl Crystallogr 26:283–291. doi:10.1107/ Karakassis I (2009) Will the oceans help feed humanity? Bioscience S0021889892009944 59:967–976. doi:10.1525/bio.2009.59.11.8 Lefebvre O, Tan Z, Kharkwal S, Ng HY (2012) Effect of increasing anodic Dundas IE (1977) Physiology of the Halobacteriaceae. In: Rose H, NaCl concentration on microbial fuel cell performance. Bioresour Tempest DW (eds) Advances in microbiology and physiology, vol Technol 112:336–340. doi:10.1016/j.biortech.2012.02.048 15. A.P., London, pp 85–120 Lerner MG, Carlson HA (2006) APBS plugin for PyMOL. University of Eriksson M, Ka J-O, Mohn WW (2001) Effects of low temperature and Michigan, Ann Arbor freeze-thaw cycles on hydrocarbon biodegradation in Arctic tundra Liithy R, Bowie JU, Eisenberg D (1992) Assessment of protein models soil. Appl Environ Microbiol 67:5107–5112. doi:10.1128/AEM.67. with three-dimensional profiles. Nature 356:83–85 11.5107-5112.2001 Litchfield CD, Gillevet PM (2002) Microbial diversity and complexity in Faller A, Schleifer KH (1981) Modified oxidase and benzidine tests for hypersaline environments: a preliminary assessment. J Ind separation of staphylococci from micrococci. J Clin Microbiol 13: Microbiol Biotechnol 28:48–55. doi:10.1038/sj/jim/7000175 1031–1035 Liu X, Gou Z, Hu Q, Wang J, Chen K, Xu C, Li S, Jiang J (2016) Hydrolytic Fetzner S (2010) Aerobic degradation of halogenated Aliphatics. In: dehalogenation of the chlorothalonil isomer o-tetrachlorophthalonitrile Timmis KN (ed) Handbook of hydrocarbon and lipid microbiology. by Pseudochrobactrum sp. BSQ-1. Int Biodeterior Biodegron 107:42– Springer, Berlin, pp 865–885. doi:10.1007/978-3-540-77587-4_62 47. doi: 10.1016/j.ibiod.2015.11.006 Frolow F, Harel M, Sussman JL, Mevarech M, Shoham M (1996) Madern D, Ebel C, Zaccai G (2000) Halophilic adaptation of enzymes. Insights into protein adaptation to a saturated salt environment from Extremophiles 4:91–98. doi:10.1007/s007920050142 the crystal structure of a halophilic 2Fe-2S ferredoxin. Nat Struct Matturro B, Presta E, Rossetti S (2016) Reductive dechlorination of Biol 3:452–458. doi:10.1038/nsb0596-452 tetrachloroethene in marine sediments: biodiversity and Garrity G, Boone DR, Castenholz RW (2012) The archaea and the deeply dehalorespiring capabilities of the indigenous microbes. Sci Total branching and phototrophic bacteria. Bergey’s manual of systematic Environ 545–546:445–452. doi:10.1016/j.scitotenv.2015.12.098 bacteriology, vol. 1. Springer Science & Business Media, Berlin Mehrshad M, Amoozegar MA, Makhdoumi A, Rasooli M, Asadi B, Heidelberg New York Schumann P, Ventosa A (2015) Halovarius luteus gen. nov., sp. nov., Gasteiger E, Hoogland C, Gattiker A (2005) Protein identification and a novel extremely halophilic archaeon from Urmia salt lake, Iran. Int J analysis tools on the ExPASy server. Humana Press, New York Syst Evol Microbiol 65:2420–2425. doi:10.1099/ijs.0.000279 Gribble GW (2009) Naturally occurring organohalogen compounds-a Meng C, He Q, Huang J-W, Cao Q, Yan X, Li S-P, Jiang J-D (2015) comprehensive update. Progress in the chemistry oforganic natural Degradation of chlorothalonil through a hydrolytic dehalogenase products, vol 91. Springer Science & Business Media, Berlin secreted from Bacillus subtilis WB800. Int Biodeterior Biodegr Heidelberg New York 104:97–104. doi:10.1016/j.ibiod.2015.05.017 Häggblom MM, Knight VK, Kerkhof LJ (2000) Anaerobic decomposi- Mevarech M, Frolow F, Gloss LM (2000) Halophilic enzymes: proteins tion of halogenated aromatic compounds. Environ Pollut 107:199– with a grain of salt. Biophys Chem 86:155–164. doi:10.1016/ S0301-4622(00)00126-5 207. doi:10.1016/S0269-7491(99)00138-4 382 Ann Microbiol (2017) 67:371–382 Mohamad NR, Buang NA, Mahat NA, Lok YY, Huyop F, Aboul-Enein molecular analysis of the gene and formation of carbon monoxide from trihaloacetate by the enzyme. Eur J Biochem 250:789–793. HY, Wahab RA (2015) A facile enzymatic synthesis of geranyl propionate by physically adsorbed Candida rugosa lipase onto doi:10.1111/j.1432-1033.1997.00789.x multi-walled carbon nanotubes. Enzym Microb Technol 72:49–55. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: doi:10.1016/j.enzmictec.2015.02.007 molecular evolutionary genetics analysis version 6.0. Mol Biol Evol Mohn WW, Stewart GR (2000) Limiting factors for hydrocarbon biodeg- 30:2725–2729. doi:10.1093/molbev/mst197 radation at low temperature in arctic soils. Soil Biol Biochem 32: Tang YJ, Carpenter SD, Deming JW, Krieger-Brockett B (2006) Depth- 1161–1172. doi:10.1016/S0038-0717(00)00032-8 related influences on biodegradation rates of phenanthrene in pollut- Moran P, Coats B (2012) Biological sample preparation for SEM imaging ed marine sediments of Puget sound, WA. Mar Pollut Bull 52:1431– of porcine retina. Microscopy Today 20:28–31 1440. doi:10.1016/j.marpolbul.2006.04.009 Nardi-Dei V, Kurihara T, Park C, Esaki N, Soda K (1997) Bacterial DL-2- Tejeda-Agredano MC, Gallego S, Niqui-Arroyo JL, Vila J, Grifoll M, haloacid dehalogenase from Pseudomonas sp. strain 113: gene clon- Ortega-Calvo JJ (2010) Effect of interface fertilization on biodegra- ing and structural comparison with D- and L-2-haloacid dation of polycyclic aromatic hydrocarbons present in nonaqueous- dehalogenases. J Bacteriol 179:4232–4238 phase liquids. Environ Sci Technol 45:1074–1081. doi:10.1021/ Novak HR, Sayer C, Isupov MN, Gotz D, Spragg AM, Littlechild JA es102418u (2014) Biochemical and structural characterisation of a haloalkane Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, dehalogenase from a marine Rhodobacteraceae. FEBS Lett 588: Rozen SG (2012) Primer3—new capabilities and interfaces. Nucleic 1616–1622. doi:10.1016/j.febslet.2014.02.056 Acids Res 40:e115–e115 Oren A (2002) Molecular ecology of extremely halophilic archaea and Uribe-Jongbloed A, Bishop PL (2007) Comparative study of PAH re- bacteria. FEMS Microbiol Ecol 39:1–7. doi:10.1111/j.1574-6941. moval efficiency under absence of molecular oxygen: effect of elec- 2002.tb00900.x tron acceptor and hydrodynamic conditions. J Environ Eng Sci 6: Oren A (2008) Microbial life at high salt concentrations: phylogenetic 367–376. doi:10.1139/s06-057 and metabolic diversity. Saline Syst 4:1–13. doi:10.1186/1746- Van Der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE, Berendsen 1448-4-2 HJC (2005) GROMACS: fast, flexible, and free. J Comput Chem Oren A (2010) Industrial and environmental applications of halophilic 26:1701–1718. doi:10.1002/jcc.20291 microorganisms. Environ Technol 31:825–834. doi:10.1080/ Van Pée KH, Unversucht S (2003) Biological dehalogenation and halo- genation reactions. Chemosphere 52:299–312. doi:10.1016/S0045- Oren A, Gurevich P, Azachi M, Henis Y (1992) Microbial degradation of 6535(03)00204-2 pollutants at high salt concentrations. Biodegradation 3:387–398. Ve Habitatlar AM (2002) Alkaliphilic micro-organisms and habitats. Turk doi:10.1007/BF00129095 JBiol 26:181–191 Ortega-Calvo J-J, Gschwend PM (2010) Influence of low oxygen ten- Ventosa A (2006) Unusual micro-organisms from unusual habitats: hy- sions and sorption to sediment black carbon on biodegradation of persaline environments. In: Symposia of the Society for General pyrene. Appl Environ Microbiol 76:4430–4437. doi:10.1128/AEM. Microbiology 1999. Cambridge University Press, Cambridge, p 223 00461-10 Ventosa A, Nieto JJ, Oren A (1998) Biology of moderately halophilic Qing Li Q, Loganath A, Seng Chong Y, Tan J, Philip Obbard J (2006) aerobic bacteria. Microbiol Mol Biol Rev 62:504–544 Persistent organic pollutants and adverse health effects in humans. J Wang G, Liang B, Li F, Li S (2011) Recent advances in the biodegrada- Toxic Environ Health A 69:1987–2005. doi:10.1080/ tion of Chlorothalonil. Curr Microbiol 63:450–457. doi:10.1007/ s00284-011-0001-7 Sanchez-Porro C, Martin S, Mellado E, Ventosa A (2003) Diversity of Wei X, Jiang Y, Chen X, Jiang Y, Lai H (2015) Amycolatopsis flava sp. moderately halophilic bacteria producing extracellular hydrolytic nov., a halophilic actinomycete isolated from Dead Sea Antonie van enzymes. J Appl Microbiol 94:295–300. doi:10.1046/j.1365-2672. Leeuwenhoek doi:10.1007/s10482-015-0542-z 2003.01834.x Xiang W, Guo J, Feng W, Huang M, Chen H, Zhao J, Zhang J, Yang Z, Schmidberger JW, Wilce JA, Weightman AJ, Whisstock JC, Wilce MCJ Sun Q (2008) Community of extremely halophilic bacteria in his- (2008) The crystal structure of DehI reveals a new alpha-haloacid toric Dagong brine well in southwestern China. World J Microbiol dehalogenase fold and active-site mechanism. J Mol Biol 378:284– Biotechnol 24:2297–2305. doi: 10.1007/s11274-008-9744-0 294. doi:10.1016/j.jmb.2008.02.035 Zanaroli G, Negroni A, Häggblom MM, Fava F (2015) Microbial Slater JH, Bull AT, Hardman DJ (1995) Microbial dehalogenation. dehalogenation of organohalides in marine and estuarine environ- Biodegradation 6:181–189. doi:10.1007/bf00700456 ments. Curr Opin Biotechnol 33:287–295. doi:10.1016/j.copbio. Sorokin DY, Tourova TP, Galinski EA, Belloch C, Tindall BJ (2006) 2015.03.013 Extremely halophilic denitrifying bacteria from hypersaline inland Zeki Camur M, Mutlu H (1996) Major-ion geochemistry and mineralogy lakes, Halovibrio denitrificans sp.nov.and Halospina denitrificans of the salt Lake (Tuz Gölü) basin, Turkey. Chem Geol 127:313–329. gen. nov., sp. nov., and evidence that the genus name Halovibrio doi:10.1016/0009-2541(95)00129-8 Fendrich 1989 with the type species Halovibrio variabi.IntJ Syst Evol Microbiol 56:379–388. doi:10.1099/ijs.0.63964-0 Zhang J, Xin Y, Cao X, Xue S, Zhang W (2014) Purification and char- Steadman SR, McMahon G (2011) The Oxford handbook of ancient acterization of 2-haloacid dehalogenase from marine bacterium Anatolia. Oxford University Press, Oxford Paracoccus sp. DEH99, isolated from marine sponge Stringfellow JM, Cairns SS, Cornish A, Cooper RA (1997) Hymeniacidon perlevis. J Ocean Univ China 13:91–96. doi:10. Haloalkanoate dehalogenase II (DehE) of a Rhizobium sp.- 1007/s11802-014-2357-3 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

