Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Identification and characterization of seven new exon 11-associated splice variants of the rat mu opioid receptor gene, OPRM1

Identification and characterization of seven new exon 11-associated splice variants of the rat mu... Background: The mouse mu opioid receptor (OPRM1) gene undergoes extensive alternative splicing at both the 3’- and 5’-ends of the gene. Previously, several C-terminal variants generated through 3’ splicing have been identified in the rat OPRM1 gene. In both mice and humans 5’ splicing generates a number of exon 11-containing variants. Studies in an exon 11 knockout mouse suggest the functional importance of these exon 11-associated variants in mediating the analgesic actions of a subset of mu opioids, including morphine-6b-glucuronide (M6G) and heroin, but not others such as morphine and methadone. We now have examined 5’ splicing in the rat. Results: The current studies identified in the rat a homologous exon 11 and seven exon 11-associated variants, suggesting conservation of exon 11 and its associated variants among mouse, rat and human. RT-PCR revealed marked differences in the expression of these variants across several brain regions, implying region-specific mRNA processing of the exon 11-associated variants. Of the seven rat exon 11-associated variants, four encoded the identical protein as found in rMOR-1, two predicted 6 TM variants, and one, rMOR-1H2, generated a novel N- terminal variant in which a stretch of an additional 50 amino acids was present at the N-terminus of the previously established rMOR-1 sequence. When expressed in CHO cells, the presence of the additional 50 amino acids in rMOR-1H2 significantly altered agonist-induced G protein activation with little effect on opioid binding. Conclusion: The identification of the rat exon 11 and its associated variants further demonstrated conservation of 5’ splicing in OPRM1 genes among rodents and humans. The functional relevance of these exon 11 associated variants was suggested by the region-specific expression of their mRNAs and the influence of the N-terminal sequence on agonist-induced G protein coupling in the novel N-terminal variant, rMOR-1H2. The importance of the exon 11-associated variants in mice in M6G and heroin analgesia revealed in the exon 11 knockout mouse implies that these analogous rat variants may also play similar roles in rat. The complexity created by alternative splicing of the rat OPRM1 gene may provide important insights of understanding the diverse responses to the various mu opioids seen in rats. Background range of responses among patients, a variability con- Three families of opioid receptors were proposed from firmed among different strains of mice. These findings, pharmacological studies [1,2]. Of the three opioid recep- along with receptor binding studies and the actions of tor families, the mu opioid receptors are particularly selective antagonists, led us to propose the existence of important since they mediate the actions of most of the multiple mu opioid receptor subtypes [3] long before clinically relevant opioids, as well as those most widely the molecular characteristics of mu receptors were abused such as heroin. Clinicians have observed a wide known. The molecular cloning of the mu opioid receptor (MOR-1) [4-6] opened new opportunities to investigate * Correspondence: pany@mskcc.org the molecular underpinnings for the concept of multiple Department of Neurology and Program in Molecular Pharmacology and Chemistry, Memorial Sloan-Kettering Cancer Center, New York, NY 10065, mu opioid receptors. A single mu opioid receptor gene USA (OPRM1) has been identified in mammals, raising Full list of author information is available at the end of the article © 2011 Xu et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Xu et al. Molecular Pain 2011, 7:9 Page 2 of 14 http://www.molecularpain.com/content/7/1/9 questions on how to reconcile a single gene with the therefore contribute to the disparities in mu agonist- multiple pharmacologically defined mu opioid receptors. induced receptor internalization. One possibility is alternative pre-mRNA splicing, which In themouse,OPRM1 generatesasetofsplicevar- can provide enormous RNA and protein diversity. A iants associated with exon 11, located approximately number of G protein-coupled receptors undergo alterna- 30 kb upstream of exon 1, under the control of a distinct tive splicing, such as dopamine D [7,8], somatostatin 2 exon 11 promoter [24,28]. Of nine exon 11-associated [9], prostaglandin EP [10], serotonin receptor subtypes variants, three variants encoded the original mMOR-1 [11], tachykinin NK(2) [12], metabotropic glutamate protein, five variants lacked exon 1 and predicted a 6 TM receptor protein, and one variant predicted a protein receptor [13,14], and metabotropic muscarinic acetyl- choline receptors [15,16]. Antisense mapping studies with single TM. The functional relevance of exon provided early evidence suggesting alternative splicing of 11-associated variants was established by studies in an the mouse and rat OPRM genes [17,18], which was exon 11 KO mouse model [42]. Unlike the exon 1 KO further supported by the studies in an exon 1 knockout mouse developed by Pintar [19], the exon 11 KO mouse (KO) mouse model generated by Pintar and colleagues retained full sensitivity towards morphine and metha- [19]. In this mouse, loss of exon 1 eliminated all the full done analgesia while the effects of M6G, fentanyl and length variants, which contain exon 1. However, a series heroin were greatly attenuated. This suggested that exon of exon 11-associated variants lacking exon 1 were still 11 associated variants mediated the actions of a subset of expressed. Pharmacologically, disrupting exon 1 in this mu opioids, including M6G and heroin. mouse completely abolished morphine analgesia, but Previous studies also have reported many splice var- not that of either M6G or heroin, consistent with the iants from the rat OPRM1 gene [20,25] (Figures 1 & 2), possibility that alternatively spliced transcripts lacking as well as the human OPRM1 gene [21,26,28,32,33]. The exon 1 might be responsible for the residual M6G and current study reports the identification and characteriza- heroin actions. tion of the rat exon 11 homolog and seven exon 11- In recent years, alternative splicing of the OPRM1 genes associated variants. has been extensively explored by our group and others [20-34]. In the mouse OPRM1 gene, over 28 alternatively Results spliced variants have been isolated. Of these splice var- Cloning the rat exon 11-associated splice variants iants, most are C-terminal variants that were generated To determine whether the rat OPRM1 gene contained an through alternative splicing between exon 3 and 10 differ- exon homologous to the mouse exon 11, we blasted the ent downstream exons [35]. These C-terminal variants rat genome database in Ensembl using the mouse exon from mice, rats and humans bound mu opioids with simi- 11 sequence and found a highly homologous sequence lar high affinities, but displayed marked differences in ago- with 86% identity, which included both coding and adja- nist-induced G protein coupling in both their potency, cent intron regions that included the splice site (Figure 3). defined by the EC values, and efficacy, indicated by the We designated this sequence as the rat exon 11. The rat maximal stimulation[25,27,36,37]. Although it can be exon 11 was located at about 21 kb upstream of exon 1 speculated that different C-terminal tails may alter interac- in the rat OPRM1 locus of chromosome 1, a distance tions of receptor with different G proteins or other related similar to the 30 kb seen in the mouse OPRM1 gene [24] proteins like regulator of G protein signaling (RGS) pro- and the 28 kb in the human OPRM1 gene [28]. However, teins based upon their intracellular location, the underly- the sequence of the rat exon 11 predicted only seven ing mechanisms for these differences remain unclear. amino acids before encountering a stop codon. To isolate Morphine-induced internalization also varied among the potential rat exon 11-associated splice variants homolo- C-terminal variants. For example, morphine given intra- gous to those identified in the mouse OPRM1 gene, we cerebroventricularly in vivo internalized mMOR-1C in the performed RT-PCR using sense primers designed from mouse lateral septum, while mMOR-1 is not internalized the rat exon 11 sequence together with two antisense pri- by morphine [38]. Mu agonist-induced interaction of mers from the 3’UTR of exon 4. We identified seven phosphorylated mu opioid receptor with b-arrestins have exon 11-associated splice variants, rMOR-1G1, rMOR- been indicated to involve the receptor internalization and 1G2, rMOR-1H1, rMOR-1H2, rMOR-1i1, rMOR-1i2 and desensitization [39-41]. Various additional phosphoryla- rMOR-1i3, from rat brain (Figures 1B, 2 &4). tion sites for b-adrenergic receptor kinase, protein kinase The rat exon 11 contained an alternative splice site C, caseine kinase, tyrosine kinase and cAMP- and cGMP- that divided the exon into two parts, a pattern similar to dependent protein kinases have been predicted among dif- that seen in the human exon 11 [28], which we assigned ferent C-termini [35]. Although highly speculative, these as exon 11a and exon 11b. Alternative usage of the two phosphorylation sites at different C-termini may differen- splice sites in the exons 11a and 11b led to the series of splice variants. rMOR-1G1 contained exons 11a/11b/2/ tially modulate the recruitment of b-arrestins and Xu et al. Molecular Pain 2011, 7:9 Page 3 of 14 http://www.molecularpain.com/content/7/1/9 A. Genomic structure 1 3 11 5 9 2 15 4 10 6 7 8 Exon a/b c/b/a a/b b/a b/a E11 Promoter E1 Promoter Intron (kb) 31 0.8 1 7 9 63 23 28 7 60 21 7 B. Alternatively spliced variants rMOR-1 rMOR-1A rMOR-1B1 rMOR-1B2 rMOR-1C1 rMOR-1C2 rMOR-1D rMOR-1P rMOR-1S rMOR-1G1 rMOR-1G2 rMOR-1H1 rMOR-1H2 rMOR-1i1 rMOR-1i2 rMOR-1i3 Figure 1 Schematic of the rat OPRM1 gene structure and alternative splicing. A. Genomic structure of the rat OPRM1gene. Exons and introns are showed by boxes and horizontal lines, respectively. Translational start and termination sites are indicated by downward and upward lines on exon boxes, respectively. Exons are numbered based upon their time of discovery, as previously reported. B. Alternatively spliced variants of the rat OPRM1 gene. Exon composition for each alternatively spliced variant was indicated by appropriate exon boxes. The lines between exons are introns that are spliced out during splicing. Translation start and stop points are shown by bars below and above exon boxes, respectively. rMOR-1 rMOR-1H1 rMOR-1i1 rMOR-1G1 rMOR-1i2 rMOR-1i3 Exon 11 M M E A F S K S A F Q K L mE11 GCGGGATCTGGGCCGATGATGGAAGCTTTCTCTAAGTCTGCATTCCAAAAGCT rE11 ATGGGATCTGGTCCAATGCTGTAAGCTTTCTCCAAGTCCGCATTCCAAAAACT M G S G P M L * A F S K S A F Q K L Exon 11b Exon 11a intron R Q R D G N Q E G K S Y L R mE11 CAGACAGAGAGATGGAAATCAAGAGGGGAAGAGTTACCTCAGgttggtttctc rMOR-1H2 rMOR-1G2 rE11 G-GACAGGGAGATAGAAATCAAGAGGGGAAG--TTACCTCAGgtgggcttctc D R E I E I K R G S Y L R intron mE11 ttcagactgtagtgatggctttgtctgaactatttgcctctcttccctgc--- rE11 ttcagagtgtagcgatggctttgcctgaactaattgcctctcttttctgc--- Figure 3 Sequence comparison of the rat exon 11 with the mouse exon 11. The nucleotide sequences and their deduced amino acids of the mouse exon 11 (mE11) and the rat exon 11 11a Exons 1 2 3 4 (rE11) are shown by capital letters. Intron sequences are indicated Figure 2 Schematic of protein structures predicted from Exon by low letters. The identical nucleotides are indicated by non-italic 11-associated variants. Colored bars indicate proteins predicted letters and diverse nucleotides by italic letters. Exon-exon and exon- from different exons. intron boundaries are indicated by arrows. Xu et al. Molecular Pain 2011, 7:9 Page 4 of 14 http://www.molecularpain.com/content/7/1/9 Figure 4 The partial nucleotide sequence and predicted amino acid sequence of the rat variants. Exon-exon boundaries are indicated by arrows. The stop codons are showed by *. The complete cDNA and deduced amino acid sequences of rMOR-1G1, rMOR-1G2, rMOR-1H1, rMOR- 1H2, rMOR-1i1, rMOR-1i2 and rMOR-1i3 have been deposited in the GenBank database with Accession numbers: DQ680043, EU024650, EU340244, EU024651, EU340245, EU024652 and EU340246, respectively. Xu et al. Molecular Pain 2011, 7:9 Page 5 of 14 http://www.molecularpain.com/content/7/1/9 3/4. If the AUG in exon 11a was used, rMOR-1G1 only predicted a peptide with seven amino acids since the stop codon predicted from exon 11b terminated its translation. However, rMOR-1G1 still could use the first AUG from exon 2 as the translational start codon to yield a 6 TM protein, a situation similar to that human hMOR-1G1 [28], the mu receptor [31] and hMOR-1K [33]. rMOR-1G2 had the same exon composition as rMOR-1G1 except that the stop codon in exon 11b was skipped due a downstream splice site of exon 11a. Thus, like both mMOR-1G and hMOR-1G2, translation of rMOR-1G2 can proceed from the exon 11a AUG to encode a 6 TM protein since the exon 11a reading- frame was in frame with that of exons 2/3/4 (Figures 2 &3). Thetwo AUGs inexon11awereinthe same reading-frame and separated by four amino acids. We arbitrarily assigned the first AUG as the translational start codon for rMOR-1G2, although it is not clear which AUG is actually used. The other five variants, rMOR-1H1, rMOR-1H2, rMOR-1i1, rMOR-1i2 and rMOR-1i3, contained exons 11a, 1a, 2, 3 and 4, but with alternative splicing among exons 11a, 11b, 1a, 1b and 1c to generate different tran- scripts. Despite their differences in exon composition, rMOR-1H1, rMOR-1i1, rMOR-1i2 and rMOR-1i3 all predicted the same protein sequence as the original rMOR-1 when using AUG in exon 1a as translational start codon (Figure 1B, 2 & 4). Translation from the AUG of exon 11a predicted a short protein sequence due to early translation termination within exon 11b, exons 1b or 1c. The ability of four different exon11-con- taining transcripts to encoded the same protein as rMOR-1 protein mimics three mouse exon 11-contain- ing variants, mMOR-1H, mMOR-1I and mMOR-1J [24]. The predicted protein sequence of rMOR-1H2 was intri- guing. Splicing from exon 11a to exon 1a gave rise to a sequence that predicted an in-frame fusion protein from exon 11a to exons 1a/2/3/4 when the AUG in exon 11a was used as the translational start codon (Figures 2 & 4). Thus, rMOR-1H2 encoded a novel receptor protein con- taining the same amino acid sequence as rMOR-1, but with an additional 50 amino acids at the N-terminus. In vitro transcription coupled translation revealed a molecu- lar weight for rMOR-1H2 that was approximately 5 kD Figure 5 In vitro translation of rMOR-1 and rMOR-1H2. In vitro higher than that of rMOR-1, suggesting the preferential transcription coupled