Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Ethanol extract separated from Sargassum horneri (Turner) abate LPS-induced inflammation in RAW 264.7 macrophages

Ethanol extract separated from Sargassum horneri (Turner) abate LPS-induced inflammation in RAW... Background: This study is aimed at identifying the anti-inflammatory properties of 70% ethanol extract produced from an edible brown seaweed Sargassum horneri (SJB-SHE) with industrial-scale production by Seojin Biotech Co. Ltd. S. horneri is a rich source of nutrient and abundantly growing along the shores of Jeju, South Korea. Methods: Here, we investigated the effect of SJB-SHE on LPS-activated RAW 264.7 macrophages. The cytotoxicity and NO production of SJB-SHE were evaluated using MTT and Griess assays, respectively. Additionally, protein expression and gene expression levels were quantified using ELISA, Western blots, and RT-qPCR. Results: Our results indicated that pre-treatment of RAW 264.7 macrophages with SJB-SHE significantly inhibited LPS-induced NO and PGE production. SJB-SHE downregulated the proteins and genes expression of LPS-induced iNOS and COX2. Additionally, SJB-SHE downregulated LPS-induced production of pro-inflammatory cytokines (tumor necrosis factor-α, interleukin (IL)-6, and IL-1β). Furthermore, SJB-SHE inhibited nuclear factor kappa-B (NF-κB) activation and translocation to the nucleus. SJB-SHE also suppressed the phosphorylation of mitogen-activated protein kinases (ERK1/2 and JNK). Conclusions: Collectively, our results demonstrated that SJB-SHE has a potential anti-inflammatory property to use as a functional food ingredient in the future. Keywords: Sargassum horneri, Ethanol extract, RAW 264.7 macrophages, Anti-inflammation, NF-κB, MAPKs Background and RelA; p65) then binds to promoter regions re- Nuclear factor kappa B (NF-κB) is a protein complex, in- sponsible for the transcription of genes that encode volved in the transcription of number of genes related to for pro-inflammatory cytokines, chemokines, and the production of pro-inflammatory cytokines and has other proteins related to the production of proteins also been demonstrated to play central role in the such as iNOS and COX2 (Pugh et al. 2012). There- LPS-induced expression of iNOS and cyclooxygenase-2 fore, it has been suggested that inhibition of NF-κB (COX2) from different cells (Merchant et al. 2017; activity including activation and translocation might Mulgund et al. 2015). Under the normal conditions, help to reduce inflammation related complications. NF-κB exists in the cytoplasm as an inactive dimer protein Sargassum horneri (Sargassaceae, Fucales, Phaeophyta) complex. However, upon the activation, NF-κB proteins is an edible brown seaweed, abundant worldwide in shal- undergo the phosphorylation and translocation to the low sea-water ecosystems (Herath et al. 2019; Kim et al. nucleus. The translocated NF-κB heterodimers (p50 2018). The thallus of S. horneri is large, macroscopic, and brown-colored, and its stem is cylindrical, erect, and * Correspondence: yhjee@jejunu.ac.kr; youjinj@jejunu.ac.kr flat. Young seaweeds resemble ferns, with opposite Department of Veterinary Medicine and Veterinary Medical Research leaf-like blades, extending from a central axis. The Institute, Jeju National University, Jeju 63243, Republic of Korea blades have broad, deeply incised, and ragged tips. As Department of Marine Life Science, School of Marine Biomedical Sciences, Jeju National University, Jeju 63243, Republic of Korea Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 2 of 10 the plant grows, it becomes a single frond, loosely Preparation of the ethanol extracts from S. horneri and branched, in a zig-zag pattern (Huang et al. 2017; Xie et composition analysis al. 2014). Once it matures, the blades become narrower Seventy percent ethanol extract of S. horneri collected and the branches develop small, ellipsoidal air bladders along the shores of Jeju Island were kindly prepared and and larger spindle-shaped reproductive receptacles, both provided by Seojin Biotech Co. Ltd., Korea (lot number on stalks (Kubo et al. 2017). Apart from the ecological SJFC70180625) (SJB-SHE). Briefly, the air-dried (50 °C) importance, S. horneri is popular as a nutrient-rich ed- seaweed samples were ground and passed through a ible seaweed in the East Asian countries. Side dishes or 40–50 mesh by Pin-mill. Then, 100 g of powdered S. soup prepared by mixing S. horneri thallus with meat or horneri was extracted with 70% ethanol solution at fish are popular in the countries located in the East Asia 65–80 °C for 12 h. Then, the extractants were concen- region. In Japan, S. horneri is known as “akamoku” and trated and freeze-dried to obtain 70% ethanolic extract of is harvested at the maturation stage for eating in regions S. horneri. Then, the resulted powder again dissolved in along the East Sea (Nomura et al. 2012; Ma et al. 2014). the 100% ethanol solution for 2 h with cellulose and then To select one of the extraction methods to prepare ex- centrifuged at 12,000 rpm in room temperature to remove tracts containing bioactive compounds from seaweeds is remaining residues and heavy metals. The supernatant an important step which has a great impact on the re- was concentrated and treated with 95% EtOH to increase search outcomes. However, the selection of the suitable purity (Herath et al. 2019). The resultant powder extraction method depends on the target compounds (SJB-SHE) was used to the consequent studies mentioned and its applications (da Silva et al. 2016). The industrial in this study. Details procedures of sample preparation, level applications such as functional foods and nutraceu- composition analysis, and composition data of SJB-SHE ticals require large amount of active substrates at low were similar to Herath et al. (2019). production cost (Fleurence 1999). However, isolation of active compounds for industrial level applications from Cell culture and cell viability assay seaweeds is limited due to the time-consuming opera- RAW 264.7 murine macrophages were purchased from tions and availability of skilled labors for isolation pro- the American Type Culture Collection, Manassas, VA, cesses. Thus, crude extracts from seaweeds as an active USA. The macrophages were maintained at 37 °C, 5% CO ingredient are more popular over the pure compounds in DMEM media supplemented with 10% heat-inactivated industries like functional foods (Kadam and Prabhasan- FBS, and 1% antibiotics. The cells were sub-cultured within kar 2010). Taken together, in the present study, 48 h intervals. The LDH activity in the culture mediums anti-inflammatory properties of the ethanolic extract ob- was assessed using LDH cytotoxicity detection kit tained from S. horneri, with industrial-scale production (Promega, Madison, WI, USA) by following the vendor’s by the company, Seojin Biotech, were evaluated on instructions. The effect of SJB-SHE on cell viability was LPS-activated RAW 264.7 macrophages. examined by colorimetric MTT assay similar to the previously described method (Jayawardena et al. 2018). The LDH release and cell viability were calculated as Material and methods shown below using plate reader at 490 nm and 540 nm Regents and antibodies respectively. All reagents used this study were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless stated other- Determination of NO, PGE , and cytokine production wise. Enzyme-linked immunosorbent assay (ELISA) kits (TNF-α, IL-1β, and IL-6) for mouse IL-1β, IL-6, and TNF-α were purchased from RAW 264.7 macrophages were incubated with various R&D Systems (Minneapolis, MN, USA). Antibodies concentration of SJB-SHE (62.5~250 μg/ml) and LPS against iNOS, COX2, p50, p-p50, p65, p-p65, β-actin, (1 μg/ml) for 24 h. The NO production in the culture nucleolin, ERK 1/2, p-ERK 1/2, JNK, and p-JNK were medium was quantified by Griess reagent as following a purchased from cell signaling Technology (Beverly, MA, previously established method (Jayawardena et al. 2018). USA). Prime Script™ first-strand cDNA synthesis kit for The level of PGE , TNF-α, IL-1β, and IL-6 in culture su- cDNA synthesis and ExTaq™ SYBR premix were pur- pernatants were evaluated using ELISA kit according to chased from TaKaRa, Japan. Dulbecco’s Modified Eagle the manufacturer’s instructions. Medium (DMEM), fetal bovine serum (FBS), and penicillin-streptomycin (10,000 U/ml) were purchased Western blot analysis from Life Technologies Corporation, Grand Island, NY, Whole-cell protein lysates and nucleus proteins were USA. The primers for amplification against iNOS, extracted using NE-PER® Nuclear and Cytoplasmic COX2, IL-1β, IL-6, and TNF-α were purchased from Extraction Kit (Thermo Scientific, Rockford, USA) fol- Bioneer, Seoul, South Korea. lowing a method described by Sanjeewa et al. (2017). Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 3 of 10 Equal amounts (40 μg) of protein were electrophoresed carbohydrate (39.99 ± 0.54%), and proteins (16.84 ± 0.74%). in 12% SDS-PAGE. After blocking with 05% non-fat Additionally, SJB-SHE contains considerable amounts of milk for 60 min, the blots were separately incubated ash (28.39 ± 0.51%) and moisture (14.68 ± 0.21). The fla- with the following primary antibodies: rabbit polyclonal vonoid and lipid contents observed in the SJB-SHE are less antibodies including iNOS, ERK1/2 (extracellular than 1%. signal-regulated kinase), p-ERK1/2, JNK, p-JNK, NF-κB p65, NF-κB p50, c-23, COX2, and β-actin (Cell Signaling Effect of SJB-SHE on cell viability and LPS-induced NO Technology, Beverly, MA, USA) overnight. The blots were and PGE production washed twice with Tween 20/Tris-buffered saline (TTBS) A range of concentrations (31.2~2000 μg/ml) was pre- and then incubated with HRP-conjugated anti-rabbit IgG pared from SJB-SHE to determine the safe concentrations for 30 min. Antibody binding was visualized by using an to treat RAW 264.7 macrophages. As shown in Fig. 1a enhanced chemiluminescent substrate (Cyanagen Srl, Bol- and b, the concentrations between 31.2~250 μg/ml did ogna, Italy). The basal level of each protein was normal- not express any cytotoxic effect towards the RAW 264.7 ized by analyzing the level of β-actin or c-23. Membranes macrophages. Therefore, as the next part of the study, the were photographed using a FUSION SOLO Vilber Lour- protective effect of SJB-SHE was evaluated against mat system. The intensities of bands were quantified using LPS-induced toxicity and NO production in RAW 264.7 the ImageJ (version 1.4) program (Sanjeewa et al. 2017). macrophages. According to the results, the treatment of LPS significantly increased the cell death rates and NO production. However, the treatment of SJB-SHE signifi- RNA extraction and quantitative reverse cantly and dose-dependently reduced the LPS-induced transcription-polymerase chain reaction (qRT-PCR) toxicity (Fig. 1c) and NO production (Fig. 1d). In addition Total RNA was isolated with Trizol reagent according to to NO, PGE was also identified as an inflammatory medi- the manufacturer’s instruction. Total RNA (1 μg) was ator produced by the macrophages which leads to the acti- reverse-transcribed to produce cDNA using a first-strand vation of inflammatory reactions. In the present study, cDNA Synthesis Kit according to the manufacturer’s thus, the levels of PGE in the culture supernatants were instructions. The target cDNA was amplified using the quantified by using the ELISA kit (Fig. 2a). The level of primers as provided in Table 1. All relative gene expres- PGE was significantly increased with the treatment of LPS. sion quantifications were normalized to GAPDH as an in- However, SJB-SHE dose-dependently reduced the LPS-in- ternal control. duced PGE production in the activated macrophages. Statistical analysis All the results are expressed as the mean values with the Protective effect of SJB-SHE against LPS-induced standard deviation of three independent repetitions. pro-inflammatory cytokine production Statistical significance was determined using t test and To evaluate the pro-inflammatory cytokine inhibitory ef- one-way or two-way analysis of variance (ANOVA) fect of SJB-SHE (TNF-α,IL-1β, and IL-6), macrophages followed by Dunnett’s post hoc test using IBM® SPSS® were incubated with SJB-SHE (62.5, 125, and 250 μg/ml) in statistics (Version 20) software. Significant differences the presence or absence of LPS (1 μg/ml) for 24 h, and the were assigned to P values < 0.05 and < 0.01 denoted by * pro-inflammatory cytokine levels in the culture superna- or # and ** or ## respectively. tants were measured by ELISA. It was noted that the treat- ment of SJB-SHE dose-dependently inhibited the LPS-activated TNF-α (Fig. 2b), IL-1β (Fig. 2c), and IL-6 Results (Fig. 2d) secretion from macrophages. Specifically, the Proximate composition of seaweed extract (SJB-SHE) treatment of SJB-SHE strongly suppressed the IL-1β pro- According to the chemical composition results, SJB-SHE duction from LPS-activated macrophages, and at the is mainly composed of polyphenols (15.30 ± 0.01%), 250 μg/ml concentration, SJB-SHE inhibited more than Table 1 Sequence of the primers used in this study 90% IL-1β compared to the LPS-treated group. Gene Primer Sequence from 5′→ 3′ GAPDH Sense AAGGGTCATCATCTCTGCCC SJB-SHE attenuate LPS-induced iNOS and COX2 secretion Antisense GTGATGGCATGGACTGTGGT- from LPS-activated macrophages To identify the mechanism how SJB-SHE reduces iNOS Sense ATGTCCGAAGCAAACATCAC LPS-activated NO and PGE production, the inhibitory Antisense TAATGTCCAGGAAGTAGGTG effect of SJB-SHE (62.5, 125, and 250 μg/ml) against COX2 Sense CAGCAAATCCTTGCTGTTCC LPS-activated iNOS and COX2 protein and its gene Antisense TGGGCAAAGAATGCAAACATC expression (Fig. 3) were evaluated. Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 4 of 10 ac bd Fig. 1 LDH release (a) and cytotoxicity (b) of SJB-SHE in RAW 264.7 macrophages. Cytoprotective (c) and NO inhibitory (d) effect of SJB-SHE in LPS-exposed RAW 264.7 macrophages. The cells were seeded in 24-well plates (1 × 10 ) and kept for 24 h to attach to the well bottoms. Then, SJB-SHE (62.5~250 μg/ml) introduced to each well and incubate for another 1 h and stimulated using LPS (1 μg/ml). After 24 h, cells and culture supernatants were used to determine viability (MTT) and NO production, respectively. Experiments were triplicated to evaluate the data, and the mean value is expressed as ± SD. *p < 0.05, **p < 0.01 As shown in Fig. 3a, the Western blot analysis was SJB-SHE attenuate LPS-induced NF-κB activation and performed to evaluate the effect of SJB-SHE on translocation COX2 and iNOS protein production. According to To investigate whether SJB-SHE (62.5~250 μg/ml) could the results, the LPS-treated macrophages (1 μg/ml) affect activation and nuclear translocation of NF-κB, had elevated levels of COX2 and iNOS (Fig. 3aand Western blot analysis for NF-κB p65, NF-κB p50, and Fig. 3b) protein production compared to the un- their phosphorylated forms was carried out with cyto- treated control. However, with the treatment of SJB- solic and nuclear extracts of LPS-stimulated RAW 264.7 SHE, the elevated levels of COX2 (Fig. 3c) and iNOS macrophages (Fig. 4). The relative expression of phos- (Fig. 3d) were significantly reduced. In addition to the phorylated forms, NF-κB p50 and p65, in the cytosol Western blot analysis, the effect of SJB-SHE on the were markedly increased upon the exposure of LPS. expression of iNOS and COX2 mRNA level was However, SJB-SHE inhibited LPS-mediated NF-κB phos- quantified using RT-qPCR analysis. According to the phorylation in the cytosol (Fig. 4a and Fig. 4b). Addition- results, mRNA expression levels of COX2 and iNOS ally, to determine whether SJB-SHE was associated with were similar to the Western blot results. These results the nucleus translocation of NF-κB, the levels of p50 strongly suggest the potential of SJB-SHE to more and p65 in the nucleus were examined. According to the suppress COX2 than iNOS. results, LPS was demonstrated to upregulate the Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 5 of 10 ac bd Fig. 2 Inhibitory effect of SJB-SHE on the PGE (a) and pro-inflammatory cytokines including TNF-α (b) IL-1β (c), and IL-6 (d) production in LPS- induced RAW 264.7 macrophages. Experiments were conducted using ELISA. SJB-SHE- (62.5~250 μg/ml) and LPS (1 μg/ml) treated cell supernatants were collected to quantify the inflammatory cytokines and PGE . Experiments were triplicated to evaluate the data, and the mean value is expressed as ± SD. * p < 0.05 and **p < 0.01 translocation of p50 and p65 from the cytosol to the nu- 250 μg/ml) treatments sufficiently reduced the phos- cleus after 30 min of LPS stimulation (Fig. 4c), and phorylation of ERK1/2 and JNK in LPS-activated SJB-SHE remarkably downregulated them (Fig. 4d). macrophages. These results suggest that the treatment of SJB-SHE has a potential to inhibit the LPS-induced NF-κB activation Discussion and translocation to the nucleus. In the