In silico characterization of a novel dehalogenase (DehHX) from the halophile Pseudomonas halophila HX isolated from Tuz Gölü Lake, Turkey: insights into a hypersaline-adapted dehalogenase

Download PDF
12 pages

Loading next page...
 
/lp/springer-journals/in-silico-characterization-of-a-novel-dehalogenase-dehhx-from-the-vNZXdZSYXd

References (72)

Publisher
Springer Journals
Copyright
Copyright © 2017 by Springer-Verlag Berlin Heidelberg and the University of Milan
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Mycology; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/s13213-017-1266-2
Publisher site
See Article on Publisher Site

Abstract

Ann Microbiol (2017) 67:371–382 DOI 10.1007/s13213-017-1266-2 ORIGINAL ARTICLE In silico characterization of a novel dehalogenase (DehHX) from the halophile Pseudomonas halophila HX isolated from Tuz Gölü Lake, Turkey: insights into a hypersaline-adapted dehalogenase 1 2 3 1 Mohamed Faraj Edbeib & Roswanira Abdul Wahab & Yilmaz Kaya & Fahrul Huyop Received: 6 October 2016 /Accepted: 7 April 2017 /Published online: 2 May 2017 Springer-Verlag Berlin Heidelberg and the University of Milan 2017 Abstract Halogenated compounds represent potential long- presence of acidic residues, which accounts for the uncom- term threats to human well-being and health and, therefore, monly low pI seen in DehHX and explains the mechanism of the quest for microorganisms capable of degrading these haz- adaptation that contributes to the exceptional halotolerance of ardous substances merits urgent consideration. We have iso- the enzyme. The excess surface acidic residues were beneficial lated a novel dehalogenase-producing bacterium from the hy- in enhancing the water-binding capacity, a crucial feature for persaline environment of Tuz Gölü Lake, Turkey and subse- preserving the stability and solubility of DehHX in highly sa- quently identified this isolate as Pseudomonas halophila HX. line conditions. In summary, we suggest that bio-prospecting Under optimal culture conditions (pH 8.0, 15% NaCl, 30 °C, for halogenated compound-degrading microorganisms in high- 200 rpm, 96 h culture time), the strain almost completely de- ly saline environments is a practical and safe strategy for the graded (99.3%) 2,2-dichloropropionic acid (20 mM). The bioremediation of contaminated coastal areas. dehalogenase gene (dehHX) of the bacterium was amplified . . by PCR, and the deduced amino acid sequence of the Keywords Biodegradation 2,2-Dichloropropionic acid DehHX was found to belong to a Group I dehalogenase and Pseudomonas halophila Halostable dehalogenase to share an 82% sequence identity to the dehalogenase DehI of Pseudomonas putida strain PP3. Interestingly, the pI of DehHX was more acidic (pI 3.89) than those of the non- Introduction halophilic dehalogenases (average measured pI 5.95). Homology-based structural modeling revealed that the surface Halogenated compounds liberated by natural and/or industrial of DehHX was unusually negatively charged due to the higher processes generally contain high concentrations of four ha- − − − lides, i.e., fluoride (F ), chloride (Cl ), bromide (Br ), and iodide (I ), all of which are well-known environmental pollut- Electronic supplementary material The online version of this article (doi:10.1007/s13213-017-1266-2) contains supplementary material, ants (Slater et al. 1995). While there are more than 5000 types which is available to authorized users. of naturally occurring halogenated hydrocarbons (Gribble 2009), the ever increasing number of manufacturing activities * Roswanira Abdul Wahab and cases of illegal dumping of halogenated compounds into roswanira@kimia.fs.utm.my water bodies (Oren et al. 1992) further increase their presence * Fahrul Huyop in the environment. An estimated 5% of the highly halogenat- fahrul@utm.my ed industrial effluents released into the environment enter sa- line or hypersaline water systems (Lefebvre et al. 2012), with Department of Biotechnology and Medical Engineering, Faculty of 2,2-dichloropropionic acid (2,2-DCP) (also known as Biosciences and Medical Engineering, Universiti Teknologi Malaysia (UTM), 81310 Johor Bahru, Malaysia Dalapon), a highly toxic and recalcitrant biocide, being one of the commonly found contaminants (Häggblom et al. 2000; Department of Chemistry, Faculty of Science, Universiti Teknologi Malaysia (UTM), 81310 Johor Bahru, Malaysia Van Pée and Unversucht 2003). Most worrying is the persis- tence of 2,2-DCP in the environment, suggesting that this Agricultural Biotechnology Department, Faculty of Agriculture, Ondokuz Mayis University, Samsun, Turkey compound has the potential to pose long-term risks to both 372 Ann Microbiol (2017) 67:371–382 environmental and human health (Birnbaum and Fenton and the availability of electron acceptors, such as oxygen 2003; Hayes et al. 2006;Qing Li et al. 2006). 2,2-DCP that (Tang et al. 2006; Uribe-Jongbloed and Bishop 2007; originates from man-made effluents has been discovered in Haritash and Kaushik 2009; Ortega-Calvo and Gschwend food sources, especially those caught in marine environments, 2010). Likewise, the distribution and abundance of a given such as fishes and prawns that constitute a substantial propor- type of extreme environment can also influence biota spe- tion of the human diet (Duarte et al. 2009). An added factor to cialization and microbial evolution (Ve Habitatlar 2002). consider is that the natural bioaccumulation process further Since little is known about dehalogenase-producing halo- concentrates such pollutants in marine food sources, making philes and given their innate stability in highly saline envi- the situation even worse (Besseling et al. 2013;Chua etal. ronments, the characterization of their bioremediation ca- 2014). Concerted efforts that focus on microbial prospecting pacities and a better understanding of the mechanism(s) in search of dehalogenase-producing bacteria to Bclean up^ employed in this process are essential. Although several halogen-polluted water bodies (Wang et al. 2011) and marine other microbial dehalogenation mechanisms have been environments are therefore urgently needed. identified, including thiolytic, oxidative, and reductive The aim of this study was to bio-prospect in hypersaline mechanisms, hydrolytic dehalogenation is the most com- habitats harboring unique and ancient halophilic microbes mon mechanism described (Kurihara and Esaki 2008; capable of surviving or thriving in halogen-contaminated Fetzner 2010). To date, isolation studies focusing on marine or hypersaline environments. Halophiles are salt- enzyme-producing bacteria from the hypersaline Tuz loving microorganisms that thrive under extreme salt con- Gölü Lake (Turkey) have focused on microbes producing ditions (up to 35% NaCl) (Castillo-Carvajal et al. 2014). enzymes such as amylases, cellulases, caseinases, Such exceptional microorganisms have been found in sev- gelatinases, lipases, catalases, and oxidases (Birbir et al. eral locations throughout the world, such as the Dead Sea, 2007), with the exception of dehalogenases. Several strains Israel (Wei et al. 2015), Lake Urmia, Iran (Mehrshad et al. of Pseudomonas sp. capable of degrading hydrocarbons 2015), the solar salterns, Tunisia (Baati et al. 2010), the and halogenated compounds (Chandra et al. 2013)have Tuzkoy salt mine, Turkey (Birbir et al. 2004), the hypersa- been successfully isolated, but none were found to be line environments in southern Spain (Sanchez-Porro et al. halotolerant. To the best of our knowledge, this is the first 2003), the Dagong Brine Well, China (Xiang et al. 2008), report detailing a dehalogenase-producing halotolerant and the Great Salt Lake, USA. In terms of salt tolerance, bacterium from Tuz Gölü Lake. We describe an aerobic these microorganisms can be categorized into five major and halotolerant 2,2-DCP-degrading bacterium identified classes based on the concentration of NaCl required for their as Pseudomonas halophila that produces a dehalogenase growth: (1) non-halophiles, < 0.2 M (approx. 