translation was performed as described in the usage of the AUG in exon 11a to initiate translation methods section. (Figure 5). The 50 amino acid sequence did not contain a predicted transmembrane domain, implying that rMOR- 1H2 still encoded a 7 TM protein. Interestingly, the addi- 2/3a probe, designated to detect most of the variant tional sequence did possess a potential N-glycosylation site. mRNAs, hybridized several heavy and diffuse bands ranging from 2 - 15 kb, a band pattern similar to Northern blots Expression of the rat exon 11-associated variant mRNAs using mouse and human brains with their respective exon Therelativesizeand abundanceofthevariantmRNAs was 2/3a probes [24,37]. The exon 11 probe detected a major assessed using Northern blot analysis (Figure 6). The exon strong band around 12 kb. A similar band with relatively Xu et al. Molecular Pain 2011, 7:9 Page 6 of 14 http://www.molecularpain.com/content/7/1/9 expression was mainly observed in the brain stem. The brain stem expressed all the variants at relatively high levels except for rMOR-1H1, whereas the hypothalamus expressed the most variants at very low levels. These results suggested region-specific alternative splicing of these variant pre-mRNAs. Characterization of the rat exon 11-associated variants by receptor binding Of the seven exon 11-associated variants, rMOR-1H1, rMOR-1i1, rMOR-1i2 and rMOR-1i3, predicted the same protein as rMOR-1, while rMOR-1H2 encoded a novel receptor protein with additional 50 amino acids extended at the N-terminal tip of rMOR-1. To examine the phar- macological binding profiles of these variants, we estab- lished CHO cell lines stably expressing these variants and examined [ H] DAMGO binding. Saturation studies demonstrated similar high affinities of [ H] DAMGO for all five variants (Table 2). Although the small difference in K values between rMOR-1i3 and rMOR-1, rMOR- 1H2, rMOR-1i1 and rMOR-1i2 were statistically signifi- cant, we believe that these small differences reflected dif- ferences in the assays rather than the receptor itself, particularly since they all predict receptors with identical amino acid sequences. While it theoretically might be due to the concurrent generation of the 16 amino acid fragment predicted from the methionine in exon 11a, there is, to date, nothing to indicate that this peptide is actually generated. Competition studies confirmed their mu selectivity (Table 3), with mu ligands such as mor- phine and M6G potently lowering binding while the kappa -selective opioid U50,488H and the delta-selective ligand DPDPE did not. As expected, the variants with the same predicted protein as rMOR-1 displayed the similar binding characteristics as rMOR-1 itself. rMOR-1H2 Figure 6 Northern blot analysis Northern blots were performed on rat brain using an exon 2/3 probe and an exon 11 probe, as bound both agonists and antagonists with affinities indis- described in the Methods section. tinguishable from other variants including rMOR-1, indi- cating that the additional 50 amino acids at N-terminus did not influence opioid binding. same size was also seen in the blot with the exon 2/3a probe. Two weaker bands were seen around 1 - 1.5 kb and Functional comparison of rMOR-1 with rMOR-1H2 in 2-4.5kb, respectively. agonist-induced [ S]GTPgS binding We next examined the expression of the variant mRNAs in several brain regions using RT-PCR (Figures 7A, 7B, All five full-length variants with 7 TM contained exon 1. Table1&Additional files1,2&3). TherMOR-1band Of these, only rMOR-1H2 encoded a novel protein, dif- was observed in all the regions with relatively equal abun- fering from the others by the extended N-terminal dance, except for lower levels in the cerebellum. However, sequence. Previously, we found that the C-terminal var- the expression of the other mRNAs varied markedly iants of the OPRM1 gene displayed differences in ago- among the regions. rMOR-1G1, rMOR-1G2 and rMOR- nist-induced G protein activation despite their small 1H2 were highly expressed in the brain stem, hippocam- differences in receptor binding profile [25]. To investi- pus and spinal cord, but had very lower levels in the cere- gateapossiblefunctionaleffectoftheadditional N- bellum and hypothalamus. In contrast, rMOR-1H1 was terminal sequence in rMOR-1H2 on agonist-induced G abundant in the cerebellum, hippocampus and spinal protein activation, we compared theagonist-inducesti- cord, but limited in the brain stem and hypothalamus. On mulation profiles of several agonists on [ S]GTPgS the other hand, rMOR-1i1, rMOR-1i2 and rMOR-1i3 binding in stably transfected CHO cells expressing Xu et al. Molecular Pain 2011, 7:9 Page 7 of 14 http://www.molecularpain.com/content/7/1/9 Figure 7 Regional distribution of the mRNAs from the rat exon 11-associated variants A. Four sets of total RNAs were extracted from brain regions dissected from four separate groups of rats. Each group contained 1 or 2 rats depending upon the size of the regions. RT-PCRs were performed using primers designed for amplifying rMOR-1G1, rMOR-1G2, rMOR-1H1, rMOR-1H2, rMOR-1i1, rMOR-1i2, rMOR-1i3 and rMOR-1 as described in the Methods. G3PDH was used as RNA loading control. The PCR products were separated on 1% agarose gel, stained with ethidium bromide and photographed using FluorChem 8000 Image System. Only one of four sets data was shown, while the data from other three sets were shown in Additional files 1, 2 & 3. B. Quantification of the PCR products from the four sets of RNAs. The band intensities from the agarose gel were quantified with AlphaEase FC software of the Image System and normalized with the band intensities of G3PDH. The data were graphed using GraphPad Prism 4.0 and analyzed with Two-way ANOVA. The results are shown in Table 1. rMOR-1H2 and rMOR-1 (Table 4). All the drugs effec- more potent in rMOR-1H2 than in rMOR-1, as was tively stimulated [ S]GTPgSbinding.However,we b-endorphin. Maximal stimulation revealed that mor- observed differences in both their potencies (EC value) phine was significantly more efficacious in rMOR-1H2 and efficacies (% maximal stimulation) among the var- than in rMOR-1. There was little correlation between iants. For example, DAMGO and dynorphin A were the EC and the maximal stimulation, as shown by the 50 Xu et al. Molecular Pain 2011, 7:9 Page 8 of 14 http://www.molecularpain.com/content/7/1/9 Table 1 Significance values of the semi-quantitative RT-PCR for the expression of the exon 11 associated variants’ mRNAs in the selected brain regions cb vs hyp cb vs bs cb vs hip cb vs spc hyp vs bs hyp vs hip hyp vs spc bs vs hip bs vs spc hip vs spc rMOR-1 ns ns 0.05 0.05 ns ns ns ns ns ns rMOR-1G1 ns 0.001 0.001 0.001 0.001 0.001 0.001 ns ns ns rMOR-1G2 ns 0.001 0.001 0.001 0.001 0.001 0.001 ns ns ns rMOR-1H1 ns ns 0.01 0.001 ns 0.001 0.001 0.001 0.001 ns rMOR-1H2 ns 0.01 0.01 0.001 0.01 0.01 0.001 ns ns ns rMOR-1i1 ns 0.001 ns ns 0.001 ns ns 0.001 0.001 ns rMOR-1i2 ns 0.001 ns ns 0.001 ns ns 0.00 0.001 ns rMOR-1i3 ns 0.001 ns ns 0.001 ns ns 0.001 0.001 ns Two-way ANOVA followed by Bonferroni post tests was performed to determine significant difference among the selected brain regions for each variant. cb: cerebellum; hyp: hypothalamus; bs: brainstem; hip: hippocampus; spc: spinal cord; ns: no significance (p > 0.05). fact that dynorphin A was the most efficacious of the [3,43-45]. However, to date only a single mu opioid ligands tested, despite its lower potency. receptor gene has been identified, raising the questions To obtain a general indication of the intrinsic activity of of how a single OPRM1 gene could explain the complex the various ligands, we compared their EC values after pharmacology of mu opioids in animals and humans. normalizing for their receptor binding affinity (EC /K ). Our early antisense mapping studies suggested different 50 i This provides an indication of the receptor occupancy exon combinations for the analgesic actions of the two needed to elicit the response. The lower the number, the mu agonists morphine and M6G, raising the possibility greater is the intrinsic activity of the ligand. While the of alternative splicing in the OPRM1 gene [17,46]. Since EC values for M6G and DAMGO were similar for then, much effort has been devoted to identifying these rMOR-1, their EC /K ratios differed by approximately OPRM1variants. To date, over 28 splice variants of the 50 i 10-fold. A similar situation existed for rMOR-1H2. The mouse OPRM1 gene have been isolated [22-24,27,35], potency of dynorphin A in stimulating [ S]GTPgS was far some of which had been previously identified in humans less than that of the other ligands, while its EC /K ratio [21] and rats [20]. 50 i was the lowest, implying the greatest intrinsic activity. The The majority of variants were C-terminal variants, differ- rank order of the EC /Ki values varied from their corre- ing only at the C-terminal tip. These variants revealed sponding rank order of both the EC and the maximal sti- marked differences in their regional distribution at both mulation values. Comparing the two variants, we also saw mRNA and protein level [22-24,27,47-52] and agonist- induced G protein activation and internalization [25,36,37]. different rank-order ratios (Table 4). These results sug- gested that the extra 50 amino acids influence agonist- We then identified a second set of variants associated with induced G protein activation. exon 11, a previously unknown exon located 30 kb upstream of exon 1 [24], and established their functional Discussion significance in an exon 11 KO mouse model [42]. Disrupt- Multiple mu opioid receptors were proposed in many ing exon 11 diminished M6G and heroin analgesia without years ago, mainly based upon pharmacological studies affecting morphine or methadone actions, suggesting that exon 11 and its associated variants played an important Table 2 Saturation studies with [ H] DAMGO role in the actions of a subset of mu opioids that include Clone K (nM) B (pmol/mg protein) D max M6G and heroin. A number of C-terminal variants have rMOR-1 0.39 ± 0.03 0.47 ± 0.07 been isolated from the rat [20,25] and human OPRM1 rMOR-1H1 0.51 ± 0.05 0.40 ± 0.01 genes [21,26,37]. We recently isolated a homolog exon 11 rMOR-1H2 0.37 ± 0.02 0.30 ± 0.05 and three its associated variants in the human OPRM1 rMOR-1i1 0.36 ± 0.05 0.24 ± 0.02 gene [28]. The current studies have now extended a similar rMOR-1i2 0.36 ± 0.04 0.26 ± 0.01 splicing pattern to the rat with the identification of a homo- rMOR-1i3 0.63 ± 0.06 0.24 ± 0.01 logous exon 11 and seven associated variants in the rat [ H] DAMGO binding was performed in membranes of CHO cells stably OPRM1 gene. Additionally, the exon 11 sequence has been expressing the indicated variant constructs. The binding parameters were predicted from the OPRM1 genomic locus of six other determined by nonlinear regression analysis. Results are the mean ± S.E.M. of mammalian species through NBCI and Ensembl databases, at least three independent determinations. P values determined by one-way ANOVA were 0.0013 for K and 0.0311 for B . Tukey post hoc analysis D max including chimpanzees, monkeys, guinea pigs, bats, cows determined that rMOR-1i3 was different from rMOR-1, rMOR-1i1, rMOR-1i2 and armadillos [53], but not in lower vertebrate species and rMOR-1H2 (p < 0.001), and that there was no significant difference among the variants in B . such as fish and amphibians that contain OPRM1 gene. max Xu et al. Molecular Pain 2011, 7:9 Page 9 of 14 http://www.molecularpain.com/content/7/1/9 Table 3 Competition of [ H] DAMGO binding among the rat MOR-1 variants Ligand K Value rMOR-1 rMOR-1H1 rMOR-1H2 rMOR-1i1 rMOR-1i2 rMOR-1i3 Morphine 1.5 ± 0.2 2.0 ± 0.3 0.8 ± 0.1 1.3 ± 0.4 1.2 ± 0.2 1.6 ± 0.2 M6G 4.5 ± 0.3 4.5 ± 0.5 2.6 ± 0.6 3.8 ± 0.5 5.1 ± 1.0 6.3 ± 0.7 DADLE 2.4 ± 0.1 1.9 ± 0.3 DSLET 6.3 ± 0.3 7.2 ± 1.1 Naloxone 0.8 ± 0.1 0.9 ± 0.1 0.8 ± 0.3 0.9 ± 0.1 0.7 ± 0.1 1.3 ± 0.2 b-Endorphin 2.7 ± 0.2 3.1 ± 0.3 3.8 ± 1.9 3.3 ± 0.3 3.7 ± 0.3 6.3 ± 0.7 Dynorphin A 15.5 ± 0.9 37.5 ± 5.3 21.8 ± 5.1 16.2 ± 3.5 23.6 ± 2.8 34.6 ± 6.8 U50,488H > 500 > 500 > 500 > 500 > 500 > 500 DPDPE > 500 > 500 > 500 > 500 > 500 > 500 [ H] DAMGO binding was performed in membranes of CHO cells stably expressing the indicated variants. Dissociate constants, K values, were determined from IC values of at least three independent determinations. One-way ANOVA was used to compare the K values for each drug among the variants. Of the opioids, 50 i only M6G (p = 0.0157) showed significant difference with lower K value of rMOR-1H2 as compared to that of rMOR-1i3 (p < 0.01) in Tukey post hoc analysis. The nucleotide sequence and genomic location of the early termination of translation in exons 1b and exon 1c, ratexon11 weresimilartothose in themouse and respectively. However, both rMOR-1i2 and rMOR-1i3 human. However, some differences exist between the rat can initiate translation from the AUG of exon 1a to gen- and mouse exons 11. Whereas the rat contains an alter- erate the same protein as the original rMOR-1. Thus, native splice site within exon 11 which splits it into together with rMOR-1H1 and rMOR-1i1, a total of four exon 11a and exon 11b, a situation similar to the exon 11-associated transcripts can produce the identical human exon 11, the mouse does not. Alternative usage rMOR-1 protein, a similar situation seen in the mouse of these two splice sites within exon 11, together with a exon 11-aasociated variants. This raises questions regard- choice of downstream exons, created a number of differ- ing why four different splice variants are needed to gen- ent variants. The rat exon 11b has a predicted stop erate the same protein. It is interesting to speculate, that codon when translated from its first AUG in exon 11a, these differences may differentially regulate their cellular leading to only seven amino acids in rMOR-1G1, location and their ability to express the protein, but there rMOR-1H1 and rMOR-1i1. However, initiating transla- is no evidence to date to support this possibility. tion from the first AUG of exon 2 in rMOR-1G1 pre- On the other hand, translation from the AUG of exon 11a also generated the 6 TM protein, rMOR-1G2. Skip- dicts a 6 TM protein. Using the AUG in exon 1a of rMOR-1H1 and rMOR-1i1, rMOR-1i2, rMOR-1i3 leads ping exon 11b maintained the reading frame from AUG to the same protein as the original rMOR-1. of exon 11a through exons 2/3/4. Similarly, skipping The variants that skip exon 11b can translate through exon 11b also enabled rMOR-1H2 to read through, from the AUG in exon 11a, but differed in amino acid yielding a novel receptor with extra 50 amino acids sequence depending upon their downstream exons. In extended at the N-terminus of rMOR-1, a prediction rMOR-1i2 and rMOR-1i3, translation using the first that was supported by in vitro transcription coupled AUG in exon 11a still predicted small proteins due to with translation. Thus, rMOR-1H2 is the first full length Table 4 Stimulation of [ S]GTPgS binding by opioids in rMOR-1 and rMOR-1H2 rMOR-1 rMOR-1H2 EC EC /K % Max Relative Efficacy (%) EC EC /K % Max Relative Efficacy (%) 50 50 i 50 50 i Morphine 59 ± 18 39 180 ± 4 71 70 ± 24 88 225 ± 20* 90 M6G 40 ± 4 9 149 ± 3 59 44 ± 6 17 189 ± 25 75 DAMGO 35 ± 2 90 192 ± 5 76 20 ± 3* 54 209 ± 17 83 b-Endorphin 58 ± 34 21 226 ± 12 89 24 ± 8 6 241 ± 17 96 Dynorphin A 344 ± 64 22 254 ± 6 100 162 ± 12* 7 251 ± 44 100 Membranes were prepared from CHO cells stably transfected with the indicated cDNA constructs and [ S]GTPgS binding carried out as described in the Methods section. The maximal stimulation, defined as the percent increase over basal binding, % Max, and the dose of drug needed to elicit 50% of the maximal response, the EC , were calculated by nonlinear regression analysis (GraphPad Prism 4.0). Results are the means ± S.E.M. of at least three independent determinations. Significant differences of the EC and maximal stimulation between rMOR-1 and rMOR-1H2 were analyzed by Student t-test. Intrinsic activity (EC /K ) was calculated by dividing EC values by K values in Table 2. The relative efficacies for the listed opioids were determined for each of the variants, 50 i 50 i based upon the maximal stimulation values. The drug with the highest level of stimulation for a specific variant was arbitrarily given an efficacy of 100%. Efficacy for all the other compounds for the indicated variant was defined relative to the drug with the greatest maximal stimulation. *: p < 0.05, when compared to rMOR-1. Xu et al. Molecular Pain 2011, 7:9 Page 10 of 14 http://www.molecularpain.com/content/7/1/9 (i.e. 7 TM) rat splice variant isolated with a different as the last coding exon. While rMOR-1G1 also predicts a protein sequence at the N-terminus. 