Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

High alkaline activity of a thermostable α-amylase (cyclomaltodextrinase) from thermoacidophilic Alicyclobacillus isolate

High alkaline activity of a thermostable α-amylase (cyclomaltodextrinase) from thermoacidophilic... It is well demonstrated that glycosyl hydrolases from Alicyclobacillus strains are general thermoacidophilic enzymes and are ideal proteins for industrial applications. In this study, a thermophilic Alicyclobacillus α-amylase of glycoside hydrolases 13_20 subfamily, AMY1, was identified from an Alicyclobacillus strain and efficiently expressed in the host Escherichia coli BL21 CodonPlus. In agreement with other reported Alicyclobacillus hydrolases, the purified AmyY1 had an optimal pH of 6.0–6.5 in phosphate or citrate/Na HPO buffers, and a remarkably decreased activity at pH 8.0. Differently, much higher activity was 2 4 detected in the alkaline glycine/NaOH reaction mixtures. Compared to the highest amylolytic activity at pH 6.0, AmyY1 exhibited 230 and 116% activities at pH 8.0 and 9.0, respectively. This glycine-activation was further confirmed by a supple- mentation of glycine into the assay mixtures. During the digestions of various raw starches, AmyY1 also exhibited high hydrolysis efficiency under acidic or alkaline conditions. Findings in this study not only endow AMY1 with much broad applications, but also may provide a novel field for the application potentials of some other Alicyclobacillus hydrolases. . . . Keywords Alicyclobacillus α-amylase AMY1 Alkaline activity Glycine/NaOH solution Raw starch hydrolysis Introduction (CDs), pullulan, and starch (Stam et al. 2006; Kuchtová and Janeček 2016). Family 13 of the glycoside hydrolases (GH) is a present- Among these hydrolases, α-amylases constitute a class ly huge group within the Carbohydrate-Active Enzymes of important industrial enzymes that are widely used in database (CAZy, www.cazy.org) database (Martinovičová various industries like food, detergent, textiles, and phar- and Janeček 2018). It comprises of more than 40 maceuticals (Sivaramakrishnan et al. 2006;Souza and subfamilies and diverse hydrolyses including α- Magalhães 2010). During conventional starch processing, amylases (EC 3.2.1.1), neopullulanases (EC 3.2.1.135), starch slurry is first gelatinized by heating and then sub- cyclomaltodextrinases (EC 3.2.1.54), etc. With more than jected to two enzymatic steps—liquefaction (by α- one substrate, the subfamily GH13_20 usually possess amylase) and saccharification (by glucamylase) (Mjec the N-terminal starch-binding domain (SBD) classified et al. 2002). Due to different pH requirements of these as the carbohydrate-binding module family CBM34 steps, complex pH adjustments are required. Therefore, (Machovic and Janeček 2006), and thus can hydrolyze amylases with high activity and stability at low pH values at least two of the three substrates cyclomaltodextrins are desirable for such industrial processes. In contrast, other applications such as textiles, detergents, and dishwashing machines require amylases that are active * Chunyu Yang and stable under alkaline pH values (Saxena et al. ycy21th@sdu.edu.cn 2007). Besides the varying pH requirements for amylolyt- * Yan Wang ic activities, thermostable α-amylases are another type of qingyuanwangyan@163.com attractive hydrolases for industry and research. As the 1 whole process for conventional enzymatic saccharification State Key Laboratory of Biobased Material and Green Papermaking, requires high temperature (Prakash and Jaiswal 2010), Qilu University of Technology, Shandong Academy of Sciences, Jinan 250353, People’s Republic of China thermostable amylases provide the advantages of decreas- ing the risk of contamination and cost of external cooling State Key Laboratory of Microbial Technology, Shandong University, Qingdao 266237, People’sRepublicof China as well as increasing the diffusion rate. 882 Ann Microbiol (2018) 68:881–888 Enzymatic degradation of raw starch granules is important adjusted to 4.0 with HCl. After incubated at 60 °C for 14 days, for industrial applications and consequently raw-starch- the culture was transferred into the same medium for next digesting amylases are ideal enzymes for these processes. enrichment. Culture from the third enrichment was diluted Therefore, there are considerable interests in the isolation of and spread onto M-5 agar plates. new strains, especially extremophiles, producing suitable am- ylases for raw-starch digestion (Dumorné 2018). Among Gene cloning and sequence analysis them, Aspergillus sp., Rhizopus sp., Bacillus sp., and Geobacillus sp. are apparently the most suitable producers Genomic DNA was isolated from strain Alicyclobacillus sp. with high hydrolysis efficiency (Sun et al. 2010; Mehta and HJ and used as template for 16S rDNA amplification and Satyanarayana 2014). genomic sequencing. 16S rDNA was amplified by PCR using Apart of these strains, members of genus Alicyclobacillus universal primers 27F and 1492R for bacteria (Lane 1991). are a recently attractive producer for thermophilic amylases. PCR product was purified with the Qiagen ІІ Extraction Kit, Being the gram-positive, thermoacidophilic, heterotrophic ligated into pEASY-blunt vector, and transformed into E. coli organisms that mostly inhabit acidic geothermal environ- DH5α competent cells. ments such as hot springs (Simbahan et al. 2004), these Genomic DNA of Alicyclobacillus sp. HJ was sequenced strains are known to be valuable sources for many thermo- by the Illumina Hiseq2000 platform and annotated by submit- stable and acidic hydrolyses such as xylanase, α-amylase, ting to the Rast server. The genome analysis revealed an and endoglucanase (Bai et al. 2010; Kumar et al. 2010; ORF0788 fragment encoding anα-amylase (AMY1). Boyce and Walsh 2015). To our knowledge, these Multiple alignments were conducted using the ClustalX pro- Alicyclobacillus hydrolases are general reported for their gram (Thompson et al. 1997) by using some homologue genes optimally acidic activities and no data was documented for retrieved from the National Center for Biotechnology high activities under alkaline conditions. Information (NCBI) database. Due to the special habitat of Alicyclobacillus strains, the For intracellular expression, amplification was con- growth of these strains is slowly and requires complex medi- ducted by using primers 0788-F (5′–CTAGCTA um. Therefore, heterologous expression of their hydrolases is GCATGGTTCTTGTGTTGCGC–3′) and 0788-R (5′– essential for large-scale applications. Previously, a CdaA pro- GCGTCGACCTGGTTGTGAAATCCGTC–3′)which in- tein was isolated from the wild-type strain Alicyclobacillus corporate restriction sites NheIand SalI, respectively. acidocaldarius and its biochemical properties had been inves- The PCR product was digested and ligated into the ex- tigated (Matzke et al. 2000). However, the heterologous ex- pression vector pET-24a(+) and the recombinant plasmid pression protocol and its potentials for industrial applications was transformed into E. coli BL21 CodonPlus. remained to be addressed. In the present study, α-amylase AMY1 was cloned from an Alicyclobacillus strain and suc- Protein expression and purification cessfully expressed in a codon bias-adjusted Escherichia coli −1 host of BL21 CodonPlus. Interestingly, AMY1 was much Luria-Bertani (LB) medium with the additions of 50 μgmL −1 active in the alkaline glycine-buffered mixtures and implied kanamycin and 40 μgmL chloromycetin was used for cell good potentials as a thermostable and alkaline α-amylase. cultivation. When cells reached to an optical density of 0.6 Furthermore, abilities of this α-amylase in digesting various (OD ), isopropyl β-D-1-thiogalactopyranoside (IPTG) was raw starches were also investigated under both acidic (pH 6.0) added to a final concentration of 0.5 mM to induce the protein. and alkaline (pH 9.0) conditions. To avoid excessive formation of inclusion bodies, cells were incubated at 16, 22, 30, or 37 °C for various time and the expression levels were visualized by 11.25% (w/v) sodium Materials and methods dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE). In detail, cells were collected by centrifugation at Strain isolation and identification 4000×g for 10 min at 4 °C, washed twice with PBS (60 mM, Na HPO ,KH PO , pH 7.4), and resuspended in 2 4 2 4 Isolation was carried out with water samples collected from HisTrap buffer A (60 mM PBS, 10% glycerol (v/v), and acidic Tengchong hot springs. Enrichment was conducted in 0.1 mM PMSF, a protease inhibitor tablet, and 10 mM 2- M-5 medium which consists of 3.7 mM KH PO , 11.6 mM mercaptoethanol, pH 7.4). The bacterial suspension was then 2 4 Na HPO ·7H O, 13.4 mM KCl, 3.8 mM (NH ) SO ,9.3mM passed twice through a French press at 15,000 psi and 4 °C 2 4 2 4 2 4 −1 NH Cl, 0.2 mM MgCl ·6H O, 0.3 mM CaCl ·H O, 1 g L (Aminco). After centrifugation at 12,000×g for 15 min, the 4 2 2 2 2 −1 skim milk, 3 g L yeast extract, 5 mL minor elements solu- debris was solubilized in a same volume of PBS as that of tion, and 0.5 mL vitamin solution (Engle et al. 1995). Due to the supernatant. Both supernatant and solubilized debris were the hot spring sample was pH 4.0, the pH of the medium was subjected to SDS-PAGE analysis. Ann Microbiol (2018) 68:881–888 883 After 12-h incubation at 16 °C, cells were harvested and starch granules from potato, corn, sweet potato, or wheat was disrupted as above described. The supernatant was collected incubated with 20 U of AMY1 at 65 °C. Samples were and applied to a Ni-NTA HisTrap affinity column (GE taken interval and centrifuged at 10,000×g for 10 min at Healthcare, Uppsala, Sweden) in an AKTA Prime System 4 °C, then the reducing sugars in the supernatant were (GE Healthcare). AMY1 was eluted by a stepwise gradient quantified by DNS method and used glucose as a stan- of imidazolein Tris/HCl buffers (50–500 mM) and the dard. The extent of hydrolysis of raw starch (R )was resulting protein fractions were analyzed by SDS-PAGE. defined by the following formula: R (%) = (A /A )× h 1 0 Another PAGE gel running in the same condition was also 100, where A was the amount of sugar in the supernatant analyzed by western blot using His-tag antibody (Abcam) as after the hydrolysis reaction and A was the amount of we previously described (Yin et al. 2018). Protein sample was raw starch before the reaction (Liu and Xu 2008). also loaded on a native polyacrylamide and SDS-free gel with −1 1gL soluble starch addition. After 90 min separation at 4 °C Nucleotide sequence accession number and 120 V, the gel was incubated in 50 mM glycine/NaOH buffer for 30 min at 65 °C and stained by Lugol’s iodine The nucleotide sequence for the α-amylase gene (AMY1) solution (Atlas 1993). was deposited in the GenBank database under accession number of KX355641. Biochemical properties of AMY1 Data availability All data generated or analyzed during this For routine analysis, the activity of purified AMY1 was deter- study are included in this published article. mined by measuring the amount of reducing sugar released −1 during the enzymatic hydrolysis of 5 g L soluble starch in tested buffers at 65 °C for 15 min. The reducing sugar was Results and discussion measured with a modified dinitrosalicylic acid method (Miller 1959). One unit of α-amylase activity was defined as the Strain isolation and α-amylase identification amount of enzyme that released 1 μmol of glucose per minute at 65 °C (Hagihara et al. 2001). Alicyclobacillus sp. HJ strain was isolated from the Tengchong Effect of pH on the α-amylase activity was determined in hot spring. 16S rDNA sequence analysis revealed 100% similar- various buffers ranging from 3.0 to 10.0 (50 mM of citrate/ ity with gene of A. acidocaldarius DSM451 (Goto et al. 2002). Na HPO buffer, pH 3.0–8.0; 50 mM of NaH PO /Na HPO , After incubated at 60 °C and stained with Lugol’s iodine solu- 2 4 2 4 2 4 pH 5.6–8.0; 50 mM of Tris-HCl, pH 8.0–10.0; 50 mM of tion, big transparent zones were observed around the colonies on barbital sodium/HCl, pH 7.0–8.6; C H N O S (HEPES), a plate containing soluble starch. Draft genome sequence from 8 18 2 4 pH 6.8–8.2; 50 mM of glycine/NaOH, pH 8.0–10.0), by main- Illumina Hiseq2000 identified an open reading frame taining a constant temperature of 65 °C. In addition, 50 mM of (ORF0788) of 578 aa that encoding putative α-amylase. It was Na B O /HCl buffers with pH ranging from 8.0 to 9.0 was closely related with the CdaA protein of A. acidocaldarius 2 4 7 used for the alkaline activity of AMY1. To investigate the (CAB40078) (Matzke et al. 2000) and with a cyclodextrinase effect of glycine concentration on the activity, the amylolytic that isolated from hot spring enrichments in the southern part of activities was determined in glycine/NaOH solutions at pH 8.0 Iceland (Labes et al. 2008). Based on the CAZY database or 9.0 but with a supplementation of various concentration (Cantareletal. 2009), these homologues belong to GH13_20 glycine. The pH stability was measured by analyzing the re- subfamily that comprising of α-amylase (EC 3.2.1.1), sidual activity after pre-incubating of the enzyme at 30 °C in pullulanase (EC 3.2.1.41), cyclomaltodextrin glucanotransferase buffers of citrate/Na HPO (pH 6.0) and glycine/NaOH (EC 2.4.1.19), cyclomaltodextrinase (EC 3.2.1.54), etc. 2 4 (pH 9.0) for 2 h, respectively. For the temperature optima Sequence alignment shown in Fig. 1 indicated that AMY1 pos- measurement, the enzymatic activity was determined after in- sesses all the typical domain signatures of GH13_20 subfamily cubating the enzyme with soluble starch at different tempera- group, including the fingerprint sequences of 286_MPKLN in tures ranging from 55 to 80 °C in citrate/Na HPO buffer the fifth conserved sequence region (CSR-V) and 315_VANE in 2 4 (pH 6.0) or glycine/NaOH buffer (pH 9.0). Thermal stability the CSR-II region (Oslancová and Janeček 2002). Based on the was tested in the standard assay conditions after pre- CAZY classification, it has a typical carbohydrate-binding mod- incubating AMY1 at 65 °C for various time intervals. ule CBM34 region in its N-terminal as those positions in many GH13_20 proteins (Kuchtová and Janeček 2016), as well as the Raw starch hydrolysis crucial residue of Asp65 for starch-binding (Abe et al. 2004). As describe in its homologue protein CdaA (Matzke et al. A 10-mL citrate/Na HPO (pH 6.0) or glycine/NaOH 2000), AMY1 possessed a mixed specificity toward various 2 4 (pH 9.0) buffered mixture containing 50 mg of various raw substrate (Table 1). The maximum hydrolysis efficiency was 884 Ann Microbiol (2018) 68:881–888 Fig. 1 Multiple sequence alignment of AMY1 with other GH13_20 cyclomaltodextrinase Bacillus sp.; O06988, maltogenic amylase hydrolases. APZ86803, AMY1, Alicyclobacillus sp. HJ, this study; Bacillus subtilis; Q08751, neopullulanase Thermoactinomyces vulgaris. P38940, neopullulanase Geobacillus stearothermophilus; Q046J8, The conserved residue of Asp is highlighted in red square and conserved maltogenic α-amylase Lactobacillus gasseri; Q9WX32, sequence characteristics of GH13_20 were also labeled cyclomaltodextrinase Alicyclobacillus acidocaldarius; Q59226, observed in the soluble starch, α-cyclomaltodextrin, and β- Overexpression and purification of AMY1 cyclomaltodextrin. Obviously, it showed a clear preference to cyclomaltodextrins and starch over pullulan, with only 21.2% It is well accepted that the expression of heterologous proteins hydrolysis rate obtained toward pullulan. This substrate spec- in E. coli is strongly affected by codon bias (Rosano and trum implies that AMY1 should be assigned as a Ceccarelli 2009). To our knowledge, available information cyclomaltodextrinase, α-amylase, or neopullulanase which for these hydrolases only focus on their catalytic properties, belongs to GH13_20 subfamily. while no detailed expression protocol described. Based on the Ann Microbiol (2018) 68:881–888 885 Table 1 Substrate spectrum of AmyY1. Reactions were performed in corresponding position as shown in lane 5. Furthermore, −1 glycine/NaOH buffer (pH 9.0) with 5 g L substrate additions, at 65 °C the expressed protein was highly active, with an intense for 15 min and bright band observed in the native gel (lane 4). This Substrate Relative activity (%) indicates effective soluble expressions of AMY1 and huge potentials of this protein in large-scale production. Soluble starch 100.0 ± 1.9 α-Cyclomaltodextrin 99.3 ± 2.2 Optimal temperature and pH of AMY1 β-Cyclomaltodextrin 100.0 ± 2.6 Potato starch 61.3 ± 2.8 As expected for an enzyme isolated from a thermophile, the