1%) NaCl; (2) called DehHX. For this dehalogenase to competently func- tion under highly saline conditions, we anticipated that spe- mild halophiles, 0.2–0.5 M (approx. 1–3%)NaCl; (3)mod- erate halophiles, 0.5–2.5 M (approx. 3–15%) NaCl; (4) bor- cial adaptive features would be present in the protein of the derline extreme halophiles, 1.5–4.0 M (approx. 9–23%) halophilic bacterium. Hence, in addition to isolating a NaCl; (5) extreme halophiles, 2.5–5.2 M (approx. 15– halotolerant bacterium we investigated the haloadaptative 32%) NaCl (Kushner and Kamekura 1988). Several species mechanism within the protein of the P. halophila that gives of dehalogenase-producing bacteria have been isolated DehHX its halotolerant property. from a variety of halogen-contaminated marine environ- ments (Chiba et al. 2009;Novaketal. 2014; Zhang et al. 2014;Mengetal. 2015). Aquatic environments are among Materials and methods the most important long-term reservoirs of highly haloge- nated organic pollutants (Zanaroli et al. 2015;Matturroet al. Samples and reagents 2016). Consequently, such sites are also excellent environ- ments for isolating halogen-degrading microorganisms, Water samples were collected aseptically from the shallow suggesting that the application of these well-adapted micro- shores (average depth 0.2 m) of the halogen-contaminated organisms for cleaning up halogen-contaminated marine or hypersaline lake Tuz Gölü, near the Van area in Turkey (39° hypersaline environments (Oren 2010) may prove possible. 2′ 50″ N; 33° 26′ 1″ E). The 2,2-DCP was obtained from According to literature, the rate and extent of microbial- Sigma-Aldrich (St. Louis, MO), and solutions of 2,2-DCP assisted degradation of pollutants are profoundly influenced were filter sterilized through a 0.2-μm nylon membrane disc by several geochemical and physical parameters, including (Hybond N; Amersham, Little Chalfont, UK) before use. temperature (Mohn and Stewart 2000; Eriksson et al. 2001; All types of media used in this study were prepared using Haritash and Kaushik 2009), salinity (Kästner et al. 1998; distilled water. Organic solvents and other chemical re- Díaz et al. 2002; Badejo et al. 2013), nutrients (Dibble and agents were procured from Sigma-Aldrich and were of an- Bartha 1979;Chenet al. 2008; Tejeda-Agredano et al. 2010), alytical purity. Ann Microbiol (2017) 67:371–382 373 Media preparation Biochemical characterization The experiment involved the preparation of two different Assessments of the physiological and biochemical properties stock solutions. The first stock solution contained basal of the bacterial strain, namely, Gram staining, motility test, −1 salts, such as NaH PO ·2H O (10.0 g l ), K HPO · carbohydrate fermentation, and gelatine hydrolysis (Kloos 2 4 2 2 4 −1 −1 3H O (42.5 g l ), and (NH ) SO (25.0 g l ), and the et al. 1974), were done according to the Bergey’sManual of 2 4 2 4 second stock solution contained trace metal salts, such as Determinative for Bacteriology (Garrity et al. 2012). After an − 1 − 1 MgSO (2.0 g l ), FeSO ·7H O (120.0 g l ), overnight incubation in a halophilic broth, oxidase and cata- 4 4 2 −1 −1 MnSO ·4H O (30.0 g l ), ZnSO ·H O(30gl ), lase activities were determined by an oxidation reaction car- 4 2 4 2 −1 CoCl ·6H O(10 gl ), and nitrilotriacetic acid (1.0 g ried out using 1% (w/v) tetramethylenediamine (Faller and 2 2 −1 l ), dissolved in distilled water (Hareland et al. 1975). Schleifer 1981) prepared in a 2.5% (w/v) hydrogen peroxide The growth medium consisted of 2,2-DCP (20 mM) and solution, and the formation of gas and bubbles, respectively, was autoclaved (121 °C, 15 psi, 15 min) before the addi- was evaluated (Colwell and Grigorova 1987). Other biochem- tion of various concentrations of filter-sterilized solutions ical tests also included methyl red, indole production, the −1 of NaCl (0, 150, 250, and 300 g·l ). The high salt con- Voges–Proskauer reaction, urease production, citrate utiliza- centration in the liquid growth medium was to ensure the tion, and nitrate reduction (Colwell and Grigorova 1987). selective growth of only halotolerant strains capable of utilizing 2,2-DCP as the sole source of carbon and energy. PCR amplification of 16S rDNA The pH of the growth medium was adjusted to pH 8 ± 0.2, and incubation was at 30 °C with shaking at 200 rpm for 5 Genomic DNA extraction was carried out using the Wizard days. Genomic DNA Extraction kit reagent (Promega, Madison, A pure colony of the halophilic microorganism was isolat- WI) as per the manufacturer’s protocol. Upon purification, ed using a minimal medium [1.5% (w/v) Oxoid bacteriologi- the DNA concentration was ascertained and the DNA stored cal agar No. 1 (Oxoid Ltd., Basingstoke, UK, as the solidify- at −20 °C until further use. PCR amplification of the 16S ing agent)]. The medium was sterilized [121 °C, 15 psi, rDNA was carried out in a mixture (50 μl) that contained 15 min] prior to addition of a filter-sterilized solution of 2,2- 0.1 μl of 27F primer (25 μM), 1 μl of 1492R primer DCP (20 mM). A single colony growing on the minimal me- (25 μM), 1 μl dNTPs (10 mM total), 4.0 μlMgCl dium was selected and subcultured onto fresh plates contain- (25 mM), 5.0 μl of 10× PCR buffer, 0.5 μl Taq polymerase ing 2,2-DCP (20 mM) as the only carbon source and subse- (Stratagene Ltd., Cambridge, UK), and 0.5 μl of DNA tem- quently incubated for 5 days at 30 °C. plate (104 ng). The PCR reactions were performed in an Eppendorf Master Cycler Nexus Gradient thermal cycler (Hamburg, Germany) using the following cycling program: Field emission scanning electron microscopy an initial denaturation of 1 min at 94 °C, followed by 30 cycles of denaturation (95 °C, 30 s), annealing (55 °C, 40 s), and The morphological characteristics of a single bacterial cul- extension (72 °C, 1 min), with a final extension of 10 min at ture were assessed using field emission scanning electron 72 °C. The bacterial 16S rDNA universal primers 27F (5′- microscopy. The bacterial cells were incubated for 24 h in a AGAGATTGATCCTGGCTCTG-3′) and 1492R, (5′-GGTT halophilic broth prepared according to Dundas (1977). The TCCTTGTTACGACAT-3′) were synthesized by First Base bacterial culture was harvested by centrifugation (5000 g for laboratories Co., Ltd (Selangor, Malaysia). The PCR products 15 min) and washed twice using distilled water. The sample were purified and sequenced by First Base Laboratory Co., was fixed in 2.5% (w/v) glutaraldehyde for 1 h and then Ltd., and the taxonomic analysis was conducted using the washed once with distilled water prior to the final fixing GenBank BLAST program in the NCBI database (Altschul treatment in 1–4% (w/v) osmium tetroxide for 1 h. The et al. 1997). The software MEGA version 6 was used for sample was dehydrated by immersion (10 min) in a series aligning and evaluating the similarity between the 16S of ethanol/water solutions with increasing percentages of rDNA sequences, and the resultant tree topology was evalu- ethanol (25, 50, 75, 95, and 100% v/v) (Moran and Coats ated by bootstrap analysis of the neighbor-joining method 2012). The sample was placed onto an aluminum foil disc (Tamura et al. 2013). and dried in a Leica EM CPD300 critical point dryer (Leica Microsystems GmbH, Wetzlar, Germany) prior to coating Determining optimum growth conditions with platinum and examination under a Hitachi SU5020 FES electron microscope (magnification 11000 ×; acceler- The culture conditions (i.e., 2,2-DCP concentration, pH, tem- ating voltage 2000 V) with an SE(L) detector set at a work- perature, agitation rate, medium salinity) that may affect bac- ing distance of 16.2 mm. terial growth rate were evaluated using minimal media. For 374 Ann Microbiol (2017) 67:371–382 assessing the effect of concentration and pH, we prepared Material 1 for the strategy scheme of amplifying the full solutions containing different concentrations of 2,2-DCP sequence of dehHX). PCR amplification was carried out in a (20, 30, 40 mM) and solutions at different pH (6.0, 7.0, 8.0, thermal cycler (Eppendorf Master Cycler Nexus Gradient; 9.0, 10.0). The pH of each solution was adjusted using HCl Eppendorf)) using the following PCR conditions: an initial (1 M) or NaOH (1 M). The effect of temperature was assessed denaturation for 5 min at 94 °C, followed by 30 cycles of at 10, 20, 30, 45, and 40 °C, respectively. The effect of shaking denaturation (94 °C, 30 s), primer annealing (58 °C, 40 s), rate was assessed at agitation speeds ranging from 150 to and extension (72 °C, 1 min), with a final extension for 250 rpm, with intervals of 25 rpm. The effect of medium 5 min at 72 °C. First Base Laboratories sequenced the PCR salinity was evaluated in growth media containing varying product. −1 concentrations of NaCl (0, 150, 250, and 300 g l . Bacterial growth was monitored by measuring the turbidity of the Amino acid composition and analysis growth culture using a Pye-Unicam SP1750 series spectro- photometer (Pye Unicam, Cambridge, UK). Experiments to The frequency of occurrence of each amino acid residue in determine the optimal 2,2-DCP concentration, pH, tempera- DehHX and other non-halophilic members of the Group I ture, agitation rate, and salinity were based on the bacterial dehalogenases was calculated using MEGA 6 (Tamura et al. growth rate measured over a 5-day incubation period. 