6 TM variant with a terminal exon 4, it requires using Theexon 11 mRNAs arerelativelyabundantin the the AUG within exon 2 to initiate translation. Despite brain, as illustrated by Northern blot analysis that our efforts, we were unable to isolate rat homologs of the displayed a major ~ 12 kb band with intensity compar- mouse mMOR-1M and mMOR-1N. While it is possible able to that observed with the exons 2/3 probe. that they do not exist in rats, it also is possible that these homologs are localized to very specific brain regions with The expression of the exon 11-associated variant a low overall abundance. The functional relevance of the mRNAs differed markedly among brain regions, con- 6 TM mouse variants has been suggested by a range of trasting with the relatively homogenous expression levels of rMOR-1. This suggested that, like the mouse, there is studies. First, although they do not bind radiolabeled mu region- and/or cell-specific RNA processing of the var- agonists with high affinity, the mouse 6 TM variants iant pre-mRNAs and/or varying levels of upstream pro- displayed a moderate binding affinity towards [ H]-dipre- moter activity. Differential expression of the variant norphine (K approximately 10 nM; J Xu, GW Pasternak mRNAs among brain regions also raised questions and YX Pan, unpublished observation). Second, the regarding their functions. Recently, we observed high 6 TM variants can physically associate with the regular correlations between mRNA expression levels, including 7 TM MOR-1 and modulate the expression of the 7 TM exon 11-associated variants, in selected brain regions receptors on cell surface membrane (J Xu, GW Pasternak with thedegreeofmorphineand heroindependence and YX Pan, unpublished observation). More impor- and tolerance among four inbred strains of mice (J Xu, tantly, disrupting exon 11 diminished M6G and heroin B Kest and YX Pan, unpublished observations). These analgesia without affecting morphine and methadone, results suggest a possible contribution of alternative spli- suggesting selective roles of the 6 TM exon 11-associated cing of the OPRM1 gene in mu opioid tolerance and variants in the actions of M6G and heroin. Finally, the addiction in mice, although the relevance of these corre- conservation of the exon 11 and exon 11-associated var- lations needs to be further validated. It will be interest- iants across species further supports their role. ing to see if these correlations also exist in rat. The genomic location of the rat exon 11 approxi- Conclusions mately 21 kb upstream of exon 1 suggested the exis- We isolated a rat exon 11 and seven exon 11-associated tence of an upstream promoter controlling the splice variants from the rat OPRM1 gene, resembling expression of the exon 11-associated variants. Prelimin- splicing in both mice and humans and suggesting con- ary studies indicate that the 5’ flanking region of the rat servation of exon 11 and its associated variants in mam- exon 11 has promoter activity, particularly in the neuro- mals. The rat OPRM1 gene now contains eleven exons blastoma cell lines NIE115 and Be(2)C cells, assessed spanning over 250 kb and whose combination by alter- using a secreted alkaline phosphotase (SEAP) reporter native splicing generates over sixteen variants. The func- assay (J Xu and XY Pan, unpublished observation). tional significance of these rat exon 11-associated rMOR-1H2 encoded a full length 7 TM mu opioid variants was suggested by the region-specific expression receptor with a unique, extended N-terminus. Its similar of their mRNAs and the influence of the novel N-term- binding profile is consistent with the other variants was inal sequence on agonist-induced G protein coupling in expected sinceitisbelievedthatthe binding pocketis the N-terminal variant, rMOR-1H2. The existence of contained within the transmembrane regions, which are the rat exon 11-associated variants raises questions identical among all the full length variants. However, regarding their potential role in mediating the actions of the additional N-terminal 50 amino acids in rMOR-1H2 heroin and M6G in rat. The diversity and complexity did influence agonist-induced G protein activation, a created by alternative splicing of the rat OPRM1 gene similar scenario seen in the human N-terminal variant, may provide important insights of understanding the hMOR-1i [28]. While similar results were observed with diverse responses to the various mu opioids seen in rat. the C-terminal variants, but this was more easily under- stood because of the presumed ability of the C-terminus Methods to influence coupling to transduction proteins. How the Genomic database searching additional N-terminal sequence influences receptor acti- Alignment of the mouse exon 11 sequence in with the vation is as yet unknown. rat OPRM1 gene in the Ensembl human genome data- In the mouse, the exon 11-associated variants mMOR- base revealed a sequence homologous to exon11. The 1G, mMOR-1M and mMOR-1N predict 6 TM variant rat exon 11 was mapped approximately 21 kb upstream due to skipping of exon 1, which encodes the first TM. of exon 1 in the rat OPRM1 locus. There is 86% identity rMOR-1G2 predicted a similar 6 TM protein with trans- at the nucleotide level between the rat exon 11 and the lation of exon 11 that resembles mMOR-1G with exon 4 mouse exon 11 sequences (Figure 3). Xu et al. Molecular Pain 2011, 7:9 Page 11 of 14 http://www.molecularpain.com/content/7/1/9 Reverse transcription-polymerase chain reaction (RT-PCR) AN1 and E4-AN2); for rMOR-1i2, a exon 11 sense pri- cloning mer (E11-SE4: 5 ’-GAA GGA TGG GAT CTG GTC Total RNA was isolated from rat brain or selected brain CAA TGC TTG CAT G-3’) and E4-AN1 primer; and regions by the guanidinium thiocyanate phenol-chloro- for rMOR-1i3, an exon 11 sense primer (E11-SE5: 5’- form extraction method [54] and reverse transcribed GCT TGA AGG ATG GGA TCT GGT CCA ATG with random primers and Superscript II reverse tran- CTA TAC GAG-3’)and E4-AN1 and E4-AN2primers. scriptase (Invitrogen) as previously described [22,55] or All PCR fragments were subcloned into pcDNA3.1/ with an antisense primer from exon 4 (E4-AN1, 5’-CAT V5His-TOPO vector (Invitrogen) and sequenced with GTG CAG AGT GAA GTA GCC AGA G-3 ’)and appropriate primers in both orientations. Superscript III reverse transcriptase (Invitrogen) follow- ing the manufacture’sprotocol.In a20 μl of RT reac- Northern blot analysis tion with random primers and Superscript II, 5 μgof Northern blot analysis was performed as described RNA together with 260 ng of random primer was first [22,55]. Briefly, 20 μg of total brain RNA/lane was sepa- incubated at 70°C for 5 min and then quickly cooled on rated on a 0.8% formaldehyde agarose gel, and trans- ice for 2 min. Following adding the reaction buffer ferred to GenePlus membrane. The membranes were together with 10 mM DTT and 1 mM dNTP and warm- hybridized with either a 257 bp P-labeled exon 11 ing the mixture at 37°C for 2 min, 260 units of Super- probe generated by PCR with a sense primer (E11-SE1) script II were added. The mixture with the enzyme was and an antisense primer (E11-AN1: 5’-GAG GTA ACT incubated at room temperature for 10 min, then at 37°C TCCCCT CTT GAT TTCTAT CTCCC-3 ’)from for 5 min and finally at 42°C for 90 min. The reaction exon 11 or a 685 bp P-labeled exons 2 & 3a probe by was terminated by heating at 75°C for 15 min. In a PCR with a sense primer from exon 2 (E2-SE1: 5’-GAC 20 μl of RT reaction with E4-AN1 primer and Super- TGC CAC CAA CAT CTA CAT TTT CAA C-3’)and script III, 5 μg of RNA together with 10 pmol of E4- an antisense primer from exon 3 (E3-AN1: 5 ’-GTT AN1 primer was first incubated at 70°C for 5 min and CGT GTA ACC CAA AGC AAT GC-3’). then quickly cooled on ice. The reaction buffer together with 5 mM DTT, 1 mM dNTP and 200 units of Super- Regional expression of the variant mRNAs script III was added. The reaction was incubated at 53°C The selected brain regions were dissected from four for 90 min and terminated by heating at 75°C for 15 separate groups of rats. Each group had one or two rats min. Two-step or nested PCRs was used to amplify depending upon the size of the region. Total RNAs exon 11-associated full-length clones using Platinum extracted from the selected brain regions were reverse- Taq DNA polymerase (Invitrogen). The first-step PCRs transcribed with an E4-AN1 primer and Superscript III were carried out using 5 μl of RT reaction as template as described in RT-PCR cloning (see above). The first- with the appropriate primers (see below) for 39 cycles strand cDNAs were used as templates for two-step or after 2 min at 94°C, each cycle consisting of a 20 sec nested PCRs. For exon 11-associated splice variants, the denaturing step at 94°C, a 20 sec annealing step at 65°C first-step PCRs were performed using 5 μl of RT reac- and a 2 min extension at 72°C. In the second-step tion as template and a sense primer from exon 11 (E11- PCRs, 2 μl of the first-step PCR products was used as SE1) and an antisense primer from exon 4 (E4-AN1) for template with appropriate primers (see below) using the 35 cycles with the same PCR cycling conditions as same PCR cycling conditions as the first-step PCR. The described in RT-PCR cloning. In the second-step PCRs, primers used for rMOR-1G1, rMOR-1G2, and rMOR- 3 μl of the first-step PCR products was used as template 1H2 were: two sense primers from exon 11 sequence with appropriate primers (see below). The primers used obtained from the genomic alignment (E11-SE1: 5’-CTT in the second-step PCRs were designed to specifically CCC ATA AGT CAT TTG CTG TCC TTG-3 ’ and amplify each variant and listed as following: for rMOR- E11-SE2: 5 ’-GAA GAG GAA CAC CGA AAC TGG 1G1, a sense primer (G1-SE: 5’-GAA GTT ACC TCA GAA GC-3’) and two antisense primers from exon 4 GAT ACA CCA AAA TGA-3’) and an exon 3 antisense (E4-AN1 and E4-AN2: 5’-GAC AGC AAC CTG ATT primer (E3-AN2: CAG CAG ACG ATA AAT ACA CCA CGT AGA TG-3’); for rMOR-1H1 and rMOR-1i1, GCC ACG-3’); for rMOR-1G2, a sense primer (G2-SE: an exon 11 sense primer (E11-SE3: 5’-GAA GGA TGG 5’-GGT CCA ATG CTA TAC ACC AAA ATG-3’)and GAT CTG GTC CAA TGC TGT AAG CTT TCT CCA E3-AN2 primer; for rMOR-1H1, a sense primer (H1-SE: AGT CCG CAT TCC AAA AAC TGG ACA GGG 5’-AAG TTA CCT CAG GGC TGG TCC-3’)and an AGA TAG AAA TCA AGA GGG GAA GTT ACC exon 2 antisense primer (E2-AN1: 5’-ATG TTC CCA TCA G-3’) and the two exon 4 antisense primers (E4- TCA GGT AGT TGA CAC TC-3’); for rMOR-1H2, a Xu et al. Molecular Pain 2011, 7:9 Page 12 of 14 http://www.molecularpain.com/content/7/1/9 sense primer (H2-SE: 5’-GGT CCA ATG CTG GCT Chinese Hamster Ovary (CHO) cells by LipofectAMINE GGT CC-3’) and E2-AN1 primer; for rMOR-1i1, a sense reagent (Invitrogen). Stable transformants were obtained primer (I1-SE: 5’-AAG TTA CCT CAG TGC ATG 10 - 14 days after selection with G418 and screened with GAG ACC-3’)and E2-AN1 primer;for rMOR-1i2,a a[ H]DAMGO binding assay. sense primer (I2-SE: GGT CCA ATG CTT GCA TGG AGA C-3’) and E2-AN1 primer; for rMOR-1i3, a sense Receptor binding assays primer (I3-SE: 5’-GGT CCA ATG CTA TAC GCG GA-3’) Membranes were prepared from stable transfectants as and E2-AN1 primer. For detecting rMOR-1, the first-step described previously [22]. Saturation and competition PCRs were performed using the same PCR cycling condi- binding assays were performed with [ H]DAMGO at tions with 5 μl of RT reaction, an exon 1c sense primer 25°C for 60 min in 50 mM potassium phosphate buffer, (E1-SE1: 5’-CCC ACT TTA CAC TCG TTT ACA CGG- pH 7.4, containing 5 mM magnesium sulfate. Specific 3’) and E4-AN1 primer. In the second-step PCRs, 3 μlof binding was defined as the difference between total the first-step PCR products was used as template with an binding and non-specific binding, determined in the exon 1 sense primer (E1-SE2: 5’-GAC AGC CTG TGC presence of 10 μM levallorphan. K and K values were D i CCT CAG ACC-3’) and E2-AN1 primer. The second-step calculated by non-linear regression analysis (GraphPad PCRs were carried out for 35 cycles after 2 min at 94°C, Prism 4.0, Carlsbad, CA). Protein concentrations were each cycle consisting of a 20 sec denaturing step at 94°C, a determined using the Lowry method as previously 20 sec annealing step at 60 - 65°C and 45 - 90 sec exten- described using bovine serum albumin (BSA) as the sion at 72°C, depending upon melting temperature of pri- standard [22,28]. mers and length of amplicons. The lengths of the PCR products were consistent with their predicted sizes: 606 bp [ S]GTPgS binding assay for rMOR-1G1, 604 bp for rMOR-1G2, 539 bp for rMOR- Membranes prepared from stable transfectants were 1H1, 537 bp for rMOR-1H2, 794 bp for rMOR-1i1, 793 bp incubated in the presence and absence of indicated for rMOR-1i2, 1051 bp for rMOR-1i3 and 217 bp for opioids for 60 min at 30°C in the assay buffer (50 mM rMOR-1. The sequences of the PCR products were con- Tris-HCl, pH 7.7, 3 mM MgCl , 0.2 mM EGTA, 10 mM firmed by sequencing with appropriate primers. A negative NaCl) containing 0.05 nM [ S]GTPgS (> 1000 Ci/ control using ddH O as template was included for each mmol, PerkimElmer) and 60 μMGDP,aspreviously