Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Exploration of genetic diversity of Bacillus spp. from industrial shrimp ponds in Vietnam by multi-locus sequence typing

Exploration of genetic diversity of Bacillus spp. from industrial shrimp ponds in Vietnam by... Bacillus is a diverse genus consisting of more than 200 species with extensive genetic diversity. Their beneficial effects in industrial shrimp farming have been well documented. However, little is known about the biodiversity of the Bacillus spp. in this aquaculture system. Taxonomic analysis by 16S rRNA sequencing does not always allow species-level identification of Bacillus spp. In this study, 26 Bacillus isolates from two industrial Litopenaeus vannamei shrimp ponds in Bac Lieu Province, Vietnam, were analyzed for their genetic diversity by multi-locus sequence typing (MLST). A total of 22 sequence types were identified and segregated into four distinct clusters, corresponding to B. subtilis, B. velezensis, B. siamensis, and B. licheniformis. Bacillus subtilis and B. velezensis accounted for more than 73% of the Bacillus isolates. Notably, the MLST scheme exhibited high discriminatory power and might be further simplified to be a convenient method to identify species of the genus Bacillus. Keywords: Bacillus group, Probiotics, Biodiversity, Industrial shrimp farming, MLST, Multi-locus sequence typing Background shrimp farming have been shown in numerous studies. According to the Food and Agriculture Organization of For instance, probiotics improve water quality, produce the United Nations (FAO), aquaculture is the fastest- inhibitory compounds against pathogens, or enhance the growing sector of food production in the world today host’s growth and immune system (Gatesoupe 1999; (FAO 2018). In Vietnam, the shrimp farming area is ap- Gomes et al. 2009; Irianto and Austin 2002; Verschuere proximately 600,000 ha, producing 300000 tons of black et al. 2000). tiger and whiteleg shrimps per year (VASEP 2018). Al- Bacteria belonging to Bacillus genus are often included though the procedure for industrial shrimp farming has in probiotics used in aquaculture as they are believed to been established, sustainable development of this model confer multiple benefits to both the environment and could be severely compromised by an increased risk of in- the cultured animals (van Hai and Fotedar 2010; Zokaei- fectious diseases such as white spot syndrome virus, early far et al. 2012). These bacteria are non-pathogenic, mortality syndrome (EMS), and white feces syndrome. spore-forming, and capable of secreting compounds with As a result, probiotics have been increasingly antimicrobial properties (Zokaeifar et al. 2012). They employed in the form of feed supplements for shrimp have been used to promote growth and control diseases farming. In Vietnam, probiotics were used in 91% of the in shrimp aquaculture (Dalmin et al. 2001; Wang et al. surveyed shrimp farms (Rico et al. 2013). By definition, 2005; Zokaeifar et al. 2014). However, there is a lack of probiotics are live microorganisms that, when adminis- knowledge on the genetic diversity of Bacillus bacteria tered in adequate amounts, confer a health benefit to in industrial shrimp aquaculture, which is the overall the host (Mack 2005). Indeed, their beneficial effects in trend of shrimp farming in Vietnam. Conventionally, culture methods or molecular tech- niques such as polymerase chain reaction-denaturing * Correspondence: hoa.lequang@hust.edu.vn School of Biotechnology and Food Technology, Hanoi University of Science gradient gel electrophoresis (PCR-DGGE) (Piterina and and Technology, Hanoi, Vietnam Pembroke 2013) or 16S rRNA sequencing (Qin et al. Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 2 of 9 2016) have been used to explore the bacterial contents Total DNA of bacterial isolates was extracted follow- of aquaculture systems. However, these are time-con- ing Burrell et al. (1998) with some modifications. Briefly, suming and often fail to reflect the diversity of closely 2 mL of overnight LB culture was centrifuged at 10, related bacterial groups, particularly species of the Ba- 000×g for 5 min and the supernatant was discarded. Cell cillus genus. Recently, multi-locus sequence typing pellet was then resuspended in 600 μL of Tris-EDTA (MLST), which characterizes bacterial strains using (50 mM Tris pH 8.0, 5 mM EDTA). Subsequently, 50 μL internal fragments of multiple housekeeping genes, of freshly prepared lysozyme (10 mg/mL) was added to has gained broad acceptance among epidemiologists the mixture and incubated at 37 °C for 2 h. A volume of (over 50 MLST schemes have been published and 35 μL of sodium dodecyl sulfate (10% (w/v)) and 15 μL made available on the Internet at https://pubmlst.org/ of proteinase K (10 mg/mL) was then added to the mix- databases/) (Larsen et al. 2012). MLST is a standard- ture, followed by another incubation step at 37 °C for 1 ized approach, highly unambiguous, and reproducible. h. After extracting with an equal volume (700 μL) of Furthermore, MLST has been successfully used to chloroform/isoamyl alcohol (24:1, v/v), the nucleic acids study the phylogenetic diversity of the Bacillus cereus from 500 μL of supernatant were precipitated by adding group (Sorokin et al. 2006). 50 μL of sodium acetate (3 M pH 5.2) and 1.4 mL of In this study, we aimed to explore the genetic diversity 100% ethanol and incubating for 1 h at room of the Bacillus group in two industrial shrimp ponds temperature. Following a centrifugation at 12,000×g for (with and without EMS) that are frequently supple- 30 min, DNA pellet was washed by 1 mL of 70% ethanol, mented with probiotic products. An MLST scheme using air dried, and resuspended in 200 μL of TE (10 mM Tris seven housekeeping genes (glpF, ilvD, ptA, purH, pycA, pH 8.0, 1 mM EDTA) containing 10 μg/mL of RNase A. rpoD, and tpiA) was applied to identify Bacillus isolates After incubating at 37 °C for 1 h to remove RNA, DNA from these shrimp ponds. was further purified and concentrated into a 50-μL vol- ume using Amicon Ultra 0.5 mL 100K centrifugal filters Methods (Millipore) following the protocols provided with the fil- Bacterial isolates ters. DNA concentration and quality were assessed based Bacillus bacteria were isolated from sediment, water, and on absorbance at 260, 280, and 230 nm using Nano- shrimp intestine samples of two industrial whiteleg Drop2000 (Thermo Fisher). shrimp (Litopenaeus vannamei) ponds in Bac Lieu Prov- ince, Vietnam, following the procedure described by Cao et al. (2011) with some modifications. Briefly, 1 g of sam- 16S rRNA sequencing ple was homogenized in 100 mL of nutrient broth (NB) 16S rRNA gene of bacterial isolates was amplified by by Stomacher® 400 Circulator (Seward) and incubated at PCR using universal primers 8F (5′-AGAGTTTGATCC 80 °C for 10 min to inactivate vegetative bacteria and TGGCTCAG-3′) and 1510R (5′-GGCTACCTTGTTAC fungi in order to isolate Bacillus spores that withstood GA-3′) (Ding and Yokota 2002). PCR reactions were this heat pretreatment. The supernatant was then sub- performed with an initial denaturation at 94 °C for 3 jected to tenfold serial dilution before being spread onto min, followed by 30 cycles of denaturation at 94 °C for nutrient agar (NA). After incubation at 37 °C for 24 h, 30 s, annealing at 52 °C for 30 s, and extension at 72 °C individual colonies were streaked onto NA to obtain for 1.5 min. Final extension step was performed at 72 °C pure isolates. Upon isolation, bacterial isolates were sub- for 10 min. Reaction mixtures of 50 μL contained 25 μL jected to catalase test and gram staining and positive iso- of GoTaq® G2 Hot Start Colorless Master Mix 2X (Pro- lates were stored in 50% glycerol at − 80 °C. A total of 26 mega, USA), 0.4 pmol/μL of each primer, and 10 ng of isolates was obtained, among which 11 (sediment, n= 2; DNA template. Negative and positive (B. subtilis strain water, n= 4; intestine n= 5) were isolated from the pond WB800N) controls were included in each PCR amplifi- that was free of EMS, while 15 (sediment, n= 8; water, cation. PCR products were purified using QIAquick PCR n= 4; intestine n= 3) were isolated from the pond that purification kit per the manufacturer’s specifications had been affected by EMS during the last three consecu- (QIAGEN, Germany) and sent to Macrogen (Seoul, tive years. Details on the origin and morphology of the Korea) for sequencing by Sanger method. Low-quality isolates are presented in Table 1. ends of DNA sequences were trimmed by DNA Chro- matogram Explorer Lite (HeracleSoftware). DNA se- DNA extraction quences were then BLAST searched against GenBank DNA extraction and subsequent experiments were per- databases (http://www.ncbi.nlm.nih.gov) and analyzed formed at Laboratory of Genetic Engineering, School of using Bioedit (Hall 1999). MEGA X (https://www.mega- Biotechnology and Food Technology, Hanoi University software.net/) was used to construct the 16S phylogen- of Science and Technology, Hanoi, Vietnam. etic tree using the neighbor-joining method with Kimura Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 3 of 9 Table 1 Origin and morphology of 26 bacterial isolates used in this study Sample ID Origin Shape