Wheat starch 68.7 ± 2.3 amylase exhibited the highest activity at 65 °C (Fig. 3a). Corn starch 54.5 ± 1.7 Additionally, it was highly stable under acidic condition at Sweet potato starch 46.1 ± 2.6 high temperature, with more than 90% residual activity detect- Pullulan 21.2 ± 1.4 ed after an incubation at 65 °C for 120 min and above 80% Soluble starch activity was regarded as 100% activity retained after 150-min incubation. Compared with the stability at pH 6.0, AMY1 also stable underalkaline condition, rare codon analysis of these sequences (http://people.mbi. with 86.1% residual activity detected after 120-min incubation ucla.edu/sumchan/caltor.html), a high content of rare codons, at pH 9.0 (Fig. 3b). e.g., 12.8% rare codons in the encoding sequence of AMY1, To explore the catalytic abilities of this thermostable α- and high frequencies of Arg, Gly, and Pro were detected. amylase, different pH buffer systems were used for its pH Therefore, E. coli BL21 CodonPlus was used as a host for profile evaluation. As shown in Fig. 4a, AMY1 displayed AMY1 expression and relative high soluble expression was an unexpected and interesting broad pH range for amylo- obtained. Further inductions at different temperatures lytic activity. In 50 mM sodium-phosphate buffers ranging showed that lower temperature was beneficial to the protein from pH 5.6 to 8.0, AMY1 exhibited the optimal activity solubility, with 57.9 mg soluble protein obtained from 1-L at pH 6.5. Similarity, the highest activity was observed at cell cultures after 16 °C induction for 12 h (Fig. 2a). On the pH 6.0 in the 50 mM citrate/Na HPO buffers (pH 3.0– 2 4 contrast, only less than half target protein was detected under 8.0) while very low activity was observed at pH 8.0. These higher temperatures. results were consistent with the pH profile of CdaA, which After stepwise gradient elution by imidazole, around showed the highest neopullulanase activity at pH 6.0 in 30.1 mg protein (91.2% purity) was eluted from His-strap. sodium/Na HPO buffer (Matzke et al. 2000), as well as 2 4 The purified amylase AMY1 displayed a clear protein band with the pH profile of many acidic Alicyclobacillus hydro- of around 60 kDa in SDS-PAGE (lane 3 in Fig. 2b), which lases (Kumar et al. 2010). Due to the potential applications was close to its estimated molecular of 64 kDa. The ex- of alkaline α-amylase in textile and detergent, the amylo- pression of AMY1 was also confirmed by western blot lytic activity of AMY1 was also investigated in some al- analysis, in which an intense band was observed at the kaline buffer systems. Interestingly, relative higher Fig. 2 SDS-PAGE and western blot analysis for the expression of α- spectra of AMY1. Lane M, molecular mass markers; lane 1, cell extract; amylase AMY1 in E. coli BL21 CodonPlus. a Expression spectra of lane 2, cell debris; lane 3, purified AMY1 visualized by Coomassie AMY1 at different temperatures. Lane M, molecular mass markers; brilliant blue staining; lane 4, AMY1 extract visualized by Lugol’s lane 1, 16 °C; lane 2, 22 °C; lane 3, 30 °C; lane 4, 37 °C; b purification iodine staining; lane 5, AMY1 extract analysis by western blot 886 Ann Microbiol (2018) 68:881–888 Fig. 3 Effect of temperature on AMY1 activity and stability. a Temperature profile of AMY1 at pH 6.0 and pH 9.0; b Activities of AMY1 after being pre-incubated at 65 °C for various times in the citrate/Na HPO buffer (pH 6.0) 2 4 or glycine/NaOH buffer (pH 9.0) solutions. The observed maximal activity was defined as 100% activities were detected in the HEPES or glycine-buffered that glycine can bind to proteins and structurally stabilize mixtures. The maximum activity was detected in the mix- the enzyme. The glycine-assisted enhancement of AMY1 ture that buffered with HEPES of pH 7.0. On the contrast, agrees with a xylanase XylI from a Thermomonospora sp., under a higher alkalinity of pH 9.0, AMY1 exhibited the in which a novel possible mechanism for the glycine- highest activity in the glycine/NaOH buffer. At pH 8.0 and assisted catalytic action of xylanase is proposed 9.0, the enzyme exhibited 230 and 116% of the activity (Vathipadiekal et al. 2007). Based on our preliminary compared to that of the optimal acidic pH (pH 6.0), re- study, the glycine concentration in the reaction mixture spectively. On the contrast, all the other alkaline systems showed an obvious decrease after 15-min incubation with of HEPES, Tris/HCl, and barbital/HCl displayed much the enzyme, while remained stable in the absence of weak alkaline activities (Fig. 4a). Due to the observed high AMY1 (data not shown). Therefore, it was suspected that activity in the alkaline glycine/NaOH buffers, the effect of glycine is also structurally involved in the enzyme cataly- glycine concentrations on the amylase activity of AMY1 sis at alkaline pH, which accelerated the catalytic process was further evaluated. Interestingly, a supplementation of of AMY1 and enhanced the amylase activity. glycine obviously enhanced the activity at both pH 8.0 and Due to the special habitats of Alicyclobacillus strains 9.0, while excessive glycine remarkably inhibited the cat- and the abundant production of hydrolases, isolation of alytic activity of AMY1. As shown in Fig. 4b, the highest thermophilic enzymes from these strains received much activity was detected in the 10 mM glycine/NaOH buff- attention in recent years. Most of Alicyclobacillus hydro- ered systems of pH 8.0 or 9.0 while decreased activities lases were found to be thermophilic, thermostable, and were observed upon increased glycine additions. acidophilic (optimal pH 3.0–6.0), except the xylanase Moreover, AMY1 was very stable after incubating in both from Alicyclobacillus sp. A4. This xylanase showed max- pH buffers of citrate/Na HPO (pH 6.0) and glycine/ imum activity at pH 7.0 and displayed more than 40% 2 4 NaOH (pH 9.0) for 120 min, with around 80% residual activity in a pH range of 3.8–9.4(Baietal. 2010). In this activity detected at both mixtures (Fig. 4c). The influence study, by using different buffer solutions, it was firstly of glycine on thermal stabilization of proteins and en- disclosed that such Alicyclobacillus α-amylase also pos- zymes are well documented (Santoro et al. 1992;Nath sessed high activity under alkaline conditions of glycine- buffered. This finding may broaden the application and Rao 2001; Goller and Galinski 1999). They suspected Fig. 4 Effect of pH on AMY1 activity and stability. a pH profile of activities of AMY1 after being pre-incubated in pH 6.0 or pH 9.0 AMY1 in different buffers; b activities of AMY1 in glycine/NaOH solutions for various times. The observed maximal activity was defined solutions (pH 8.0 and 9.0) with different glycine concentration; c as 100% Ann Microbiol (2018) 68:881–888 887 Fig. 5 Raw starch hydrolysis by the crude extract of AMY1. a In the citrate/Na HPO solution of 2 4 pH 6.0; b in the glycine/NaOH solution of pH 9.0. Hydrolysis was conducted at 65 °C for different time intervals and each substrate was hydrolyzed in triplicate potentials of some Alicyclobacillus hydrolases and confers Conclusion versatility of these hydrolases in various industries, e.g., alkaline α-amylases have great potential in textile, deter- In this study, an Alicyclobacillusα-amylase was cloned and gent, food, and pharmaceutical industries. successfully expressed in E. coli BL21 CodonPlus with high expression level. Besides its acidic pH optima as those of other thermoacidiphilic Alicyclobacillus hydrolases, higher al- Raw starch hydrolysis under acidic or alkaline kaline activity was found in the glycine-activated systems. conditions This finding not only confers AMY1a broad pH range in utilizing starch, but also provides possibility for exploring In the course of conventional enzymatic saccharification, novel application fields of other Alicyclobacillus hydrolases. starch slurry is first gelatinizedbyheatinguptoatemper- ature of 105 °C and then subjected to two enzymatic Funding This work was financial supported from the Key Scientific steps—liquefaction and saccharification. As gelatinization Research Project of Shandong Province (2015GSF121020). increases the viscosity of the slurry, it poses a technical problem during mixing and pumping (Mamo and Compliance with ethical standards Gessesse 1999). The importance