variant throughout the two-step PCRs. RNA loading was reported [25,36,37]. Basal binding was determined in the estimated by parallel one-step PCRs with a pair of primers presence of GDP and absence of drug. The reaction was for glyceraldehydes 3-phosphate dehydrogenase (G3PDH) terminated by rapid filtration under vacuum through (Clontech). The PCR products were separated on 1% agar- glass fiber filters, followed by three washes with 3 ml of ose gel, stained with ethidium bromide. The agarose gel ice-cold 50 mM Tris-HCl, pH 7.4. Bound radioactivity was photographed and analyzed using a FluorChem 8000 was measured by liquid scintillation spectrophotometry Image System (Alpha Innotech). in Liquid Scintillation Analyzer (TRI-CARB 2900TR, PerkimElmer) after overnight extraction in 5 ml liquis- In vitro transcription coupled translation cint scintillation fluid (National Diagnostic Inc.). Thefull-lengthcDNAsofrMOR-1and rMOR-1H2in Additional material the pcDNA3.1/V5His-TOPO vector were transcribed and translated in vitro with a TnT T7 coupled reticulo- Additional file 1: Regional distribution of the mRNAs from the rat cyte lysate system (Promega) following the manufac- exon 11-associated variants (repeated experiment 1) Figure S1. All turer’s protocol. Briefly, the plasmids were incubated the procedures were performed with a separated group of rat as with T7 RNA polymerase and reticulocyte lysate in the described in the Methods section and Figure 7 legend. presence of 0.04 mCi of [ S]methionine (> 1000 Ci/ Additional file 2: Regional distribution of the mRNAs from the rat exon 11-associated variants (repeated experiment 2) Figure S2. All mmol; PerkimElmer) at 25°C for 90 min. The translated the procedures were performed with a separated group of rat as products were separated on a 12% SDS-polyacrylamide described in the Methods section and Figure 7 legend. gel, and the gel was treated with Amplify (GE Life), Additional file 3: Regional distribution of the mRNAs from the rat dried and exposed to Kodak BioMax MR film. exon 11-associated variants (repeated experiment 3) Figure S3. All the procedures were performed with a separated group of rat as described in the Methods section and Figure 7 legend. Expression of rMOR-1H1, rMOR-1H2, rMOR-1i1, rMOR-1i2 and rMOR-1i3 in Chinese hamster ovary (CHO) cells The rMOR-1H1/pcDNA3.1-TOTO, rMOR-1H2/pcDNA List of abbreviations 3.1-TOPO, rMOR-1i1/pcDNA3.1-TOPO, rMOR-1i2/ 2 4 5 M6G: morphine-6β-glucuronide; DAMGO: [ -Ala ,N-MePhe ,Gly-ol ] pcDNA3.1-TOPO, rMOR-1i3/pcDNA3.1-TOPO and enkephalin; MOR: mu opioid receptor; OPRM1: mu opioid receptor gene; RT: rMOR-1/pcDNA3.1(-) plasmids were used to transfect Reverse-transcription; PCR: polymerase chain reaction; KO: knockout. Xu et al. Molecular Pain 2011, 7:9 Page 13 of 14 http://www.molecularpain.com/content/7/1/9 15. Park YS, Lee YS, Cho NJ, Kaang BK: Alternative splicing of gar-1, a Acknowledgements Caenorhabditis elegans G-protein-linked acetylcholine receptor gene. This work was supported, in part, by research grants to GWP (DA02615 and Biochem Biophys Res Commun 2000, 268:354-358. DA00220) and Y-XP (DA13997 and DA02944) from the National Institute on 16. Park YS, Kim S, Shin Y, Choi B, Cho NJ: Alternative splicing of the Drug Abuse, a grant from the National Genetics Foundation, a grant from muscarinic acetylcholine receptor GAR-3 in Caenorhabditis elegans. Mr. William H. Goodwin and Mrs. Alice Goodwin and the Commonwealth Biochem Biophys Res Commun 2003, 308:961-965. Foundation for Cancer Research and The Experimental Therapeutics Center 17. Rossi GC, Pan YX, Brown GP, Pasternak GW: Antisense mapping the MOR-1 of Memorial Sloan-Kettering Cancer Center to GWP and by a Core Grant to opioid receptor: Evidence for alternative splicing and a novel morphine- MSKCC from the National Cancer Institute (CA8748). 6β-glucuronide receptor. FEBS Lett 1995, 369:192-196. 18. Pasternak GW: Multiple opiate receptors: deja vu all over again. Author details Neuropharmacology 2004, 47(Suppl 1):312-323. Department of Neurology and Program in Molecular Pharmacology and Chemistry, Memorial Sloan-Kettering Cancer Center, New York, NY 10065, 19. Schuller AG, King MA, Zhang J, Bolan E, Pan YX, Morgan DJ, et al: Retention USA. Department of Psychology, CW Post College, Long Island University, of heroin and morphine-6 beta-glucuronide analgesia in a new line of Brookville, NY 11568, USA. mice lacking exon 1 of MOR-1. Nat Neurosci 1999, 2:151-156. 20. Zimprich A, Simon T, Hollt V: Cloning and expression of an isoform of the Authors’ contributions rat μ opioid receptor (rMOR 1 B) which differs in agonist induced JX and MX performed RT-PCR, Northern blot analysis, in vitro transcription desensitization from rMOR1. FEBS Lett 1995, 359:142-146. coupled translation, receptor binding and [ S]GTPγS binding assays. GCR 21. Bare LA, Mansson E, Yang D: Expression of two variants of the human μ dissected brain regions for RNA extraction. Y-XP designed and coordinated opioid receptor mRNA in SK-N-SH cells and human brain. FEBS Lett 1994, the experiments and analyzed data. Y-XP and GWP oversaw the project and 354:213-216. wrote the manuscript. All authors read and approved the manuscript. 22. Pan YX, Xu J, Bolan E, Abbadie C, Chang A, Zuckerman A, et al: Identification and characterization of three new alternatively spliced Competing interests mu-opioid receptor isoforms. Mol Pharmacol 1999, 56:396-403. The authors declare that they have no competing interests. 23. Pan YX, Xu J, Bolan E, Chang A, Mahurter L, Rossi G, et al: Isolation and expression of a novel alternatively spliced mu opioid receptor isoform, Received: 21 July 2010 Accepted: 21 January 2011 MOR-1F. FEBS Lett 2000, 466:337-340. Published: 21 January 2011 24. Pan YX, Xu J, Mahurter L, Bolan E, Xu M, Pasternak GW: Generation of the mu opioid receptor (MOR-1) protein by three new splice variants of the Oprm gene. Proc Natl Acad Sci USA 2001, 98:14084-14089. References 25. Pasternak DA, Pan L, Xu J, Yu R, Xu MM, Pasternak GW, et al: Identification 1. Lord JAH, Waterfield AA, Hughes J, Kosterlitz HW: Endogenous opioid of three new alternatively spliced variants of the rat mu opioid receptor peptides: multiple agonists and receptors. Nature 1977, 267:495-499. gene: dissociation of affinity and efficacy. J Neurochem 2004, 91:881-890. 2. Martin WR, Eades CG, Thompson JA, Huppler RE, Gilbert PE: The effects of 26. Pan YX, Xu J, Mahurter L, Xu MM, Gilbert AK, Pasternak GW: Identification morphine and nalorphine-like drugs in the nondependent and and characterization of two new human mu opioid receptor splice morphine-dependent chronic spinal dog. J Pharmacol Exp Ther 1976, variants, hMOR-1O and hMOR-1X. Biochem Biophys Res Commun 2003, 197:517-532. 301:1057-1061. 3. Wolozin BL, Pasternak GW: Classification of multiple morphine and 27. Pan YX, Xu J, Bolan E, Moskowitz HS, Xu M, Pasternak GW: Identification of enkephalin binding sites in the central nervous system. Proc Natl Acad four novel exon 5 splice variants of the mouse mu-opioid receptor Sci USA 1981, 78:6181-6185. gene: functional consequences of C-terminal splicing. Mol Pharmacol 4. Chen Y, Mestek A, Liu J, Hurley JA, Yu L: Molecular cloning and functional 2005, 68:866-875. expression of a μ-opioid receptor from rat brain. Mol Pharmacol 1993, 28. Xu J, Xu M, Hurd YL, Pasternak GW, Pan YX: Isolation and characterization 44:8-12. of new exon 11-associated N-terminal splice variants of the human mu 5. Thompson RC, Mansour A, Akil H, Watson SJ: Cloning and opioid receptor gene. J Neurochem 2009, 108:962-972. pharmacological characterization of a rat μ opioid receptor. Neuron 1993, 29. Doyle GA, Rebecca SX, Lin SS, Press DM, Grice DE, Buono RJ, et al: 11:903-913. Identification of three mouse micro-opioid receptor (MOR) gene 6. Wang JB, Imai Y, Eppler CM, Gregor P, Spivak CE, Uhl GR: μ opiate (Oprm1) splice variants containing a newly identified alternatively receptor: cDNA cloning and expression. Proc Natl Acad Sci USA 1993, spliced exon. Gene 2007, 388:135-147. 90:10230-10234. 30. Doyle GA, Sheng XR, Lin SS, Press DM, Grice DE, Buono RJ, et al: 7. Guiramand J, Montmayeur JP, Ceraline J, Bhatia M, Borrelli E: Alternative Identification of five mouse mu-opioid receptor (MOR) gene (Oprm1) splicing of the dopamine D2 receptor directs specificity of coupling to splice variants containing a newly identified alternatively spliced exon. G-proteins. J Biol Chem 1995, 270:7354-7358. Gene 2007, 395:98-107. 8. Usiello A, Baik JH, Rouge-Pont F, Picetti R, Dierich A, LeMeur M, et al: 31. Cadet P, Mantione KJ, Stefano GB: Molecular identification and functional Distinct functions of the two isoforms of dopamine D2 receptors. Nature expression of mu 3, a novel alternatively spliced variant of the human 2000, 408:199-203. mu opiate receptor gene. J Immunol 2003, 170:5118-5123. 9. Vanetti M, Kouba M, Wang X, Vogt G, Hollt V: Cloning and expression of a 32. Choi HS, Kim CS, Hwang CK, Song KY, Wang W, Qiu Y, et al: The opioid novel mouse somatostatin receptor (SSTR2B). FEBS Lett 1998, 311:290-294. ligand binding of human mu-opioid receptor is modulated by novel 10. Namba T, Sugimoto Y, Negishi M, Irie A, Ushikubi F, Kakizuka A, et al: splice variants of the receptor. Biochem Biophys Res Commun 2006, Alternative splicing of C-terminal tail of prostaglandin E receptor 343:1132-1140. subtype EP3 determines G-protein specificity. Nature 1993, 365:166-170. 33. Shabalina SA, Zaykin DV, Gris P, Ogurtsov AY, Gauthier J, Shibata K, et al: 11. Lucas JJ, Hen R: New players in the 5-HT receptor field: genes and Expansion of the human mu-opioid receptor gene architecture: novel knockouts. Trends Pharmacol Sci 1995, 16:246-252. functional variants. Hum Mol Genet 2009, 18:1037-1051. 12. Candenas ML, Cintado CG, Pennefather JN, Pereda MT, Loizaga JM, 34. Kvam TM, Baar C, Rakvag TT, Kaasa S, Krokan HE, Skorpen F: Genetic Maggi CA, et al: Identification of a tachykinin NK(2) receptor splice analysis of the murine mu opioid receptor: increased complexity of variant and its expression in human and rat tissues. Life Sci 2002, Oprm gene splicing. J Mol Med 2004, 82:250-255. 72:269-277. 35. Pan YX: Diversity and complexity of the mu opioid receptor gene: 13. Schulz HL, Stohr H, Weber BH: Characterization of three novel isoforms of alternative pre-mRNA splicing and promoters. DNA Cell Biol 2005, the metabotrobic glutamate receptor 7 (GRM7). Neurosci Lett 2002, 24:736-750. 326:37-40. 36. Bolan EA, Pan YX, Pasternak GW: Functional analysis of MOR-1 splice 14. Malherbe P, Kew JN, Richards JG, Knoflach F, Kratzeisen C, Zenner MT, et al: variants of the mouse mu opioid receptor gene Oprm. Synapse 2004, Identification and characterization of a novel splice variant of the 51:11-18. metabotropic glutamate receptor 5 gene in human hippocampus and cerebellum. Brain Res Mol Brain Res 2002, 109:168-178. Xu et al. Molecular Pain 2011, 7:9 Page 14 of 14 http://www.molecularpain.com/content/7/1/9 37. Pan L, Xu J, Yu R, Xu MM, Pan YX, Pasternak GW: Identification and characterization of six new alternatively spliced variants of the human mu opioid receptor gene, Oprm. Neuroscience 2005, 133:209-220. 38. Abbadie C, Pasternak GW: Differential in vivo internalization of MOR-1 and MOR-1C by morphine. Neuroreport 2001, 12:3069-3072. 39. Zhang J, Ferguson SS, Barak LS, Bodduluri SR, Laporte SA, Law PY, et al: Role for G protein-coupled receptor kinase in agonist-specific regulation of mu-opioid receptor responsiveness. Proc Natl Acad Sci USA 1998, 95:7157-7162. 40. Qiu Y, Law PY, Loh HH: Mu-opioid receptor desensitization: role of receptor phosphorylation, internalization, and representation. J Biol Chem 2003, 278:36733-36739. 41. Bohn LM, Gainetdinov RR, Lin FT, Lefkowitz RJ, Caron MG: Mu-opioid receptor desensitization by beta-arrestin-2 determines morphine tolerance but not dependence. Nature 2000, 408:720-723. 42. Pan YX, Xu J, Xu M, Rossi GC, Matulonis JE, Pasternak GW: Involvement of exon 11-associated variants of the mu opioid receptor MOR-1 in heroin, but not morphine, actions. PNAS 2009, 106:4917-4922. 43. Pasternak GW: Pharmacological mechanisms of opioid analgesics. Clin Neuropharmacol 1993, 16:1-18. 44. Pasternak GW, Childers SR, Snyder SH: Opiate analgesia: Evidence for mediation by a subpopulation of opiate receptors. Science 1980, 208:514-516. 45. Pasternak GW, Snyder SH: Identification of a novel high affinity opiate receptor binding in rat brain. Nature 1975, 253:563-565. 46. Rossi GC, Pan YX, Cheng J, Pasternak GW: Blockade of morphine analgesia by an antisense oligodeoxynucleotide against the mu receptor. Life Sci 1994, 54:PL375-379. 47. Abbadie C, Pan YX, Pasternak GW: Differential distribution in rat brain of mu opioid receptor carboxy terminal splice variants MOR-1C and MOR- 1-like immunoreactivity: Evidence for region-specific processing. J Comp Neurol 2000, 419:244-256. 48. Abbadie C, Pan YX, Drake CT, Pasternak GW: Comparative immunhistochemical distributions of carboxy terminus epitopes from the mu opioid receptor splice variants MOR-1D, MOR-1 and MOR-1C in the mouse and rat central nervous systems. Neuroscience 2000, 100:141-153. 49. Abbadie C, Gultekin SH, Pasternak GW: Immunohistochemical localization of the carboxy terminus of the novel mu opioid receptor splice variant MOR-1C within the human spinal cord. Neuroreport 2000, 11:1953-1957. 50. Abbadie C, Pasternak GW, Aicher SA: Presynaptic localization of the carboxy-terminus epitopes of the mu opioid receptor splice variants MOR-1C and MOR-1D in the superficial laminae of the rat spinal cord. Neuroscience 2001, 106:833-842. 51. Zhang Y, Pan YX, Kolesnikov Y, Pasternak GW: Immunohistochemical labeling of the mu opioid receptor carboxy terminal splice variant mMOR-1B4 in the mouse central nervous system. Brain Res 2006, 1099:33-43. 52. Abbadie C, Rossi GC, Orciuolo A, Zadina JE, Pasternak GW: Anatomical and functional correlation of the endomorphins with mu opioid receptor splice variants. Eur J Neurosci 2002, 16:1075-1082. 53. Pan YX, Pasternak GW: Molecular Biology of Mu Opioid Receptors. In Opiate. Edited by: Pasternak GW. Humana Press; 2010, Ch.6. 54. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987, 162:156-159. 55. Pan YX, Cheng J, Xu J, Rossi G, Jacobson E, Ryan-Moro J, et al: Cloning and fuctional characterization of a kappa -related opioid receptor. Mol Pharmacol 1995, 47:1180-1188. Submit your next manuscript to BioMed Central and take full advantage of: doi:10.1186/1744-8069-7-9 Cite this article as: Xu et al.: Identification and characterization of seven • Convenient online submission new exon 11-associated splice variants of the rat mu opioid receptor gene, OPRM1. Molecular Pain 2011 7:9. • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Molecular Pain Springer Journals

Identification and characterization of seven new exon 11-associated splice variants of the rat mu opioid receptor gene, OPRM1

Download PDF
14 pages

Loading next page...