Edge Elevation Color + opacity BRB 2.1 EMS, intestine Circular Entire Flat White, opaque BRB 2.2 EMS, intestine Circular Undulate Umbonate White, opaque BRB 6.3 EMS, intestine Irregular Lobate Flat White, translucent BDB 1.1 EMS, sediment Circular Entire Raised White, opaque BDB 1.2 EMS, sediment Irregular Undulate Raised White, opaque BDB 11.1 EMS, sediment Circular Entire Umbonate White, opaque BDB 3.1 EMS, sediment Irregular Undulate Flat White, opaque BDB 3.2 EMS, sediment Circular Undulate Flat Buff BDB 3.4 EMS, sediment Irregular Undulate Flat White, opaque BDB 3.5 EMS, sediment Irregular Entire Raised, wrinkled White, opaque BDB 6.1 EMS, sediment Circular Entire Flat White, translucent BNB 1.1 EMS, water Circular Undulate Umbonate White, opaque BNB 1.2 EMS, water Circular Undulate Umbonate White, opaque BNB 5.2 EMS, water Circular Entire Umbonate White, opaque BNB 9.3 EMS, water Circular Entire Flat, wrinkled White, opaque BRK 1.1 Non-EMS, intestine Irregular Lobate Flat White, opaque BRK 4.4 Non-EMS, intestine Irregular Lobate Flat White, opaque BRK 5.4 Non-EMS, intestine Circular Undulate Flat, wrinkled White, opaque BRK 6.1 Non-EMS, intestine Circular Undulate Flat White, opaque BRK 7.3 Non-EMS, intestine Circular Entire Flat White, opaque BDK 2.3 Non-EMS, sediment Circular Entire Flat, wrinkled White, opaque BDK 9.2 Non-EMS, sediment Circular Undulate Raised, wrinkled White, opaque BNK 2.2 Non-EMS, water Circular Undulate Flat, wrinkled White, opaque BNK 2.3 Non-EMS, water Circular Entire Flat, wrinkled White, opaque BNK 7.1 Non-EMS, water Circular Undulate Flat, wrinkled White, opaque BNK 8.1 Non-EMS, water Circular Entire Raised, wrinkled White, opaque 2-parameter substitution model (Kikuchi 2009; Kimura controls were included in each PCR amplification. Fol- 1980) and 1000 bootstrapping tests. lowing amplification, PCR products were purified using QIAquick PCR purification kit or QIAquick® Gel Extrac- MLST analysis tion Kit (Qiagen, Germany) per the manufacturer’s spec- Intragenic regions of seven housekeeping genes (glpF, ifications and sent to Macrogen (Seoul, Korea) for ilvD, ptA, purH, pycA, rpoD, and tpiA) were selected for sequencing. MLST analysis (www.pubmlst.org/bsubtilis). Primers for Obtained DNA sequences were trimmed at both ends PCR amplification of the seven genes were designed to obtain regions corresponding to B. subtilis sequences using Primer3 software (Untergasser et al. 2012), and available on PubMLST database (www.pubmlst.org/ their sequences are shown in Table 2. PCR amplifica- bsubtilis), and aligned using CLUSTALW (MEGA X). tions were performed using Promega GoTaq® G2 Hot The number of polymorphic sites of each gene fragment Start Colorless Master Mix 2X as mentioned above. Re- was manually counted using the alignment outputs. Dif- actions of 50 μL contained 25 μL of GoTaq® G2 Hot Start ferent alleles were determined on the basis of one-nu- Colorless Master Mix 2X, 0.4 pmol/μL of each primer, cleotide difference and were assigned arbitrary numbers. and 10 ng of DNA template. One single cycling program For each bacterial isolate, a combination of seven alleles was used for amplification of the seven genes: initial de- defined its allelic profile and sequence type (ST). Cover- naturation at 95 °C for 3 min, 40 cycles of denaturation age of the complete coding sequences was identified (95 °C, 30 s), annealing (54 °C, 30 s), extension (72 °C, 50 using BLAST search against GenBank databases. MEGA s), and one final elongation step at 72 °C for 5 min. X software was used to construct phylogenetic trees Negative and positive (B. subtilis strain WB800N) using the neighbor-joining method with Kimura 2- Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 4 of 9 Table 2 Primer sequences for MLST analysis Primer Sequence (5′–3′) Annealing temperature Expected size rpoD-F GCCGAAGAAGAATTTGACCTTAA 54 °C 854 bp rpoD-R CGTTTRCTTCTGCTHGGATGTCT glpF-F WTGACAGCATTTTGGGG 54 °C 690 bp glpF-R GTAAAATACRCCGCCGA ilvD-F ATGAGATATTCGCTGCC 54 °C 622 bp ilvD-R CTTCGTTAATGCGTTCTAAAGAG ptA-F ATACATATGAAGGSATGGAAGA 54 °C 610 bp ptA-R TAGCCGATGTTTCCTGCT tpiA-F TCAGCTTCGTTGAAGAAGTGAAA 54 °C 620 bp tpiA-R GGACTCTGCCATATATTCTTTA PycA-F AAATCAGARGCGAAAGC 54 °C 545 bp PycA-R CCTGAGCGGTAAGCCAT purH-F TTTGAGAAAAAACAATCGCT 54 °C 568 bp purH-R TCGGCTCCCTTTTCGTCGG parameter substitution model (Akita et al. 2017; Kimura isolates except for BRB 6.3 and BDB 6.1 (Additional file 1: 1980) and 1000 bootstrapping tests. Sequence type ana- Table S1). lysis and recombinational tests (START) software (ver- The neighbor-joining phylogenetic tree, based on 16S sion 1.0.5) (http://www.mlst.net) was used to calculate G rRNA sequences of the isolates and type of strains re- + C content and d /d value. Discrimination indices trieved from the GenBank database, contains four clades: N S (DI) were computed as previously described (Hunter B. licheniformis, B. subtilis/B. tequilensis, B. amylolique- and Gaston 1988). faciens/B. siamensis, and B. velezensis (Fig. 1). From this phylogenetic tree, it is evident that the isolates BRB 6.3 and BDB 6.1 are closely related to B. licheniformis, while Results the isolates BNB 1.2, BNB 5.2, BNB 1.1, BRK 5.4, BDB Sequencing of 16S rRNA identified 26 Bacillus isolates 11.1, BNK 2.2, and BRB 2.2 are closely related to B. vele- Pioneer work on prokaryotic taxonomy has recom- zensis. Nevertheless, identification of the other isolates mended that identification to the species level is defined was inconclusive. Indeed, the low bootstrap values on as a 16S rDNA sequence similarity of ≥ 99% with that of the remaining part of the tree indicated that 16S rRNA the type strain sequence in GenBank database (Cai et al. sequencing is not suitable for phylogenetic analysis of all 2003; Stackebrandt and Ebers 2006; Benga et al. 2014). isolates at the species level (Hampl et al. 2001). This In the present study, the 16S rRNA gene fragment was may be due to the high similarity of 16S sequences from amplified and sequenced using the universal primer 8F Bacillus isolates in the present study. and 1510R (Ding and Yokota 2002). Approximately All of these results clearly showed that 16S rRNA gene 1400 bp (range 1380–1421 bp) of the 16S rRNA gene se- alone was not able to identify all Bacillus isolates at the quence was successfully obtained for each isolate (Add- species level. Therefore, they were subjected to genotyp- itional file 1: Table S1) with Phred scores higher than 20 ing by an MLST scheme that utilizes internal fragments (Ewing and Green 1998). These sequences were blasted of seven housekeeping genes. against the 16S rRNA sequence database at NCBI. The results (Additional file 1: Table S1) indicated that all iso- MLST analysis lates belong to the genus Bacillus with the highest simi- From the sequencing results, allelic and sequence pro- larity scores ranging from 99.8 to 100%. However, it was files of the seven housekeeping genes (glpF, ilvD, ptA, not able to identify these isolates at the species level. For purH, pycA, rpoD, and tpiA) were presented in Table 3. example, isolate BRB 2.2, BDB 1.1, BDB 11.1, BDB 3.5, The lengths of analyzed fragments ranged from 384 to BNB 1.1, BNB 1.2, BNB 5.2, BRK 5.4, BDK 2.3, BNK 2.2, 470 bp, covering from 11.6 (pycA) to 55.1% (tpiA) of the BNK 2.3, BNK 7.1, and BNK 8.1 could be any species of complete gene sequences. Multiple sequence alignment B. amyloliquefaciens, B. velezensis, B. subtilis,or B. sia- did not show any insertions or deletions; however, SNPs mensis. The difference between the highest and second were frequently observed. We found 146 (38.0%), 164 highest similarity scores was less than 0.1% for all (34.9%), 105 (25.4%), 137 (34.3%), 168 (42.1%), 108 Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 5 of 9 Fig. 1 Neighbor-joining phylogenetic tree based on 16S rRNA sequences of 26 Bacillus isolates from EMS-free and EMS-affected shrimp ponds and representative Bacillus reference strains. Names of different clades were placed on the right-hand side. GenBank accession numbers are indicated in parentheses. Isolates from the EMS-affected pond are indicated by asterisks Table 3 Allelic profiles of the seven housekeeping genes used in MLST analysis Gene Size of fragment analyzed Coverage of complete CDS (%) Number of Number of Percentage of Avg G + C DI dN/dS alleles polymorphic sites polymorphic sites content (%) ratio glpF 384 46.6 18 146 38.0 50.0 0.972 0.061 ilvD 470 28.0 16 164 34.9 54.5 0.957 0.040 pta 414 42.6 15 105 25.4 51.4 0.942 0.020 purH 399 25.9 17 137 34.3 50.4 0.96 0.080 pycA 399 11.6 19 168 42.1 49.6 0.966 0.048 rpoD 384 34.4 11 108 28.1 49.2 0.908 0.001 tpiA 420 55.1 13 89 21.2 49.3 0.932 0.041 DI discrimination index Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 6 of 9 (28.1%), and 89 (21.2%) polymorphic sites for glpF, ilvD, industrial whiteleg shrimp ponds in Bac Lieu Province, pta, purH, pycA, rpoD,and tpiA, respectively. Moreover, Vietnam, by 16S rRNA sequencing and multiple-locus for each locus, we found 11 to 19 alleles, which were sequence typing. Notably, one pond was affected with counted on the basis of one-base difference. Average (G + EMS while the other was free of EMS. Both ponds were C) content of each gene was about 