present study, we demonstrated the anti-inflamma- tory potential of 70% ethanol extract obtained from S. hor- SJB-SHE inhibit LPS-induced MAPK phosphorylation neri against LPS-activated macrophages. The extraction In an attempt to identify whether or not the inhibition procedure was carried out in commercial scale by Seojin of inflammatory responses demonstrated by SJB-SHE is Biotech Co. Ltd., Korea. According to the results, mediated via the mitogen-activated protein kinases SJB-SHE (62.5~250 μg/ml) inhibited the LPS-induced (MAPK) pathway, the inhibitory effects of SJB-SHE (1 μg/ml) NO, PGE , and pro-inflammatory cytokine pro- were observed on LPS-induced phosphorylation of duction via blocking the activation and translocation of growth factor-regulated extracellular signal-related kinases NF-κB proteins as well as inhibiting the MAPKs (ERK)1/2 and c-jun N-terminal kinases (JNK) proteins in phosphorylation. RAW 264.7 macrophages via Western blotting. As A large number of phlorotannin substances, particu- presented in Fig. 5, LPS (1 μg/ml) significantly upregulated larly those present in brown seaweeds, have been re- the phosphorylation of ERK1/2 and JNK in RAW ported to possess a number of bioactive properties 264.7 macrophages. However, SJB-SHE (62.5, 125, and including anti-inflammation, antioxidant, and anticancer Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 6 of 10 ac bd Fig. 3 Inhibitory effects of SJB-SHE on LPS-induced inflammation-associated protein in RAW 264.7 macrophages. Western blots used to determine iNOS and COX2 levels (a), the related expression of the bands were analyzed using ImageJ software (b). β-actin was used as internal control. −ΔΔCt Results are expressed as the mean ± SD of three separate experiments. The gene expression analysis of iNOS (c) and COX2 (d). The 2 method was used to calculate the relative mRNA levels. Internal reference used in the experiment was GAPDH. Experiments were triplicated. mRNA significance relative to the non-treated control was calculated using the Mann-Whitney U test. *p < 0.05 and **p < 0.01 (Wijesinghe and Jeon 2011). However, the use of pure evaluate iNOS and COX2 inhibitory effect of SJB-SHE compounds for functional foods and other applications using LPS-activated RAW 264.7 macrophages. According in large quantities are not cost-effective and require to the results, treatments of SJB-SHE cause to downregu- time-consuming operations to isolate bio-active natural late iNOS and COX2 levels observed in LPS-activated substances. Therefore, in the present study, we at- macrophage cells (protein and mRNA). This result sug- tempted to evaluate anti-inflammatory mechanisms of a gests that SJB-SHE has a potential to inhibit NO and PGE commercial scale extract of S. horneri (SJB-SHE) using via downregulating iNOS and COX2 expression in LPS-activated RAW 264.7 macrophages. COX2 and LPS-activated RAW 264.7 macrophages. iNOS are important inflammatory mediators which are re- The initiation and development of the inflammation sponsible for initiating inflammation in cellular environ- process involve a series of pro-inflammatory cytokines. ments. NO and PGE are produced by two different LPS is a well-known immune stimulant used to activate proteins namely iNOS and COX2, respectively (Hseu et al. macrophage and production of cytokine is a major re- 2005). It has been reported that uncontrolled/irregular sponse. Based on the previous studies, the inhibition of upregulated production of iNOS and COX2 has been asso- pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) ciated with the pathophysiology of cancers and inflamma- provide solid insights to develop functional products tory disorders (Surh et al. 2001). Thus, the extracts capable against inflammatory responses (Li et al. 2018). to inhibit iNOS and COX2 might have the potential to re- According to the results we noted, the treatment of duce inflammatory responses and act as functional mate- SJB-SHE has a potential to inhibit LPS-activated inflam- rials. Therefore, in the present study, we attempted to mation in RAW 264.7 macrophages by suppressing Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 7 of 10 a c b d Fig. 4 Evaluation of SJB-SHE potential to inhibit the NF-κB pathway-associated proteins in LPS stimulated RAW 264.7 macrophages. Cytosolic NF-κB p50 and p65 phosphorylation levels (a); the intensity of protein expressions were quantified using ImageJ (b). Nuclear translocation levels of NF-κB p50 and p65 (c) and the intensity of NF-κB protein expressions in the nucleus (d). β-actin (cytosolic) and C-23 (nucleus) were used as internal controls. Results are expressed as the mean ± SD of three separate experiments. *p < 0.05 and **p < 0.01 cytokine secretion. In addition to this study, Sanjeewa et activate the levels of transcription factor NF-κB (Kiemer al. (2017) reported that the crude polysaccharide sepa- et al. 2003). Other than iNOS and COX2, Zielinski and rated from S. horneri has a potential to inhibit Krueger (2012) reported the activation of NF-κB also LPS-activated pro-inflammatory cytokine secretion from causes to activate pro-inflammatory cytokine (IL-1β and RAW 264.7 macrophages. TNF-α) expression and inhibits anti-inflammatory NF-κB comprises a family (Rel) of transcriptional fac- cytokines (IL-4 and IL-10) (Zielinski and Krueger 2012). tors, upon activation form heterodimers and homodi- Previously, a number of studies reported that organic ex- mers, binds to target DNA promoter sequences, and tracts obtained from brown seaweeds have the potential to then triggers gene expression. Under the normal condi- inhibit LPS-induced NF-κB activation and translocation tions, NF-κB proteins (p50 and p65) bind with an inhibi- them to the nucleus in macrophages (Kim et al. 2009;Jung tor, namely IκBα, and remain in the cytoplasm in an et al. 2013). Similarly, we also noted the treatment of dif- inactive state. However, when cells exposed to the in- ferent concentrations of SJB-SHE causes to downregulate flammatory stimuli such as LPS, IκBα degrades and the LPS-activated NF-κB activation and translocation. NF-κB translocates to the nucleus and lead to transcrip- MAPKs, the serine-threonine protein kinases, regulate tion of inflammation-related genes (Lund 2010). More- cellular activities by mediating the signal transduction from over, regulation of inflammatory mediators such as cell surface to nucleus to initiate gene expression, mitosis, iNOS, COX2, and pro-inflammatory cytokines is known differentiation, survival, and apoptosis (Salter 2015). A to occur primarily on the transcriptional level, whereby number of studies reported that MAPKs play an important Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 8 of 10 Fig. 5 MAPK pathway-associated protein evaluation in LPS-induced RAW 264.7 macrophages. The inhibitory effect SJB-SHE against LPS-activated MAPK phosphorylation evaluated using Western blot (a) and obtained quantitative data (b). β-actin was used as the internal standard. ImageJ (V 1.4) was used to analyze the band intensities and quantify the data. Results are expressed as the mean ± SD of three separate experiments. *p < 0.05 and **p < 0.01 role during inflammation by activating gene expressions of upregulated phosphorylation levels of ERK1/2 and JNK pro-inflammatory cytokines and chemokines (Akira 2001). were downregulated by SJB-SHE at the tested concentra- According to the previous studies, MAPKs such as ERK1/2 tions (62.5~250 μg/ml). The inhibitory effect of SJB-SHE and JNK are activated by LPS stimulation (Akira 2001). against LPS-activated MAPKs phosphorylation might be Taken together, the inhibition of MAPKs phosphorylation associated with its anti-inflammatory activity. is a feasible approach to treat inflammatory diseases (Li et al. 2018). In order to identify the effect of SJB-SHE on Conclusions MAPK inhibition, the phosphorylation levels of ERK1/2 According to the results, SJB-SHE abate the LPS-acti- and JNK were evaluated using Western blot analysis. In vated NO, PGE , and pro-inflammatory cytokine pro- the present study, we also demonstrated the treatment of duction from RAW 264.7 macrophages. Subsequent LPS (1 μg/ml) causes to upregulate the MAPKs phosphor- studies demonstrated the inhibitory effect of SJB-SHE ylation significantly compared to the control. However, the against LPS-activated NF-κB activation and translocation Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 9 of 10 to the nucleus as well as its inhibitory effect of MAPKs da Silva RPFF, Rocha-Santos TAP, Duarte AC. Supercritical fluid extraction of bioactive compounds. TrAC Trends Anal Chem. 2016;76:40–51. phosphorylation. Taken together, our findings provided a Fleurence J. Seaweed proteins: biochemical, nutritional aspects and potential clear insight into the molecular mechanisms by which uses. Trends Food Sci Technol. 