2013). Outputs were exported into an Excel spreadsheet to calculate the average number of each amino acid, and the 2,2-DCP depletion monitored by high-performance liquid results were plotted onto an Excel worksheet. The overall chromatography average of hydropathicity value for each protein was calculat- ed using ProtParam (Gasteiger et al. 2005). Bacterial cells cultured under the ascertained optimal condi- tions were harvested at 24-h intervals and centrifuged (2000 g Structural analysis of DehHX for 10 min) to remove the insoluble particles. The supernatants were collected and subsequently filtered through a 0.2-μm The DehHX structure was built using SWISS-MODEL soft- membrane (Toyo Roshi Ltd., Tokyo, Japan). The high- ware (Biasini et al. 2014) with DehI as the template. The initial performance liquid chromatography (HPLC) system (Waters DehHX structure was subjected to structural evaluation using Alliance 2690 HPLC Separations Module; Agilent the software packages VERIFY-3D (Liithy et al. 1992), PRO- Technologies, Santa Clara, CA) had two components—acap- CHECK (Laskowski et al. 1993), and ERRAT (Colovos and illary Hi-Plex H column (300 × 7.7 mm, 5 μm) and a photo- Yeates 1993), respectively. The model was subjected to mo- diode array detector. The mobile phase was 0.005 M H SO . lecular dynamics refinement using the parallel version of 2 4 A negative control sample lacking the bacterial inoculation GROMACS 4.5.1 and the Gromos96 53a6 force field, run was run in parallel in each assay. Each 20-μl sample was run on an Ubuntu computer having a 1.6-GHz processor and a through the column at a flow rate of 0.6 ml/min and a temper- quad-core processor (Van Der Spoel et al. 2005). The system ature of 30 °C. A calibration curve was prepared using a series volume, temperature (30 K), and number of particles for the of varying concentrations of 2,2-DCP solutions. ensemble were held constant. The relative electrostatic surface potential of the model was calculated by APBS (Lerner and PCR amplification of the halostable dehalogenase gene Carlson 2006) in PyMOL (DeLano 2002). (dehHX) Amplification of the partial sequence of dehHX was done Results using the dehI-F (5′-ACGCTGCGGGTGCCATGGGT-3′) and dehI-r (5′-TACTTTGGATTGCCATAGTT-3′) primers. Characterization of a new bacterium capable of using The amplified fragment was later sequenced and aligned using 2.2-DCP as the sole carbon source MultAlin software (Corpet 1988). Alignment with several other sequences of known Group I dehalogenases maintained By incubating a water sample from the hypersaline lake Tuz by GenBank revealed that the partial sequence of dehHX was Gölü in minimal medium containing NaCl (25%, w/v) and highly similar to that of dehI (accession no. AY138113). 20 mM 2,2-DCP, we were able to isolate a new halotolerant Based on the terminal regions of the dehI sequence, primers bacterium that could use 2,2-DCP as the sole carbon source. dehHX-F (5′-ATGACCAACCCGTATTTTCC-3′)and After incubating the newly isolated bacterium at 30 °C for 5 dehHX-R (5′-AATCGGTCACTGGCTATCG-3′) were de- days on agar containing 2,2-DCP, we isolated pure colonies signed using the software Primer 3 (v. 0.4.0) (Untergasser (red in color and approx. 2–4 mm in diameter). Interestingly, et al. 2012) and the primers then synthesized at First BASE no colonies were observed in the medium which did not contain Laboratories (Fig. 1; see also Electronic Supplementary 2,2-DCP. The isolates were Gram-negative, rod-shaped Ann Microbiol (2017) 67:371–382 375 1 ATGACCAACCCGTATTTTCCGCAGGCGAGCCAGCTGGATGTGGAAACCGAAAGCACCTAT Fig. 1 Amplification strategy to >>>dehHX-F>>> obtain the full sequence of the dehalogenase gene of 61 GAAGATGTGGAACTGACCGCGCGCGTGCCGTGGGTGGCGTTTGGCTGCCGCGTGCTGGCG Pseudomonas halophila HX (dehHX). The complete dehI sequence was obtained from the 121 ACCTTTCCGGGCTATGCGCCGCTGTGGGAACGCTGCGGGTGCCATGGGTTACCGAATAT NCBI database (accession no. >>>dehI-F>>> AJ133460.1). The dehHX coding region is shown in bold, and the 181 GCGGAACAGGCGGCGGATGAACTGCGCGAAGAAAGCGTGGTGAACGTGGGCCCGCTGCCG start and stop codons are shaded. Primers used to amplify the 241 AACGCGGATGAAGAACTGTGGCATGCGTTTTTTGATGATGGCGAAGTGGAAGATGTGGAA fragment and the complete dehHX sequence are underlined and labeled 301 GAAGTGACCTATGCGTTTAACTATGGCAATCCAAAGTAGATGAAACCATTACCGCGCTG <<<dehI-r1<<< 361 AGCGAAAGCACCCAGATGCGCCCGGTGGGCGGCGCGGAAGTGAACAGCGAACTGGAAGCG 421 AGCATTCCGGATGGCAAACCGGATGGCATGGATCCGACCGCGCCGCTGGTGGATGCGACC 481 AAAGCGAGCACCGAAGTGCAGGGCGATGAAAAAGAAGTGATTACCGCGTCCTTGCGCATC <<<dehI-r2<<< 541 GGCCCGGCGAGCGATTTTCAGGCGCTGTTTAACTGGCCGGATGTGCTGCAGGTGGTGACC 601 GATGAAGTGCTGGCGCCGGTGGCGGATACCGAACAGTATGATGCGGATAGCCGCGAACTG 661 GTGACCGATGCGCCGGAACTGGTGGAAGGCCTGCCGGGCAGCGCGGGCGTGCAGCGCAGC 721 GAACTGATGAGCATGCTGACCCCGAACGAAGAAGCGGGCCTGACCGGCGTGCTGTTTACC 781 TATCAGCGCTTTATTGCGGATATTACCATTAGCATTATTCATATTACCGAATGCCTGGAT 841 GGCGCGGAAGCGGCGAGCGATAGCCAGTGACCGATT <<<dehHX-R<<< microorganisms with an average cell size of 0.7 × 1.9 μm. They to P. halophila DSM 3050 (GenBank accession no NR- grew optimally at pH 7.9 and were extremely halotolerant, 117120.1) (Fig. 2). We named the new isolate P. halophila HX. being able to grow on media supplemented with NaCl concen- trations up to 25% (w/v). The isolates were motile with high catalase and oxidase activities. They digested gelatine, casein, Optimum growth conditions for P. halophila HX and citrate substrates although they were, unable to utilize man- nitol and glucose. Additionally, they were not capable of reduc- The optimum growth conditions for the P. halophila HX iso- ing nitrate to nitrite. Interestingly, their biochemical properties lates were assessed by varying several parameters, including (Table 1) were similar to those previously described for P. 2,2-DCP concentration (10–30 mM), pH (6.0–9.0), tempera- halophila DSM3050(Sorokinetal. 2006). ture (10–35 °C), and agitation rate (150–250 rpm). The opti- mum conditions that rendered the highest growth of P. halophila HX after 96 h of incubation time were 30 °C, Identification of the isolated bacterium as a P. halophila strain according to its 16S rDNA gene sequence pH 8.0, and an agitation rate of 200 rpm. These optimal con- ditions were subsequently applied for the culturing of P. halophila HX in growth media containing increasing con- The 16S rDNA gene sequence (GenBank accession no. centrations of NaCl using only 2,2-DCP as the sole carbon and KR071871) of the bacterium was obtained as a continuous energy source. Figure 3 shows the growth curves for stretch of 1450 bp, and the sequence was found to be almost P. halophila HX monitored at varying concentrations of identical (99%) to those of other P. halophila strains. We con- NaCl. The bacterium grew well in the highly concentrated structed a phylogenetic tree using 16S rDNA gene sequences, media and tolerated NaCl concentrations as high as 25% and the result indicated that the new bacterium is a close relative 376 Ann Microbiol (2017) 67:371–382 Table 1 Comparison of the main Feature P. halophila strain HX P. halophila strain DSM 3050 (Sorokin et al. 2006) morphological and biochemical characteristics for Pseudomonas halophila HX and P. halophila Shape Fat Rods Rods DSM 3050 Size (μm) 0.67–0.81 × 1.58–2.22 0.8–1.0 × 1.5–5.0 Pigmentation Reddish Reddish-brown Gram straining _ _ Motility + + Facultative anaerobe _ _ Oxidase activity + + Catalase activity + ND NaCl range 0–4.27 M (25% w/v)1.5–4.5 M (26% w/v) Temp range (°C) 10–35 4–37 pH range 7–96.7–8.5 Abilitytodigest starch _ _ Abilitytodigest gelatin + + Ability to digest casein + + Ability to digest citrate + ND Nitrate reduction _ _ Ability to digest lactose _ ND Ability to digest mannitol _ ND Abilitytodigest glucose _ ND G + C content (mol%) 58 61 Source Tuz Gölü Lake (Turkey) Great Salt Lake (Utah, USA) +, positive reaction; −, negative reaction; ND, not determined −1 (w/v) (250 g l , 4.27 M) and demonstrated a constant cell residual 2,2-DCP in the growth medium remained relatively sta- doubling time of 25.4 ± 0.6 h. ble during the stationary phase (72–96 h), but decreased precip- itously during the starvation phase (>96 h; Fig. 4). Measuring 2,2-DCP depletion by HPLC Sequencing of dehalogenase gene dehHX The nearly complete depletion of 2,2-DCP (99.3%) in the growth medium containing 25% (w/v) NaCl as compared to the negative To confirm the presence of a dehalogenase gene (dehHX)inthe control after a 96-h incubation confirmed that the P. halophila isolated P. halophila HX, we amplified a fragment of the gene by HX isolate was capable of utilizing 2,2-DCP as the carbon source. PCR. The electrophoresed amplified DNA product (503 bp) was Rapid consumption of the compound occurred mainly within the similarinsizetothatidentifiedbyHill andcolleagues(1999). exponential growth phase (24–72 h). The concentration of Alignment of the dehHX fragment sequence with those of other Fig. 2 Neighbor-joining phylogeny tree for the P. halophila HX isolate. Scale bar represents 0.01% substitution per site. The accession number for each bacterium is obtained from NCBI and presented in parenthesis Ann Microbiol (2017) 67:371–382 377 Fig. 3 Growth curves for P. halophila HX cultured in medium containing various concentrations of NaCl. Vertical bars Standard deviation of the mean Group I dehalogenases, i.e., dehI of Pseudomonas putida strain summed average percentage (12.2%) for dehalogenases from PP3 (Schmidberger et al. 2008), DL-DEX of Pseudomonas sp. non-halophilic species. Although His can be considered to be a 113 (Nardi-Dei et al. 1997), dehE of Rhizobium sp. RC1 positively charged molecule, the percentage of His in DehHX (Stringfellow et al. 1997), and HadD of Pseudomonas putida (1.7%) was found to be comparable with that of the non- AJ1(Barthetal. 1992), revealed that dehHX has the highest halophilic dehalogenases (2.5%). In addition, the overall aver- sequence identity (83.1%) with dehI (Table 2). age of hydropathicity for the DehHX was −0.31, indicating it Considering the significant similarity between the dehHX was more hydrophilic than the non-halophilic homologs, name- fragment and the dehI gene, the subsequent step to amplify the ly, DehI (−0.09), DehE (−0.15), and HadD (−0.19). complete dehHX sequence based on the dehI sequence Interestingly, the higher number of negatively charged res- seemed possible. In this study, the complete dehHX sequence idues found in the DehHX relative to dehalogenases from the (approx. 900 bp) was successfully amplified and isolated non-halophilic bacteria strongly suggests that the surface po- using the dehHX fragment as the template with primers con- tential of DehHX is negative, as expected. Correspondingly, structed from the dehI sequence. The full dehHX sequence and the DehHX model structure generated in this study corrobo- its deduced amino acid sequence were deposited in the NCBI rates our hypothesis. The results revealed an unusually large GenBank (accession no. KR297065). Pertinently, pairwise distribution of negatively charged (acidic) residues over the alignment of the deduced DehHX amino acid sequence with surface of the DehHX protein. The anomaly seen here, there- that of DehI revealed an 82% identity. fore, explains the observably overall negative surface electro- Subsequent comparative analysis of the DehHX sequence static potential of DehHX (Fig. 6). with those of other Group I dehalogenases revealed that the DehHX amino acid composition was distinctly unlike those of other taxa (Fig. 5) as the DehHX contained a substantially Discussion higher number of acidic residues, i.e., 8.27% Asp and 12.06% Glu versus an average of 5.5% Asp and 7% Glu in the amino The increasing demand for more eco-friendly solutions to acid sequences of the non-halophiles. Similarly, the percentages clean up saline and hypersaline environments contaminated of positively charged residues, i.e., Lys and Arg, were signifi- with halogenated compounds has resulted in the scientific cantly lower in DehHX (1.3 and 2.7%, respectively) than the community turning their attention towards the halophilic dehalogenase-producing microorganisms over their non- 20 1.4 halophilic counterparts. The rationale behind this choice is 1.2 that such microorganisms have evolved unique cellular enzy- matic machinery that allows them to thrive in extreme saline 0.8 environments. In our study, we isolated, identified, and char- 0.6 8 acterized a novel halotolerant dehalogenase, DehHX, pro- 0.4 duced by P. halophila. Subsequent in silico assessments of 0.2 the DehHX protein provided useful insights into the physio- logical haloadaptation mechanisms which render P. halophila 0 0 024 48 72 96 Time (hour) HX well-adapted for survival in highly saline environments. 2,2-DCP Growth Since halophilic enzymes are defined in terms of the Fig. 4 Relationship between the concentration of 2,2-dichloropropionic halophily of the organism in which they are found or based acid (2,2-DCP) and the exponential and stationary portions of the growth on their salt requirements for activity, stability, or solubility curve of P. halophila HX in liquid minimal medium supplemented with 25% (w/v) NaCl and 2,2-DCP (20 mM) (Madern et al. 2000), the results of our study show that the 2,2-DCP Concentraton (mM) Absorbance 600nm 378 Ann Microbiol (2017) 67:371–382 Table 2 Multiple sequence Gene Identity (%) Source Accession number alignment of a fragment of the dehalogenase gene of P. halophila dehI 83.1 Pseudomonas putida strain PP3 AJ133460.1 HX (dehHX)with other Group I dehalogenase genes 52 Pseudomonas sp. 113 U97030 D,L-dex dehE 61.3 Rhizobium sp. RC1 Y15517 HadD 49.4 Pseudomonas putida strain AJ1 M81841 isolated P. halophila is well-adapted to using 2,2-DCP as its sole ranged from 6.95 to 8.15) on other microbes isolated from Tuz source of carbon, as evident from the almost complete depletion Gölü Lake (Zeki Camur and Mutlu 1996). The preference of of the compound (99.3%) after 96 h of incubation. These results P. halophila HX for slightly alkaline conditions can be attributed thus affirm the positive as well as competent utilization of the to the naturally high NaCl content in the thalassohaline Tuz Gölü substance by P. halophila HX. Remarkably, the growth of the Lake (Litchfield and Gillevet 2002;Oren 2008), although more bacterium was still observable in culture medium containing up neutral pH values have also been recorded (Oren 2002). to 40 mM of 2,2-DCP; beyond this concentration its viability Remarkably, this lake is both naturally alkaline and highly saline began to decline, presumably due to the increased toxicity of because of the seasonal evaporation periods that cause an ex- the compound (Bagherbaigi et al. 2013). Assessment of the effect tremely complex surface accumulation of alkaline soil within of salinity on the bacterium revealed that P. halophila HX is the ecosystem (Litchfield and Gillevet 2002;Oren 2008; exceptionally halotolerant, a quality not generally observed in Steadman and McMahon 2011). In addition to elevating the bacteria of the Pseudomonas family. These results reveal the pH, this phenomenon increases the concentration of NaCl in P. halophila HX was able to retain its viability even at high salt the lake (Litchfield and Gillevet 2002;Oren 2008), thereby fur- concentrations [25% (w/v) NaCl] and efficiently utilize the 2,2- ther enhancing the osmotic pressure difference between the DCP as its sole carbon source. Based on these characteristics, the aquatic life and the environment. A noteworthy point to highlight utilization of the bacterium as a potentially bioremediation agent here is the ability of DehHX from P. halophila HX to efficiently for cleaning up hypersaline or marine environments contaminat- degrade 2,2-DCP under highly alkaline and saline conditions. ed with halogenated compounds is feasible. The efficacy of the bacterium to degrade such toxic compound Since the efficacy of P. halophila HX to carry out bioremedi- as 2,2-DCP is unlike those seen in other non-halotolerant ation processes could be influenced by various factors, optimiza- dehalogenase-producing bacteria in which maximal catalyzing tion of the physical conditions related to microbial-assisted bio- activities are normally observed at neutral or slightly basic con- remediation processes is necessary (Ventosa 2006). In the case of ditions (Abdul Hamid et al. 2015; Liu et al. 2016). Hence, our the effect of pH, our results reveal that the growth of P. halophila study results suggest that DehHX has potential value for the