49–54%. This range is frequently supplemented with probiotic products. similar to the (G + C) contents of the corresponding gene Initially, 26 Bacillus spp. were detected by 16S rRNA sequences from the B. subtilis strain 168, which is the first sequencing. Although being useful for phylogenetic reference genomic data for the Bacillus genus. Average studies at the genus level, the discriminatory power at dN/dS values were much less than 1 (maximum at 0.080), species level of the 16S method remained questionable indicating that the seven gene fragments are under nega- as at least four species of the Bacillus group were identi- tive selection pressure and mutations were mainly syn- fied per isolate while performing BLAST searches of the onymous (Kryazhimskiy and Plotkin 2008). Synonymous sequenced 16S fragments. This may be due to the high substitutions were at least 12.5 times (1/0.080) more fre- similarity of 16S sequences between closely related spe- quent than amino acid changes at any locus. This could cies (Stackebrandt and Goebel 1994). It has also been be explained by the crucial functions of these housekeep- shown that 16S rRNA sequences of some Bacillus spe- ing genes in Bacillus bacteria. cies are almost identical (Janda and Abbott 2007). On The discrimination indices (DI) were also computed to the other hand, the MLST scheme used in the present compare the discriminatory power of the individual study allowed determination of the exact species of all genes. The lowest DI value of the seven loci was 0.908, the 26 isolates. Overall, all the seven genes exhibited a indicating a high discriminatory power and the efficiency satisfactory discriminatory power (DI ≥ 0.908). Interest- in differentiating the isolates in our study. glpF was ingly, the locus with the most polymorphic sites did not scored the highest at 0.972 (18 alleles, 38.0% poly- exhibit the highest DI (Table 2). Therefore, we suggest morphic sites). Interestingly, the most polymorphic frag- that using the locus with the highest discriminatory ment (pycA, 42.1% polymorphic sites) did not exhibit power (glpF, purH, and pycA) could be enough to differ- the highest DI (0.966). These results may allow us to fur- entiate bacterial isolates of B. subtilis, B. velezensis, B. ther simplify the MLST scheme by using the most dis- siamensis,and B. licheniformis. Nevertheless, a larger criminatory loci. population is required to evaluate this hypothesis After concatenation of the seven fragments, a total of extensively. 22 sequence types was distinguished among the 26 iso- The neighbor-joining phylogenetic tree based on the lates. A neighbor-joining phylogenetic tree based on concatenated MLST fragments showed four distinct concatenated sequences (Fig. 2) was constructed using clades corresponding to the four Bacillus species and be- MEGA X software. Based on the BLAST search of the ing supported by reliable bootstrap values (higher than concatemer sequences, representative reference se- 80). The isolates were majorly B. subtilis and B. velezen- quences were selected from GenBank databases as sis (73%). The dominance of B. subtilis could be due to ingroups and outgroups. Clustering of all sequences re- that they are commonly used in probiotics or biocontrol vealed four major, non-overlapping clades, supported by agents (Buruiană et al. 2014; Farzanfar 2006). For B. the bootstrap value of 100. They corresponded to the velezensis, several studies have pointed out that they can four species of the Bacillus genus: B. velezensis, B. sia- act as biocontrol agents (Palazzini et al. 2016) and ex- mensis, B. subtilis, and B. licheniformis, respectively. We hibit antimicrobial activity against fish pathogenic bac- observed an uneven distribution of the isolates between teria (Yi et al. 2018), including Vibrio parahaemolyticus, these groups. Bacillus velezensis and B. subtilis clades (8 which is the leading cause of EMS in cultured shrimps. and 11 isolates, respectively) accounted for more than Therefore, they could have been used regularly and be- 73% of the total samples. Regarding the Bacillus con- came widespread in industrial shrimp ponds in Vietnam. tents in EMS-free and EMS-affected ponds, no signifi- However, this is not the case for the B. licheniformis spe- cant difference was observed with one exception for the cies. Despite being popular in probiotic products (Elsha- B. licheniformis group. Indeed, two B. licheniformis iso- ghabee et al. 2017), only two isolates of this species were lates were exclusively present in the EMS-affected pond. found in EMS-affected pond. Nevertheless, we cannot The remaining isolates from EMS-free and EMS-affected exclude the possibility that bacterial isolates identified in ponds were quite evenly distributed between the three this study could also originate from natural sediments in clades of B. subtilis, B. velezensis, and B. siamensis. the ponds. In fact, Bacillus spp. are ubiquitous and found abundantly in soil (Garbeva et al. 2003). Discussion All Bacillus species detected in this study have been In the present study, we described the diversity and previously shown to have beneficial effects in aquaculture population structure of Bacillus isolates from two systems. For instance, B. subtilis and B. licheniformis are Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 7 of 9 Fig. 2 Neighbor-joining phylogenetic tree based on concatenated MLST DNA sequences of 26 Bacillus isolates from EMS-free and EMS-affected shrimp ponds and representative Bacillus reference strains. Names of different clades were placed on the right-hand side. GenBank accession numbers are indicated in parentheses. Isolates from the EMS-affected pond are indicated by asterisks commonly used in commercialized probiotic products The antagonist effects of Bacillus bacteria against V. and their benefits have been thoroughly investigated (van parahaemolyticus, presumably the direct cause of EMS Hai and Fotedar 2010; Zokaeifar et al. 2012). Several stud- in shrimps, have been reported (Liu et al. 2015; Tran et ies have also pointed out the effects of B. velezensis and B. al. 2013; Xu et al. 2013). However, there was no signifi- siamensis as probiotics or biocontrol agents in industrial cant difference in Bacillus content between the EMS- aquaculture farming (Buruiană et al. 2014; Meidong et al. free and EMS-affected shrimp ponds except that two B. 2017; Palazzini et al. 2016). They play a pivotal role in nu- licheniformis isolates were exclusively found in the EMS- trient cycling, nutrition of the cultured animals, water affected pond. This preliminary result needs further re- quality, and disease control (Moriarty 1997). search with a larger sample size to be confirmed. Of Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 8 of 9 note, the ability of secreting antibacterial compounds is Author details 1 2 Truc Anh Co., Ltd, Bac Lieu, Vietnam. School of Biotechnology and Food characteristic of a few Bacillus strains only (Azevedo et Technology, Hanoi University of Science and Technology, Hanoi, Vietnam. al. 1993; Liu et al. 2015). Therefore, antimicrobial activ- 3 4 Vietnam Fisheries Society, Hanoi, Vietnam. College of Aquaculture & ity to V. parahaemolyticus needs to be tested for each Fisheries, Can Tho University, Can Tho, Vietnam. Bacillus isolates in order to determine whether there Received: 10 April 2019 Accepted: 29 July 2019 was a difference in antimicrobial profile between isolates from EMS-free and EMS-affected shrimp ponds. References Conclusions Akita H, Kimura Z-I, Yusoff MZM, Nakashima N, Hoshino T. Identification and In conclusion, we have shown that MLST is a more effi- characterization of Burkholderia multivorans CCA53. BMC Res Notes. 2017; 10(1):249. https://doi.org/10.1186/s13104-017-2565-1. cient phylogenetic tool than the 16S rRNA sequencing Azevedo E.C., Rios E.M., Fukushima K, & Campos-Takaki G.M. Bacitracin production for identifying Bacillus species isolated from shrimp by a new strain of Bacillus subtilis. Appl Biochem Biotechnol. 1993;42(1):1. aquaculture. Using this approach, we have identified four https://doi.org/10.1007/BF02788897. Benga L, Benten WP, Engelhardt E, Kohrer K, Gougoula C, Sager M. 16S ribosomal major Bacillus species including B. subtilis, B. velezensis, DNA sequence-based identification of bacteria in laboratory rodents: a B. siamensis, and B. licheniformis from EMS-free and practical approach in laboratory animal bacteriology diagnostics. Lab Anim. EMS-affected industrial shrimp ponds, among which B. 2014;48(4):305–12. https://doi.org/10.1177/0023677214538240. Burrell PC, Keller J, Blackall LL. Microbiology of a nitrite-oxidizing bioreactor. Appl subtilis and B. velezensis accounted for more than 73% Environ Microbiol. 1998;64(5):1878–83. of the isolates. Further research will be dedicated to Buruiană C-T, Georgiana P, Vizireanu C. Effects of probiotic Bacillus species in evaluate the antagonistic activity of the isolates against aquaculture – an overview (Vol. 38); 2014. Cai H, Archambault M, Prescott JF. 16S ribosomal RNA sequence-based V. parahaemolyticus strains causing EMS. identification of veterinary clinical bacteria. J Vet Diagn Invest. 