of enzymatic saccharifi- cation of raw starch without heating has become well rec- Conflict of interest The authors declare that they have no conflict of interest. ognized in recent years (Sun et al. 2010). To test the ability of AMY1 to digest raw starch, starch from potato, corn, Research involving human participants and/or animals N/A sweet potato, and wheat was hydrolyzed using solutions of pH 6.0 or pH 9.0. Different from the higher alkaline activ- Informed consent N/A ity toward soluble starch, relatively higher raw starch uti- lizing rates were observed at pH 6.0 (Fig. 5a) and slightly lower degrading efficiencies at pH 9.0 after 4-h incubation References (Fig. 5b). It is well known that soluble starch is formed from raw starch especially by relatively mild treatment Abe A, Tonozuka T, Sakano Y, Kamitori S (2004) Complex structures of with acids, by oxidation, or by heating with glycerol. We Thermoactinomyces vulgaris R-47 α-amylase 1 with maltooligosaccharides demonstrate the role of domain N acting as suspected that the acidic environment contributes to the a starch-binding domain. J Mol Biol 335:811–822 raw starch hydrolysis and thus gains a higher hydrolysis Atlas RM (1993) In: Parks LC (ed) In: Handbook of microbiological efficiency at pH 6.0. Among tested raw starches, the media. CRC Press, Boca Raton, FL, p 843 highest hydrolysis efficiency was observed for potato Bai Y, Wang J, Zhang Z, Yang P, Shi P, Luo H, Meng K, Huang H, Yao B (2010) A new xylanase from thermoacidophilic Alicyclobacillus sp. starch, with hydrolysis ratios of 50.4 and 45.9% observed A4 with broad-range pH activity and pH stability. J Ind Microbiol at pH 6.0 and pH 9.0, respectively. Hydrolysis ratio of Biotechnol 37:187–194 wheat starch was also quite high, 42.9 and 39.7% at Boyce A, Walsh G (2015) Characterization of a novel thermostable pH 6.0 and 9.0, respectively. Differently, the utilization endoglucanase from Alicyclobacillus vulcanalis of potential appli- cation in bioethanol production. Appl Microbiol Biotechnol 99: of corn starch was relative slow (30.8 and 24.2%, respec- 7515–7525 tively). The worst of all, the bigger granules and poor sol- CantarelBL,Coutinho PM,RancurelC,Bernard T,LombardV, ubility of sweet potato starch resulted in very low hydro- Henrissat B (2009) The Carbohydrate-Active EnZymes database lysis rates; only around 13.0% of the substrate was hydro- (CAZy): an expert resource for glycogenomics. Nucleic Acids Res 37:233–238 lyzed even after 4-h incubation. 888 Ann Microbiol (2018) 68:881–888 Dumorné K (2018) Biotechnological and industrial applications of Miller GL (1959) Use of dinitrosalicylic acid reagent for determination of enzymes produced by extremophilic bacteria. A mini review. reducing sugar. Anal Chem 31:426–428 Preprints, 2018010198. https://doi.org/10.20944/ Mjec VDM, Van dVB, Uitdehaag JH (2002) Properties and applications preprints201801.0198.v1 of starch-converting enzymes of the alpha-amylase family [review]. Engle M, Li YH, Woese C, Wiegel J (1995) Isolation and characterization J Biotechnol 94:137–155 of a novel alkalitolerant thermophile, Anaerobranca horikoshii gen. Nath D, Rao M (2001) pH dependent conformational and structural nov., sp. Nov. Int J Syst Bacteriol 45:454–461 changes of xylanase from an alkalophilic thermophilic Bacillus sp. Goller K, Galinski EA (1999) Protection of a model enzyme (lactate (NCIM 59). Enzyme Microbiol Technol 28:397–403 dehydrogenase) against heat, urea and freeze-thaw treatment by Oslancová A, Janeček Š (2002) Oligo-1,6-glucosidase and compatible solute additives. J Mol Catal B 7:37–45 neopullulanase enzyme subfamilies from the alpha-amylase family Goto K, Mochida KM, Asahara M, Suzuki M, Yokota A (2002) defined by the fifth conserved sequence region. Cell Mol Life Sci Application of the hypervariable region of the 16S rDNA sequence 59:1945–1959 as an index for the rapid identification of species in the genus Prakash O, Jaiswal N (2010) α-Amylase: an ideal representative of ther- Alicyclobacillus. J Gen Appl Microbiol 48:243–250 mostable enzymes. Appl Biochem Biotechnol 160:2401–2414 Hagihara H, Igarashi K, Hayashi Y, Endo K, Ikawa-Kitayama K, Ozaki Rosano GL, Ceccarelli EA (2009) Rare codon content affects the solu- K, Kawai S, Ito S (2001) Novel α-amylase that is highly resistant to bility of recombinant proteins in a codon bias-adjusted Escherichia chelating reagents and chemical oxidants from the alkaliphilic coli strain. Microb Cell Factories 8:41 Bacillus isolate KSM-K38. Appl Environ Microbiol 67:1744–1750 Santoro MM, Liu Y, Khan SMA, Hou L, Bolen DW (1992) Increased Kuchtová A, Janeček Š (2016) Domain evolution in enzymes of the thermal stability of proteins in the presence of naturally occurring neopullulanase subfamily. Microbiology 162:2099–2115 osmolytes. Biochemistry 31:5278–5283 Kumar GS, Chandra MS, Mallaiah KV, Sreenivasulu P, Choi YL (2010) Saxena RK, Dutt K, Agarwal L, Nayyar P (2007) A highly thermostable Purification and characterization of highly thermostable α-amylase and alkaline amylase from a Bacillus sp. PN5. Bioresour Technol: from thermophilic Alicyclobacillus acidocaldarius. Biotechnol 98260–98265 Bioprocess Eng 15:435–440 Simbahan J, Drijber R, Blum P (2004) Alicyclobacillus vulcanalis sp. Labes A, Karlsson RN, Fridjonsson OH, Turner P, Hreggvidson GO, nov. a thermophilic, acidophilic bacterium isolated from Coso hot Kristjansson GK, Holst O, Schönheit P (2008) Novel members of springs, California, USA. Int J Syst Evol Micro 54:1703–1707 glycoside hydrolase family 13 derived from environmental DNA. Sivaramakrishnan S, Gangadharan D, Nampoothiri KM, Soccol CR, Appl Environ Microbiol 74:1914–1921 Pandey A (2006) α-Amylases from microbial sources—an Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E, overview on recent developments. Food Technol Biotechnol Goodfellow M (eds) Nucleic acid techniques in bacterial systemat- 44:173–184 ics. John Wiley & Sons, Inc., Chichester, UK, pp 115–175 Souza PM, Magalhães PO (2010) Application of microbial α-amylase in Liu XD, Xu YA (2008) Novel raw starch digesting a-amylase from a industry—a review. Braz J Microbiol 41:850–861 newly isolated Bacillus sp. YX-1: purification and characterization. Stam MR, Danchin EGJ, Rancurel C, Coutinho PM, Henrissat B (2006) Bioresour Technol 99:4315–4320 Dividing the large glycoside hydrolase family 13 into subfamilies: Machovic M, Janeček Š (2006) Starch-binding domains in the towards improved functional annotations of α-amylase-related pro- postgenome era. Cell Mol Life Sci 63:2710–2724 teins. Prot Engineer Design Sel 19:555–562 Mamo G, Gessesse A (1999) Purification and characterization of two raw Sun H, Zhao P, Ge X, Xia Y, Hao Z, Liu J, Peng M (2010) Recent starch digesting thermostable alpha amylases from a thermophilic advances in microbial raw starch degrading enzymes. Appl Bacillus sp. Enzyme Microb Technol 25:433–438 Biochem Biotechnol 160:988–1003 Martinovičová M, Janeček Š (2018) In silico analysis of the α-amylase Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG family GH57: eventual subfamilies reflecting enzyme specificities. (1997) The CLUSTAL_X windows interface: flexible strategies Biotech 8:307 for multiple sequence alignment aided by quality analysis tools. Matzke J, Herrmann A, Schneider E, Bakker EP (2000) Gene cloning, Nucleic Acids Res 25:4876–4882 nucleotide sequence and biochemical properties of a cytoplasmic Vathipadiekal V, Verma A, Rao M (2007) Glycine-assisted enhancement cyclomaltodextrinase (neopullulanase) from Alicyclobacillus of 1,4-β-D-xylanxylanohydrolase activity at alkaline pH with a pH acidocaldarius, classification of a group of enzymes. FEMS optimumshift. Biol Chem 388:61–65 Microbiol Lett 183:55–61 Mehta D, Satyanarayana T (2014) Domain C of thermostable alpha- Yin HJ, Zhang LN, Yang Z, Li SN, Nie XY, Wang Y, Yang CY (2018) amylase of Geobacillus thermoleovorans mediates raw starch ad- Contribution of domain B to the catalytic properties of a sorption. Appl Microbiol Biotechnol 98:4503–4519 Flavobacteriaceae α-amylase. Process Biochem 70:104–109 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

High alkaline activity of a thermostable α-amylase (cyclomaltodextrinase) from thermoacidophilic Alicyclobacillus isolate

Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/high-alkaline-activity-of-a-thermostable-amylase-cyclomaltodextrinase-FMj86rx5Vl