self- HX reached the optimum state between pH 6.0 and 9.0, a finding cleaning and bioremediation of alkaline and saline environments which is in agreement with that of an earlier study (optimum pH polluted with halogenated hydrocarbons. Fig. 5 Bar graph comparing the numbers of each amino acid in the dehalogenase DehHX and the average number of each amino acid in dehalogenases from non- halophilic bacteria. Black bar DehHX, white bar Group I dehalogenases, including DehE from Rhizobium sp., DehI from Pseudomonas putida PP3, DL- DEX from Pseudomonas sp. 113, 7 and HadD from Pseudomonas putida strain AJ1 Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln Arg Ser Thr Val Trp Tyr Amino Acid Composition (%) Ann Microbiol (2017) 67:371–382 379 Fig. 6 Surface electrostatic potentials of three dehalogenases. a DehHX from P. halophila HX, b DehI from P. putida strain PP3, c DL-DEX from P. sp. 113. The electrostatic energy is reported in units of kT. Red Negative potential, blue positive potential We also examined the effect of temperature because the tem- development of this trait may be due to the heterogeneity of perature of a system can influence the equilibrium position of an the Tuz Gölü Lake habitat (Sorokin et al. 2006). The salinity enzyme–enzyme-catalyzed reaction, as well as the activity and of the lake fluctuates regularly in space and time, hence pre- stability of the enzyme (Mohamad et al. 2015). Our results dem- dominantly favoring the survival of euryhaline microorgan- onstrate that P. halophila HX was viable between 10 °C and isms (Sorokin et al. 2006). The increased oligotrophy and high 35 °C, which is similar to the temperature range reported in an salinity conditions in Tuz Gölü Lake indicate that the non- earlier study involving P. halophila DSM3050 isolated from the halophilic dehalogenases would not be able to survive in such GreatSaltLakeinthe USA(4–37 °C) (Ventosa et al. 1998). The environments as highly saline conditions could potentially slight variation in the optimal growth temperatures between alter protein folding of their enzymes and disrupt their active these two P. halophila strains is possibly due to their adaptation conformation. Moreover, changes in the hydrophobic and to living in different habitats. In the case of P. halophila electrostatic interactions that accompany fluctuations in salin- DSM3050, the temperature range of the Great Salt Lake can ity could also contribute to the structural destabilization and varyfrom26°Cinmid-Julyto4°Cduringthe springtime consequent inactivation of enzymes (Sorokin et al. 2006). (Crosman and Horel 2009), while the temperature fluctuations Although the average salinity of Tuz Gölü Lake is consider- in theupper regionsofthe TuzGölü Lakewater arebetween ably higher than 35% (w/v) NaCl, we noted that increasing the 12 °C and 37 °C during the summer/spring (Altınetal. 2012). concentration of NaCl in the growth medium of P. halophila to Hence, it can be inferred that the possible reason for the differ- beyond 25% (w/v) adversely affected the bacterium and ences in the optimal pH for these two P. halophila strainsisthe prevented its multiplication. This outcome may have been due substantial temperature variation between their two habitats. to the lack of carbon-containing nutrients other than 2,2-DCP. We also assessed the effect of agitation speed on the growth of An earlier report corroborates our observation, hence signifying P. halophila HX and found that agitation speeds between 150 the importance of nutrient availability for the survival and prop- and 250 rpm were appropriate to maintain the necessary amount agation of such bacteria in saline environments (Sorokin et al. of dissolved oxygen in the P. halophile HX growth medium. This 2006). However, the relatively broad salinity range preferred by is an important aspect to be considered when cultivating batch P. halophila HX suggests that this bacterium may be a suitable cultures of bacteria as a suitable agitation speed would conse- bioremediation agent for many saline environments, such as quently improve bacterial growth by ensuring that the bacterial seawater [3.5% (w/v) NaCl] polluted with halogenated culture suspension remains properly aerated and the nutrients hydrocarbons. sufficiently distributed and available. Furthermore, bacterial set- It is wide accepted that a highly saline environment can tlement to the bottom of the flask can result in increased cell significantly impact the solubility and stability of a protein death due to the lack of nutrient availability and should be and consequently its functionality (Oren 2008). Under such averted in order to result in the production of higher amounts conditions, the protein becomes dehydrated as water becomes of dehalogenase to catalyze the dehalogenation of 2,2-DCP. less available owing to the phenomenon of water molecules The ability of P. halophila HX to tolerate concentrations of being locked within ionic lattices (Mevarech et al. 2000). This −1 NaCl as high as 25% (w/v) (250 g l , 4.27 M) with a cell locking phenomenon causes the unfolding of the dehydrated doubling time of 25.4 ± 0.6 h is relatively similar to charac- hydrophobic residues located on the surface of the enzyme teristics reported for P. halophila DSM 3050 [up to 26.2% and subsequent clumping with other protein molecules, −1 (w/v) 262 g l , 4.5 M] (Sorokin et al. 2006). Interestingly, resulting in disruption of the protein’s stability. To counter such P. halophila HX grew well in all culture broths containing undesirable changes, the negatively charged surface of the NaCl concentrations as high as 25% (w/v). Unlike halophiles, DehHX protein, which is unusually rich in acidic residues, halotolerant microorganisms can grow well in a non-saline may have arisen as an evolutionary adaptive mechanism to environment, as was also observed for P. halophila HX. The allow the acidic residues to interact and bind with the remaining 380 Ann Microbiol (2017) 67:371–382 (PYO.ZRT.1911.15.001). MFE thanks the Libyan Government for the water molecules in the surrounding saline environment. scholarship award (Libyan Ministry of Higher Education Scholarship Additionally, the decreased hydrophobicity in DehHX (related Program No. 700/2007). to the high concentrations of surface acidic residues) is another excellent adaptation of the dehalogenase to better compete with ions for water molecules. This adaptative mechanism helps the References DehHX dehalogenase to improve its solubilization and hydra- tion (Frolow et al. 1996;Britton etal. 2006; Karan et al. 2012) Abdul Hamid AA, Tengku Abdul Hamid TH, Abdul Wahab R, Omar in such environments. Earlier studies that reported on the crystal MSS, Huyop F (2015) An S188V mutation alters substrate specificity structures of halophilic enzymes also demonstrated the pres- of non-stereospecific α-Haloalkanoic acid Dehalogenase E (DehE). ence of exceptionally high numbers of surface acidic amino PLoS One 10:e0121687. doi:10.1371/journal.pone.0121687 acids (Frolow et al. 1996; Madern et al. 2000). AltınTB, Barak B, Altın BN (2012) Change in precipitation and temper- ature amounts over three decades in central Anatolia, Turkey. Atmos Clim Sci 2:107. doi:10.4236/acs.2012.21013 Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Conclusions Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new gener- ation of protein database search programs. Nucleic Acids Res 25: 3389–3402. doi:10.1093/nar/25.17.3389 The results of this study highlight the isolation of a novel Baati H, Amdouni R, Gharsallah N, Sghir A, Ammar E (2010) Isolation and halotolerant bacterium, P. halophila HX, from Tuz Gölü characterization of moderately halophilic bacteria from Tunisian solar Lake which produces a dehalogenase, i.e., DehHX. DehHX saltern. Curr Microbiol 60:157–161. doi:10.1007/s00284-009-9516-6 from P. halophila HX is the first ever Group 1 haloalkanoic Badejo AC, Badejo AO, Shin KH, Chai YG (2013) A gene expression dehalogenase isolated from a hypersaline environment. The study of the activities of aromatic ring-cleavage dioxygenases in Mycobacterium gilvum PYR-GCK to changes in salinity and pH bacterium was found to almost completely degrade 2,2-DCP during pyrene degradation. PLoS One 8:e58066. doi:10.1371/ after 96 h of incubation (99%) and to utilize this compound as journal.pone.0058066 the sole carbon and energy source. Correspondingly, our ho- Bagherbaigi S, Gicana RG, Lamis RJ, Nemati M, Huyop F (2013) mology modeling study strongly suggests that P. halophila Characterisation of Arthrobacter sp. S1 that can degrade α and β- HX has evolutionarily adapted to the extreme hypersaline haloalkanoic acids isolated from contaminated soil. Ann Microbiol 63:1363–1369. doi:10.1007/s13213-012-0595-4 and alkaline environment of