 
/lp/springer-journals/identification-and-characterization-of-seven-new-exon-11-associated-daVo3ZxKF2

References (121)

Publisher
Springer Journals
Copyright
Copyright © 2011 by Xu et al; licensee BioMed Central Ltd.
Subject
Medicine & Public Health; Pain Medicine; Molecular Medicine; Neurobiology
eISSN
1744-8069
DOI
10.1186/1744-8069-7-9
pmid
21255438
Publisher site
See Article on Publisher Site

Abstract

Background: The mouse mu opioid receptor (OPRM1) gene undergoes extensive alternative splicing at both the 3’- and 5’-ends of the gene. Previously, several C-terminal variants generated through 3’ splicing have been identified in the rat OPRM1 gene. In both mice and humans 5’ splicing generates a number of exon 11-containing variants. Studies in an exon 11 knockout mouse suggest the functional importance of these exon 11-associated variants in mediating the analgesic actions of a subset of mu opioids, including morphine-6b-glucuronide (M6G) and heroin, but not others such as morphine and methadone. We now have examined 5’ splicing in the rat. Results: The current studies identified in the rat a homologous exon 11 and seven exon 11-associated variants, suggesting conservation of exon 11 and its associated variants among mouse, rat and human. RT-PCR revealed marked differences in the expression of these variants across several brain regions, implying region-specific mRNA processing of the exon 11-associated variants. Of the seven rat exon 11-associated variants, four encoded the identical protein as found in rMOR-1, two predicted 6 TM variants, and one, rMOR-1H2, generated a novel N- terminal variant in which a stretch of an additional 50 amino acids was present at the N-terminus of the previously established rMOR-1 sequence. When expressed in CHO cells, the presence of the additional 50 amino acids in rMOR-1H2 significantly altered agonist-induced G protein activation with little effect on opioid binding. Conclusion: The identification of the rat exon 11 and its associated variants further demonstrated conservation of 5’ splicing in OPRM1 genes among rodents and humans. The functional relevance of these exon 11 associated variants was suggested by the region-specific expression of their mRNAs and the influence of the N-terminal sequence on agonist-induced G protein coupling in the novel N-terminal variant, rMOR-1H2. The importance of the exon 11-associated variants in mice in M6G and heroin analgesia revealed in the exon 11 knockout mouse implies that these analogous rat variants may also play similar roles in rat. The complexity created by alternative splicing of the rat OPRM1 gene may provide important insights of understanding the diverse responses to the various mu opioids seen in rats. Background range of responses among patients, a variability con- Three families of opioid receptors were proposed from firmed among different strains of mice. These findings, pharmacological studies [1,2]. Of the three opioid recep- along with receptor binding studies and the actions of tor families, the mu opioid receptors are particularly selective antagonists, led us to propose the existence of important since they mediate the actions of most of the multiple mu opioid receptor subtypes [3] long before clinically relevant opioids, as well as those most widely the molecular characteristics of mu receptors were abused such as heroin. Clinicians have observed a wide known. The molecular cloning of the mu opioid receptor (MOR-1) [4-6] opened new opportunities to investigate * Correspondence: pany@mskcc.org the molecular underpinnings for the concept of multiple Department of Neurology and Program in Molecular Pharmacology and Chemistry, Memorial Sloan-Kettering Cancer Center, New York, NY 10065, mu opioid receptors. A single mu opioid receptor gene USA (OPRM1) has been identified in mammals, raising Full list of author information is available at the end of the article © 2011 Xu et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Xu et al. Molecular Pain 2011, 7:9 Page 2 of 14 http://www.molecularpain.com/content/7/1/9 questions on how to reconcile a single gene with the therefore contribute to the disparities in mu agonist- multiple pharmacologically defined mu opioid receptors. induced receptor internalization. One possibility is alternative pre-mRNA splicing, which In themouse,OPRM1 generatesasetofsplicevar- can provide enormous RNA and protein diversity. A iants associated with exon 11, located approximately number of G protein-coupled receptors undergo alterna- 30 kb upstream of exon 1, under the control of a distinct tive splicing, such as dopamine D [7,8], somatostatin 2 exon 11 promoter [24,28]. Of nine exon 11-associated [9], prostaglandin EP [10], serotonin receptor subtypes variants, three variants encoded the original mMOR-1 [11], tachykinin NK(2) [12], metabotropic glutamate protein, five variants lacked exon 1 and predicted a 6 TM receptor protein, and one variant predicted a protein receptor [13,14], and metabotropic muscarinic acetyl- choline receptors [15,16]. Antisense mapping studies with single TM. The functional relevance of exon provided early evidence suggesting alternative splicing of 11-associated variants was established by studies in an the mouse and rat OPRM genes [17,18], which was exon 11 KO mouse model [42]. Unlike the exon 1 KO further supported by the studies in an exon 1 knockout mouse developed by Pintar [19], the exon 11 KO mouse (KO) mouse model generated by Pintar and colleagues retained full sensitivity towards morphine and metha- [19]. In this mouse, loss of exon 1 eliminated all the full done analgesia while the effects of M6G, fentanyl and length variants, which contain exon 1. However, a series heroin were greatly attenuated. This suggested that exon of exon 11-associated variants lacking exon 1 were still 11 associated variants mediated the actions of a subset of expressed. Pharmacologically, disrupting exon 1 in this mu opioids, including M6G and heroin. mouse completely abolished morphine analgesia, but Previous studies also have reported many splice var- not that of either M6G or heroin, consistent with the iants from the rat OPRM1 gene [20,25] (Figures 1 & 2), possibility that alternatively spliced transcripts lacking as well as the human OPRM1 gene [21,26,28,32,33]. The exon 1 might be responsible for the residual M6G and current study reports the identification and characteriza- heroin actions. tion of the rat exon 11 homolog and seven exon 11- In recent years, alternative splicing of the OPRM1 genes associated variants. has been extensively explored by our group and others [20-34]. In the mouse OPRM1 gene, over 28 alternatively Results spliced variants have been isolated. Of these splice var- Cloning the rat exon 11-associated splice variants iants, most are C-terminal variants that were generated To determine whether the rat OPRM1 gene contained an through alternative splicing between exon 3 and 10 differ- exon homologous to the mouse exon 11, we blasted the ent downstream exons [35]. These C-terminal variants rat genome database in Ensembl using the mouse exon from mice, rats and humans bound mu opioids with simi- 11 sequence and found a highly homologous sequence lar high affinities, but displayed marked differences in ago- with 86% identity, which included both coding and adja- nist-induced G protein coupling in both their potency, cent intron regions that included the splice site (Figure 3). defined by the EC values, and efficacy, indicated by the We designated this sequence as the rat exon 11. The rat maximal stimulation[25,27,36,37]. Although it can be exon 11 was located at about 21 kb upstream of exon 1 speculated that different C-terminal tails may alter interac- in the rat OPRM1 locus of chromosome 1, a distance tions of receptor with different G proteins or other related similar to the 30 kb seen in the mouse OPRM1 gene [24] proteins like regulator of G protein signaling (RGS) pro- and the 28 kb in the human OPRM1 gene [28]. However, teins based upon their intracellular location, the underly- the sequence of the rat exon 11 predicted only seven ing mechanisms for these differences remain unclear. amino acids before encountering a stop codon. To isolate Morphine-induced internalization also varied among the potential rat exon 11-associated splice variants homolo- C-terminal variants. For example, morphine given intra- gous to those identified in the mouse OPRM1 gene, we cerebroventricularly in vivo internalized mMOR-1C in the performed RT-PCR using sense primers designed from mouse lateral septum, while mMOR-1 is not internalized the rat exon 11 sequence together with two antisense pri- by morphine [38]. Mu agonist-induced interaction of mers from the 3’UTR of exon 4. We identified seven phosphorylated mu opioid receptor with b-arrestins have exon 11-associated splice variants, rMOR-1G1, rMOR- been indicated to involve the receptor internalization and 1G2, rMOR-1H1, rMOR-1H2, rMOR-1i1, rMOR-1i2 and desensitization [39-41]. Various additional phosphoryla- rMOR-1i3, from rat brain (Figures 1B, 2 &4). tion sites for b-adrenergic receptor kinase, protein kinase The rat exon 11 contained an alternative splice site C, caseine kinase, tyrosine kinase and cAMP- and cGMP- that divided the exon into two parts, a pattern similar to dependent protein kinases have been predicted among dif- that seen in the human exon 11 [28], which we assigned ferent C-termini [35]. Although highly speculative, these as exon 11a and exon 11b. Alternative usage of the two phosphorylation sites at different C-termini may differen- splice sites in the exons 11a and 11b led to the series of splice variants. rMOR-1G1 contained exons 11a/11b/2/ tially modulate the recruitment of b-arrestins and Xu et al. Molecular Pain 2011, 7:9 Page 3 of 14 http://www.molecularpain.com/content/7/1/9 A. Genomic structure 1 3 11 5 9 2 15 4 10 6 7 8 Exon a/b c/b/a a/b b/a b/a E11 Promoter E1 Promoter Intron (kb) 31 0.8 1 7 9 63 23 28 7 60 21 7 B. Alternatively spliced variants rMOR-1 rMOR-1A rMOR-1B1 rMOR-1B2 rMOR-1C1 rMOR-1C2 rMOR-1D rMOR-1P rMOR-1S rMOR-1G1 rMOR-1G2 rMOR-1H1 rMOR-1H2 rMOR-1i1 rMOR-1i2 rMOR-1i3 Figure 1 Schematic of the rat OPRM1 gene structure and alternative splicing. A. Genomic structure of the rat OPRM1gene. Exons and introns are showed by boxes and horizontal lines, respectively. Translational start and termination sites are indicated by downward and upward lines on exon boxes, respectively. Exons are numbered based upon their time of discovery, as previously reported. B. Alternatively spliced variants of the rat OPRM1 gene. Exon composition for each alternatively spliced variant was indicated by appropriate exon boxes. The lines between exons are introns that are spliced out during splicing. Translation start and stop points are shown by bars below and above exon boxes, respectively. rMOR-1 rMOR-1H1 rMOR-1i1 rMOR-1G1 rMOR-1i2 rMOR-1i3 Exon 11 M M E A F S K S A F Q K L mE11 GCGGGATCTGGGCCGATGATGGAAGCTTTCTCTAAGTCTGCATTCCAAAAGCT rE11 ATGGGATCTGGTCCAATGCTGTAAGCTTTCTCCAAGTCCGCATTCCAAAAACT M G S G P M L * A F S K S A F Q K L Exon 11b Exon 11a intron R Q R D G N Q E G K S Y L R mE11 CAGACAGAGAGATGGAAATCAAGAGGGGAAGAGTTACCTCAGgttggtttctc rMOR-1H2 rMOR-1G2 rE11 G-GACAGGGAGATAGAAATCAAGAGGGGAAG--TTACCTCAGgtgggcttctc D R E I E I K R G S Y L R intron mE11 ttcagactgtagtgatggctttgtctgaactatttgcctctcttccctgc--- rE11 ttcagagtgtagcgatggctttgcctgaactaattgcctctcttttctgc--- Figure 3 Sequence comparison of the rat exon 11 with the mouse exon 11. The nucleotide sequences and their deduced amino acids of the mouse exon 11 (mE11) and the rat exon 11 11a Exons 1 2 3 4 (rE11) are shown by capital letters. Intron sequences are indicated Figure 2 Schematic of protein structures predicted from Exon by low letters. The identical nucleotides are indicated by non-italic 11-associated variants. Colored bars indicate proteins predicted letters and diverse nucleotides by italic letters. Exon-exon and exon- from different exons. intron boundaries are indicated by arrows. Xu et al. Molecular Pain 2011, 7:9 Page 4 of 14 http://www.molecularpain.com/content/7/1/9 Figure 4 The partial nucleotide sequence and predicted amino acid sequence of the rat variants. Exon-exon boundaries are indicated by arrows. The stop codons are showed by *. The complete cDNA and deduced amino acid sequences of rMOR-1G1, rMOR-1G2, rMOR-1H1, rMOR- 1H2, rMOR-1i1, rMOR-1i2 and rMOR-1i3 have been deposited in the GenBank database with Accession numbers: DQ680043, EU024650, EU340244, EU024651, EU340245, EU024652 and EU340246, respectively. Xu et al. Molecular Pain 2011, 7:9 Page 5 of 14 http://www.molecularpain.com/content/7/1/9 3/4. If the AUG in exon 11a was used, rMOR-1G1 only predicted a peptide with seven amino acids since the stop codon predicted from exon 11b terminated its translation. However, rMOR-1G1 still could use the first AUG from exon 2 as the translational start codon to yield a 6 TM protein, a situation similar to that human hMOR-1G1 [28], the mu receptor [31] and hMOR-1K [33]. rMOR-1G2 had the same exon composition as rMOR-1G1 except that the stop codon in exon 11b was skipped due a downstream splice site of exon 11a. Thus, like both mMOR-1G and hMOR-1G2, translation of rMOR-1G2 can proceed from the exon 11a AUG to encode a 6 TM protein since the exon 11a reading- frame was in frame with that of exons 2/3/4 (Figures 2 &3). Thetwo AUGs inexon11awereinthe same reading-frame and separated by four amino acids. We arbitrarily assigned the first AUG as the translational start codon for rMOR-1G2, although it is not clear which AUG is actually used. The other five variants, rMOR-1H1, rMOR-1H2, rMOR-1i1, rMOR-1i2 and rMOR-1i3, contained exons 11a, 1a, 2, 3 and 4, but with alternative splicing among exons 11a, 11b, 1a, 1b and 1c to generate different tran- scripts. Despite their differences in exon composition, rMOR-1H1, rMOR-1i1, rMOR-1i2 and rMOR-1i3 all predicted the same protein sequence as the original rMOR-1 when using AUG in exon 1a as translational start codon (Figure 1B, 2 & 4). Translation from the AUG of exon 11a predicted a short protein sequence due to early translation termination within exon 11b, exons 1b or 1c. The ability of four different exon11-con- taining transcripts to encoded the same protein as rMOR-1 protein mimics three mouse exon 11-contain- ing variants, mMOR-1H, mMOR-1I and mMOR-1J [24]. The predicted protein sequence of rMOR-1H2 was intri- guing. Splicing from exon 11a to exon 1a gave rise to a sequence that predicted an in-frame fusion protein from exon 11a to exons 1a/2/3/4 when the AUG in exon 11a was used as the translational start codon (Figures 2 & 4). Thus, rMOR-1H2 encoded a novel receptor protein con- taining the same amino acid sequence as rMOR-1, but with an additional 50 amino acids at the N-terminus. In vitro transcription coupled translation revealed a molecu- lar weight for rMOR-1H2 that was approximately 5 kD Figure 5 In vitro