1999;10:25–8. SJB-SHE inhibited the inflammation through suppress- Herath K, Cho J, Kim A, Kim HS, Han EJ, Kim HJ, Kim MS, Ahn G, Jeon YJ, Jee Y. Differential modulation of immune response and cytokine profiles of ing NF-κB and MAPK signaling pathways in RAW 264.7 Sargassum horneri ethanol extract in murine spleen with or without macrophages. Therefore, this study might be useful to Concanavalin A stimulation. Biomed Pharmacother. 2019;110:930–42. develop functional material from S. horneri in the future Hseu YC, Wu FY, Wu JJ, Chen JY, Chang WH, Lu FJ, Lai YC, Yang HL. Anti- inflammatory potential of Antrodia Camphorata through inhibition of iNOS, at a low cost. COX-2 and cytokines via the NF-kappaB pathway. Int Immunopharmacol. 2005;5:1914–25. Abbreviations Huang C, Sun Z, Gao D, Yao J, Hu Z, Li Y, Wang Y, Xu K, Chen W. Molecular DMEM: Dulbecco’s Modified Eagle Medium; ERK: Extracellular signal-related analysis of Sargassum from the northern China seas. Phytotaxa. kinases; FBS: Fetal bovine serum; 2017;319:71–83. JNK: c-jun N-terminal kinases; MAPK: Mitogen-activated protein kinases; Jayawardena TU, Asanka Sanjeewa KK, Shanura Fernando IP, Ryu BM, Kang M-C, MTT: 3-(4,5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; Jee Y, Lee WW, Jeon Y-J. Sargassum horneri (Turner) C. Agardh ethanol NF-κB: Nuclear factor kappa B; SJB-SHE: 70% ethanol extract of S. horneri extract inhibits the fine dust inflammation response via activating Nrf2/HO-1 provided by Seojin Biotech Co. Ltd., Korea signaling in RAW 264.7 cells. BMC Complement Altern Med. 2018;18:249. Jung HA, Jin SE, Ahn BR, Lee CM, Choi JS. Anti-inflammatory activity of edible brown Acknowledgements alga Eisenia bicyclis and its constituents fucosterol and phlorotannins in LPS- The authors wish to thanks National Research Foundation of Korea and the stimulated RAW264.7 macrophages. Food Chem Toxicol. 2013;59:199–206. Ministry of Education to support for this study. Kadam SU, Prabhasankar P. Marine foods as functional ingredients in bakery and pasta products. Food Res Int. 2010;43:1975–80. Funding Kiemer AK, Hartung T, Huber C, Vollmar AM. Phyllanthus amarus has anti-inflammatory The research was supported by the Program of National Research potential by inhibition of iNOS, COX-2, and cytokines via the NF-κB pathway. Foundation of Korea through the Ministry of Education. J Hepatol. 2003;38:289–97. Kim H-S, Sanjeewa KKA, Fernando IPS, Ryu B, Yang H-W, Ahn G, Kang MC, Availability of data and materials Heo S-J, Je J-G, Jeon Y-J. A comparative study of Sargassum horneri Korea All data sets generated and/or analyzed during the current study are and China strains collected along the coast of Jeju Island South Korea: its available from the corresponding author on reasonable request. components and bioactive properties. Algae. 2018;33:341–9. Kim MM, Rajapakse N, Kim SK. Anti-inflammatory effect of Ishige okamurae Authors’ contributions ethanolic extract via inhibition of NF-kappaB transcription factor in RAW 264. KKAS, YJ, and YJJ designed this study, drafted the manuscript, and revised the 7 cells. Phytother Res. 2009;23:628–34. manuscript. KKAS, HSK, SYK, GA, HJK, and TUJ performed the experiments, Kubo N, Douke A, Nishigaki T, Tsuji G. Development and characterization of analyzed the data, and drafted the manuscript. KKAS, YJ, TUJ, SYK, and XF simple sequence repeat markers for genetic analyses of Sargassum horneri conceived the study. All authors read and approved the final manuscript. (Sargassaceae, Phaeophyta) populations in Kyoto, Japan. J Appl Phycol. 2017; 29:1729–33. Ethics approval and consent to participate Li KK, Shen SS, Deng X, Shiu HT, Siu WS, Leung PC, Ko CH, Cheng BH. Not applicable. Dihydrofisetin exerts its anti-inflammatory effects associated with suppressing ERK/p38 MAPK and Heme Oxygenase-1 activation in lipopolysaccharide-stimulated RAW 264.7 macrophages and carrageenan- Consent for publication induced mice paw edema. Int Immunopharmacol. 2018;54:366–74. Not applicable. Lund AK. 6.14 - oxidants and endothelial dysfunction. In: McQueen CA, editor. Comprehensive toxicology (Second Edition). Oxford: Elsevier; 2010. p. 243–74. Competing interests Ma AC, Chen Z, Wang T, Song N, Yan Q, Fang YC, Guan HS, Liu HB. Isolation of The authors declare that they have no competing interests. the molecular species of monogalactosyldiacylglycerols from brown edible seaweed Sargassum horneri and their inhibitory effects on triglyceride Publisher’sNote accumulation in 3T3-L1 adipocytes. J Agric Food Chem. 2014;62:11157–62. Springer Nature remains neutral with regard to jurisdictional claims in Merchant M, Morkotinis V, Hale A, White M, Moran C. Crocodylian nuclear factor published maps and institutional affiliations. kappa B. Comp Biochem Physiol B Biochem Mol Biol. 2017;213:28–34. Mulgund A, Doshi S, Agarwal A. Chapter 25 - the role of oxidative stress in Author details endometriosis. In: Watson RR, editor. Handbook of fertility. San Diego: Department of Marine Life Science, School of Marine Biomedical Sciences, Academic Press; 2015. p. 273–81. Jeju National University, Jeju 63243, Republic of Korea. Department of Food Nomura M, Kamogawa H, Susanto E, Kawagoe C, Yasui H, Saga N, Hosokawa M, Technology and Nutrition, Chonnam National University, Yeosu 59626, Miyashita K. Seasonal variations of total lipids, fatty acid composition, and Republic of Korea. Seojin Biotech Co. Ltd, Acedongbaek Tower, 1-501∼504, fucoxanthin contents of Sargassum horneri (Turner) and Cystoseira hakodatensis 16-4, Dongbaekjungang-ro, 16 beon-gil, Gieung-gu, Yongin-si, Gyeonggi-do (Yendo) from the northern seashore of Japan. J Appl Phycol. 2012;25:1159–69. 17015, Republic of Korea. College of Food Science and Engineering, Ocean Pugh TJ, Sartor CI, O’Neil B, Raben D. Chapter 5 - biologics and their interactions University of China, Qingdao 266003, Shandong, China. Department of with radiation. In: Gunderson LL, Tepper JE, editors. Clinical radiation Veterinary Medicine and Veterinary Medical Research Institute, Jeju National oncology (Third Edition). Philadelphia: W.B. Saunders; 2012. p. 83–94. University, Jeju 63243, Republic of Korea. Salter DM. 8 - Connective tissue responses to mechanical stress. In: Hochberg MC, Silman AJ, Smolen JS, Weinblatt ME, Weisman MH, editors. Rheumatology Received: 18 January 2019 Accepted: 6 February 2019 (sixth edition). Philadelphia: Content Repository Only! 2015. p. 61–4. Sanjeewa KKA, Fernando IPS, Kim EA, Ahn G, Jee Y, Jeon YJ. Anti-inflammatory activity of a sulfated polysaccharide isolated from an enzymatic digest of brown References seaweed Sargassum horneri in RAW 264.7 cells. Nutr Res Pract. 2017;11:3–10. Akira S. Toll-like receptors and innate immunity. In: Dixon FJ, editor. Advances in Surh Y-J, Chun K-S, Cha H-H, Han SS, Keum Y-S, Park K-K, Lee SS. Molecular immunology, vol 78. United States: Academic Press; 2001. p. 1–56. ISSN 0065- mechanisms underlying chemopreventive activities of anti-inflammatory 2776, ISBN 9780120224784, https://doi.org/10.1016/S0065-2776(01)78001-7, phytochemicals: down-regulation of COX-2 and iNOS through suppression of (http://www.sciencedirect.com/science/article/pii/S0065277601780017). NF-κB activation. Mutat Res Fundam Mol Mech Mutagen. 2001;480-481:243–68. Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 10 of 10 Wijesinghe W, Jeon Y-J. Biological activities and potential cosmeceutical applications of bioactive components from brown seaweeds: a review. Phytochem Rev. 2011;10:431–43. Xie X, Wang G, Pan G, Sun J, Li J. Development of oogonia of Sargassum horneri (Fucales, Heterokontophyta) and concomitant variations in PSII photosynthetic activities. Phycologia. 2014;53:10–4. Zielinski MR, Krueger JM. Chapter 48 - inflammation and sleep. In: Barkoukis TJ, Matheson JK, Ferber R, Doghramji K, editors. Therapy in sleep medicine. Philadelphia: W.B. Saunders; 2012. p. 607–16. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Fisheries and Aquatic Sciences Springer Journals

Ethanol extract separated from Sargassum horneri (Turner) abate LPS-induced inflammation in RAW 264.7 macrophages

Download PDF
10 pages

Loading next page...