2003;15(5): 465–9. Cao H, He S, Wei R, Diong M, and Lu L, Bacillus Amyloliquefaciens G: A Potential Additional file Antagonistic Bacterium against Eel-Pathogenic Aeromonas hydrophila. Evid Based Complement Alternat Med. 2011;2011:7. Article ID 824104, https://doi. Additional file 1: Table S1. Identification of 26 Bacillus isolates by 16S org/10.1155/2011/824104. rRNA sequencing. Size of the 16S rRNA fragment; names of the reference Dalmin G, Kathiresan K, Purushothaman A. Effect of probiotics on bacterial strains and similarity obtained by BLASTN against the 16S rRNA sequence population and health status of shrimp in culture pond ecosystem. Indian J database at NCBI for each isolate. (DOCX 35 kb) Exp Biol. 2001;39(9):939–42. Ding L, Yokota A. Phylogenetic analysis of the genus Aquaspirillum based on 16S rRNA gene sequences. FEMS Microbiol Lett. 2002;212(2):165–9 https://doi. Abbreviations org/10.1111/j.1574-6968.2002.tb11261.x. DGGE: Denaturing gradient gel electrophoresis; DI: Discrimination index; Elshaghabee FMF, Rokana N, Gulhane RD, Sharma C, Panwar H. Bacillus as EMS: Early mortality syndrome; FAO: Food and Agriculture Organization of potential probiotics: status, concerns, and future perspectives. Frontiers in the United Nations; MLST: Multi-locus sequence typing; PCR: Polymerase microbiology. 2017;8:1490. https://doi.org/10.3389/fmicb.2017.01490. chain reaction; ST: Sequence type; START: Sequence type analysis and Ewing B, Green P. Base-calling of automated sequencer traces using phred. II. recombinational tests Error probabilities. Genome Res. 1998;8:186–94. FAO. The State of World Fisheries and Aquaculture 2018 - meeting the Acknowledgements sustainable development goals. Rome. Licence: CC BY-NC-SA 3.0 IGO. 2018 We thank the staffs from Truc Anh Co., Ltd for their contributions to this Farzanfar A. The use of probiotics in shrimp aquaculture. FEMS Immunol Med study. Microbiol. 2006;48(2):149–58. https://doi.org/10.1111/j.1574-695X.2006.00116.x. Garbeva P, van Veen JA, van Elsas JD. Predominant Bacillus spp. in agricultural Authors’ contributions soil under different management regimes detected via PCR-DGGE. Microb XTL, UNV, and HQL conceived and designed the study. XTL, DTP, TAP, and Ecol. 2003;45(3):302–16. https://doi.org/10.1007/s00248-002-2034-8. THK collected the data. XTL, TTT, and HQL performed the analysis. XTL, TTT, Gatesoupe FJ. The use of probiotics in aquaculture. Aquaculture. 1999;180(1):147– UNV, and HQL drafted the manuscript. All authors read and approved the 65. https://doi.org/10.1016/S0044-8486(99)00187-8. final manuscript. Gomes LC, et al. Benefits of using the probiotic Efinol®L during transportation of cardinal tetra, Paracheirodon axelrodi (Schultz), in the Amazon. 2009;40(2): 157–65. https://doi.org/10.1111/j.1365-2109.2008.02077.x. Funding Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis This research was partially funded by the Ministry of Science and Technology program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–8. of Vietnam (grant no. 06/2014/HD-NDT) Hampl V, Pavlícek A, Flegr J. Construction and bootstrap analysis of DNA fingerprinting-based phylogenetic trees with the freeware program FreeTree: Availability of data and materials application to trichomonad parasites. Int J Syst Evol Microbiol. 2001;51(Pt 3): All datasets generated during and/or analyzed during the current study are 731. https://doi.org/10.1099/00207713-51-3-731. available from the corresponding author on reasonable request. Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988; Ethics approval and consent to participate 26(11):2465–6. Not applicable. Irianto A, Austin B. Probiotics in aquaculture. 2002;25(11):633–42. https://doi.org/1 0.1046/j.1365-2761.2002.00422.x. Consent for publication Janda JM, Abbott SL. 16S rRNA gene sequencing for bacterial identification in Not applicable. the diagnostic laboratory: pluses, perils, and pitfalls. J Clin Microbiol. 2007; 45(9):2761–4. https://doi.org/10.1128/JCM.01228-07. Competing interests Kikuchi Y. Endosymbiotic bacteria in insects: their diversity and culturability. The authors declare that they have no competing interests. Microbes Environ. 2009;24:195–204. https://doi.org/10.1264/jsme2.ME09140S. Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 9 of 9 Kimura M. A simple method for estimating evolutionary rates of base water quality, growth performance, immune response, and resistance against substitutions through comparative studies of nucleotide sequences. J Mol Vibrio harveyi infection in juvenile white shrimp, Litopenaeus vannamei. Fish Evol. 1980;16(2):111–20. Shellfish Immunol. 2014;36(1):68-74. Kryazhimskiy S, & Plotkin J. B. The population genetics of dN/dS. PLoS Genet. 2008;4(12):e1000304. https://doi.org/10.1371/journal.pgen.1000304. Publisher’sNote Larsen MV, et al. Multilocus sequence typing of total-genome-sequenced Springer Nature remains neutral with regard to jurisdictional claims in bacteria. J Clin Microbiol. 2012;50(4):1355–61. https://doi.org/10.1128/jcm.06 published maps and institutional affiliations. 094-11. Liu XF, et al. Isolation and characterisation of Bacillus spp. antagonistic to Vibrio parahaemolyticus for use as probiotics in aquaculture. World J Microbiol Biotechnol. 2015;31(5):795–803. https://doi.org/10.1007/s11274-015-1833-2. Mack DR. Probiotics-mixed messages. Can Fam Physician. 2005;51(11):1455–64. Meidong R, et al. A novel probiotic Bacillus siamensis B44v isolated from Thai pickled vegetables (Phak-dong) for potential use as a feed supplement in aquaculture. J Gen Appl Microbiol. 2017;63:246–53. Moriarty DJW. The role of microorganisms in aquaculture ponds. Aquaculture. 1997;151(1):333–49. https://doi.org/10.1016/S0044-8486(96)01487-1. Palazzini JM, Dunlap CA, Bowman MJ, Chulze SN. Bacillus velezensis RC 218 as a biocontrol agent to reduce Fusarium head blight and deoxynivalenol accumulation: genome sequencing and secondary metabolite cluster profiles. Microbiol Res. 2016;192:30–6. https://doi.org/10.1016/j.micres.2016.06. Piterina AV, Pembroke JT. Use of PCR-DGGE based molecular methods to analyse microbial community diversity and stability during the thermophilic stages of an ATAD wastewater sludge treatment process as an aid to performance monitoring. ISRN Biotechnol. 2013;2013:162645. https://doi.org/10.5402/2 013/162645. Qin Y, et al. Bacterial abundance and diversity in pond water supplied with different feeds. Scientific Rep. 2016;6:35232. https://doi.org/10.1038/ srep35232. Rico A, et al. Use of veterinary medicines, feed additives and probiotics in four major internationally traded aquaculture species farmed in Asia. Aquaculture. 2013;412-413:231–43. https://doi.org/10.1016/j.aquaculture.2013.07.028. Sorokin A, et al. Multiple-locus sequence typing analysis of Bacillus cereus and Bacillus thuringiensis reveals separate clustering and a distinct population structure of psychrotrophic strains. Appl Environ Microbiol. 2006;72(2):1569– 78. https://doi.org/10.1128/AEM.72.2.1569-1578.2006. Stackebrandt E, Ebers J. Taxonomic parameters revisited: tarnished gold standards (Vol. 8); 2006. Stackebrandt E, Goebel BM. Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. 1994;44(4):846–9. https://doi.org/10.1099/00207713-44-4-846. Tran L, et al. Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp. Dis Aquat Organ. 2013;105(1):45–55. https://doi.org/10.3354/dao02621. Untergasser A, et al. Primer3--new capabilities and interfaces. Nucleic Acid Res. 2012;40(15):e115. https://doi.org/10.1093/nar/gks596. van Hai N, Fotedar R. A review of probiotics in shrimp aquaculture. J Appl Aquaculture. 2010;22(3):251–66. https://doi.org/10.1080/10454438.2010.5005 VASEP. Report on Vietnam shrimp sector 2008-2017. Portal of Vietnam Association of Seafood Exporters and Producers. 2018 Verschuere L, Rombaut G, Sorgeloos P, Verstraete W. Probiotic bacteria as biological control agents in aquaculture. Microbiol Mol Biol Rev. 2000;64(4): 655–71. Wang, Y.-B., Xu, Z.-R., & Xia, M.-S. J. F. S. (2005). The effectiveness of commercial probiotics in northern white shrimp Penaeus vannamei ponds. 71(5), 1036- 1041. doi:https://doi.org/10.1111/j.1444-2906.2005.01061.x Xu D, Wang Y, Sun L, Liu H, Li J. Inhibitory activity of a novel antibacterial peptide AMPNT-6 from Bacillus subtilis against Vibrio parahaemolyticus in shrimp. Food Control. 2013;30(1):58–61. https://doi.org/10.1016/j.foodcont.2 012.07.025. Yi Y, et al. Probiotic potential of Bacillus velezensis JW: antimicrobial activity against fish pathogenic bacteria and immune enhancement effects on Carassius auratus. Fish Shellfish Immunol. 2018;78:322–30. https://doi.org/10.1 016/j.fsi.2018.04.055. Zokaeifar H, et al. Selection and identification of non-pathogenic bacteria isolated from fermented pickles with antagonistic properties against two shrimp pathogens. J Antibiotic. 2012;65(6):289–94. https://doi.org/10.1038/ja.2012.17. Zokaeifar H, Babaei N, Saad C.R., Kamarudin M.S., Sijam K, Balcazar J.L. Administration of Bacillus subtilis strains in the rearing water enhances the http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Fisheries and Aquatic Sciences Springer Journals

Exploration of genetic diversity of Bacillus spp. from industrial shrimp ponds in Vietnam by multi-locus sequence typing

Download PDF
9 pages

Loading next page...