translation of rMOR-1 and rMOR-1H2. In vitro higher than that of rMOR-1, suggesting the preferential transcription coupled translation was performed as described in the usage of the AUG in exon 11a to initiate translation methods section. (Figure 5). The 50 amino acid sequence did not contain a predicted transmembrane domain, implying that rMOR- 1H2 still encoded a 7 TM protein. Interestingly, the addi- 2/3a probe, designated to detect most of the variant tional sequence did possess a potential N-glycosylation site. mRNAs, hybridized several heavy and diffuse bands ranging from 2 - 15 kb, a band pattern similar to Northern blots Expression of the rat exon 11-associated variant mRNAs using mouse and human brains with their respective exon Therelativesizeand abundanceofthevariantmRNAs was 2/3a probes [24,37]. The exon 11 probe detected a major assessed using Northern blot analysis (Figure 6). The exon strong band around 12 kb. A similar band with relatively Xu et al. Molecular Pain 2011, 7:9 Page 6 of 14 http://www.molecularpain.com/content/7/1/9 expression was mainly observed in the brain stem. The brain stem expressed all the variants at relatively high levels except for rMOR-1H1, whereas the hypothalamus expressed the most variants at very low levels. These results suggested region-specific alternative splicing of these variant pre-mRNAs. Characterization of the rat exon 11-associated variants by receptor binding Of the seven exon 11-associated variants, rMOR-1H1, rMOR-1i1, rMOR-1i2 and rMOR-1i3, predicted the same protein as rMOR-1, while rMOR-1H2 encoded a novel receptor protein with additional 50 amino acids extended at the N-terminal tip of rMOR-1. To examine the phar- macological binding profiles of these variants, we estab- lished CHO cell lines stably expressing these variants and examined [ H] DAMGO binding. Saturation studies demonstrated similar high affinities of [ H] DAMGO for all five variants (Table 2). Although the small difference in K values between rMOR-1i3 and rMOR-1, rMOR- 1H2, rMOR-1i1 and rMOR-1i2 were statistically signifi- cant, we believe that these small differences reflected dif- ferences in the assays rather than the receptor itself, particularly since they all predict receptors with identical amino acid sequences. While it theoretically might be due to the concurrent generation of the 16 amino acid fragment predicted from the methionine in exon 11a, there is, to date, nothing to indicate that this peptide is actually generated. Competition studies confirmed their mu selectivity (Table 3), with mu ligands such as mor- phine and M6G potently lowering binding while the kappa -selective opioid U50,488H and the delta-selective ligand DPDPE did not. As expected, the variants with the same predicted protein as rMOR-1 displayed the similar binding characteristics as rMOR-1 itself. rMOR-1H2 Figure 6 Northern blot analysis Northern blots were performed on rat brain using an exon 2/3 probe and an exon 11 probe, as bound both agonists and antagonists with affinities indis- described in the Methods section. tinguishable from other variants including rMOR-1, indi- cating that the additional 50 amino acids at N-terminus did not influence opioid binding. same size was also seen in the blot with the exon 2/3a probe. Two weaker bands were seen around 1 - 1.5 kb and Functional comparison of rMOR-1 with rMOR-1H2 in 2-4.5kb, respectively. agonist-induced [ S]GTPgS binding We next examined the expression of the variant mRNAs in several brain regions using RT-PCR (Figures 7A, 7B, All five full-length variants with 7 TM contained exon 1. Table1&Additional files1,2&3). TherMOR-1band Of these, only rMOR-1H2 encoded a novel protein, dif- was observed in all the regions with relatively equal abun- fering from the others by the extended N-terminal dance, except for lower levels in the cerebellum. However, sequence. Previously, we found that the C-terminal var- the expression of the other mRNAs varied markedly iants of the OPRM1 gene displayed differences in ago- among the regions. rMOR-1G1, rMOR-1G2 and rMOR- nist-induced G protein activation despite their small 1H2 were highly expressed in the brain stem, hippocam- differences in receptor binding profile [25]. To investi- pus and spinal cord, but had very lower levels in the cere- gateapossiblefunctionaleffectoftheadditional N- bellum and hypothalamus. In contrast, rMOR-1H1 was terminal sequence in rMOR-1H2 on agonist-induced G abundant in the cerebellum, hippocampus and spinal protein activation, we compared theagonist-inducesti- cord, but limited in the brain stem and hypothalamus. On mulation profiles of several agonists on [ S]GTPgS the other hand, rMOR-1i1, rMOR-1i2 and rMOR-1i3 binding in stably transfected CHO cells expressing Xu et al. Molecular Pain 2011, 7:9 Page 7 of 14 http://www.molecularpain.com/content/7/1/9 Figure 7 Regional distribution of the mRNAs from the rat exon 11-associated variants A. Four sets of total RNAs were extracted from brain regions dissected from four separate groups of rats. Each group contained 1 or 2 rats depending upon the size of the regions. RT-PCRs were performed using primers designed for amplifying rMOR-1G1, rMOR-1G2, rMOR-1H1, rMOR-1H2, rMOR-1i1, rMOR-1i2, rMOR-1i3 and rMOR-1 as described in the Methods. G3PDH was used as RNA loading control. The PCR products were separated on 1% agarose gel, stained with ethidium bromide and photographed using FluorChem 8000 Image System. Only one of four sets data was shown, while the data from other three sets were shown in Additional files 1, 2 & 3. B. Quantification of the PCR products from the four sets of RNAs. The band intensities from the agarose gel were quantified with AlphaEase FC software of the Image System and normalized with the band intensities of G3PDH. The data were graphed using GraphPad Prism 4.0 and analyzed with Two-way ANOVA. The results are shown in Table 1. rMOR-1H2 and rMOR-1 (Table 4). All the drugs effec- more potent in rMOR-1H2 than in rMOR-1, as was tively stimulated [ S]GTPgSbinding.However,we b-endorphin. Maximal stimulation revealed that mor- observed differences in both their potencies (EC value) phine was significantly more efficacious in rMOR-1H2 and efficacies (% maximal stimulation) among the var- than in rMOR-1. There was little correlation between iants. For example, DAMGO and dynorphin A were the EC and the maximal stimulation, as shown by the 50 Xu et al. Molecular Pain 2011, 7:9 Page 8 of 14 http://www.molecularpain.com/content/7/1/9 Table 1 Significance values of the semi-quantitative RT-PCR for the expression of the exon 11 associated variants’ mRNAs in the selected brain regions cb vs hyp cb vs bs cb vs hip cb vs spc hyp vs bs hyp vs hip hyp vs spc bs vs hip bs vs spc hip vs spc rMOR-1 ns ns 0.05 0.05 ns ns ns ns ns ns rMOR-1G1 ns 0.001 0.001 0.001 0.001 0.001 0.001 ns ns ns rMOR-1G2 ns 0.001 0.001 0.001 0.001 0.001 0.001 ns ns ns rMOR-1H1 ns ns 0.01 0.001 ns 0.001 0.001 0.001 0.001 ns rMOR-1H2 ns 0.01 0.01 0.001 0.01 0.01 0.001 ns ns ns rMOR-1i1 ns 0.001 ns ns 0.001 ns ns 0.001 0.001 ns rMOR-1i2 ns 0.001 ns ns 0.001 ns ns 0.00 0.001 ns rMOR-1i3 ns 0.001 ns ns 0.001 ns ns 0.001 0.001 ns Two-way ANOVA followed by Bonferroni post tests was performed to determine significant difference among the selected brain regions for each variant. cb: cerebellum; hyp: hypothalamus; bs: brainstem; hip: hippocampus; spc: spinal cord; ns: no significance (p > 0.05). fact that dynorphin A was the most efficacious of the [3,43-45]. However, to date only a single mu opioid ligands tested, despite its lower potency. receptor gene has been identified, raising the questions To obtain a general indication of the intrinsic activity of of how a single OPRM1 gene could explain the complex the various ligands, we compared their EC values after pharmacology of mu opioids in animals and humans. normalizing for their receptor binding affinity (EC /K ). Our early antisense mapping studies suggested different 50 i This provides an indication of the receptor occupancy exon combinations for the analgesic actions of the two needed to elicit the response. The lower the number, the mu agonists morphine and M6G, raising the possibility greater is the intrinsic activity of the ligand. While the of alternative splicing in the OPRM1 gene [17,46]. Since EC values for M6G and DAMGO were similar for then, much effort has been devoted to identifying these rMOR-1, their EC /K ratios differed by approximately OPRM1variants. To date, over 28 splice variants of the 50 i 10-fold. A similar situation existed for rMOR-1H2. The mouse OPRM1 gene have been isolated [22-24,27,35], potency of dynorphin A in stimulating [ S]GTPgS was far some of which had been previously identified in humans less than that of the other ligands, while its EC /K ratio [21] and rats [20]. 50 i was the lowest, implying the greatest intrinsic activity. The The majority of variants were C-terminal variants, differ- rank order of the EC /Ki values varied from their corre- ing only at the C-terminal tip. These variants revealed sponding rank order of both the EC and the maximal sti- marked differences in their regional distribution at both mulation values. Comparing the two variants, we also saw mRNA and protein level [22-24,27,47-52] and agonist- induced G protein activation and internalization [25,36,37]. different rank-order ratios (Table 4). These results sug- gested that the extra 50 amino acids influence agonist- We then identified a second set of variants associated with induced G protein activation. exon 11, a previously unknown exon located 30 kb upstream of exon 1 [24], and established their functional Discussion significance in an exon 11 KO mouse model [42]. Disrupt- Multiple mu opioid receptors were proposed in many ing exon 11 diminished M6G and heroin analgesia without years ago, mainly based upon pharmacological studies affecting morphine or methadone actions, suggesting that exon 11 and its associated variants played an important Table 2 Saturation studies with [ H] DAMGO role in the actions of a subset of mu opioids that include Clone K (nM) B (pmol/mg protein) D max M6G and heroin. A number of C-terminal variants have rMOR-1 0.39 ± 0.03 0.47 ± 0.07 been isolated from the rat [20,25] and human OPRM1 rMOR-1H1 0.51 ± 0.05 0.40 ± 0.01 genes [21,26,37]. We recently isolated a homolog exon 11 rMOR-1H2 0.37 ± 0.02 0.30 ± 0.05 and three its associated variants in the human OPRM1 rMOR-1i1 0.36 ± 0.05 0.24 ± 0.02 gene [28]. The current studies have now extended a similar rMOR-1i2 0.36 ± 0.04 0.26 ± 0.01 splicing pattern to the rat with the identification of a homo- rMOR-1i3 0.63 ± 0.06 0.24 ± 0.01 logous exon 11 and seven associated variants in the rat [ H] DAMGO binding was performed in membranes of CHO cells stably OPRM1 gene. Additionally, the exon 11 sequence has been expressing the indicated variant constructs. The binding parameters were predicted from the OPRM1 genomic locus of six other determined by nonlinear regression analysis. Results are the mean ± S.E.M. of mammalian species through NBCI and Ensembl databases, at least three independent determinations. P values determined by one-way ANOVA were 0.0013 for K and 0.0311 for B . Tukey post hoc analysis D max including chimpanzees, monkeys, guinea pigs, bats, cows determined that rMOR-1i3 was different from rMOR-1, rMOR-1i1, rMOR-1i2 and armadillos [53], but not in lower vertebrate species and rMOR-1H2 (p < 0.001), and that there was no significant difference among the variants in B . such as fish and amphibians that contain OPRM1 gene. max Xu et al. Molecular Pain 2011, 7:9 Page 9 of 14 http://www.molecularpain.com/content/7/1/9 Table 3 Competition of [ H] DAMGO binding among the rat MOR-1 variants Ligand K Value rMOR-1 rMOR-1H1 rMOR-1H2 rMOR-1i1 rMOR-1i2 rMOR-1i3 Morphine 1.5 ± 0.2 2.0 ± 0.3 0.8 ± 0.1 1.3 ± 0.4 1.2 ± 0.2 1.6 ± 0.2 M6G 4.5 ± 0.3 4.5 ± 0.5 2.6 ± 0.6 3.8 ± 0.5 5.1 ± 1.0 6.3 ± 0.7 DADLE 2.4 ± 0.1 1.9 ± 0.3 DSLET 6.3 ± 0.3 7.2 ± 1.1 Naloxone 0.8 ± 0.1 0.9 ± 0.1 0.8 ± 0.3 0.9 ± 0.1 0.7 ± 0.1 1.3 ± 0.2 b-Endorphin 2.7 ± 0.2 3.1 ± 0.3 3.8 ± 1.9 3.3 ± 0.3 3.7 ± 0.3 6.3 ± 0.7 Dynorphin A 15.5 ± 0.9 37.5 ± 5.3 21.8 ± 5.1 16.2 ± 3.5 23.6 ± 2.8 34.6 ± 6.8 U50,488H > 500 > 500 > 500 > 500 > 500 > 500 DPDPE > 500 > 500 > 500 > 500 > 500 > 500 [ H] DAMGO binding was performed in membranes of CHO cells stably expressing the indicated variants. Dissociate constants, K values, were determined from IC values of at least three independent determinations. One-way ANOVA was used to compare the K values for each drug among the variants. Of the opioids, 50 i only M6G (p = 0.0157) showed significant difference with lower K value of rMOR-1H2 as compared to that of rMOR-1i3 (p < 0.01) in Tukey post hoc analysis. The nucleotide sequence and genomic location of the early termination of translation in exons 1b and exon 1c, ratexon11 weresimilartothose in themouse and respectively. However, both rMOR-1i2 and rMOR-1i3 human. However, some differences exist between the rat can initiate translation from the AUG of exon 1a to gen- and mouse exons 11. Whereas the rat contains an alter- erate the same protein as the original rMOR-1. Thus, native splice site within exon 11 which splits it into together with rMOR-1H1 and rMOR-1i1, a total of four exon 11a and exon 11b, a situation similar to the exon 11-associated transcripts can produce the identical human exon 11, the mouse does not. Alternative usage rMOR-1 protein, a similar situation seen in the mouse of these two splice sites within exon 11, together with a exon 11-aasociated variants. This raises questions regard- choice of downstream exons, created a number of differ- ing why four different splice variants are needed to gen- ent variants. The rat exon 11b has a predicted stop erate the same protein. It is interesting to speculate, that codon when translated from its first AUG in exon 11a, these differences may differentially regulate their cellular leading to only seven amino acids in rMOR-1G1, location and their ability to express the protein, but there rMOR-1H1 and rMOR-1i1. However, initiating transla- is no evidence to date to support this possibility. tion from the first AUG of exon 2 in rMOR-1G1 pre- On the other hand, translation from the AUG of exon 11a also generated the 6 TM protein, rMOR-1G2. Skip- dicts a 6 TM protein. Using the AUG in exon 1a of rMOR-1H1 and rMOR-1i1, rMOR-1i2, rMOR-1i3 leads ping exon 11b maintained the reading frame from AUG to the same protein as the original rMOR-1. of exon 11a through exons 2/3/4. Similarly, skipping The variants that skip exon 11b can translate through exon 11b also enabled rMOR-1H2 to read through, from the AUG in exon 11a, but differed in amino acid yielding a novel receptor with extra 50 amino acids sequence depending upon their downstream exons. In extended at the N-terminus of rMOR-1, a prediction rMOR-1i2 and rMOR-1i3, translation using the first that was supported by in vitro transcription coupled AUG in exon 11a still predicted small proteins due to with translation. Thus, rMOR-1H2 is the first full length Table 4 Stimulation of [ S]GTPgS binding by opioids in rMOR-1 and rMOR-1H2 rMOR-1 rMOR-1H2 EC EC /K % Max Relative Efficacy (%) EC EC /K % Max Relative Efficacy (%) 50 50 i 50 50 i Morphine 59 ± 18 39 180 ± 4 71 70 ± 24 88 225 ± 20* 90 M6G 40 ± 4 9 149 ± 3 59 44 ± 6 17 189 ± 25 75 DAMGO 35 ± 2 90 192 ± 5 76 20 ± 3* 54 209 ± 17 83 b-Endorphin 58 ± 34 21 226 ± 12 89 24 ± 8 6 241 ± 17 96 Dynorphin A 344 ± 64 22 254 ± 6 100 162 ± 12* 7 251 ± 44 100 Membranes were prepared from CHO cells stably transfected with the indicated cDNA constructs and [ S]GTPgS binding carried out as described in the Methods section. The maximal stimulation, defined as the percent increase over basal binding, % Max, and the dose of drug needed to elicit 50% of the maximal response, the EC , were calculated by nonlinear regression analysis (GraphPad Prism 4.0). Results are the means ± S.E.M. of at least three independent determinations. Significant differences of the EC and maximal stimulation between rMOR-1 and rMOR-1H2 were analyzed by Student t-test. Intrinsic activity (EC /K ) was calculated by dividing EC values by K values in Table 2. The relative efficacies for the listed opioids were determined for each of the variants, 50 i 50 i based upon the maximal stimulation values. The drug with the highest level of stimulation for a specific variant was arbitrarily given an efficacy of 100%. Efficacy for all the other compounds for the indicated variant was defined relative to the drug with the greatest maximal stimulation. *: p < 0.05, when compared to rMOR-1. Xu et al. Molecular Pain 2011, 7:9 Page 10 of 14 http://www.molecularpain.com/content/7/1/9 (i.e. 7 TM) rat splice variant isolated with a different as the last coding exon. While rMOR-1G1 also predicts a protein sequence at the N-terminus. 