 
/lp/springer-journals/ethanol-extract-separated-from-sargassum-horneri-turner-abate-lps-oXDugoWQAw

References (39)

Publisher
Springer Journals
Copyright
Copyright © 2019 by The Author(s)
Subject
Life Sciences; Fish & Wildlife Biology & Management; Marine & Freshwater Sciences; Zoology; Animal Ecology
eISSN
2234-1757
DOI
10.1186/s41240-019-0121-8
Publisher site
See Article on Publisher Site

Abstract

Background: This study is aimed at identifying the anti-inflammatory properties of 70% ethanol extract produced from an edible brown seaweed Sargassum horneri (SJB-SHE) with industrial-scale production by Seojin Biotech Co. Ltd. S. horneri is a rich source of nutrient and abundantly growing along the shores of Jeju, South Korea. Methods: Here, we investigated the effect of SJB-SHE on LPS-activated RAW 264.7 macrophages. The cytotoxicity and NO production of SJB-SHE were evaluated using MTT and Griess assays, respectively. Additionally, protein expression and gene expression levels were quantified using ELISA, Western blots, and RT-qPCR. Results: Our results indicated that pre-treatment of RAW 264.7 macrophages with SJB-SHE significantly inhibited LPS-induced NO and PGE production. SJB-SHE downregulated the proteins and genes expression of LPS-induced iNOS and COX2. Additionally, SJB-SHE downregulated LPS-induced production of pro-inflammatory cytokines (tumor necrosis factor-α, interleukin (IL)-6, and IL-1β). Furthermore, SJB-SHE inhibited nuclear factor kappa-B (NF-κB) activation and translocation to the nucleus. SJB-SHE also suppressed the phosphorylation of mitogen-activated protein kinases (ERK1/2 and JNK). Conclusions: Collectively, our results demonstrated that SJB-SHE has a potential anti-inflammatory property to use as a functional food ingredient in the future. Keywords: Sargassum horneri, Ethanol extract, RAW 264.7 macrophages, Anti-inflammation, NF-κB, MAPKs Background and RelA; p65) then binds to promoter regions re- Nuclear factor kappa B (NF-κB) is a protein complex, in- sponsible for the transcription of genes that encode volved in the transcription of number of genes related to for pro-inflammatory cytokines, chemokines, and the production of pro-inflammatory cytokines and has other proteins related to the production of proteins also been demonstrated to play central role in the such as iNOS and COX2 (Pugh et al. 2012). There- LPS-induced expression of iNOS and cyclooxygenase-2 fore, it has been suggested that inhibition of NF-κB (COX2) from different cells (Merchant et al. 2017; activity including activation and translocation might Mulgund et al. 2015). Under the normal conditions, help to reduce inflammation related complications. NF-κB exists in the cytoplasm as an inactive dimer protein Sargassum horneri (Sargassaceae, Fucales, Phaeophyta) complex. However, upon the activation, NF-κB proteins is an edible brown seaweed, abundant worldwide in shal- undergo the phosphorylation and translocation to the low sea-water ecosystems (Herath et al. 2019; Kim et al. nucleus. The translocated NF-κB heterodimers (p50 2018). The thallus of S. horneri is large, macroscopic, and brown-colored, and its stem is cylindrical, erect, and * Correspondence: yhjee@jejunu.ac.kr; youjinj@jejunu.ac.kr flat. Young seaweeds resemble ferns, with opposite Department of Veterinary Medicine and Veterinary Medical Research leaf-like blades, extending from a central axis. The Institute, Jeju National University, Jeju 63243, Republic of Korea blades have broad, deeply incised, and ragged tips. As Department of Marine Life Science, School of Marine Biomedical Sciences, Jeju National University, Jeju 63243, Republic of Korea Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 2 of 10 the plant grows, it becomes a single frond, loosely Preparation of the ethanol extracts from S. horneri and branched, in a zig-zag pattern (Huang et al. 2017; Xie et composition analysis al. 2014). Once it matures, the blades become narrower Seventy percent ethanol extract of S. horneri collected and the branches develop small, ellipsoidal air bladders along the shores of Jeju Island were kindly prepared and and larger spindle-shaped reproductive receptacles, both provided by Seojin Biotech Co. Ltd., Korea (lot number on stalks (Kubo et al. 2017). Apart from the ecological SJFC70180625) (SJB-SHE). Briefly, the air-dried (50 °C) importance, S. horneri is popular as a nutrient-rich ed- seaweed samples were ground and passed through a ible seaweed in the East Asian countries. Side dishes or 40–50 mesh by Pin-mill. Then, 100 g of powdered S. soup prepared by mixing S. horneri thallus with meat or horneri was extracted with 70% ethanol solution at fish are popular in the countries located in the East Asia 65–80 °C for 12 h. Then, the extractants were concen- region. In Japan, S. horneri is known as “akamoku” and trated and freeze-dried to obtain 70% ethanolic extract of is harvested at the maturation stage for eating in regions S. horneri. Then, the resulted powder again dissolved in along the East Sea (Nomura et al. 2012; Ma et al. 2014). the 100% ethanol solution for 2 h with cellulose and then To select one of the extraction methods to prepare ex- centrifuged at 12,000 rpm in room temperature to remove tracts containing bioactive compounds from seaweeds is remaining residues and heavy metals. The supernatant an important step which has a great impact on the re- was concentrated and treated with 95% EtOH to increase search outcomes. However, the selection of the suitable purity (Herath et al. 2019). The resultant powder extraction method depends on the target compounds (SJB-SHE) was used to the consequent studies mentioned and its applications (da Silva et al. 2016). The industrial in this study. Details procedures of sample preparation, level applications such as functional foods and nutraceu- composition analysis, and composition data of SJB-SHE ticals require large amount of active substrates at low were similar to Herath et al. (2019). production cost (Fleurence 1999). However, isolation of active compounds for industrial level applications from Cell culture and cell viability assay seaweeds is limited due to the time-consuming opera- RAW 264.7 murine macrophages were purchased from tions and availability of skilled labors for isolation pro- the American Type Culture Collection, Manassas, VA, cesses. Thus, crude extracts from seaweeds as an active USA. The macrophages were maintained at 37 °C, 5% CO ingredient are more popular over the pure compounds in DMEM media supplemented with 10% heat-inactivated industries like functional foods (Kadam and Prabhasan- FBS, and 1% antibiotics. The cells were sub-cultured within kar 2010). Taken together, in the present study, 48 h intervals. The LDH activity in the culture mediums anti-inflammatory properties of the ethanolic extract ob- was assessed using LDH cytotoxicity detection kit tained from S. horneri, with industrial-scale production (Promega, Madison, WI, USA) by following the vendor’s by the company, Seojin Biotech, were evaluated on instructions. The effect of SJB-SHE on cell viability was LPS-activated RAW 264.7 macrophages. examined by colorimetric MTT assay similar to the previously described method (Jayawardena et al. 2018). The LDH release and cell viability were calculated as Material and methods shown below using plate reader at 490 nm and 540 nm Regents and antibodies respectively. All reagents used this study were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless stated other- Determination of NO, PGE , and cytokine production wise. Enzyme-linked immunosorbent assay (ELISA) kits (TNF-α, IL-1β, and IL-6) for mouse IL-1β, IL-6, and TNF-α were purchased from RAW 264.7 macrophages were incubated with various R&D Systems (Minneapolis, MN, USA). Antibodies concentration of SJB-SHE (62.5~250 μg/ml) and LPS against iNOS, COX2, p50, p-p50, p65, p-p65, β-actin, (1 μg/ml) for 24 h. The NO production in the culture nucleolin, ERK 1/2, p-ERK 1/2, JNK, and p-JNK were medium was quantified by Griess reagent as following a purchased from cell signaling Technology (Beverly, MA, previously established method (Jayawardena et al. 2018). USA). Prime Script™ first-strand cDNA synthesis kit for The level of PGE , TNF-α, IL-1β, and IL-6 in culture su- cDNA synthesis and ExTaq™ SYBR premix were pur- pernatants were evaluated using ELISA kit according to chased from TaKaRa, Japan. Dulbecco’s Modified Eagle the manufacturer’s instructions. Medium (DMEM), fetal bovine serum (FBS), and penicillin-streptomycin (10,000 U/ml) were purchased Western blot analysis from Life Technologies Corporation, Grand Island, NY, Whole-cell protein lysates and nucleus proteins were USA. The primers for amplification against iNOS, extracted using NE-PER® Nuclear and Cytoplasmic COX2, IL-1β, IL-6, and TNF-α were purchased from Extraction Kit (Thermo Scientific, Rockford, USA) fol- Bioneer, Seoul, South Korea. lowing a method described by Sanjeewa et al. (2017). Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 3 of 10 Equal amounts (40 μg) of protein were electrophoresed carbohydrate (39.99 ± 0.54%), and proteins (16.84 ± 0.74%). in 12% SDS-PAGE. After blocking with 05% non-fat Additionally, SJB-SHE contains considerable amounts of milk for 60 min, the blots were separately incubated ash (28.39 ± 0.51%) and moisture (14.68 ± 0.21). The fla- with the following primary antibodies: rabbit polyclonal vonoid and lipid contents observed in the SJB-SHE are less antibodies including iNOS, ERK1/2 (extracellular than 1%. signal-regulated kinase), p-ERK1/2, JNK, p-JNK, NF-κB p65, NF-κB p50, c-23, COX2, and β-actin (Cell Signaling Effect of SJB-SHE on cell viability and LPS-induced NO Technology, Beverly, MA, USA) overnight. The blots were and PGE production washed twice with Tween 20/Tris-buffered saline (TTBS) A range of concentrations (31.2~2000 μg/ml) was pre- and then incubated with HRP-conjugated anti-rabbit IgG pared from SJB-SHE to determine the safe concentrations for 30 min. Antibody binding was visualized by using an to treat RAW 264.7 macrophages. As shown in Fig. 1a enhanced chemiluminescent substrate (Cyanagen Srl, Bol- and b, the concentrations between 31.2~250 μg/ml did ogna, Italy). The basal level of each protein was normal- not express any cytotoxic effect towards the RAW 264.7 ized by analyzing the level of β-actin or c-23. Membranes macrophages. Therefore, as the next part of the study, the were photographed using a FUSION SOLO Vilber Lour- protective effect of SJB-SHE was evaluated against mat system. The intensities of bands were quantified using LPS-induced toxicity and NO production in RAW 264.7 the ImageJ (version 1.4) program (Sanjeewa et al. 2017). macrophages. According to the results, the treatment of LPS significantly increased the cell death rates and NO production. However, the treatment of SJB-SHE signifi- RNA extraction and quantitative reverse cantly and dose-dependently reduced the LPS-induced transcription-polymerase chain reaction (qRT-PCR) toxicity (Fig. 1c) and NO production (Fig. 1d). In addition Total RNA was isolated with Trizol reagent according to to NO, PGE was also identified as an inflammatory medi- the manufacturer’s instruction. Total RNA (1 μg) was ator produced by the macrophages which leads to the acti- reverse-transcribed to produce cDNA using a first-strand vation of inflammatory reactions. In the present study, cDNA Synthesis Kit according to the manufacturer’s thus, the levels of PGE in the culture supernatants were instructions. The target cDNA was amplified using the quantified by using the ELISA kit (Fig. 2a). The level of primers as provided in Table 1. All relative gene expres- PGE was significantly increased with the treatment of LPS. sion quantifications were normalized to GAPDH as an in- However, SJB-SHE dose-dependently reduced the LPS-in- ternal control. duced PGE production in the activated macrophages. Statistical analysis All the results are expressed as the mean values with the Protective effect of SJB-SHE against LPS-induced standard deviation of three independent repetitions. pro-inflammatory cytokine production Statistical significance was determined using t test and To evaluate the pro-inflammatory cytokine inhibitory ef- one-way or two-way analysis of variance (ANOVA) fect of SJB-SHE (TNF-α,IL-1β, and IL-6), macrophages followed by Dunnett’s post hoc test using IBM® SPSS® were incubated with SJB-SHE (62.5, 125, and 250 μg/ml) in statistics (Version 20) software. Significant differences the presence or absence of LPS (1 μg/ml) for 24 h, and the were assigned to P values < 0.05 and < 0.01 denoted by * pro-inflammatory cytokine levels in the culture superna- or # and ** or ## respectively. tants were measured by ELISA. It was noted that the treat- ment of SJB-SHE dose-dependently inhibited the LPS-activated TNF-α (Fig. 2b), IL-1β (Fig. 2c), and IL-6 Results (Fig. 2d) secretion from macrophages. Specifically, the Proximate composition of seaweed extract (SJB-SHE) treatment of SJB-SHE strongly suppressed the IL-1β pro- According to the chemical composition results, SJB-SHE duction from LPS-activated macrophages, and at the is mainly composed of polyphenols (15.30 ± 0.01%), 250 μg/ml concentration, SJB-SHE inhibited more than Table 1 Sequence of the primers used in this study 90% IL-1β compared to the LPS-treated group. Gene Primer Sequence from 5′→ 3′ GAPDH Sense AAGGGTCATCATCTCTGCCC SJB-SHE attenuate LPS-induced iNOS and COX2 secretion Antisense GTGATGGCATGGACTGTGGT- from LPS-activated macrophages To identify the mechanism how SJB-SHE reduces iNOS Sense ATGTCCGAAGCAAACATCAC LPS-activated NO and PGE production, the inhibitory Antisense TAATGTCCAGGAAGTAGGTG effect of SJB-SHE (62.5, 125, and 250 μg/ml) against COX2 Sense CAGCAAATCCTTGCTGTTCC LPS-activated iNOS and COX2 protein and its gene Antisense TGGGCAAAGAATGCAAACATC expression (Fig. 3) were evaluated. Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 4 of 10 ac bd Fig. 1 LDH release (a) and cytotoxicity (b) of SJB-SHE in RAW 264.7 macrophages. Cytoprotective (c) and NO inhibitory (d) effect of SJB-SHE in LPS-exposed RAW 264.7 macrophages. The cells were seeded in 24-well plates (1 × 10 ) and kept for 24 h to attach to the well bottoms. Then, SJB-SHE (62.5~250 μg/ml) introduced to each well and incubate for another 1 h and stimulated using LPS (1 μg/ml). After 24 h, cells and culture supernatants were used to determine viability (MTT) and NO production, respectively. Experiments were triplicated to evaluate the data, and the mean value is expressed as ± SD. *p < 0.05, **p < 0.01 As shown in Fig. 3a, the Western blot analysis was SJB-SHE attenuate LPS-induced NF-κB activation and performed to evaluate the effect of SJB-SHE on translocation COX2 and iNOS protein production. According to To investigate whether SJB-SHE (62.5~250 μg/ml) could the results, the LPS-treated macrophages (1 μg/ml) affect activation and nuclear translocation of NF-κB, had elevated levels of COX2 and iNOS (Fig. 3aand Western blot analysis for NF-κB p65, NF-κB p50, and Fig. 3b) protein production compared to the un- their phosphorylated forms was carried out with cyto- treated control. However, with the treatment of SJB- solic and nuclear extracts of LPS-stimulated RAW 264.7 SHE, the elevated levels of COX2 (Fig. 3c) and iNOS macrophages (Fig. 4). The relative expression of phos- (Fig. 3d) were significantly reduced. In addition to the phorylated forms, NF-κB p50 and p65, in the cytosol Western blot analysis, the effect of SJB-SHE on the were markedly increased upon the exposure of LPS. expression of iNOS and COX2 mRNA level was However, SJB-SHE inhibited LPS-mediated NF-κB phos- quantified using RT-qPCR analysis. According to the phorylation in the cytosol (Fig. 4a and Fig. 4b). Addition- results, mRNA expression levels of COX2 and iNOS ally, to determine whether SJB-SHE was associated with were similar to the Western blot results. These results the nucleus translocation of NF-κB, the levels of p50 strongly suggest the potential of SJB-SHE to more and p65 in the nucleus were examined. According to the suppress COX2 than iNOS. results, LPS was demonstrated to upregulate the Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 5 of 10 ac bd Fig. 2 Inhibitory effect of SJB-SHE on the PGE (a) and pro-inflammatory cytokines including TNF-α (b) IL-1β (c), and IL-6 (d) production in LPS- induced RAW 264.7 macrophages. Experiments were conducted using ELISA. SJB-SHE- (62.5~250 μg/ml) and LPS (1 μg/ml) treated cell supernatants were collected to quantify the inflammatory cytokines and PGE . Experiments were triplicated to evaluate the data, and the mean value is expressed as ± SD. * p < 0.05 and **p < 0.01 translocation of p50 and p65 from the cytosol to the nu- 250 μg/ml) treatments sufficiently reduced the phos- cleus after 30 min of LPS stimulation (Fig. 4c), and phorylation of ERK1/2 and JNK in LPS-activated SJB-SHE remarkably downregulated them (Fig. 4d). macrophages. These results suggest that the