Lake Tuz Gölü, as inferred from Barth PT, Bolton L, Thomson JC (1992) Cloning and partial sequencing of an the unique DehHX protein generated in this study, which operon encoding two Pseudomonas putida haloalkanoate showed the presence of an exceptionally high number of sur- dehalogenases of opposite stereospecificity. J Bacteriol 174:2612–2619 face acidic residues, in contrary to the non-haloterant Besseling E, Wegner A, Foekema EM, van den Heuvel-Greve MJ, dehalogenases. It is worth mentioning here that the unusually Koelmans AA (2013) Effects of Microplastic on fitness and PCB bioaccumulation by the lugworm Arenicola marina (L.) Environ Sci high number of surface acidic residues on the DehHX protein Technol 47:593–600. doi:10.1021/es302763x suggest that this dehalogenase has a higher water-binding ca- Biasini M, Bienert S, Waterhouse A, Arnold K, Studer G, Schmidt T, pacity and therefore can remain sufficiently hydrated under Kiefer F, Cassarino TG, Bertoni M, Bordoli L, Schwede T (2014) highly saline and alkaline conditions. The findings in the in SWISS-MODEL: modelling protein tertiary and quaternary struc- ture using evolutionary information. Nucleic Acids Res 42:W252– silico study corroborate the efficiency of DehHX to degrade W258. doi:10.1093/nar/gku340 nearly all of the 2,2-DCP, even when this substance is present Birbir M, Ogan A, Calli B, Mertoglu B (2004) Enzyme characteristics of at very high percentages of NaCl in the growth medium. extremely Halophilic Archaeal Community in Tuzkoy Salt Mine, Correspondingly, our findings confirm our hypothesis that Turkey. World J Microbiol Biotechnol 20:613–621. doi:10.1023/ B:WIBI.0000043185.06176.b8 P. halophila has adapted well to living under such conditions. Birbir M, Calli B, Mertoglu B, Bardavid RE, Oren A, Ogmen MN, Ogan In general, we have shown that bio-prospecting for halogen- A (2007) Extremely halophilic Archaea from Tuz Lake, Turkey, and degrading microorganisms in highly saline environments is the adjacent Kaldirim and Kayacik salterns. World J Microbiol not only feasible, but potentially a more practical as well as Biotechnol 23:309–316. doi:10.1007/s11274-006-9223-4 eco-friendly strategy for cleaning up contaminated coastal Birnbaum LS, Fenton SE (2003) Cancer and developmental exposure to endocrine disruptors. Environ Health Perspect 111:389–394 areas. The findings reported here further provide useful in- Britton KL, Baker PJ, Fisher M, Ruzheinikov S, Gilmour DJ, Bonete MJ, sights into the engineering and tailoring of specific proteins Ferrer J, Pire C, Esclapez J, Rice DW (2006) Analysis of protein that could function under extreme industrial and environmen- solvent interactions in glucose dehydrogenase from the extreme hal- tal conditions. ophile Haloferax mediterranei. Proc Natl Acad Sci U S A 103: 4846–4851. doi:10.1073/pnas.0508854103 Castillo-Carvajal LC, Sanz-Martín JL, Barragán-Huerta BE (2014) Acknowledgments The Fundamental Research Grant Scheme from Biodegradation of organic pollutants in saline wastewater by halo- the Ministry of Higher Education Malaysia (FRGS philic microorganisms: a review. Environ Sci Pollut Res 21:9578– R.J130000.7826.4F649) and the Research University Grant Scheme from 9588. doi:10.1007/s11356-014-3036-z the Ministry of Education, Malaysia (GUP Q.J130000.2545.09H95) from Chandra S, Sharma R, Singh K, Sharma A (2013) Application of biore- the Universiti Teknologi, Malaysia supported this work. YK would like to mediation technology in the environment contaminated with thank Ondokuz Mayiz University for joint financial support of the project Ann Microbiol (2017) 67:371–382 381 petroleum hydrocarbon. Ann Microbiol 63:417–431. doi:10.1007/ Hareland WA, Crawford RL, Chapman PJ, Dagley S (1975) s13213-012-0543-3 Metabolic function and properties of 4hydroxyphenylacetic Chen J, Wong MH, Wong YS, Tam NFY (2008) Multi-factors on biodeg- acid 1-hydroxylase from Pseudomonas acidovorans.J radation kinetics of polycyclic aromatic hydrocarbons (PAHs) by Bacteriol 121:272–285 Sphingomonas sp. a bacterial strain isolated from mangrove sediment. Haritash AK, Kaushik CP (2009) Biodegradation aspects of polycyclic Mar Pollut Bull 57:695–702. doi:10.1016/j.marpolbul.2008.03.013 aromatic hydrocarbons (PAHs): a review. J Hazard Mater 169:1–15. doi:10.1016/j.jhazmat.2009.03.137 Chiba Y, Yoshida T, Ito N, Nishimura H, Imada C, Yasuda H, Sako Y (2009) Isolation of a bacterium possessing a haloacid dehalogenase Hayes TB, Case P, Chui S, Chung D, Haeffele C, Haston K, Lee M, Mai VP, from a marine sediment core. Microbes Environ 24:276–279. doi: Marjuoa Y, Parker J, Tsui M (2006) Pesticide mixtures, endocrine dis- 10.1264/jsme2.ME09123 ruption, and amphibian declines: are we underestimating the impact? Chua EM, Shimeta J, Nugegoda D, Morrison PD, Clarke BO (2014) Environ Health Perspect 114:40–50. doi:10.1289/ehp.8051 Assimilation of polybrominated diphenyl ethers from microplastics Hill KE, Marchesi JR, Weightman AJ (1999) Investigation of two evolu- by the marine amphipod, Allorchestes compressa. Environ Sci tionarily unrelated halocarboxylic acid dehalogenase gene families. Technol 48:8127–8134. doi:10.1021/es405717z J Bacteriol 181:2535–2547 Colovos C, Yeates TO (1993) Verification of protein structures: patterns Karan R, Capes MD, DasSarma S (2012) Function and biotechnology of of nonbonded atomic interactions. Protein Sci 2:1511–1519. doi:10. extremophilic enzymes in low water activity. Aquat Biosyst 8:1. doi: 1002/pro.5560020916 10.1186/2046-9063-8-4 Colwell RR, Grigorova R (eds) (1987) Current methods for classification Kästner M, Breuer-Jammali M, Mahro B (1998) Impact of inoculation and identification of microorganisms. Methods in microbiology, vol. protocols, salinity, and pH on the degradation of polycyclic aromatic 19. CABI, Wallingford. doi:10.1002/jobm.3620290610 hydrocarbons (PAHs) and survival of PAH-degrading bacteria intro- Corpet F (1988) Multiple sequence alignment with hierarchical clustering. duced into soil. Appl Environ Microbiol 64:359–362 Nucleic Acids Res 16:10881–10890. doi:10.1093/nar/16.22.10881 Kloos WE, Tornabene TG, Schleifer KH (1974) Isolation and character- Crosman ET, Horel JD (2009) MODIS-derived surface temperature of the ization of Micrococci from human skin, including two new species: Great salt Lake. Remote Sens Environ 113:73–81. doi:10.1016/j.rse. Micrococcus lylae and Micrococcus kristinae. Int J Syst Bacteriol 2008.08.013 24:79–101. doi:10.1099/00207713-24-1-79 DeLano WL (2002) Pymol: an open-source molecular graphics tool. Kurihara T, Esaki N (2008) Bacterial hydrolytic dehalogenases and relat- CCP4 Newsl Protein Crystallogr 40:82–92 ed enzymes: occurrences, reaction mechanisms, and applications. Díaz MP, Boyd KG, Grigson SJW, Burgess JG (2002) Biodegradation of Chem Rec 8:67–74 crude oil across a wide range of salinities by an extremely halotolerant Kushner D, Kamekura M (1988) Physiology of halophilic eubacteria. In: bacterial consortium MPD-M, immobilized onto polypropylene fi- Rodriguez-Valera F (ed)Halophilic bacteria, vol. 1. CRC Press, bers. Biotechnol Bioeng 79:145–153. doi:10.1002/bit.10318 Boca Raton, pp 87–103 Dibble JT, Bartha R (1979) Effect of environmental parameters on the Laskowski RA, MacArthur MW, Moss DS, Thornton JM (1993) biodegradation of oil sludge. Appl Environ Microbiol 37:729–739 PROCHECK: a program to check the stereochemical quality of protein Duarte CM, Holmer M, Olsen Y, Soto D, Marbà N, Guiu J, Black K, structures. J Appl Crystallogr 26:283–291. doi:10.1107/ Karakassis I (2009) Will the oceans help feed humanity? Bioscience S0021889892009944 59:967–976. doi:10.1525/bio.2009.59.11.8 Lefebvre O, Tan Z, Kharkwal S, Ng HY (2012) Effect of increasing anodic Dundas IE (1977) Physiology of the Halobacteriaceae. In: Rose H, NaCl concentration on microbial fuel cell performance. Bioresour Tempest DW (eds) Advances in microbiology and physiology, vol Technol 112:336–340. doi:10.1016/j.biortech.2012.02.048 15. A.P., London, pp 85–120 Lerner MG, Carlson HA (2006) APBS plugin for PyMOL. University of Eriksson M, Ka J-O, Mohn WW (2001) Effects of low temperature and Michigan, Ann Arbor freeze-thaw cycles on hydrocarbon biodegradation in Arctic tundra Liithy R, Bowie JU, Eisenberg D (1992) Assessment of protein models soil. Appl Environ Microbiol 67:5107–5112. doi:10.1128/AEM.67. with three-dimensional profiles. Nature 356:83–85 11.5107-5112.2001 Litchfield CD, Gillevet PM (2002) Microbial diversity and complexity in Faller A, Schleifer KH (1981) Modified oxidase and benzidine tests for hypersaline environments: a preliminary assessment. J Ind separation of staphylococci from micrococci. J Clin Microbiol 13: Microbiol Biotechnol 28:48–55. doi:10.1038/sj/jim/7000175 1031–1035 Liu X, Gou Z, Hu Q, Wang J, Chen K, Xu C, Li