6 TM variant with a terminal exon 4, it requires using Theexon 11 mRNAs arerelativelyabundantin the the AUG within exon 2 to initiate translation. Despite brain, as illustrated by Northern blot analysis that our efforts, we were unable to isolate rat homologs of the displayed a major ~ 12 kb band with intensity compar- mouse mMOR-1M and mMOR-1N. While it is possible able to that observed with the exons 2/3 probe. that they do not exist in rats, it also is possible that these homologs are localized to very specific brain regions with The expression of the exon 11-associated variant a low overall abundance. The functional relevance of the mRNAs differed markedly among brain regions, con- 6 TM mouse variants has been suggested by a range of trasting with the relatively homogenous expression levels of rMOR-1. This suggested that, like the mouse, there is studies. First, although they do not bind radiolabeled mu region- and/or cell-specific RNA processing of the var- agonists with high affinity, the mouse 6 TM variants iant pre-mRNAs and/or varying levels of upstream pro- displayed a moderate binding affinity towards [ H]-dipre- moter activity. Differential expression of the variant norphine (K approximately 10 nM; J Xu, GW Pasternak mRNAs among brain regions also raised questions and YX Pan, unpublished observation). Second, the regarding their functions. Recently, we observed high 6 TM variants can physically associate with the regular correlations between mRNA expression levels, including 7 TM MOR-1 and modulate the expression of the 7 TM exon 11-associated variants, in selected brain regions receptors on cell surface membrane (J Xu, GW Pasternak with thedegreeofmorphineand heroindependence and YX Pan, unpublished observation). More impor- and tolerance among four inbred strains of mice (J Xu, tantly, disrupting exon 11 diminished M6G and heroin B Kest and YX Pan, unpublished observations). These analgesia without affecting morphine and methadone, results suggest a possible contribution of alternative spli- suggesting selective roles of the 6 TM exon 11-associated cing of the OPRM1 gene in mu opioid tolerance and variants in the actions of M6G and heroin. Finally, the addiction in mice, although the relevance of these corre- conservation of the exon 11 and exon 11-associated var- lations needs to be further validated. It will be interest- iants across species further supports their role. ing to see if these correlations also exist in rat. The genomic location of the rat exon 11 approxi- Conclusions mately 21 kb upstream of exon 1 suggested the exis- We isolated a rat exon 11 and seven exon 11-associated tence of an upstream promoter controlling the splice variants from the rat OPRM1 gene, resembling expression of the exon 11-associated variants. Prelimin- splicing in both mice and humans and suggesting con- ary studies indicate that the 5’ flanking region of the rat servation of exon 11 and its associated variants in mam- exon 11 has promoter activity, particularly in the neuro- mals. The rat OPRM1 gene now contains eleven exons blastoma cell lines NIE115 and Be(2)C cells, assessed spanning over 250 kb and whose combination by alter- using a secreted alkaline phosphotase (SEAP) reporter native splicing generates over sixteen variants. The func- assay (J Xu and XY Pan, unpublished observation). tional significance of these rat exon 11-associated rMOR-1H2 encoded a full length 7 TM mu opioid variants was suggested by the region-specific expression receptor with a unique, extended N-terminus. Its similar of their mRNAs and the influence of the novel N-term- binding profile is consistent with the other variants was inal sequence on agonist-induced G protein coupling in expected sinceitisbelievedthatthe binding pocketis the N-terminal variant, rMOR-1H2. The existence of contained within the transmembrane regions, which are the rat exon 11-associated variants raises questions identical among all the full length variants. However, regarding their potential role in mediating the actions of the additional N-terminal 50 amino acids in rMOR-1H2 heroin and M6G in rat. The diversity and complexity did influence agonist-induced G protein activation, a created by alternative splicing of the rat OPRM1 gene similar scenario seen in the human N-terminal variant, may provide important insights of understanding the hMOR-1i [28]. While similar results were observed with diverse responses to the various mu opioids seen in rat. the C-terminal variants, but this was more easily under- stood because of the presumed ability of the C-terminus Methods to influence coupling to transduction proteins. How the Genomic database searching additional N-terminal sequence influences receptor acti- Alignment of the mouse exon 11 sequence in with the vation is as yet unknown. rat OPRM1 gene in the Ensembl human genome data- In the mouse, the exon 11-associated variants mMOR- base revealed a sequence homologous to exon11. The 1G, mMOR-1M and mMOR-1N predict 6 TM variant rat exon 11 was mapped approximately 21 kb upstream due to skipping of exon 1, which encodes the first TM. of exon 1 in the rat OPRM1 locus. There is 86% identity rMOR-1G2 predicted a similar 6 TM protein with trans- at the nucleotide level between the rat exon 11 and the lation of exon 11 that resembles mMOR-1G with exon 4 mouse exon 11 sequences (Figure 3). Xu et al. Molecular Pain 2011, 7:9 Page 11 of 14 http://www.molecularpain.com/content/7/1/9 Reverse transcription-polymerase chain reaction (RT-PCR) AN1 and E4-AN2); for rMOR-1i2, a exon 11 sense pri- cloning mer (E11-SE4: 5 ’-GAA GGA TGG GAT CTG GTC Total RNA was isolated from rat brain or selected brain CAA TGC TTG CAT G-3’) and E4-AN1 primer; and regions by the guanidinium thiocyanate phenol-chloro- for rMOR-1i3, an exon 11 sense primer (E11-SE5: 5’- form extraction method [54] and reverse transcribed GCT TGA AGG ATG GGA TCT GGT CCA ATG with random primers and Superscript II reverse tran- CTA TAC GAG-3’)and E4-AN1 and E4-AN2primers. scriptase (Invitrogen) as previously described [22,55] or All PCR fragments were subcloned into pcDNA3.1/ with an antisense primer from exon 4 (E4-AN1, 5’-CAT V5His-TOPO vector (Invitrogen) and sequenced with GTG CAG AGT GAA GTA GCC AGA G-3 ’)and appropriate primers in both orientations. Superscript III reverse transcriptase (Invitrogen) follow- ing the manufacture’sprotocol.In a20 μl of RT reac- Northern blot analysis tion with random primers and Superscript II, 5 μgof Northern blot analysis was performed as described RNA together with 260 ng of random primer was first [22,55]. Briefly, 20 μg of total brain RNA/lane was sepa- incubated at 70°C for 5 min and then quickly cooled on rated on a 0.8% formaldehyde agarose gel, and trans- ice for 2 min. Following adding the reaction buffer ferred to GenePlus membrane. The membranes were together with 10 mM DTT and 1 mM dNTP and warm- hybridized with either a 257 bp P-labeled exon 11 ing the mixture at 37°C for 2 min, 260 units of Super- probe generated by PCR with a sense primer (E11-SE1) script II were added. The mixture with the enzyme was and an antisense primer (E11-AN1: 5’-GAG GTA ACT incubated at room temperature for 10 min, then at 37°C TCCCCT CTT GAT TTCTAT CTCCC-3 ’)from for 5 min and finally at 42°C for 90 min. The reaction exon 11 or a 685 bp P-labeled exons 2 & 3a probe by was terminated by heating at 75°C for 15 min. In a PCR with a sense primer from exon 2 (E2-SE1: 5’-GAC 20 μl of RT reaction with E4-AN1 primer and Super- TGC CAC CAA CAT CTA CAT TTT CAA C-3’)and script III, 5 μg of RNA together with 10 pmol of E4- an antisense primer from exon 3 (E3-AN1: 5 ’-GTT AN1 primer was first incubated at 70°C for 5 min and CGT GTA ACC CAA AGC AAT GC-3’). then quickly cooled on ice. The reaction buffer together with 5 mM DTT, 1 mM dNTP and 200 units of Super- Regional expression of the variant mRNAs script III was added. The reaction was incubated at 53°C The selected brain regions were dissected from four for 90 min and terminated by heating at 75°C for 15 separate groups of rats. Each group had one or two rats min. Two-step or nested PCRs was used to amplify depending upon the size of the region. Total RNAs exon 11-associated full-length clones using Platinum extracted from the selected brain regions were reverse- Taq DNA polymerase (Invitrogen). The first-step PCRs transcribed with an E4-AN1 primer and Superscript III were carried out using 5 μl of RT reaction as template as described in RT-PCR cloning (see above). The first- with the appropriate primers (see below) for 39 cycles strand cDNAs were used as templates for two-step or after 2 min at 94°C, each cycle consisting of a 20 sec nested PCRs. For exon 11-associated splice variants, the denaturing step at 94°C, a 20 sec annealing step at 65°C first-step PCRs were performed using 5 μl of RT reac- and a 2 min extension at 72°C. In the second-step tion as template and a sense primer from exon 11 (E11- PCRs, 2 μl of the first-step PCR products was used as SE1) and an antisense primer from exon 4 (E4-AN1) for template with appropriate primers (see below) using the 35 cycles with the same PCR cycling conditions as same PCR cycling conditions as the first-step PCR. The described in RT-PCR cloning. In the second-step PCRs, primers used for rMOR-1G1, rMOR-1G2, and rMOR- 3 μl of the first-step PCR products was used as template 1H2 were: two sense primers from exon 11 sequence with appropriate primers (see below). The primers used obtained from the genomic alignment (E11-SE1: 5’-CTT in the second-step PCRs were designed to specifically CCC ATA AGT CAT TTG CTG TCC TTG-3 ’ and amplify each variant and listed as following: for rMOR- E11-SE2: 5 ’-GAA GAG GAA CAC CGA AAC TGG 1G1, a sense primer (G1-SE: 5’-GAA GTT ACC TCA GAA GC-3’) and two antisense primers from exon 4 GAT ACA CCA AAA TGA-3’) and an exon 3 antisense (E4-AN1 and E4-AN2: 5’-GAC AGC AAC CTG ATT primer (E3-AN2: CAG CAG ACG ATA AAT ACA CCA CGT AGA TG-3’); for rMOR-1H1 and rMOR-1i1, GCC ACG-3’); for rMOR-1G2, a sense primer (G2-SE: an exon 11 sense primer (E11-SE3: 5’-GAA GGA TGG 5’-GGT CCA ATG CTA TAC ACC AAA ATG-3’)and GAT CTG GTC CAA TGC TGT AAG CTT TCT CCA E3-AN2 primer; for rMOR-1H1, a sense primer (H1-SE: AGT CCG CAT TCC AAA AAC TGG ACA GGG 5’-AAG TTA CCT CAG GGC TGG TCC-3’)and an AGA TAG AAA TCA AGA GGG GAA GTT ACC exon 2 antisense primer (E2-AN1: 5’-ATG TTC CCA TCA G-3’) and the two exon 4 antisense primers (E4- TCA GGT AGT TGA CAC TC-3’); for rMOR-1H2, a Xu et al. Molecular Pain 2011, 7:9 Page 12 of 14 http://www.molecularpain.com/content/7/1/9 sense primer (H2-SE: 5’-GGT CCA ATG CTG GCT Chinese Hamster Ovary (CHO) cells by LipofectAMINE GGT CC-3’) and E2-AN1 primer; for rMOR-1i1, a sense reagent (Invitrogen). Stable transformants were obtained primer (I1-SE: 5’-AAG TTA CCT CAG TGC ATG 10 - 14 days after selection with G418 and screened with GAG ACC-3’)and E2-AN1 primer;for rMOR-1i2,a a[ H]DAMGO binding assay. sense primer (I2-SE: GGT CCA ATG CTT GCA TGG AGA C-3’) and E2-AN1 primer; for rMOR-1i3, a sense Receptor binding assays primer (I3-SE: 5’-GGT CCA ATG CTA TAC GCG GA-3’) Membranes were prepared from stable transfectants as and E2-AN1 primer. For detecting rMOR-1, the first-step described previously [22]. Saturation and competition PCRs were performed using the same PCR cycling condi- binding assays were performed with [ H]DAMGO at tions with 5 μl of RT reaction, an exon 1c sense primer 25°C for 60 min in 50 mM potassium phosphate buffer, (E1-SE1: 5’-CCC ACT TTA CAC TCG TTT ACA CGG- pH 7.4, containing 5 mM magnesium sulfate. Specific 3’) and E4-AN1 primer. In the second-step PCRs, 3 μlof binding was defined as the difference between total the first-step PCR products was used as template with an binding and non-specific binding, determined in the exon 1 sense primer (E1-SE2: 5’-GAC AGC CTG TGC presence of 10 μM levallorphan. K and K values were D i CCT CAG ACC-3’) and E2-AN1 primer. The second-step calculated by non-linear regression analysis (GraphPad PCRs were carried out for 35 cycles after 2 min at 94°C, Prism 4.0, Carlsbad, CA). Protein concentrations were each cycle consisting of a 20 sec denaturing step at 94°C, a determined using the Lowry method as previously 20 sec annealing step at 60 - 65°C and 45 - 90 sec exten- described using bovine serum albumin (BSA) as the sion at 72°C, depending upon melting temperature of pri- standard [22,28]. mers and length of amplicons. The lengths of the PCR products were consistent with their predicted sizes: 606 bp [ S]GTPgS binding assay for rMOR-1G1, 604 bp for rMOR-1G2, 539 bp for rMOR- Membranes prepared from stable transfectants were 1H1, 537 bp for rMOR-1H2, 794 bp for rMOR-1i1, 793 bp incubated in the presence and absence of indicated for rMOR-1i2, 1051 bp for rMOR-1i3 and 217 bp for opioids for 60 min at 30°C in the assay buffer (50 mM rMOR-1. The sequences of the PCR products were con- Tris-HCl, pH 7.7, 3 mM MgCl , 0.2 mM EGTA, 10 mM firmed by sequencing with appropriate primers. A negative NaCl) containing 0.05 nM [ S]GTPgS (> 