References (34)

Publisher
Springer Journals
Copyright
Copyright © 2018 by Springer-Verlag GmbH Germany, part of Springer Nature and the University of Milan
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Mycology; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/s13213-018-1394-3
Publisher site
See Article on Publisher Site

Abstract

It is well demonstrated that glycosyl hydrolases from Alicyclobacillus strains are general thermoacidophilic enzymes and are ideal proteins for industrial applications. In this study, a thermophilic Alicyclobacillus α-amylase of glycoside hydrolases 13_20 subfamily, AMY1, was identified from an Alicyclobacillus strain and efficiently expressed in the host Escherichia coli BL21 CodonPlus. In agreement with other reported Alicyclobacillus hydrolases, the purified AmyY1 had an optimal pH of 6.0–6.5 in phosphate or citrate/Na HPO buffers, and a remarkably decreased activity at pH 8.0. Differently, much higher activity was 2 4 detected in the alkaline glycine/NaOH reaction mixtures. Compared to the highest amylolytic activity at pH 6.0, AmyY1 exhibited 230 and 116% activities at pH 8.0 and 9.0, respectively. This glycine-activation was further confirmed by a supple- mentation of glycine into the assay mixtures. During the digestions of various raw starches, AmyY1 also exhibited high hydrolysis efficiency under acidic or alkaline conditions. Findings in this study not only endow AMY1 with much broad applications, but also may provide a novel field for the application potentials of some other Alicyclobacillus hydrolases. . . . Keywords Alicyclobacillus α-amylase AMY1 Alkaline activity Glycine/NaOH solution Raw starch hydrolysis Introduction (CDs), pullulan, and starch (Stam et al. 2006; Kuchtová and Janeček 2016). Family 13 of the glycoside hydrolases (GH) is a present- Among these hydrolases, α-amylases constitute a class ly huge group within the Carbohydrate-Active Enzymes of important industrial enzymes that are widely used in database (CAZy, www.cazy.org) database (Martinovičová various industries like food, detergent, textiles, and phar- and Janeček 2018). It comprises of more than 40 maceuticals (Sivaramakrishnan et al. 2006;Souza and subfamilies and diverse hydrolyses including α- Magalhães 2010). During conventional starch processing, amylases (EC 3.2.1.1), neopullulanases (EC 3.2.1.135), starch slurry is first gelatinized by heating and then sub- cyclomaltodextrinases (EC 3.2.1.54), etc. With more than jected to two enzymatic steps—liquefaction (by α- one substrate, the subfamily GH13_20 usually possess amylase) and saccharification (by glucamylase) (Mjec the N-terminal starch-binding domain (SBD) classified et al. 2002). Due to different pH requirements of these as the carbohydrate-binding module family CBM34 steps, complex pH adjustments are required. Therefore, (Machovic and Janeček 2006), and thus can hydrolyze amylases with high activity and stability at low pH values at least two of the three substrates cyclomaltodextrins are desirable for such industrial processes. In contrast, other applications such as textiles, detergents, and dishwashing machines require amylases that are active * Chunyu Yang and stable under alkaline pH values (Saxena et al. ycy21th@sdu.edu.cn 2007). Besides the varying pH requirements for amylolyt- * Yan Wang ic activities, thermostable α-amylases are another type of qingyuanwangyan@163.com attractive hydrolases for industry and research. As the 1 whole process for conventional enzymatic saccharification State Key Laboratory of Biobased Material and Green Papermaking, requires high temperature (Prakash and Jaiswal 2010), Qilu University of Technology, Shandong Academy of Sciences, Jinan 250353, People’s Republic of China thermostable amylases provide the advantages of decreas- ing the risk of contamination and cost of external cooling State Key Laboratory of Microbial Technology, Shandong University, Qingdao 266237, People’sRepublicof China as well as increasing the diffusion rate. 882 Ann Microbiol (2018) 68:881–888 Enzymatic degradation of raw starch granules is important adjusted to 4.0 with HCl. After incubated at 60 °C for 14 days, for industrial applications and consequently raw-starch- the culture was transferred into the same medium for next digesting amylases are ideal enzymes for these processes. enrichment. Culture from the third enrichment was diluted Therefore, there are considerable interests in the isolation of and spread onto M-5 agar plates. new strains, especially extremophiles, producing suitable am- ylases for raw-starch digestion (Dumorné 2018). Among Gene cloning and sequence analysis them, Aspergillus sp., Rhizopus sp., Bacillus sp., and Geobacillus sp. are apparently the most suitable producers Genomic DNA was isolated from strain Alicyclobacillus sp. with high hydrolysis efficiency (Sun et al. 2010; Mehta and HJ and used as template for 16S rDNA amplification and Satyanarayana 2014). genomic sequencing. 16S rDNA was amplified by PCR using Apart of these strains, members of genus Alicyclobacillus universal primers 27F and 1492R for bacteria (Lane 1991). are a recently attractive producer for thermophilic amylases. PCR product was purified with the Qiagen ІІ Extraction Kit, Being the gram-positive, thermoacidophilic, heterotrophic ligated into pEASY-blunt vector, and transformed into E. coli organisms that mostly inhabit acidic geothermal environ- DH5α competent cells. ments such as hot springs (Simbahan et al. 2004), these Genomic DNA of Alicyclobacillus sp. HJ was sequenced strains are known to be valuable sources for many thermo- by the Illumina Hiseq2000 platform and annotated by submit- stable and acidic hydrolyses such as xylanase, α-amylase, ting to the Rast server. The genome analysis revealed an and endoglucanase (Bai et al. 2010; Kumar et al. 2010; ORF0788 fragment encoding anα-amylase (AMY1). Boyce and Walsh 2015). To our knowledge, these Multiple alignments were conducted using the ClustalX pro- Alicyclobacillus hydrolases are general reported for their gram (Thompson et al. 1997) by using some homologue genes optimally acidic activities and no data was documented for retrieved from the National Center for Biotechnology high activities under alkaline conditions. Information (NCBI) database. Due to the special habitat of Alicyclobacillus strains, the For intracellular expression, amplification was con- growth of these strains is slowly and requires complex medi- ducted by using primers 0788-F (5′–CTAGCTA um. Therefore, heterologous expression of their hydrolases is GCATGGTTCTTGTGTTGCGC–3′) and 0788-R (5′– essential for large-scale applications. Previously, a CdaA pro- GCGTCGACCTGGTTGTGAAATCCGTC–3′)which in- tein was isolated from the wild-type strain Alicyclobacillus corporate restriction sites NheIand SalI, respectively. acidocaldarius and its biochemical properties had been inves- The PCR product was digested and ligated into the ex- tigated (Matzke et al. 2000). However, the heterologous ex- pression vector pET-24a(+) and the recombinant plasmid pression protocol and its potentials for industrial applications was transformed into E. coli BL21 CodonPlus. remained to be addressed. In the present study, α-amylase AMY1 was cloned from an Alicyclobacillus strain and suc- Protein expression and purification cessfully expressed in a codon bias-adjusted Escherichia coli −1 host of BL21 CodonPlus. Interestingly, AMY1 was much Luria-Bertani (LB) medium with the additions of 50 μgmL −1 active in the alkaline glycine-buffered mixtures and implied kanamycin and 40 μgmL chloromycetin was used for cell good potentials as a thermostable and alkaline α-amylase. cultivation. When cells reached to an optical density of 0.6 Furthermore, abilities of this α-amylase in digesting various (OD ), isopropyl β-D-1-thiogalactopyranoside (IPTG) was raw starches were also investigated under both acidic (pH 6.0) added to a final concentration of 0.5 mM to induce the protein. and alkaline (pH 9.0) conditions. To avoid excessive formation of inclusion bodies, cells were incubated at 16, 22, 30, or 37 °C for various time and the expression levels were visualized by 11.25% (w/v) sodium Materials and methods dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE). In