 
/lp/springer-journals/exploration-of-genetic-diversity-of-bacillus-spp-from-industrial-hQrlsldraf

References (51)

Publisher
Springer Journals
Copyright
Copyright © 2019 by The Author(s)
Subject
Life Sciences; Fish & Wildlife Biology & Management; Marine & Freshwater Sciences; Zoology; Animal Ecology
eISSN
2234-1757
DOI
10.1186/s41240-019-0132-5
Publisher site
See Article on Publisher Site

Abstract

Bacillus is a diverse genus consisting of more than 200 species with extensive genetic diversity. Their beneficial effects in industrial shrimp farming have been well documented. However, little is known about the biodiversity of the Bacillus spp. in this aquaculture system. Taxonomic analysis by 16S rRNA sequencing does not always allow species-level identification of Bacillus spp. In this study, 26 Bacillus isolates from two industrial Litopenaeus vannamei shrimp ponds in Bac Lieu Province, Vietnam, were analyzed for their genetic diversity by multi-locus sequence typing (MLST). A total of 22 sequence types were identified and segregated into four distinct clusters, corresponding to B. subtilis, B. velezensis, B. siamensis, and B. licheniformis. Bacillus subtilis and B. velezensis accounted for more than 73% of the Bacillus isolates. Notably, the MLST scheme exhibited high discriminatory power and might be further simplified to be a convenient method to identify species of the genus Bacillus. Keywords: Bacillus group, Probiotics, Biodiversity, Industrial shrimp farming, MLST, Multi-locus sequence typing Background shrimp farming have been shown in numerous studies. According to the Food and Agriculture Organization of For instance, probiotics improve water quality, produce the United Nations (FAO), aquaculture is the fastest- inhibitory compounds against pathogens, or enhance the growing sector of food production in the world today host’s growth and immune system (Gatesoupe 1999; (FAO 2018). In Vietnam, the shrimp farming area is ap- Gomes et al. 2009; Irianto and Austin 2002; Verschuere proximately 600,000 ha, producing 300000 tons of black et al. 2000). tiger and whiteleg shrimps per year (VASEP 2018). Al- Bacteria belonging to Bacillus genus are often included though the procedure for industrial shrimp farming has in probiotics used in aquaculture as they are believed to been established, sustainable development of this model confer multiple benefits to both the environment and could be severely compromised by an increased risk of in- the cultured animals (van Hai and Fotedar 2010; Zokaei- fectious diseases such as white spot syndrome virus, early far et al. 2012). These bacteria are non-pathogenic, mortality syndrome (EMS), and white feces syndrome. spore-forming, and capable of secreting compounds with As a result, probiotics have been increasingly antimicrobial properties (Zokaeifar et al. 2012). They employed in the form of feed supplements for shrimp have been used to promote growth and control diseases farming. In Vietnam, probiotics were used in 91% of the in shrimp aquaculture (Dalmin et al. 2001; Wang et al. surveyed shrimp farms (Rico et al. 2013). By definition, 2005; Zokaeifar et al. 2014). However, there is a lack of probiotics are live microorganisms that, when adminis- knowledge on the genetic diversity of Bacillus bacteria tered in adequate amounts, confer a health benefit to in industrial shrimp aquaculture, which is the overall the host (Mack 2005). Indeed, their beneficial effects in trend of shrimp farming in Vietnam. Conventionally, culture methods or molecular tech- niques such as polymerase chain reaction-denaturing * Correspondence: hoa.lequang@hust.edu.vn School of Biotechnology and Food Technology, Hanoi University of Science gradient gel electrophoresis (PCR-DGGE) (Piterina and and Technology, Hanoi, Vietnam Pembroke 2013) or 16S rRNA sequencing (Qin et al. Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 2 of 9 2016) have been used to explore the bacterial contents Total DNA of bacterial isolates was extracted follow- of aquaculture systems. However, these are time-con- ing Burrell et al. (1998) with some modifications. Briefly, suming and often fail to reflect the diversity of closely 2 mL of overnight LB culture was centrifuged at 10, related bacterial groups, particularly species of the Ba- 000×g for 5 min and the supernatant was discarded. Cell cillus genus. Recently, multi-locus sequence typing pellet was then resuspended in 600 μL of Tris-EDTA (MLST), which characterizes bacterial strains using (50 mM Tris pH 8.0, 5 mM EDTA). Subsequently, 50 μL internal fragments of multiple housekeeping genes, of freshly prepared lysozyme (10 mg/mL) was added to has gained broad acceptance among epidemiologists the mixture and incubated at 37 °C for 2 h. A volume of (over 50 MLST schemes have been published and 35 μL of sodium dodecyl sulfate (10% (w/v)) and 15 μL made available on the Internet at https://pubmlst.org/ of proteinase K (10 mg/mL) was then added to the mix- databases/) (Larsen et al. 2012). MLST is a standard- ture, followed by another incubation step at 37 °C for 1 ized approach, highly unambiguous, and reproducible. h. After extracting with an equal volume (700 μL) of Furthermore, MLST has been successfully used to chloroform/isoamyl alcohol (24:1, v/v), the nucleic acids study the phylogenetic diversity of the Bacillus cereus from 500 μL of supernatant were precipitated by adding group (Sorokin et al. 2006). 50 μL of sodium acetate (3 M pH 5.2) and 1.4 mL of In this study, we aimed to explore the genetic diversity 100% ethanol and incubating for 1 h at room of the Bacillus group in two industrial shrimp ponds temperature. Following a centrifugation at 12,000×g for (with and without EMS) that are frequently supple- 30 min, DNA pellet was washed by 1 mL of 70% ethanol, mented with probiotic products. An MLST scheme using air dried, and resuspended in 200 μL of TE (10 mM Tris seven housekeeping genes (glpF, ilvD, ptA, purH, pycA, pH 8.0, 1 mM EDTA) containing 10 μg/mL of RNase A. rpoD, and tpiA) was applied to identify Bacillus isolates After incubating at 37 °C for 1 h to remove RNA, DNA from these shrimp ponds. was further purified and concentrated into a 50-μL vol- ume using Amicon Ultra 0.5 mL 100K centrifugal filters Methods (Millipore) following the protocols provided with the fil- Bacterial isolates ters. DNA concentration and quality were assessed based Bacillus bacteria were isolated from sediment, water, and on absorbance at 260, 280, and 230 nm using Nano- shrimp intestine samples of two industrial whiteleg Drop2000 (Thermo Fisher). shrimp (Litopenaeus vannamei) ponds in Bac Lieu Prov- ince, Vietnam, following the procedure described by Cao et al. (2011) with some modifications. Briefly, 1 g of sam- 16S rRNA sequencing ple was homogenized in 100 mL of nutrient broth (NB) 16S rRNA gene of bacterial isolates was amplified by by Stomacher® 400 Circulator (Seward) and incubated at PCR using universal primers 8F (5′-AGAGTTTGATCC 80 °C for 10 min to inactivate vegetative bacteria and TGGCTCAG-3′) and 1510R (5′-GGCTACCTTGTTAC fungi in order to isolate Bacillus spores that withstood GA-3′) (Ding and Yokota 2002). PCR reactions were this heat pretreatment. The supernatant was then sub- performed with an initial denaturation at 94 °C for 3 jected to tenfold serial dilution before being spread onto min, followed by 30 cycles of denaturation at 94 °C for nutrient agar (NA). After incubation at 37 °C for 24 h, 30 s, annealing at 52 °C for 30 s, and extension at 72 °C individual colonies were streaked onto NA to obtain for 1.5 min. Final extension step was performed at 72 °C pure isolates. Upon isolation, bacterial isolates were sub- for 10 min. Reaction mixtures of 50 μL contained 25 μL jected to catalase test and gram staining and positive iso- of GoTaq® G2 Hot Start Colorless Master Mix 2X (Pro- lates were stored in 50% glycerol at − 80 °C. A total of 26 mega, USA), 0.4 pmol/μL of each primer, and 10 ng of isolates was obtained, among which 11 (sediment, n= 2; DNA template. Negative and positive (B. subtilis strain water, n= 4; intestine n= 5) were isolated from the pond WB800N) controls were included in each PCR amplifi- that was free of EMS, while 15 (sediment, n= 8; water, cation. PCR products were purified using QIAquick PCR n= 4; intestine n= 3) were isolated from the pond that purification kit per the manufacturer’s specifications had been affected by EMS during the last three consecu- (QIAGEN, Germany) and sent to Macrogen (Seoul, tive years. Details on the origin and morphology of the Korea) for sequencing by Sanger method. Low-quality isolates are presented in Table 1. ends of DNA sequences were trimmed by DNA Chro- matogram Explorer Lite (HeracleSoftware). DNA se- DNA extraction quences were then BLAST searched against GenBank DNA extraction and subsequent experiments were per- databases (http://www.ncbi.nlm.nih.gov) and analyzed formed at Laboratory of Genetic Engineering, School of using Bioedit (Hall 1999). MEGA X (https://www.mega- Biotechnology and Food Technology, Hanoi University software.net/) was used to construct the 16S phylogen- of Science and Technology, Hanoi, Vietnam. etic tree using the neighbor-joining method with