1000 Ci/ control using ddH O as template was included for each mmol, PerkimElmer) and 60 μMGDP,aspreviously variant throughout the two-step PCRs. RNA loading was reported [25,36,37]. Basal binding was determined in the estimated by parallel one-step PCRs with a pair of primers presence of GDP and absence of drug. The reaction was for glyceraldehydes 3-phosphate dehydrogenase (G3PDH) terminated by rapid filtration under vacuum through (Clontech). The PCR products were separated on 1% agar- glass fiber filters, followed by three washes with 3 ml of ose gel, stained with ethidium bromide. The agarose gel ice-cold 50 mM Tris-HCl, pH 7.4. Bound radioactivity was photographed and analyzed using a FluorChem 8000 was measured by liquid scintillation spectrophotometry Image System (Alpha Innotech). in Liquid Scintillation Analyzer (TRI-CARB 2900TR, PerkimElmer) after overnight extraction in 5 ml liquis- In vitro transcription coupled translation cint scintillation fluid (National Diagnostic Inc.). Thefull-lengthcDNAsofrMOR-1and rMOR-1H2in Additional material the pcDNA3.1/V5His-TOPO vector were transcribed and translated in vitro with a TnT T7 coupled reticulo- Additional file 1: Regional distribution of the mRNAs from the rat cyte lysate system (Promega) following the manufac- exon 11-associated variants (repeated experiment 1) Figure S1. All turer’s protocol. Briefly, the plasmids were incubated the procedures were performed with a separated group of rat as with T7 RNA polymerase and reticulocyte lysate in the described in the Methods section and Figure 7 legend. presence of 0.04 mCi of [ S]methionine (> 1000 Ci/ Additional file 2: Regional distribution of the mRNAs from the rat exon 11-associated variants (repeated experiment 2) Figure S2. All mmol; PerkimElmer) at 25°C for 90 min. The translated the procedures were performed with a separated group of rat as products were separated on a 12% SDS-polyacrylamide described in the Methods section and Figure 7 legend. gel, and the gel was treated with Amplify (GE Life), Additional file 3: Regional distribution of the mRNAs from the rat dried and exposed to Kodak BioMax MR film. exon 11-associated variants (repeated experiment 3) Figure S3. All the procedures were performed with a separated group of rat as described in the Methods section and Figure 7 legend. Expression of rMOR-1H1, rMOR-1H2, rMOR-1i1, rMOR-1i2 and rMOR-1i3 in Chinese hamster ovary (CHO) cells The rMOR-1H1/pcDNA3.1-TOTO, rMOR-1H2/pcDNA List of abbreviations 3.1-TOPO, rMOR-1i1/pcDNA3.1-TOPO, rMOR-1i2/ 2 4 5 M6G: morphine-6β-glucuronide; DAMGO: [ -Ala ,N-MePhe ,Gly-ol ] pcDNA3.1-TOPO, rMOR-1i3/pcDNA3.1-TOPO and enkephalin; MOR: mu opioid receptor; OPRM1: mu opioid receptor gene; RT: rMOR-1/pcDNA3.1(-) plasmids were used to transfect Reverse-transcription; PCR: polymerase chain reaction; KO: knockout. Xu et al. Molecular Pain 2011, 7:9 Page 13 of 14 http://www.molecularpain.com/content/7/1/9 15. Park YS, Lee YS, Cho NJ, Kaang BK: Alternative splicing of gar-1, a Acknowledgements Caenorhabditis elegans G-protein-linked acetylcholine receptor gene. This work was supported, in part, by research grants to GWP (DA02615 and Biochem Biophys Res Commun 2000, 268:354-358. DA00220) and Y-XP (DA13997 and DA02944) from the National Institute on 16. Park YS, Kim S, Shin Y, Choi B, Cho NJ: Alternative splicing of the Drug Abuse, a grant from the National Genetics Foundation, a grant from muscarinic acetylcholine receptor GAR-3 in Caenorhabditis elegans. Mr. William H. Goodwin and Mrs. Alice Goodwin and the Commonwealth Biochem Biophys Res Commun 2003, 308:961-965. Foundation for Cancer Research and The Experimental Therapeutics Center 17. Rossi GC, Pan YX, Brown GP, Pasternak GW: Antisense mapping the MOR-1 of Memorial Sloan-Kettering Cancer Center to GWP and by a Core Grant to opioid receptor: Evidence for alternative splicing and a novel morphine- MSKCC from the National Cancer Institute (CA8748). 6β-glucuronide receptor. FEBS Lett 1995, 369:192-196. 18. Pasternak GW: Multiple opiate receptors: deja vu all over again. Author details Neuropharmacology 2004, 47(Suppl 1):312-323. Department of Neurology and Program in Molecular Pharmacology and Chemistry, Memorial Sloan-Kettering Cancer Center, New York, NY 10065, 19. Schuller AG, King MA, Zhang J, Bolan E, Pan YX, Morgan DJ, et al: Retention USA. Department of Psychology, CW Post College, Long Island University, of heroin and morphine-6 beta-glucuronide analgesia in a new line of Brookville, NY 11568, USA. mice lacking exon 1 of MOR-1. Nat Neurosci 1999, 2:151-156. 20. Zimprich A, Simon T, Hollt V: Cloning and expression of an isoform of the Authors’ contributions rat μ opioid receptor (rMOR 1 B) which differs in agonist induced JX and MX performed RT-PCR, Northern blot analysis, in vitro transcription desensitization from rMOR1. FEBS Lett 1995, 359:142-146. coupled translation, receptor binding and [ S]GTPγS binding assays. GCR 21. Bare LA, Mansson E, Yang D: Expression of two variants of the human μ dissected brain regions for RNA extraction. Y-XP designed and coordinated opioid receptor mRNA in SK-N-SH cells and human brain. FEBS Lett 1994, the experiments and analyzed data. Y-XP and GWP oversaw the project and 354:213-216. wrote the manuscript. All authors read and approved the manuscript. 22. Pan YX, Xu J, Bolan E, Abbadie C, Chang A, Zuckerman A, et al: Identification and characterization of three new alternatively spliced Competing interests mu-opioid receptor isoforms. Mol Pharmacol 1999, 56:396-403. The authors declare that they have no competing interests. 23. Pan YX, Xu J, Bolan E, Chang A, Mahurter L, Rossi G, et al: Isolation and expression of a novel alternatively spliced mu opioid receptor isoform, Received: 21 July 2010 Accepted: 21 January 2011 MOR-1F. FEBS Lett 2000, 466:337-340. Published: 21 January 2011 24. Pan YX, Xu J, Mahurter L, Bolan E, Xu M, Pasternak GW: Generation of the mu opioid receptor (MOR-1) protein by three new splice variants of the Oprm gene. Proc Natl Acad Sci USA 2001, 98:14084-14089. References 25. Pasternak DA, Pan L, Xu J, Yu R, Xu MM, Pasternak GW, et al: Identification 1. Lord JAH, Waterfield AA, Hughes J, Kosterlitz HW: Endogenous opioid of three new alternatively spliced variants of the rat mu opioid receptor peptides: multiple agonists and receptors. Nature 1977, 267:495-499. gene: dissociation of affinity and efficacy. J Neurochem 2004, 91:881-890. 2. Martin WR, Eades CG, Thompson JA, Huppler RE, Gilbert PE: The effects of 26. Pan YX, Xu J, Mahurter L, Xu MM, Gilbert AK, Pasternak GW: Identification morphine and nalorphine-like drugs in the nondependent and and characterization of two new human mu opioid receptor splice morphine-dependent chronic spinal dog. J Pharmacol Exp Ther 1976, variants, hMOR-1O and hMOR-1X. Biochem Biophys Res Commun 2003, 197:517-532. 301:1057-1061. 3. Wolozin BL, Pasternak GW: Classification of multiple morphine and 27. Pan YX, Xu J, Bolan E, Moskowitz HS, Xu M, Pasternak GW: Identification of enkephalin binding sites in the central nervous system. Proc Natl Acad four novel exon 5 splice variants of the mouse mu-opioid receptor Sci USA 1981, 78:6181-6185. gene: functional consequences of C-terminal splicing. Mol Pharmacol 4. Chen Y, Mestek A, Liu J, Hurley JA, Yu L: Molecular cloning and functional 2005, 68:866-875. expression of a μ-opioid receptor from rat brain. Mol Pharmacol 1993, 28. Xu J, Xu M, Hurd YL, Pasternak GW, Pan YX: Isolation and characterization 44:8-12. of new exon 11-associated N-terminal splice variants of the human mu 5. Thompson RC, Mansour A, Akil H, Watson SJ: Cloning and opioid receptor gene. J Neurochem 2009, 108:962-972. pharmacological characterization of a rat μ opioid receptor. Neuron 1993, 29. Doyle GA, Rebecca SX, Lin SS, Press DM, Grice DE, Buono RJ, et al: 11:903-913. Identification of three mouse micro-opioid receptor (MOR) gene 6. Wang JB, Imai Y, Eppler CM, Gregor P, Spivak CE, Uhl GR: μ opiate (Oprm1) splice variants containing a newly identified alternatively receptor: cDNA cloning and expression. Proc Natl Acad Sci USA 1993, spliced exon. Gene 2007, 388:135-147. 90:10230-10234. 30. Doyle GA, Sheng XR, Lin SS, Press DM, Grice DE, Buono RJ, et al: 7. Guiramand J, Montmayeur JP, Ceraline J, Bhatia M, Borrelli E: Alternative Identification of five mouse mu-opioid receptor (MOR) gene (Oprm1) splicing of the dopamine D2 receptor directs specificity of coupling to splice variants containing a newly identified alternatively spliced exon. G-proteins. J Biol Chem 1995, 270:7354-7358. Gene 2007, 395:98-107. 8. Usiello A, Baik JH, Rouge-Pont F, Picetti R, Dierich A, LeMeur M, et al: 31. Cadet P, Mantione KJ, Stefano GB: Molecular identification and functional Distinct functions of the two isoforms of dopamine D2 receptors. Nature expression of mu 3, a novel alternatively spliced variant of the human 2000, 408:199-203. mu opiate receptor gene. J Immunol 2003, 170:5118-5123. 9. Vanetti M, Kouba M, Wang X, Vogt G, Hollt V: Cloning and expression of a 32. Choi HS, Kim CS, Hwang CK, Song KY, Wang W, Qiu Y, et al: The opioid novel mouse somatostatin receptor (SSTR2B). FEBS Lett 1998, 311:290-294. ligand binding of human mu-opioid receptor is modulated by novel 10. Namba T, Sugimoto Y, Negishi M, Irie A, Ushikubi F, Kakizuka A, et al: splice variants of the receptor. Biochem Biophys Res Commun 2006, Alternative splicing of C-terminal tail of prostaglandin E receptor 343:1132-1140. subtype EP3 determines G-protein specificity. Nature 1993, 365:166-170. 33. Shabalina SA, Zaykin DV, Gris P, Ogurtsov AY, Gauthier J, Shibata K, et al: 11. Lucas JJ, Hen R: New players in the 5-HT receptor field: genes and Expansion of the human mu-opioid receptor gene architecture: novel knockouts. Trends Pharmacol Sci 1995, 16:246-252. functional variants. Hum Mol Genet 2009, 18:1037-1051. 12. Candenas ML, Cintado CG, Pennefather JN, Pereda MT, Loizaga JM, 34. Kvam TM, Baar C, Rakvag TT, Kaasa S, Krokan HE, Skorpen F: Genetic Maggi CA, et al: Identification of a tachykinin NK(2) receptor splice analysis of the murine mu opioid receptor: increased complexity of variant and its expression in human and rat tissues. Life Sci 2002, Oprm gene splicing. J Mol Med 2004, 82:250-255. 72:269-277. 35. Pan YX: Diversity and complexity of the mu opioid receptor gene: 13. Schulz HL, Stohr H, Weber BH: Characterization of three novel isoforms of alternative pre-mRNA splicing and promoters. DNA Cell Biol 2005, the metabotrobic glutamate receptor 7 (GRM7). Neurosci Lett 2002, 24:736-750. 326:37-40. 36. Bolan EA, Pan YX, Pasternak GW: Functional analysis of MOR-1 splice 14. Malherbe P, Kew JN, Richards JG, Knoflach F, Kratzeisen C, Zenner MT, et al: variants of the mouse mu opioid receptor gene Oprm. Synapse 2004, Identification and characterization of a novel splice variant of the 51:11-18. metabotropic glutamate receptor 5 gene in human hippocampus and cerebellum. Brain Res Mol Brain Res 2002, 109:168-178. Xu et al. Molecular Pain 2011, 7:9 Page 14 of 14 http://www.molecularpain.com/content/7/1/9 37. Pan L, Xu J, Yu R, Xu MM, Pan YX, Pasternak GW: Identification and characterization of six new alternatively spliced variants of the human mu opioid receptor gene, Oprm. Neuroscience 2005, 133:209-220. 38. Abbadie C, Pasternak GW: Differential in vivo internalization of MOR-1 and MOR-1C by morphine. Neuroreport 2001, 12:3069-3072. 39. Zhang J, Ferguson SS, Barak LS, Bodduluri SR, Laporte SA, Law PY, et al: Role for G protein-coupled receptor kinase in agonist-specific regulation of mu-opioid receptor responsiveness. Proc Natl Acad Sci USA 1998, 95:7157-7162. 40. Qiu Y, Law PY, Loh HH: Mu-opioid receptor desensitization: role of receptor phosphorylation, internalization, and representation. J Biol Chem 2003, 278:36733-36739. 41. Bohn LM, Gainetdinov RR, Lin FT, Lefkowitz RJ, Caron MG: Mu-opioid receptor desensitization by beta-arrestin-2 determines morphine tolerance but not dependence. Nature 2000, 408:720-723. 42. Pan YX, Xu J, Xu M, Rossi GC, Matulonis JE, Pasternak GW: Involvement of exon 11-associated variants of the mu opioid receptor MOR-1 in heroin, but not morphine, actions. PNAS 2009, 106:4917-4922. 43. Pasternak GW: Pharmacological mechanisms of opioid analgesics. Clin Neuropharmacol 1993, 16:1-18. 44. Pasternak GW, Childers SR, Snyder SH: Opiate analgesia: Evidence for mediation by a subpopulation of opiate receptors. Science 1980, 208:514-516. 45. Pasternak GW, Snyder SH: Identification of a novel high affinity opiate receptor binding in rat brain. Nature 1975, 253:563-565. 46. Rossi GC, Pan YX, Cheng J, Pasternak GW: Blockade of morphine analgesia by an antisense oligodeoxynucleotide against the mu receptor. Life Sci 1994, 54:PL375-379. 47. Abbadie C, Pan YX, Pasternak GW: Differential distribution in rat brain of mu opioid receptor carboxy terminal splice variants MOR-1C and MOR- 1-like immunoreactivity: Evidence for region-specific processing. J Comp Neurol 2000, 419:244-256. 48. Abbadie C, Pan YX, Drake CT, Pasternak GW: Comparative immunhistochemical distributions of carboxy terminus epitopes from the mu opioid receptor splice variants MOR-1D, MOR-1 and MOR-1C in the mouse and rat central nervous systems. Neuroscience 2000, 100:141-153. 49. Abbadie C, Gultekin SH, Pasternak GW: Immunohistochemical localization of the carboxy terminus of the novel mu opioid receptor splice variant MOR-1C within the human spinal cord. Neuroreport 2000, 11:1953-1957. 50. Abbadie C, Pasternak GW, Aicher SA: Presynaptic localization of the carboxy-terminus epitopes of the mu opioid receptor splice variants MOR-1C and MOR-1D in the superficial laminae of the rat spinal cord. Neuroscience 2001, 106:833-842. 51. Zhang Y, Pan YX, Kolesnikov Y, Pasternak GW: Immunohistochemical labeling of the mu opioid receptor carboxy terminal splice variant mMOR-1B4 in the mouse central nervous system. Brain Res 2006, 1099:33-43. 52. Abbadie C, Rossi GC, Orciuolo A, Zadina JE, Pasternak GW: Anatomical and functional correlation of the endomorphins with mu opioid receptor splice variants. Eur J Neurosci 2002, 16:1075-1082. 53. Pan YX, Pasternak GW: Molecular Biology of Mu Opioid Receptors. In Opiate. Edited by: Pasternak GW. Humana Press; 2010, Ch.6. 54. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987, 162:156-159. 55. Pan YX, Cheng J, Xu J, Rossi G, Jacobson E, Ryan-Moro J, et al: Cloning and fuctional characterization of a kappa -related opioid receptor. Mol Pharmacol 1995, 47:1180-1188. Submit your next manuscript to BioMed Central and take full advantage of: doi:10.1186/1744-8069-7-9 Cite this article as: Xu et al.: Identification and characterization of seven • Convenient online submission new exon 11-associated splice variants of the rat mu opioid receptor gene, OPRM1. Molecular Pain 2011 7:9. • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit

Journal

Molecular Pain – Springer Journals

Published: Jan 21, 2011

There are no references for this article.