detail, cells were collected by centrifugation at Strain isolation and identification 4000×g for 10 min at 4 °C, washed twice with PBS (60 mM, Na HPO ,KH PO , pH 7.4), and resuspended in 2 4 2 4 Isolation was carried out with water samples collected from HisTrap buffer A (60 mM PBS, 10% glycerol (v/v), and acidic Tengchong hot springs. Enrichment was conducted in 0.1 mM PMSF, a protease inhibitor tablet, and 10 mM 2- M-5 medium which consists of 3.7 mM KH PO , 11.6 mM mercaptoethanol, pH 7.4). The bacterial suspension was then 2 4 Na HPO ·7H O, 13.4 mM KCl, 3.8 mM (NH ) SO ,9.3mM passed twice through a French press at 15,000 psi and 4 °C 2 4 2 4 2 4 −1 NH Cl, 0.2 mM MgCl ·6H O, 0.3 mM CaCl ·H O, 1 g L (Aminco). After centrifugation at 12,000×g for 15 min, the 4 2 2 2 2 −1 skim milk, 3 g L yeast extract, 5 mL minor elements solu- debris was solubilized in a same volume of PBS as that of tion, and 0.5 mL vitamin solution (Engle et al. 1995). Due to the supernatant. Both supernatant and solubilized debris were the hot spring sample was pH 4.0, the pH of the medium was subjected to SDS-PAGE analysis. Ann Microbiol (2018) 68:881–888 883 After 12-h incubation at 16 °C, cells were harvested and starch granules from potato, corn, sweet potato, or wheat was disrupted as above described. The supernatant was collected incubated with 20 U of AMY1 at 65 °C. Samples were and applied to a Ni-NTA HisTrap affinity column (GE taken interval and centrifuged at 10,000×g for 10 min at Healthcare, Uppsala, Sweden) in an AKTA Prime System 4 °C, then the reducing sugars in the supernatant were (GE Healthcare). AMY1 was eluted by a stepwise gradient quantified by DNS method and used glucose as a stan- of imidazolein Tris/HCl buffers (50–500 mM) and the dard. The extent of hydrolysis of raw starch (R )was resulting protein fractions were analyzed by SDS-PAGE. defined by the following formula: R (%) = (A /A )× h 1 0 Another PAGE gel running in the same condition was also 100, where A was the amount of sugar in the supernatant analyzed by western blot using His-tag antibody (Abcam) as after the hydrolysis reaction and A was the amount of we previously described (Yin et al. 2018). Protein sample was raw starch before the reaction (Liu and Xu 2008). also loaded on a native polyacrylamide and SDS-free gel with −1 1gL soluble starch addition. After 90 min separation at 4 °C Nucleotide sequence accession number and 120 V, the gel was incubated in 50 mM glycine/NaOH buffer for 30 min at 65 °C and stained by Lugol’s iodine The nucleotide sequence for the α-amylase gene (AMY1) solution (Atlas 1993). was deposited in the GenBank database under accession number of KX355641. Biochemical properties of AMY1 Data availability All data generated or analyzed during this For routine analysis, the activity of purified AMY1 was deter- study are included in this published article. mined by measuring the amount of reducing sugar released −1 during the enzymatic hydrolysis of 5 g L soluble starch in tested buffers at 65 °C for 15 min. The reducing sugar was Results and discussion measured with a modified dinitrosalicylic acid method (Miller 1959). One unit of α-amylase activity was defined as the Strain isolation and α-amylase identification amount of enzyme that released 1 μmol of glucose per minute at 65 °C (Hagihara et al. 2001). Alicyclobacillus sp. HJ strain was isolated from the Tengchong Effect of pH on the α-amylase activity was determined in hot spring. 16S rDNA sequence analysis revealed 100% similar- various buffers ranging from 3.0 to 10.0 (50 mM of citrate/ ity with gene of A. acidocaldarius DSM451 (Goto et al. 2002). Na HPO buffer, pH 3.0–8.0; 50 mM of NaH PO /Na HPO , After incubated at 60 °C and stained with Lugol’s iodine solu- 2 4 2 4 2 4 pH 5.6–8.0; 50 mM of Tris-HCl, pH 8.0–10.0; 50 mM of tion, big transparent zones were observed around the colonies on barbital sodium/HCl, pH 7.0–8.6; C H N O S (HEPES), a plate containing soluble starch. Draft genome sequence from 8 18 2 4 pH 6.8–8.2; 50 mM of glycine/NaOH, pH 8.0–10.0), by main- Illumina Hiseq2000 identified an open reading frame taining a constant temperature of 65 °C. In addition, 50 mM of (ORF0788) of 578 aa that encoding putative α-amylase. It was Na B O /HCl buffers with pH ranging from 8.0 to 9.0 was closely related with the CdaA protein of A. acidocaldarius 2 4 7 used for the alkaline activity of AMY1. To investigate the (CAB40078) (Matzke et al. 2000) and with a cyclodextrinase effect of glycine concentration on the activity, the amylolytic that isolated from hot spring enrichments in the southern part of activities was determined in glycine/NaOH solutions at pH 8.0 Iceland (Labes et al. 2008). Based on the CAZY database or 9.0 but with a supplementation of various concentration (Cantareletal. 2009), these homologues belong to GH13_20 glycine. The pH stability was measured by analyzing the re- subfamily that comprising of α-amylase (EC 3.2.1.1), sidual activity after pre-incubating of the enzyme at 30 °C in pullulanase (EC 3.2.1.41), cyclomaltodextrin glucanotransferase buffers of citrate/Na HPO (pH 6.0) and glycine/NaOH (EC 2.4.1.19), cyclomaltodextrinase (EC 3.2.1.54), etc. 2 4 (pH 9.0) for 2 h, respectively. For the temperature optima Sequence alignment shown in Fig. 1 indicated that AMY1 pos- measurement, the enzymatic activity was determined after in- sesses all the typical domain signatures of GH13_20 subfamily cubating the enzyme with soluble starch at different tempera- group, including the fingerprint sequences of 286_MPKLN in tures ranging from 55 to 80 °C in citrate/Na HPO buffer the fifth conserved sequence region (CSR-V) and 315_VANE in 2 4 (pH 6.0) or glycine/NaOH buffer (pH 9.0). Thermal stability the CSR-II region (Oslancová and Janeček 2002). Based on the was tested in the standard assay conditions after pre- CAZY classification, it has a typical carbohydrate-binding mod- incubating AMY1 at 65 °C for various time intervals. ule CBM34 region in its N-terminal as those positions in many GH13_20 proteins (Kuchtová and Janeček 2016), as well as the Raw starch hydrolysis crucial residue of Asp65 for starch-binding (Abe et al. 2004). As describe in its homologue protein CdaA (Matzke et al. A 10-mL citrate/Na HPO (pH 6.0) or glycine/NaOH 2000), AMY1 possessed a mixed specificity toward various 2 4 (pH 9.0) buffered mixture containing 50 mg of various raw substrate (Table 1). The maximum hydrolysis efficiency was 884 Ann Microbiol (2018) 68:881–888 Fig. 1 Multiple sequence alignment of AMY1 with other GH13_20 cyclomaltodextrinase Bacillus sp.; O06988, maltogenic amylase hydrolases. APZ86803, AMY1, Alicyclobacillus sp. HJ, this study; Bacillus subtilis; Q08751, neopullulanase Thermoactinomyces vulgaris. P38940, neopullulanase Geobacillus stearothermophilus; Q046J8, The conserved residue of Asp is highlighted in red square and conserved maltogenic α-amylase Lactobacillus gasseri; Q9WX32, sequence characteristics of GH13_20 were also labeled cyclomaltodextrinase Alicyclobacillus acidocaldarius; Q59226, observed in the soluble starch, α-cyclomaltodextrin, and β- Overexpression and purification of AMY1 cyclomaltodextrin. Obviously, it showed a clear preference to cyclomaltodextrins and starch over pullulan, with only 21.2% It is well accepted that the expression of heterologous proteins hydrolysis rate obtained toward pullulan. This substrate spec- in E. coli is strongly affected by codon bias (Rosano and trum implies that AMY1 should be assigned as a Ceccarelli 2009). To our knowledge, available information cyclomaltodextrinase, α-amylase, or neopullulanase which for these hydrolases only focus on their catalytic properties, belongs to GH13_20 subfamily. while no detailed expression protocol described. Based on the Ann Microbiol (2018) 68:881–888 885 Table 1 Substrate spectrum of AmyY1. Reactions were performed in corresponding position as shown in lane 5. Furthermore, −1 glycine/NaOH buffer (pH 9.0) with 5 g L substrate additions, at 65 °C the expressed protein was highly active, with an intense for 15 min and bright band observed in the native gel (lane 4). This Substrate Relative activity (%) indicates effective soluble expressions of AMY1 and huge potentials of this protein in large-scale production. Soluble starch 100.0 ± 1.9 α-Cyclomaltodextrin 99.3 ± 2.2 Optimal