treatment of SJB-SHE has a potential to inhibit the LPS-induced NF-κB activation Discussion and translocation to the nucleus. In the present study, we demonstrated the anti-inflamma- tory potential of 70% ethanol extract obtained from S. hor- SJB-SHE inhibit LPS-induced MAPK phosphorylation neri against LPS-activated macrophages. The extraction In an attempt to identify whether or not the inhibition procedure was carried out in commercial scale by Seojin of inflammatory responses demonstrated by SJB-SHE is Biotech Co. Ltd., Korea. According to the results, mediated via the mitogen-activated protein kinases SJB-SHE (62.5~250 μg/ml) inhibited the LPS-induced (MAPK) pathway, the inhibitory effects of SJB-SHE (1 μg/ml) NO, PGE , and pro-inflammatory cytokine pro- were observed on LPS-induced phosphorylation of duction via blocking the activation and translocation of growth factor-regulated extracellular signal-related kinases NF-κB proteins as well as inhibiting the MAPKs (ERK)1/2 and c-jun N-terminal kinases (JNK) proteins in phosphorylation. RAW 264.7 macrophages via Western blotting. As A large number of phlorotannin substances, particu- presented in Fig. 5, LPS (1 μg/ml) significantly upregulated larly those present in brown seaweeds, have been re- the phosphorylation of ERK1/2 and JNK in RAW ported to possess a number of bioactive properties 264.7 macrophages. However, SJB-SHE (62.5, 125, and including anti-inflammation, antioxidant, and anticancer Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 6 of 10 ac bd Fig. 3 Inhibitory effects of SJB-SHE on LPS-induced inflammation-associated protein in RAW 264.7 macrophages. Western blots used to determine iNOS and COX2 levels (a), the related expression of the bands were analyzed using ImageJ software (b). β-actin was used as internal control. −ΔΔCt Results are expressed as the mean ± SD of three separate experiments. The gene expression analysis of iNOS (c) and COX2 (d). The 2 method was used to calculate the relative mRNA levels. Internal reference used in the experiment was GAPDH. Experiments were triplicated. mRNA significance relative to the non-treated control was calculated using the Mann-Whitney U test. *p < 0.05 and **p < 0.01 (Wijesinghe and Jeon 2011). However, the use of pure evaluate iNOS and COX2 inhibitory effect of SJB-SHE compounds for functional foods and other applications using LPS-activated RAW 264.7 macrophages. According in large quantities are not cost-effective and require to the results, treatments of SJB-SHE cause to downregu- time-consuming operations to isolate bio-active natural late iNOS and COX2 levels observed in LPS-activated substances. Therefore, in the present study, we at- macrophage cells (protein and mRNA). This result sug- tempted to evaluate anti-inflammatory mechanisms of a gests that SJB-SHE has a potential to inhibit NO and PGE commercial scale extract of S. horneri (SJB-SHE) using via downregulating iNOS and COX2 expression in LPS-activated RAW 264.7 macrophages. COX2 and LPS-activated RAW 264.7 macrophages. iNOS are important inflammatory mediators which are re- The initiation and development of the inflammation sponsible for initiating inflammation in cellular environ- process involve a series of pro-inflammatory cytokines. ments. NO and PGE are produced by two different LPS is a well-known immune stimulant used to activate proteins namely iNOS and COX2, respectively (Hseu et al. macrophage and production of cytokine is a major re- 2005). It has been reported that uncontrolled/irregular sponse. Based on the previous studies, the inhibition of upregulated production of iNOS and COX2 has been asso- pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) ciated with the pathophysiology of cancers and inflamma- provide solid insights to develop functional products tory disorders (Surh et al. 2001). Thus, the extracts capable against inflammatory responses (Li et al. 2018). to inhibit iNOS and COX2 might have the potential to re- According to the results we noted, the treatment of duce inflammatory responses and act as functional mate- SJB-SHE has a potential to inhibit LPS-activated inflam- rials. Therefore, in the present study, we attempted to mation in RAW 264.7 macrophages by suppressing Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 7 of 10 a c b d Fig. 4 Evaluation of SJB-SHE potential to inhibit the NF-κB pathway-associated proteins in LPS stimulated RAW 264.7 macrophages. Cytosolic NF-κB p50 and p65 phosphorylation levels (a); the intensity of protein expressions were quantified using ImageJ (b). Nuclear translocation levels of NF-κB p50 and p65 (c) and the intensity of NF-κB protein expressions in the nucleus (d). β-actin (cytosolic) and C-23 (nucleus) were used as internal controls. Results are expressed as the mean ± SD of three separate experiments. *p < 0.05 and **p < 0.01 cytokine secretion. In addition to this study, Sanjeewa et activate the levels of transcription factor NF-κB (Kiemer al. (2017) reported that the crude polysaccharide sepa- et al. 2003). Other than iNOS and COX2, Zielinski and rated from S. horneri has a potential to inhibit Krueger (2012) reported the activation of NF-κB also LPS-activated pro-inflammatory cytokine secretion from causes to activate pro-inflammatory cytokine (IL-1β and RAW 264.7 macrophages. TNF-α) expression and inhibits anti-inflammatory NF-κB comprises a family (Rel) of transcriptional fac- cytokines (IL-4 and IL-10) (Zielinski and Krueger 2012). tors, upon activation form heterodimers and homodi- Previously, a number of studies reported that organic ex- mers, binds to target DNA promoter sequences, and tracts obtained from brown seaweeds have the potential to then triggers gene expression. Under the normal condi- inhibit LPS-induced NF-κB activation and translocation tions, NF-κB proteins (p50 and p65) bind with an inhibi- them to the nucleus in macrophages (Kim et al. 2009;Jung tor, namely IκBα, and remain in the cytoplasm in an et al. 2013). Similarly, we also noted the treatment of dif- inactive state. However, when cells exposed to the in- ferent concentrations of SJB-SHE causes to downregulate flammatory stimuli such as LPS, IκBα degrades and the LPS-activated NF-κB activation and translocation. NF-κB translocates to the nucleus and lead to transcrip- MAPKs, the serine-threonine protein kinases, regulate tion of inflammation-related genes (Lund 2010). More- cellular activities by mediating the signal transduction from over, regulation of inflammatory mediators such as cell surface to nucleus to initiate gene expression, mitosis, iNOS, COX2, and pro-inflammatory cytokines is known differentiation, survival, and apoptosis (Salter 2015). A to occur primarily on the transcriptional level, whereby number of studies reported that MAPKs play an important Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 8 of 10 Fig. 5 MAPK pathway-associated protein evaluation in LPS-induced RAW 264.7 macrophages. The inhibitory effect SJB-SHE against LPS-activated MAPK phosphorylation evaluated using Western blot (a) and obtained quantitative data (b). β-actin was used as the internal standard. ImageJ (V 1.4) was used to analyze the band intensities and quantify the data. Results are expressed as the mean ± SD of three separate experiments. *p < 0.05 and **p < 0.01 role during inflammation by activating gene expressions of upregulated phosphorylation levels of ERK1/2 and JNK pro-inflammatory cytokines and chemokines (Akira 2001). were downregulated by SJB-SHE at the tested concentra- According to the previous studies, MAPKs such as ERK1/2 tions (62.5~250 μg/ml). The inhibitory effect of SJB-SHE and JNK are activated by LPS stimulation (Akira 2001). against LPS-activated MAPKs phosphorylation might be Taken together, the inhibition of MAPKs phosphorylation associated with its anti-inflammatory activity. is a feasible approach to treat inflammatory diseases (Li et al. 2018). In order to identify the effect of SJB-SHE on Conclusions MAPK inhibition, the phosphorylation levels of ERK1/2 According to the results, SJB-SHE abate the LPS-acti- and JNK were evaluated using Western blot analysis. In vated NO, PGE , and pro-inflammatory cytokine pro- the present study, we also demonstrated the treatment of duction from RAW 264.7 macrophages. Subsequent LPS (1 μg/ml) causes to upregulate the MAPKs phosphor- studies demonstrated the inhibitory effect of SJB-SHE ylation significantly compared to the control. However, the against LPS-activated NF-κB activation and translocation Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 9 of 10 to the nucleus as well as its inhibitory effect of MAPKs da Silva RPFF, Rocha-Santos TAP, Duarte AC. Supercritical fluid extraction of bioactive compounds. TrAC Trends Anal Chem. 2016;76:40–51. phosphorylation. Taken together, our findings provided a Fleurence J. Seaweed proteins: biochemical, nutritional aspects and potential clear insight into the molecular mechanisms by which uses. Trends Food Sci Technol. 