Kimura Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 3 of 9 Table 1 Origin and morphology of 26 bacterial isolates used in this study Sample ID Origin Shape Edge Elevation Color + opacity BRB 2.1 EMS, intestine Circular Entire Flat White, opaque BRB 2.2 EMS, intestine Circular Undulate Umbonate White, opaque BRB 6.3 EMS, intestine Irregular Lobate Flat White, translucent BDB 1.1 EMS, sediment Circular Entire Raised White, opaque BDB 1.2 EMS, sediment Irregular Undulate Raised White, opaque BDB 11.1 EMS, sediment Circular Entire Umbonate White, opaque BDB 3.1 EMS, sediment Irregular Undulate Flat White, opaque BDB 3.2 EMS, sediment Circular Undulate Flat Buff BDB 3.4 EMS, sediment Irregular Undulate Flat White, opaque BDB 3.5 EMS, sediment Irregular Entire Raised, wrinkled White, opaque BDB 6.1 EMS, sediment Circular Entire Flat White, translucent BNB 1.1 EMS, water Circular Undulate Umbonate White, opaque BNB 1.2 EMS, water Circular Undulate Umbonate White, opaque BNB 5.2 EMS, water Circular Entire Umbonate White, opaque BNB 9.3 EMS, water Circular Entire Flat, wrinkled White, opaque BRK 1.1 Non-EMS, intestine Irregular Lobate Flat White, opaque BRK 4.4 Non-EMS, intestine Irregular Lobate Flat White, opaque BRK 5.4 Non-EMS, intestine Circular Undulate Flat, wrinkled White, opaque BRK 6.1 Non-EMS, intestine Circular Undulate Flat White, opaque BRK 7.3 Non-EMS, intestine Circular Entire Flat White, opaque BDK 2.3 Non-EMS, sediment Circular Entire Flat, wrinkled White, opaque BDK 9.2 Non-EMS, sediment Circular Undulate Raised, wrinkled White, opaque BNK 2.2 Non-EMS, water Circular Undulate Flat, wrinkled White, opaque BNK 2.3 Non-EMS, water Circular Entire Flat, wrinkled White, opaque BNK 7.1 Non-EMS, water Circular Undulate Flat, wrinkled White, opaque BNK 8.1 Non-EMS, water Circular Entire Raised, wrinkled White, opaque 2-parameter substitution model (Kikuchi 2009; Kimura controls were included in each PCR amplification. Fol- 1980) and 1000 bootstrapping tests. lowing amplification, PCR products were purified using QIAquick PCR purification kit or QIAquick® Gel Extrac- MLST analysis tion Kit (Qiagen, Germany) per the manufacturer’s spec- Intragenic regions of seven housekeeping genes (glpF, ifications and sent to Macrogen (Seoul, Korea) for ilvD, ptA, purH, pycA, rpoD, and tpiA) were selected for sequencing. MLST analysis (www.pubmlst.org/bsubtilis). Primers for Obtained DNA sequences were trimmed at both ends PCR amplification of the seven genes were designed to obtain regions corresponding to B. subtilis sequences using Primer3 software (Untergasser et al. 2012), and available on PubMLST database (www.pubmlst.org/ their sequences are shown in Table 2. PCR amplifica- bsubtilis), and aligned using CLUSTALW (MEGA X). tions were performed using Promega GoTaq® G2 Hot The number of polymorphic sites of each gene fragment Start Colorless Master Mix 2X as mentioned above. Re- was manually counted using the alignment outputs. Dif- actions of 50 μL contained 25 μL of GoTaq® G2 Hot Start ferent alleles were determined on the basis of one-nu- Colorless Master Mix 2X, 0.4 pmol/μL of each primer, cleotide difference and were assigned arbitrary numbers. and 10 ng of DNA template. One single cycling program For each bacterial isolate, a combination of seven alleles was used for amplification of the seven genes: initial de- defined its allelic profile and sequence type (ST). Cover- naturation at 95 °C for 3 min, 40 cycles of denaturation age of the complete coding sequences was identified (95 °C, 30 s), annealing (54 °C, 30 s), extension (72 °C, 50 using BLAST search against GenBank databases. MEGA s), and one final elongation step at 72 °C for 5 min. X software was used to construct phylogenetic trees Negative and positive (B. subtilis strain WB800N) using the neighbor-joining method with Kimura 2- Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 4 of 9 Table 2 Primer sequences for MLST analysis Primer Sequence (5′–3′) Annealing temperature Expected size rpoD-F GCCGAAGAAGAATTTGACCTTAA 54 °C 854 bp rpoD-R CGTTTRCTTCTGCTHGGATGTCT glpF-F WTGACAGCATTTTGGGG 54 °C 690 bp glpF-R GTAAAATACRCCGCCGA ilvD-F ATGAGATATTCGCTGCC 54 °C 622 bp ilvD-R CTTCGTTAATGCGTTCTAAAGAG ptA-F ATACATATGAAGGSATGGAAGA 54 °C 610 bp ptA-R TAGCCGATGTTTCCTGCT tpiA-F TCAGCTTCGTTGAAGAAGTGAAA 54 °C 620 bp tpiA-R GGACTCTGCCATATATTCTTTA PycA-F AAATCAGARGCGAAAGC 54 °C 545 bp PycA-R CCTGAGCGGTAAGCCAT purH-F TTTGAGAAAAAACAATCGCT 54 °C 568 bp purH-R TCGGCTCCCTTTTCGTCGG parameter substitution model (Akita et al. 2017; Kimura isolates except for BRB 6.3 and BDB 6.1 (Additional file 1: 1980) and 1000 bootstrapping tests. Sequence type ana- Table S1). lysis and recombinational tests (START) software (ver- The neighbor-joining phylogenetic tree, based on 16S sion 1.0.5) (http://www.mlst.net) was used to calculate G rRNA sequences of the isolates and type of strains re- + C content and d /d value. Discrimination indices trieved from the GenBank database, contains four clades: N S (DI) were computed as previously described (Hunter B. licheniformis, B. subtilis/B. tequilensis, B. amylolique- and Gaston 1988). faciens/B. siamensis, and B. velezensis (Fig. 1). From this phylogenetic tree, it is evident that the isolates BRB 6.3 and BDB 6.1 are closely related to B. licheniformis, while Results the isolates BNB 1.2, BNB 5.2, BNB 1.1, BRK 5.4, BDB Sequencing of 16S rRNA identified 26 Bacillus isolates 11.1, BNK 2.2, and BRB 2.2 are closely related to B. vele- Pioneer work on prokaryotic taxonomy has recom- zensis. Nevertheless, identification of the other isolates mended that identification to the species level is defined was inconclusive. Indeed, the low bootstrap values on as a 16S rDNA sequence similarity of ≥ 99% with that of the remaining part of the tree indicated that 16S rRNA the type strain sequence in GenBank database (Cai et al. sequencing is not suitable for phylogenetic analysis of all 2003; Stackebrandt and Ebers 2006; Benga et al. 2014). isolates at the species level (Hampl et al. 2001). This In the present study, the 16S rRNA gene fragment was may be due to the high similarity of 16S sequences from amplified and sequenced using the universal primer 8F Bacillus isolates in the present study. and 1510R (Ding and Yokota 2002). Approximately All of these results clearly showed that 16S rRNA gene 1400 bp (range 1380–1421 bp) of the 16S rRNA gene se- alone was not able to identify all Bacillus isolates at the quence was successfully obtained for each isolate (Add- species level. Therefore, they were subjected to genotyp- itional file 1: Table S1) with Phred scores higher than 20 ing by an MLST scheme that utilizes internal fragments (Ewing and Green 1998). These sequences were blasted of seven housekeeping genes. against the 16S rRNA sequence database at NCBI. The results (Additional file 1: Table S1) indicated that all iso- MLST analysis lates belong to the genus Bacillus with the highest simi- From the sequencing results, allelic and sequence pro- larity scores ranging from 99.8 to 100%. However, it was files of the seven housekeeping genes (glpF, ilvD, ptA, not able to identify these isolates at the species level. For purH, pycA, rpoD, and tpiA) were presented in Table 3. example, isolate BRB 2.2, BDB 1.1, BDB 11.1, BDB 3.5, The lengths of analyzed fragments ranged from 384 to BNB 1.1, BNB 1.2, BNB 5.2, BRK 5.4, BDK 2.3, BNK 2.2, 470 bp, covering from 11.6 (pycA) to 55.1% (tpiA) of the BNK 2.3, BNK 7.1, and BNK 8.1 could be any species of complete gene sequences. Multiple sequence alignment B. amyloliquefaciens, B. velezensis, B. subtilis,or B. sia- did not show any insertions or deletions; however, SNPs mensis. The difference between the highest and second were frequently observed. We found 146 (38.0%), 164 highest similarity scores was less than 0.1% for all (34.9%), 105 (25.4%), 137 (34.3%), 168 (42.1%), 108 Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 5 of 9 Fig. 1 Neighbor-joining phylogenetic tree based on 16S rRNA sequences of 26 Bacillus isolates from EMS-free and EMS-affected shrimp ponds and representative Bacillus reference strains. Names of different clades were placed on the right-hand side. GenBank accession numbers are indicated in parentheses. Isolates from the EMS-affected pond are indicated by asterisks Table 3 Allelic profiles of the seven housekeeping genes used in MLST analysis Gene Size of fragment analyzed Coverage of complete CDS (%) Number of Number of Percentage of Avg G + C DI dN/dS alleles polymorphic sites polymorphic sites content (%) ratio glpF 384 46.6 18 146 38.0 50.0 0.972 0.061 ilvD 470 28.0 16 164 34.9 54.5 0.957 0.040 pta 414 42.6 15 105 25.4 51.4 0.942 0.020 purH 399 25.9 17 137 34.3 50.4 0.96 0.080 pycA 399 11.6 19 168 42.1 49.6 0.966 0.048 rpoD 384 34.4 11 108 28.1 49.2 0.908 0.001 tpiA 420 55.1 13 89 21.2 49.3 0.932 0.041 DI discrimination index Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 6 of 9 (28.1%), and 89 (21.2%) polymorphic sites for glpF, ilvD, industrial whiteleg shrimp ponds in Bac Lieu Province, pta, purH, pycA, rpoD,and tpiA, respectively. Moreover, Vietnam, by 16S rRNA sequencing and multiple-locus for each locus, we found 11 to 19 alleles, which were sequence typing. Notably, one pond was affected with counted on