temperature and pH of AMY1 β-Cyclomaltodextrin 100.0 ± 2.6 Potato starch 61.3 ± 2.8 As expected for an enzyme isolated from a thermophile, the Wheat starch 68.7 ± 2.3 amylase exhibited the highest activity at 65 °C (Fig. 3a). Corn starch 54.5 ± 1.7 Additionally, it was highly stable under acidic condition at Sweet potato starch 46.1 ± 2.6 high temperature, with more than 90% residual activity detect- Pullulan 21.2 ± 1.4 ed after an incubation at 65 °C for 120 min and above 80% Soluble starch activity was regarded as 100% activity retained after 150-min incubation. Compared with the stability at pH 6.0, AMY1 also stable underalkaline condition, rare codon analysis of these sequences (http://people.mbi. with 86.1% residual activity detected after 120-min incubation ucla.edu/sumchan/caltor.html), a high content of rare codons, at pH 9.0 (Fig. 3b). e.g., 12.8% rare codons in the encoding sequence of AMY1, To explore the catalytic abilities of this thermostable α- and high frequencies of Arg, Gly, and Pro were detected. amylase, different pH buffer systems were used for its pH Therefore, E. coli BL21 CodonPlus was used as a host for profile evaluation. As shown in Fig. 4a, AMY1 displayed AMY1 expression and relative high soluble expression was an unexpected and interesting broad pH range for amylo- obtained. Further inductions at different temperatures lytic activity. In 50 mM sodium-phosphate buffers ranging showed that lower temperature was beneficial to the protein from pH 5.6 to 8.0, AMY1 exhibited the optimal activity solubility, with 57.9 mg soluble protein obtained from 1-L at pH 6.5. Similarity, the highest activity was observed at cell cultures after 16 °C induction for 12 h (Fig. 2a). On the pH 6.0 in the 50 mM citrate/Na HPO buffers (pH 3.0– 2 4 contrast, only less than half target protein was detected under 8.0) while very low activity was observed at pH 8.0. These higher temperatures. results were consistent with the pH profile of CdaA, which After stepwise gradient elution by imidazole, around showed the highest neopullulanase activity at pH 6.0 in 30.1 mg protein (91.2% purity) was eluted from His-strap. sodium/Na HPO buffer (Matzke et al. 2000), as well as 2 4 The purified amylase AMY1 displayed a clear protein band with the pH profile of many acidic Alicyclobacillus hydro- of around 60 kDa in SDS-PAGE (lane 3 in Fig. 2b), which lases (Kumar et al. 2010). Due to the potential applications was close to its estimated molecular of 64 kDa. The ex- of alkaline α-amylase in textile and detergent, the amylo- pression of AMY1 was also confirmed by western blot lytic activity of AMY1 was also investigated in some al- analysis, in which an intense band was observed at the kaline buffer systems. Interestingly, relative higher Fig. 2 SDS-PAGE and western blot analysis for the expression of α- spectra of AMY1. Lane M, molecular mass markers; lane 1, cell extract; amylase AMY1 in E. coli BL21 CodonPlus. a Expression spectra of lane 2, cell debris; lane 3, purified AMY1 visualized by Coomassie AMY1 at different temperatures. Lane M, molecular mass markers; brilliant blue staining; lane 4, AMY1 extract visualized by Lugol’s lane 1, 16 °C; lane 2, 22 °C; lane 3, 30 °C; lane 4, 37 °C; b purification iodine staining; lane 5, AMY1 extract analysis by western blot 886 Ann Microbiol (2018) 68:881–888 Fig. 3 Effect of temperature on AMY1 activity and stability. a Temperature profile of AMY1 at pH 6.0 and pH 9.0; b Activities of AMY1 after being pre-incubated at 65 °C for various times in the citrate/Na HPO buffer (pH 6.0) 2 4 or glycine/NaOH buffer (pH 9.0) solutions. The observed maximal activity was defined as 100% activities were detected in the HEPES or glycine-buffered that glycine can bind to proteins and structurally stabilize mixtures. The maximum activity was detected in the mix- the enzyme. The glycine-assisted enhancement of AMY1 ture that buffered with HEPES of pH 7.0. On the contrast, agrees with a xylanase XylI from a Thermomonospora sp., under a higher alkalinity of pH 9.0, AMY1 exhibited the in which a novel possible mechanism for the glycine- highest activity in the glycine/NaOH buffer. At pH 8.0 and assisted catalytic action of xylanase is proposed 9.0, the enzyme exhibited 230 and 116% of the activity (Vathipadiekal et al. 2007). Based on our preliminary compared to that of the optimal acidic pH (pH 6.0), re- study, the glycine concentration in the reaction mixture spectively. On the contrast, all the other alkaline systems showed an obvious decrease after 15-min incubation with of HEPES, Tris/HCl, and barbital/HCl displayed much the enzyme, while remained stable in the absence of weak alkaline activities (Fig. 4a). Due to the observed high AMY1 (data not shown). Therefore, it was suspected that activity in the alkaline glycine/NaOH buffers, the effect of glycine is also structurally involved in the enzyme cataly- glycine concentrations on the amylase activity of AMY1 sis at alkaline pH, which accelerated the catalytic process was further evaluated. Interestingly, a supplementation of of AMY1 and enhanced the amylase activity. glycine obviously enhanced the activity at both pH 8.0 and Due to the special habitats of Alicyclobacillus strains 9.0, while excessive glycine remarkably inhibited the cat- and the abundant production of hydrolases, isolation of alytic activity of AMY1. As shown in Fig. 4b, the highest thermophilic enzymes from these strains received much activity was detected in the 10 mM glycine/NaOH buff- attention in recent years. Most of Alicyclobacillus hydro- ered systems of pH 8.0 or 9.0 while decreased activities lases were found to be thermophilic, thermostable, and were observed upon increased glycine additions. acidophilic (optimal pH 3.0–6.0), except the xylanase Moreover, AMY1 was very stable after incubating in both from Alicyclobacillus sp. A4. This xylanase showed max- pH buffers of citrate/Na HPO (pH 6.0) and glycine/ imum activity at pH 7.0 and displayed more than 40% 2 4 NaOH (pH 9.0) for 120 min, with around 80% residual activity in a pH range of 3.8–9.4(Baietal. 2010). In this activity detected at both mixtures (Fig. 4c). The influence study, by using different buffer solutions, it was firstly of glycine on thermal stabilization of proteins and en- disclosed that such Alicyclobacillus α-amylase also pos- zymes are well documented (Santoro et al. 1992;Nath sessed high activity under alkaline conditions of glycine- buffered. This finding may broaden the application and Rao 2001; Goller and Galinski 1999). They suspected Fig. 4 Effect of pH on AMY1 activity and stability. a pH profile of activities of AMY1 after being pre-incubated in pH 6.0 or pH 9.0 AMY1 in different buffers; b activities of AMY1 in glycine/NaOH solutions for various times. The observed maximal activity was defined solutions (pH 8.0 and 9.0) with different glycine concentration; c as 100% Ann Microbiol (2018) 68:881–888 887 Fig. 5 Raw starch hydrolysis by the crude extract of AMY1. a In the citrate/Na HPO solution of 2 4 pH 6.0; b in the glycine/NaOH solution of pH 9.0. Hydrolysis was conducted at 65 °C for different time intervals and each substrate was hydrolyzed in triplicate potentials of some Alicyclobacillus hydrolases and confers Conclusion versatility of these hydrolases in various industries, e.g., alkaline α-amylases have great potential in textile, deter- In this study, an Alicyclobacillusα-amylase was cloned and gent, food, and pharmaceutical industries. successfully expressed in E. coli BL21 CodonPlus with high expression level. Besides its acidic pH optima as those of other thermoacidiphilic Alicyclobacillus hydrolases, higher al- Raw starch hydrolysis under acidic or alkaline kaline activity was found in the glycine-activated systems. conditions This finding not only confers AMY1a broad pH range in utilizing starch, but also provides possibility for exploring In the course of conventional enzymatic saccharification, novel application fields of other Alicyclobacillus hydrolases. starch slurry is first gelatinizedbyheatinguptoatemper- ature of 105 °C and then subjected to two enzymatic Funding This work was financial supported from the Key Scientific steps—liquefaction and saccharification. As gelatinization Research Project of Shandong Province (2015GSF121020). increases the viscosity of the