S, Jiang J (2016) Hydrolytic Fetzner S (2010) Aerobic degradation of halogenated Aliphatics. In: dehalogenation of the chlorothalonil isomer o-tetrachlorophthalonitrile Timmis KN (ed) Handbook of hydrocarbon and lipid microbiology. by Pseudochrobactrum sp. BSQ-1. Int Biodeterior Biodegron 107:42– Springer, Berlin, pp 865–885. doi:10.1007/978-3-540-77587-4_62 47. doi: 10.1016/j.ibiod.2015.11.006 Frolow F, Harel M, Sussman JL, Mevarech M, Shoham M (1996) Madern D, Ebel C, Zaccai G (2000) Halophilic adaptation of enzymes. Insights into protein adaptation to a saturated salt environment from Extremophiles 4:91–98. doi:10.1007/s007920050142 the crystal structure of a halophilic 2Fe-2S ferredoxin. Nat Struct Matturro B, Presta E, Rossetti S (2016) Reductive dechlorination of Biol 3:452–458. doi:10.1038/nsb0596-452 tetrachloroethene in marine sediments: biodiversity and Garrity G, Boone DR, Castenholz RW (2012) The archaea and the deeply dehalorespiring capabilities of the indigenous microbes. Sci Total branching and phototrophic bacteria. Bergey’s manual of systematic Environ 545–546:445–452. doi:10.1016/j.scitotenv.2015.12.098 bacteriology, vol. 1. Springer Science & Business Media, Berlin Mehrshad M, Amoozegar MA, Makhdoumi A, Rasooli M, Asadi B, Heidelberg New York Schumann P, Ventosa A (2015) Halovarius luteus gen. nov., sp. nov., Gasteiger E, Hoogland C, Gattiker A (2005) Protein identification and a novel extremely halophilic archaeon from Urmia salt lake, Iran. Int J analysis tools on the ExPASy server. Humana Press, New York Syst Evol Microbiol 65:2420–2425. doi:10.1099/ijs.0.000279 Gribble GW (2009) Naturally occurring organohalogen compounds-a Meng C, He Q, Huang J-W, Cao Q, Yan X, Li S-P, Jiang J-D (2015) comprehensive update. Progress in the chemistry oforganic natural Degradation of chlorothalonil through a hydrolytic dehalogenase products, vol 91. Springer Science & Business Media, Berlin secreted from Bacillus subtilis WB800. Int Biodeterior Biodegr Heidelberg New York 104:97–104. doi:10.1016/j.ibiod.2015.05.017 Häggblom MM, Knight VK, Kerkhof LJ (2000) Anaerobic decomposi- Mevarech M, Frolow F, Gloss LM (2000) Halophilic enzymes: proteins tion of halogenated aromatic compounds. Environ Pollut 107:199– with a grain of salt. Biophys Chem 86:155–164. doi:10.1016/ S0301-4622(00)00126-5 207. doi:10.1016/S0269-7491(99)00138-4 382 Ann Microbiol (2017) 67:371–382 Mohamad NR, Buang NA, Mahat NA, Lok YY, Huyop F, Aboul-Enein molecular analysis of the gene and formation of carbon monoxide from trihaloacetate by the enzyme. Eur J Biochem 250:789–793. HY, Wahab RA (2015) A facile enzymatic synthesis of geranyl propionate by physically adsorbed Candida rugosa lipase onto doi:10.1111/j.1432-1033.1997.00789.x multi-walled carbon nanotubes. Enzym Microb Technol 72:49–55. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: doi:10.1016/j.enzmictec.2015.02.007 molecular evolutionary genetics analysis version 6.0. Mol Biol Evol Mohn WW, Stewart GR (2000) Limiting factors for hydrocarbon biodeg- 30:2725–2729. doi:10.1093/molbev/mst197 radation at low temperature in arctic soils. Soil Biol Biochem 32: Tang YJ, Carpenter SD, Deming JW, Krieger-Brockett B (2006) Depth- 1161–1172. doi:10.1016/S0038-0717(00)00032-8 related influences on biodegradation rates of phenanthrene in pollut- Moran P, Coats B (2012) Biological sample preparation for SEM imaging ed marine sediments of Puget sound, WA. Mar Pollut Bull 52:1431– of porcine retina. Microscopy Today 20:28–31 1440. doi:10.1016/j.marpolbul.2006.04.009 Nardi-Dei V, Kurihara T, Park C, Esaki N, Soda K (1997) Bacterial DL-2- Tejeda-Agredano MC, Gallego S, Niqui-Arroyo JL, Vila J, Grifoll M, haloacid dehalogenase from Pseudomonas sp. strain 113: gene clon- Ortega-Calvo JJ (2010) Effect of interface fertilization on biodegra- ing and structural comparison with D- and L-2-haloacid dation of polycyclic aromatic hydrocarbons present in nonaqueous- dehalogenases. J Bacteriol 179:4232–4238 phase liquids. Environ Sci Technol 45:1074–1081. doi:10.1021/ Novak HR, Sayer C, Isupov MN, Gotz D, Spragg AM, Littlechild JA es102418u (2014) Biochemical and structural characterisation of a haloalkane Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, dehalogenase from a marine Rhodobacteraceae. FEBS Lett 588: Rozen SG (2012) Primer3—new capabilities and interfaces. Nucleic 1616–1622. doi:10.1016/j.febslet.2014.02.056 Acids Res 40:e115–e115 Oren A (2002) Molecular ecology of extremely halophilic archaea and Uribe-Jongbloed A, Bishop PL (2007) Comparative study of PAH re- bacteria. FEMS Microbiol Ecol 39:1–7. doi:10.1111/j.1574-6941. moval efficiency under absence of molecular oxygen: effect of elec- 2002.tb00900.x tron acceptor and hydrodynamic conditions. J Environ Eng Sci 6: Oren A (2008) Microbial life at high salt concentrations: phylogenetic 367–376. doi:10.1139/s06-057 and metabolic diversity. Saline Syst 4:1–13. doi:10.1186/1746- Van Der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE, Berendsen 1448-4-2 HJC (2005) GROMACS: fast, flexible, and free. J Comput Chem Oren A (2010) Industrial and environmental applications of halophilic 26:1701–1718. doi:10.1002/jcc.20291 microorganisms. Environ Technol 31:825–834. doi:10.1080/ Van Pée KH, Unversucht S (2003) Biological dehalogenation and halo- genation reactions. Chemosphere 52:299–312. doi:10.1016/S0045- Oren A, Gurevich P, Azachi M, Henis Y (1992) Microbial degradation of 6535(03)00204-2 pollutants at high salt concentrations. Biodegradation 3:387–398. Ve Habitatlar AM (2002) Alkaliphilic micro-organisms and habitats. Turk doi:10.1007/BF00129095 JBiol 26:181–191 Ortega-Calvo J-J, Gschwend PM (2010) Influence of low oxygen ten- Ventosa A (2006) Unusual micro-organisms from unusual habitats: hy- sions and sorption to sediment black carbon on biodegradation of persaline environments. In: Symposia of the Society for General pyrene. Appl Environ Microbiol 76:4430–4437. doi:10.1128/AEM. Microbiology 1999. Cambridge University Press, Cambridge, p 223 00461-10 Ventosa A, Nieto JJ, Oren A (1998) Biology of moderately halophilic Qing Li Q, Loganath A, Seng Chong Y, Tan J, Philip Obbard J (2006) aerobic bacteria. Microbiol Mol Biol Rev 62:504–544 Persistent organic pollutants and adverse health effects in humans. J Wang G, Liang B, Li F, Li S (2011) Recent advances in the biodegrada- Toxic Environ Health A 69:1987–2005. doi:10.1080/ tion of Chlorothalonil. Curr Microbiol 63:450–457. doi:10.1007/ s00284-011-0001-7 Sanchez-Porro C, Martin S, Mellado E, Ventosa A (2003) Diversity of Wei X, Jiang Y, Chen X, Jiang Y, Lai H (2015) Amycolatopsis flava sp. moderately halophilic bacteria producing extracellular hydrolytic nov., a halophilic actinomycete isolated from Dead Sea Antonie van enzymes. J Appl Microbiol 94:295–300. doi:10.1046/j.1365-2672. Leeuwenhoek doi:10.1007/s10482-015-0542-z 2003.01834.x Xiang W, Guo J, Feng W, Huang M, Chen H, Zhao J, Zhang J, Yang Z, Schmidberger JW, Wilce JA, Weightman AJ, Whisstock JC, Wilce MCJ Sun Q (2008) Community of extremely halophilic bacteria in his- (2008) The crystal structure of DehI reveals a new alpha-haloacid toric Dagong brine well in southwestern China. World J Microbiol dehalogenase fold and active-site mechanism. J Mol Biol 378:284– Biotechnol 24:2297–2305. doi: 10.1007/s11274-008-9744-0 294. doi:10.1016/j.jmb.2008.02.035 Zanaroli G, Negroni A, Häggblom MM, Fava F (2015) Microbial Slater JH, Bull AT, Hardman DJ (1995) Microbial dehalogenation. dehalogenation of organohalides in marine and estuarine environ- Biodegradation 6:181–189. doi:10.1007/bf00700456 ments. Curr Opin Biotechnol 33:287–295. doi:10.1016/j.copbio. Sorokin DY, Tourova TP, Galinski EA, Belloch C, Tindall BJ (2006) 2015.03.013 Extremely halophilic denitrifying bacteria from hypersaline inland Zeki Camur M, Mutlu H (1996) Major-ion geochemistry and mineralogy lakes, Halovibrio denitrificans sp.nov.and Halospina denitrificans of the salt Lake (Tuz Gölü) basin, Turkey. Chem Geol 127:313–329. gen. nov., sp. nov., and evidence that the genus name Halovibrio doi:10.1016/0009-2541(95)00129-8 Fendrich 1989 with the type species Halovibrio variabi.IntJ Syst Evol Microbiol 56:379–388. doi:10.1099/ijs.0.63964-0 Zhang J, Xin Y, Cao X, Xue S, Zhang W (2014) Purification and char- Steadman SR, McMahon G (2011) The Oxford handbook of ancient acterization of 2-haloacid dehalogenase from marine bacterium Anatolia. Oxford University Press, Oxford Paracoccus sp. DEH99, isolated from marine sponge Stringfellow JM, Cairns SS, Cornish A, Cooper RA (1997) Hymeniacidon perlevis. J Ocean Univ China 13:91–96. doi:10. Haloalkanoate dehalogenase II (DehE) of a Rhizobium sp.- 1007/s11802-014-2357-3

Journal

Annals of Microbiology – Springer Journals

Published: May 2, 2017

There are no references for this article.