the basis of one-base difference. Average (G + EMS while the other was free of EMS. Both ponds were C) content of each gene was about 49–54%. This range is frequently supplemented with probiotic products. similar to the (G + C) contents of the corresponding gene Initially, 26 Bacillus spp. were detected by 16S rRNA sequences from the B. subtilis strain 168, which is the first sequencing. Although being useful for phylogenetic reference genomic data for the Bacillus genus. Average studies at the genus level, the discriminatory power at dN/dS values were much less than 1 (maximum at 0.080), species level of the 16S method remained questionable indicating that the seven gene fragments are under nega- as at least four species of the Bacillus group were identi- tive selection pressure and mutations were mainly syn- fied per isolate while performing BLAST searches of the onymous (Kryazhimskiy and Plotkin 2008). Synonymous sequenced 16S fragments. This may be due to the high substitutions were at least 12.5 times (1/0.080) more fre- similarity of 16S sequences between closely related spe- quent than amino acid changes at any locus. This could cies (Stackebrandt and Goebel 1994). It has also been be explained by the crucial functions of these housekeep- shown that 16S rRNA sequences of some Bacillus spe- ing genes in Bacillus bacteria. cies are almost identical (Janda and Abbott 2007). On The discrimination indices (DI) were also computed to the other hand, the MLST scheme used in the present compare the discriminatory power of the individual study allowed determination of the exact species of all genes. The lowest DI value of the seven loci was 0.908, the 26 isolates. Overall, all the seven genes exhibited a indicating a high discriminatory power and the efficiency satisfactory discriminatory power (DI ≥ 0.908). Interest- in differentiating the isolates in our study. glpF was ingly, the locus with the most polymorphic sites did not scored the highest at 0.972 (18 alleles, 38.0% poly- exhibit the highest DI (Table 2). Therefore, we suggest morphic sites). Interestingly, the most polymorphic frag- that using the locus with the highest discriminatory ment (pycA, 42.1% polymorphic sites) did not exhibit power (glpF, purH, and pycA) could be enough to differ- the highest DI (0.966). These results may allow us to fur- entiate bacterial isolates of B. subtilis, B. velezensis, B. ther simplify the MLST scheme by using the most dis- siamensis,and B. licheniformis. Nevertheless, a larger criminatory loci. population is required to evaluate this hypothesis After concatenation of the seven fragments, a total of extensively. 22 sequence types was distinguished among the 26 iso- The neighbor-joining phylogenetic tree based on the lates. A neighbor-joining phylogenetic tree based on concatenated MLST fragments showed four distinct concatenated sequences (Fig. 2) was constructed using clades corresponding to the four Bacillus species and be- MEGA X software. Based on the BLAST search of the ing supported by reliable bootstrap values (higher than concatemer sequences, representative reference se- 80). The isolates were majorly B. subtilis and B. velezen- quences were selected from GenBank databases as sis (73%). The dominance of B. subtilis could be due to ingroups and outgroups. Clustering of all sequences re- that they are commonly used in probiotics or biocontrol vealed four major, non-overlapping clades, supported by agents (Buruiană et al. 2014; Farzanfar 2006). For B. the bootstrap value of 100. They corresponded to the velezensis, several studies have pointed out that they can four species of the Bacillus genus: B. velezensis, B. sia- act as biocontrol agents (Palazzini et al. 2016) and ex- mensis, B. subtilis, and B. licheniformis, respectively. We hibit antimicrobial activity against fish pathogenic bac- observed an uneven distribution of the isolates between teria (Yi et al. 2018), including Vibrio parahaemolyticus, these groups. Bacillus velezensis and B. subtilis clades (8 which is the leading cause of EMS in cultured shrimps. and 11 isolates, respectively) accounted for more than Therefore, they could have been used regularly and be- 73% of the total samples. Regarding the Bacillus con- came widespread in industrial shrimp ponds in Vietnam. tents in EMS-free and EMS-affected ponds, no signifi- However, this is not the case for the B. licheniformis spe- cant difference was observed with one exception for the cies. Despite being popular in probiotic products (Elsha- B. licheniformis group. Indeed, two B. licheniformis iso- ghabee et al. 2017), only two isolates of this species were lates were exclusively present in the EMS-affected pond. found in EMS-affected pond. Nevertheless, we cannot The remaining isolates from EMS-free and EMS-affected exclude the possibility that bacterial isolates identified in ponds were quite evenly distributed between the three this study could also originate from natural sediments in clades of B. subtilis, B. velezensis, and B. siamensis. the ponds. In fact, Bacillus spp. are ubiquitous and found abundantly in soil (Garbeva et al. 2003). Discussion All Bacillus species detected in this study have been In the present study, we described the diversity and previously shown to have beneficial effects in aquaculture population structure of Bacillus isolates from two systems. For instance, B. subtilis and B. licheniformis are Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 7 of 9 Fig. 2 Neighbor-joining phylogenetic tree based on concatenated MLST DNA sequences of 26 Bacillus isolates from EMS-free and EMS-affected shrimp ponds and representative Bacillus reference strains. Names of different clades were placed on the right-hand side. GenBank accession numbers are indicated in parentheses. Isolates from the EMS-affected pond are indicated by asterisks commonly used in commercialized probiotic products The antagonist effects of Bacillus bacteria against V. and their benefits have been thoroughly investigated (van parahaemolyticus, presumably the direct cause of EMS Hai and Fotedar 2010; Zokaeifar et al. 2012). Several stud- in shrimps, have been reported (Liu et al. 2015; Tran et ies have also pointed out the effects of B. velezensis and B. al. 2013; Xu et al. 2013). However, there was no signifi- siamensis as probiotics or biocontrol agents in industrial cant difference in Bacillus content between the EMS- aquaculture farming (Buruiană et al. 2014; Meidong et al. free and EMS-affected shrimp ponds except that two B. 2017; Palazzini et al. 2016). They play a pivotal role in nu- licheniformis isolates were exclusively found in the EMS- trient cycling, nutrition of the cultured animals, water affected pond. This preliminary result needs further re- quality, and disease control (Moriarty 1997). search with a larger sample size to be confirmed. Of Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 8 of 9 note, the ability of secreting antibacterial compounds is Author details 1 2 Truc Anh Co., Ltd, Bac Lieu, Vietnam. School of Biotechnology and Food characteristic of a few Bacillus strains only (Azevedo et Technology, Hanoi University of Science and Technology, Hanoi, Vietnam. al. 1993; Liu et al. 2015). Therefore, antimicrobial activ- 3 4 Vietnam Fisheries Society, Hanoi, Vietnam. College of Aquaculture & ity to V. parahaemolyticus needs to be tested for each Fisheries, Can Tho University, Can Tho, Vietnam. Bacillus isolates in order to determine whether there Received: 10 April 2019 Accepted: 29 July 2019 was a difference in antimicrobial profile between isolates from EMS-free and EMS-affected shrimp ponds. References Conclusions Akita H, Kimura Z-I, Yusoff MZM, Nakashima N, Hoshino T. Identification and In conclusion, we have shown that MLST is a more effi- characterization of Burkholderia multivorans CCA53. BMC Res Notes. 2017; 10(1):249. https://doi.org/10.1186/s13104-017-2565-1. cient phylogenetic tool than the 16S rRNA sequencing Azevedo E.C., Rios E.M., Fukushima K, & Campos-Takaki G.M. Bacitracin production for identifying Bacillus species isolated from shrimp by a new strain of Bacillus subtilis. Appl Biochem Biotechnol. 1993;42(1):1. aquaculture. Using this approach, we have identified four https://doi.org/10.1007/BF02788897. Benga L, Benten WP, Engelhardt E, Kohrer K, Gougoula C, Sager M. 16S ribosomal major Bacillus species including B. subtilis, B. velezensis, DNA sequence-based identification of bacteria in laboratory rodents: a B. siamensis, and B. licheniformis from EMS-free and practical approach in laboratory animal bacteriology diagnostics. Lab Anim. EMS-affected industrial shrimp ponds, among which B. 2014;48(4):305–12. https://doi.org/10.1177/0023677214538240. Burrell PC, Keller J, Blackall LL. Microbiology of a nitrite-oxidizing bioreactor. Appl subtilis and B. velezensis accounted for more than 73% Environ Microbiol. 1998;64(5):1878–83. of the isolates. Further research will be dedicated to Buruiană C-T, Georgiana P, Vizireanu C. Effects of probiotic Bacillus species in evaluate the antagonistic activity of the isolates against aquaculture – an overview (Vol. 38); 2014. Cai H, Archambault M, Prescott JF. 16S ribosomal RNA sequence-based V. parahaemolyticus strains causing EMS. identification of veterinary clinical bacteria. J Vet Diagn Invest. 