slurry, it poses a technical problem during mixing and pumping (Mamo and Compliance with ethical standards Gessesse 1999). The importance of enzymatic saccharifi- cation of raw starch without heating has become well rec- Conflict of interest The authors declare that they have no conflict of interest. ognized in recent years (Sun et al. 2010). To test the ability of AMY1 to digest raw starch, starch from potato, corn, Research involving human participants and/or animals N/A sweet potato, and wheat was hydrolyzed using solutions of pH 6.0 or pH 9.0. Different from the higher alkaline activ- Informed consent N/A ity toward soluble starch, relatively higher raw starch uti- lizing rates were observed at pH 6.0 (Fig. 5a) and slightly lower degrading efficiencies at pH 9.0 after 4-h incubation References (Fig. 5b). It is well known that soluble starch is formed from raw starch especially by relatively mild treatment Abe A, Tonozuka T, Sakano Y, Kamitori S (2004) Complex structures of with acids, by oxidation, or by heating with glycerol. We Thermoactinomyces vulgaris R-47 α-amylase 1 with maltooligosaccharides demonstrate the role of domain N acting as suspected that the acidic environment contributes to the a starch-binding domain. J Mol Biol 335:811–822 raw starch hydrolysis and thus gains a higher hydrolysis Atlas RM (1993) In: Parks LC (ed) In: Handbook of microbiological efficiency at pH 6.0. Among tested raw starches, the media. CRC Press, Boca Raton, FL, p 843 highest hydrolysis efficiency was observed for potato Bai Y, Wang J, Zhang Z, Yang P, Shi P, Luo H, Meng K, Huang H, Yao B (2010) A new xylanase from thermoacidophilic Alicyclobacillus sp. starch, with hydrolysis ratios of 50.4 and 45.9% observed A4 with broad-range pH activity and pH stability. J Ind Microbiol at pH 6.0 and pH 9.0, respectively. Hydrolysis ratio of Biotechnol 37:187–194 wheat starch was also quite high, 42.9 and 39.7% at Boyce A, Walsh G (2015) Characterization of a novel thermostable pH 6.0 and 9.0, respectively. Differently, the utilization endoglucanase from Alicyclobacillus vulcanalis of potential appli- cation in bioethanol production. Appl Microbiol Biotechnol 99: of corn starch was relative slow (30.8 and 24.2%, respec- 7515–7525 tively). The worst of all, the bigger granules and poor sol- CantarelBL,Coutinho PM,RancurelC,Bernard T,LombardV, ubility of sweet potato starch resulted in very low hydro- Henrissat B (2009) The Carbohydrate-Active EnZymes database lysis rates; only around 13.0% of the substrate was hydro- (CAZy): an expert resource for glycogenomics. Nucleic Acids Res 37:233–238 lyzed even after 4-h incubation. 888 Ann Microbiol (2018) 68:881–888 Dumorné K (2018) Biotechnological and industrial applications of Miller GL (1959) Use of dinitrosalicylic acid reagent for determination of enzymes produced by extremophilic bacteria. A mini review. reducing sugar. Anal Chem 31:426–428 Preprints, 2018010198. https://doi.org/10.20944/ Mjec VDM, Van dVB, Uitdehaag JH (2002) Properties and applications preprints201801.0198.v1 of starch-converting enzymes of the alpha-amylase family [review]. Engle M, Li YH, Woese C, Wiegel J (1995) Isolation and characterization J Biotechnol 94:137–155 of a novel alkalitolerant thermophile, Anaerobranca horikoshii gen. Nath D, Rao M (2001) pH dependent conformational and structural nov., sp. Nov. Int J Syst Bacteriol 45:454–461 changes of xylanase from an alkalophilic thermophilic Bacillus sp. Goller K, Galinski EA (1999) Protection of a model enzyme (lactate (NCIM 59). Enzyme Microbiol Technol 28:397–403 dehydrogenase) against heat, urea and freeze-thaw treatment by Oslancová A, Janeček Š (2002) Oligo-1,6-glucosidase and compatible solute additives. J Mol Catal B 7:37–45 neopullulanase enzyme subfamilies from the alpha-amylase family Goto K, Mochida KM, Asahara M, Suzuki M, Yokota A (2002) defined by the fifth conserved sequence region. Cell Mol Life Sci Application of the hypervariable region of the 16S rDNA sequence 59:1945–1959 as an index for the rapid identification of species in the genus Prakash O, Jaiswal N (2010) α-Amylase: an ideal representative of ther- Alicyclobacillus. J Gen Appl Microbiol 48:243–250 mostable enzymes. Appl Biochem Biotechnol 160:2401–2414 Hagihara H, Igarashi K, Hayashi Y, Endo K, Ikawa-Kitayama K, Ozaki Rosano GL, Ceccarelli EA (2009) Rare codon content affects the solu- K, Kawai S, Ito S (2001) Novel α-amylase that is highly resistant to bility of recombinant proteins in a codon bias-adjusted Escherichia chelating reagents and chemical oxidants from the alkaliphilic coli strain. Microb Cell Factories 8:41 Bacillus isolate KSM-K38. Appl Environ Microbiol 67:1744–1750 Santoro MM, Liu Y, Khan SMA, Hou L, Bolen DW (1992) Increased Kuchtová A, Janeček Š (2016) Domain evolution in enzymes of the thermal stability of proteins in the presence of naturally occurring neopullulanase subfamily. Microbiology 162:2099–2115 osmolytes. Biochemistry 31:5278–5283 Kumar GS, Chandra MS, Mallaiah KV, Sreenivasulu P, Choi YL (2010) Saxena RK, Dutt K, Agarwal L, Nayyar P (2007) A highly thermostable Purification and characterization of highly thermostable α-amylase and alkaline amylase from a Bacillus sp. PN5. Bioresour Technol: from thermophilic Alicyclobacillus acidocaldarius. Biotechnol 98260–98265 Bioprocess Eng 15:435–440 Simbahan J, Drijber R, Blum P (2004) Alicyclobacillus vulcanalis sp. Labes A, Karlsson RN, Fridjonsson OH, Turner P, Hreggvidson GO, nov. a thermophilic, acidophilic bacterium isolated from Coso hot Kristjansson GK, Holst O, Schönheit P (2008) Novel members of springs, California, USA. Int J Syst Evol Micro 54:1703–1707 glycoside hydrolase family 13 derived from environmental DNA. Sivaramakrishnan S, Gangadharan D, Nampoothiri KM, Soccol CR, Appl Environ Microbiol 74:1914–1921 Pandey A (2006) α-Amylases from microbial sources—an Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E, overview on recent developments. Food Technol Biotechnol Goodfellow M (eds) Nucleic acid techniques in bacterial systemat- 44:173–184 ics. John Wiley & Sons, Inc., Chichester, UK, pp 115–175 Souza PM, Magalhães PO (2010) Application of microbial α-amylase in Liu XD, Xu YA (2008) Novel raw starch digesting a-amylase from a industry—a review. Braz J Microbiol 41:850–861 newly isolated Bacillus sp. YX-1: purification and characterization. Stam MR, Danchin EGJ, Rancurel C, Coutinho PM, Henrissat B (2006) Bioresour Technol 99:4315–4320 Dividing the large glycoside hydrolase family 13 into subfamilies: Machovic M, Janeček Š (2006) Starch-binding domains in the towards improved functional annotations of α-amylase-related pro- postgenome era. Cell Mol Life Sci 63:2710–2724 teins. Prot Engineer Design Sel 19:555–562 Mamo G, Gessesse A (1999) Purification and characterization of two raw Sun H, Zhao P, Ge X, Xia Y, Hao Z, Liu J, Peng M (2010) Recent starch digesting thermostable alpha amylases from a thermophilic advances in microbial raw starch degrading enzymes. Appl Bacillus sp. Enzyme Microb Technol 25:433–438 Biochem Biotechnol 160:988–1003 Martinovičová M, Janeček Š (2018) In silico analysis of the α-amylase Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG family GH57: eventual subfamilies reflecting enzyme specificities. (1997) The CLUSTAL_X windows interface: flexible strategies Biotech 8:307 for multiple sequence alignment aided by quality analysis tools. Matzke J, Herrmann A, Schneider E, Bakker EP (2000) Gene cloning, Nucleic Acids Res 25:4876–4882 nucleotide sequence and biochemical properties of a cytoplasmic Vathipadiekal V, Verma A, Rao M (2007) Glycine-assisted enhancement cyclomaltodextrinase (neopullulanase) from Alicyclobacillus of 1,4-β-D-xylanxylanohydrolase activity at alkaline pH with a pH acidocaldarius, classification of a group of enzymes. FEMS optimumshift. Biol Chem 388:61–65 Microbiol Lett 183:55–61 Mehta D, Satyanarayana T (2014) Domain C of thermostable alpha- Yin HJ, Zhang LN, Yang Z, Li SN, Nie XY, Wang Y, Yang CY (2018) amylase of Geobacillus thermoleovorans mediates raw starch ad- Contribution of domain B to the catalytic properties of a sorption. Appl Microbiol Biotechnol 98:4503–4519 Flavobacteriaceae α-amylase. Process Biochem 70:104–109

Journal

Annals of Microbiology – Springer Journals

Published: Nov 1, 2018

There are no references for this article.