1999;10:25–8. SJB-SHE inhibited the inflammation through suppress- Herath K, Cho J, Kim A, Kim HS, Han EJ, Kim HJ, Kim MS, Ahn G, Jeon YJ, Jee Y. Differential modulation of immune response and cytokine profiles of ing NF-κB and MAPK signaling pathways in RAW 264.7 Sargassum horneri ethanol extract in murine spleen with or without macrophages. Therefore, this study might be useful to Concanavalin A stimulation. Biomed Pharmacother. 2019;110:930–42. develop functional material from S. horneri in the future Hseu YC, Wu FY, Wu JJ, Chen JY, Chang WH, Lu FJ, Lai YC, Yang HL. Anti- inflammatory potential of Antrodia Camphorata through inhibition of iNOS, at a low cost. COX-2 and cytokines via the NF-kappaB pathway. Int Immunopharmacol. 2005;5:1914–25. Abbreviations Huang C, Sun Z, Gao D, Yao J, Hu Z, Li Y, Wang Y, Xu K, Chen W. Molecular DMEM: Dulbecco’s Modified Eagle Medium; ERK: Extracellular signal-related analysis of Sargassum from the northern China seas. Phytotaxa. kinases; FBS: Fetal bovine serum; 2017;319:71–83. JNK: c-jun N-terminal kinases; MAPK: Mitogen-activated protein kinases; Jayawardena TU, Asanka Sanjeewa KK, Shanura Fernando IP, Ryu BM, Kang M-C, MTT: 3-(4,5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; Jee Y, Lee WW, Jeon Y-J. Sargassum horneri (Turner) C. Agardh ethanol NF-κB: Nuclear factor kappa B; SJB-SHE: 70% ethanol extract of S. horneri extract inhibits the fine dust inflammation response via activating Nrf2/HO-1 provided by Seojin Biotech Co. Ltd., Korea signaling in RAW 264.7 cells. BMC Complement Altern Med. 2018;18:249. Jung HA, Jin SE, Ahn BR, Lee CM, Choi JS. Anti-inflammatory activity of edible brown Acknowledgements alga Eisenia bicyclis and its constituents fucosterol and phlorotannins in LPS- The authors wish to thanks National Research Foundation of Korea and the stimulated RAW264.7 macrophages. Food Chem Toxicol. 2013;59:199–206. Ministry of Education to support for this study. Kadam SU, Prabhasankar P. Marine foods as functional ingredients in bakery and pasta products. Food Res Int. 2010;43:1975–80. Funding Kiemer AK, Hartung T, Huber C, Vollmar AM. Phyllanthus amarus has anti-inflammatory The research was supported by the Program of National Research potential by inhibition of iNOS, COX-2, and cytokines via the NF-κB pathway. Foundation of Korea through the Ministry of Education. J Hepatol. 2003;38:289–97. Kim H-S, Sanjeewa KKA, Fernando IPS, Ryu B, Yang H-W, Ahn G, Kang MC, Availability of data and materials Heo S-J, Je J-G, Jeon Y-J. A comparative study of Sargassum horneri Korea All data sets generated and/or analyzed during the current study are and China strains collected along the coast of Jeju Island South Korea: its available from the corresponding author on reasonable request. components and bioactive properties. Algae. 2018;33:341–9. Kim MM, Rajapakse N, Kim SK. Anti-inflammatory effect of Ishige okamurae Authors’ contributions ethanolic extract via inhibition of NF-kappaB transcription factor in RAW 264. KKAS, YJ, and YJJ designed this study, drafted the manuscript, and revised the 7 cells. Phytother Res. 2009;23:628–34. manuscript. KKAS, HSK, SYK, GA, HJK, and TUJ performed the experiments, Kubo N, Douke A, Nishigaki T, Tsuji G. Development and characterization of analyzed the data, and drafted the manuscript. KKAS, YJ, TUJ, SYK, and XF simple sequence repeat markers for genetic analyses of Sargassum horneri conceived the study. All authors read and approved the final manuscript. (Sargassaceae, Phaeophyta) populations in Kyoto, Japan. J Appl Phycol. 2017; 29:1729–33. Ethics approval and consent to participate Li KK, Shen SS, Deng X, Shiu HT, Siu WS, Leung PC, Ko CH, Cheng BH. Not applicable. Dihydrofisetin exerts its anti-inflammatory effects associated with suppressing ERK/p38 MAPK and Heme Oxygenase-1 activation in lipopolysaccharide-stimulated RAW 264.7 macrophages and carrageenan- Consent for publication induced mice paw edema. Int Immunopharmacol. 2018;54:366–74. Not applicable. Lund AK. 6.14 - oxidants and endothelial dysfunction. In: McQueen CA, editor. Comprehensive toxicology (Second Edition). Oxford: Elsevier; 2010. p. 243–74. Competing interests Ma AC, Chen Z, Wang T, Song N, Yan Q, Fang YC, Guan HS, Liu HB. Isolation of The authors declare that they have no competing interests. the molecular species of monogalactosyldiacylglycerols from brown edible seaweed Sargassum horneri and their inhibitory effects on triglyceride Publisher’sNote accumulation in 3T3-L1 adipocytes. J Agric Food Chem. 2014;62:11157–62. Springer Nature remains neutral with regard to jurisdictional claims in Merchant M, Morkotinis V, Hale A, White M, Moran C. Crocodylian nuclear factor published maps and institutional affiliations. kappa B. Comp Biochem Physiol B Biochem Mol Biol. 2017;213:28–34. Mulgund A, Doshi S, Agarwal A. Chapter 25 - the role of oxidative stress in Author details endometriosis. In: Watson RR, editor. Handbook of fertility. San Diego: Department of Marine Life Science, School of Marine Biomedical Sciences, Academic Press; 2015. p. 273–81. Jeju National University, Jeju 63243, Republic of Korea. Department of Food Nomura M, Kamogawa H, Susanto E, Kawagoe C, Yasui H, Saga N, Hosokawa M, Technology and Nutrition, Chonnam National University, Yeosu 59626, Miyashita K. Seasonal variations of total lipids, fatty acid composition, and Republic of Korea. Seojin Biotech Co. Ltd, Acedongbaek Tower, 1-501∼504, fucoxanthin contents of Sargassum horneri (Turner) and Cystoseira hakodatensis 16-4, Dongbaekjungang-ro, 16 beon-gil, Gieung-gu, Yongin-si, Gyeonggi-do (Yendo) from the northern seashore of Japan. J Appl Phycol. 2012;25:1159–69. 17015, Republic of Korea. College of Food Science and Engineering, Ocean Pugh TJ, Sartor CI, O’Neil B, Raben D. Chapter 5 - biologics and their interactions University of China, Qingdao 266003, Shandong, China. Department of with radiation. In: Gunderson LL, Tepper JE, editors. Clinical radiation Veterinary Medicine and Veterinary Medical Research Institute, Jeju National oncology (Third Edition). Philadelphia: W.B. Saunders; 2012. p. 83–94. University, Jeju 63243, Republic of Korea. Salter DM. 8 - Connective tissue responses to mechanical stress. In: Hochberg MC, Silman AJ, Smolen JS, Weinblatt ME, Weisman MH, editors. Rheumatology Received: 18 January 2019 Accepted: 6 February 2019 (sixth edition). Philadelphia: Content Repository Only! 2015. p. 61–4. Sanjeewa KKA, Fernando IPS, Kim EA, Ahn G, Jee Y, Jeon YJ. Anti-inflammatory activity of a sulfated polysaccharide isolated from an enzymatic digest of brown References seaweed Sargassum horneri in RAW 264.7 cells. Nutr Res Pract. 2017;11:3–10. Akira S. Toll-like receptors and innate immunity. In: Dixon FJ, editor. Advances in Surh Y-J, Chun K-S, Cha H-H, Han SS, Keum Y-S, Park K-K, Lee SS. Molecular immunology, vol 78. United States: Academic Press; 2001. p. 1–56. ISSN 0065- mechanisms underlying chemopreventive activities of anti-inflammatory 2776, ISBN 9780120224784, https://doi.org/10.1016/S0065-2776(01)78001-7, phytochemicals: down-regulation of COX-2 and iNOS through suppression of (http://www.sciencedirect.com/science/article/pii/S0065277601780017). NF-κB activation. Mutat Res Fundam Mol Mech Mutagen. 2001;480-481:243–68. Sanjeewa et al. Fisheries and Aquatic Sciences (2019) 22:6 Page 10 of 10 Wijesinghe W, Jeon Y-J. Biological activities and potential cosmeceutical applications of bioactive components from brown seaweeds: a review. Phytochem Rev. 2011;10:431–43. Xie X, Wang G, Pan G, Sun J, Li J. Development of oogonia of Sargassum horneri (Fucales, Heterokontophyta) and concomitant variations in PSII photosynthetic activities. Phycologia. 2014;53:10–4. Zielinski MR, Krueger JM. Chapter 48 - inflammation and sleep. In: Barkoukis TJ, Matheson JK, Ferber R, Doghramji K, editors. Therapy in sleep medicine. Philadelphia: W.B. Saunders; 2012. p. 607–16.

Journal

Fisheries and Aquatic Sciences – Springer Journals

Published: Feb 27, 2019

There are no references for this article.