2003;15(5): 465–9. Cao H, He S, Wei R, Diong M, and Lu L, Bacillus Amyloliquefaciens G: A Potential Additional file Antagonistic Bacterium against Eel-Pathogenic Aeromonas hydrophila. Evid Based Complement Alternat Med. 2011;2011:7. Article ID 824104, https://doi. Additional file 1: Table S1. Identification of 26 Bacillus isolates by 16S org/10.1155/2011/824104. rRNA sequencing. Size of the 16S rRNA fragment; names of the reference Dalmin G, Kathiresan K, Purushothaman A. Effect of probiotics on bacterial strains and similarity obtained by BLASTN against the 16S rRNA sequence population and health status of shrimp in culture pond ecosystem. Indian J database at NCBI for each isolate. (DOCX 35 kb) Exp Biol. 2001;39(9):939–42. Ding L, Yokota A. Phylogenetic analysis of the genus Aquaspirillum based on 16S rRNA gene sequences. FEMS Microbiol Lett. 2002;212(2):165–9 https://doi. Abbreviations org/10.1111/j.1574-6968.2002.tb11261.x. DGGE: Denaturing gradient gel electrophoresis; DI: Discrimination index; Elshaghabee FMF, Rokana N, Gulhane RD, Sharma C, Panwar H. Bacillus as EMS: Early mortality syndrome; FAO: Food and Agriculture Organization of potential probiotics: status, concerns, and future perspectives. Frontiers in the United Nations; MLST: Multi-locus sequence typing; PCR: Polymerase microbiology. 2017;8:1490. https://doi.org/10.3389/fmicb.2017.01490. chain reaction; ST: Sequence type; START: Sequence type analysis and Ewing B, Green P. Base-calling of automated sequencer traces using phred. II. recombinational tests Error probabilities. Genome Res. 1998;8:186–94. FAO. The State of World Fisheries and Aquaculture 2018 - meeting the Acknowledgements sustainable development goals. Rome. Licence: CC BY-NC-SA 3.0 IGO. 2018 We thank the staffs from Truc Anh Co., Ltd for their contributions to this Farzanfar A. The use of probiotics in shrimp aquaculture. FEMS Immunol Med study. Microbiol. 2006;48(2):149–58. https://doi.org/10.1111/j.1574-695X.2006.00116.x. Garbeva P, van Veen JA, van Elsas JD. Predominant Bacillus spp. in agricultural Authors’ contributions soil under different management regimes detected via PCR-DGGE. Microb XTL, UNV, and HQL conceived and designed the study. XTL, DTP, TAP, and Ecol. 2003;45(3):302–16. https://doi.org/10.1007/s00248-002-2034-8. THK collected the data. XTL, TTT, and HQL performed the analysis. XTL, TTT, Gatesoupe FJ. The use of probiotics in aquaculture. Aquaculture. 1999;180(1):147– UNV, and HQL drafted the manuscript. All authors read and approved the 65. https://doi.org/10.1016/S0044-8486(99)00187-8. final manuscript. Gomes LC, et al. Benefits of using the probiotic Efinol®L during transportation of cardinal tetra, Paracheirodon axelrodi (Schultz), in the Amazon. 2009;40(2): 157–65. https://doi.org/10.1111/j.1365-2109.2008.02077.x. Funding Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis This research was partially funded by the Ministry of Science and Technology program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–8. of Vietnam (grant no. 06/2014/HD-NDT) Hampl V, Pavlícek A, Flegr J. Construction and bootstrap analysis of DNA fingerprinting-based phylogenetic trees with the freeware program FreeTree: Availability of data and materials application to trichomonad parasites. Int J Syst Evol Microbiol. 2001;51(Pt 3): All datasets generated during and/or analyzed during the current study are 731. https://doi.org/10.1099/00207713-51-3-731. available from the corresponding author on reasonable request. Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988; Ethics approval and consent to participate 26(11):2465–6. Not applicable. Irianto A, Austin B. Probiotics in aquaculture. 2002;25(11):633–42. https://doi.org/1 0.1046/j.1365-2761.2002.00422.x. Consent for publication Janda JM, Abbott SL. 16S rRNA gene sequencing for bacterial identification in Not applicable. the diagnostic laboratory: pluses, perils, and pitfalls. J Clin Microbiol. 2007; 45(9):2761–4. https://doi.org/10.1128/JCM.01228-07. Competing interests Kikuchi Y. Endosymbiotic bacteria in insects: their diversity and culturability. The authors declare that they have no competing interests. Microbes Environ. 2009;24:195–204. https://doi.org/10.1264/jsme2.ME09140S. Le et al. Fisheries and Aquatic Sciences (2019) 22:17 Page 9 of 9 Kimura M. A simple method for estimating evolutionary rates of base water quality, growth performance, immune response, and resistance against substitutions through comparative studies of nucleotide sequences. J Mol Vibrio harveyi infection in juvenile white shrimp, Litopenaeus vannamei. Fish Evol. 1980;16(2):111–20. Shellfish Immunol. 2014;36(1):68-74. Kryazhimskiy S, & Plotkin J. B. The population genetics of dN/dS. PLoS Genet. 2008;4(12):e1000304. https://doi.org/10.1371/journal.pgen.1000304. Publisher’sNote Larsen MV, et al. Multilocus sequence typing of total-genome-sequenced Springer Nature remains neutral with regard to jurisdictional claims in bacteria. J Clin Microbiol. 2012;50(4):1355–61. https://doi.org/10.1128/jcm.06 published maps and institutional affiliations. 094-11. Liu XF, et al. Isolation and characterisation of Bacillus spp. antagonistic to Vibrio parahaemolyticus for use as probiotics in aquaculture. World J Microbiol Biotechnol. 2015;31(5):795–803. https://doi.org/10.1007/s11274-015-1833-2. Mack DR. Probiotics-mixed messages. Can Fam Physician. 2005;51(11):1455–64. Meidong R, et al. A novel probiotic Bacillus siamensis B44v isolated from Thai pickled vegetables (Phak-dong) for potential use as a feed supplement in aquaculture. J Gen Appl Microbiol. 2017;63:246–53. Moriarty DJW. The role of microorganisms in aquaculture ponds. Aquaculture. 1997;151(1):333–49. https://doi.org/10.1016/S0044-8486(96)01487-1. Palazzini JM, Dunlap CA, Bowman MJ, Chulze SN. Bacillus velezensis RC 218 as a biocontrol agent to reduce Fusarium head blight and deoxynivalenol accumulation: genome sequencing and secondary metabolite cluster profiles. Microbiol Res. 2016;192:30–6. https://doi.org/10.1016/j.micres.2016.06. Piterina AV, Pembroke JT. Use of PCR-DGGE based molecular methods to analyse microbial community diversity and stability during the thermophilic stages of an ATAD wastewater sludge treatment process as an aid to performance monitoring. ISRN Biotechnol. 2013;2013:162645. https://doi.org/10.5402/2 013/162645. Qin Y, et al. Bacterial abundance and diversity in pond water supplied with different feeds. Scientific Rep. 2016;6:35232. https://doi.org/10.1038/ srep35232. Rico A, et al. Use of veterinary medicines, feed additives and probiotics in four major internationally traded aquaculture species farmed in Asia. Aquaculture. 2013;412-413:231–43. https://doi.org/10.1016/j.aquaculture.2013.07.028. Sorokin A, et al. Multiple-locus sequence typing analysis of Bacillus cereus and Bacillus thuringiensis reveals separate clustering and a distinct population structure of psychrotrophic strains. Appl Environ Microbiol. 2006;72(2):1569– 78. https://doi.org/10.1128/AEM.72.2.1569-1578.2006. Stackebrandt E, Ebers J. Taxonomic parameters revisited: tarnished gold standards (Vol. 8); 2006. Stackebrandt E, Goebel BM. Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. 1994;44(4):846–9. https://doi.org/10.1099/00207713-44-4-846. Tran L, et al. Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp. Dis Aquat Organ. 2013;105(1):45–55. https://doi.org/10.3354/dao02621. Untergasser A, et al. Primer3--new capabilities and interfaces. Nucleic Acid Res. 2012;40(15):e115. https://doi.org/10.1093/nar/gks596. van Hai N, Fotedar R. A review of probiotics in shrimp aquaculture. J Appl Aquaculture. 2010;22(3):251–66. https://doi.org/10.1080/10454438.2010.5005 VASEP. Report on Vietnam shrimp sector 2008-2017. Portal of Vietnam Association of Seafood Exporters and Producers. 2018 Verschuere L, Rombaut G, Sorgeloos P, Verstraete W. Probiotic bacteria as biological control agents in aquaculture. Microbiol Mol Biol Rev. 2000;64(4): 655–71. Wang, Y.-B., Xu, Z.-R., & Xia, M.-S. J. F. S. (2005). The effectiveness of commercial probiotics in northern white shrimp Penaeus vannamei ponds. 71(5), 1036- 1041. doi:https://doi.org/10.1111/j.1444-2906.2005.01061.x Xu D, Wang Y, Sun L, Liu H, Li J. Inhibitory activity of a novel antibacterial peptide AMPNT-6 from Bacillus subtilis against Vibrio parahaemolyticus in shrimp. Food Control. 2013;30(1):58–61. https://doi.org/10.1016/j.foodcont.2 012.07.025. Yi Y, et al. Probiotic potential of Bacillus velezensis JW: antimicrobial activity against fish pathogenic bacteria and immune enhancement effects on Carassius auratus. Fish Shellfish Immunol. 2018;78:322–30. https://doi.org/10.1 016/j.fsi.2018.04.055. Zokaeifar H, et al. Selection and identification of non-pathogenic bacteria isolated from fermented pickles with antagonistic properties against two shrimp pathogens. J Antibiotic. 2012;65(6):289–94. https://doi.org/10.1038/ja.2012.17. Zokaeifar H, Babaei N, Saad C.R., Kamarudin M.S., Sijam K, Balcazar J.L. Administration of Bacillus subtilis strains in the rearing water enhances the

Journal

Fisheries and Aquatic Sciences – Springer Journals

Published: Aug 13, 2019

There are no references for this article.