Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Establishment and long-term culture of the cell lines derived from gonad tissues of Siberian sturgeon (Acipenser baerii)

Establishment and long-term culture of the cell lines derived from gonad tissues of Siberian... To culture germline stem cells in vitro, establishment of the cell lines that can be used as the feeder cells is a prerequisite. In this study, we tried to establish gonad-derived cell lines in Siberian sturgeon (Acipenser baerii). Five 1-year-old A. baerii were used as a donor of gonad tissues, and gonad-dissociated cells were cultured in vitro. Subsequently, determination of growth conditions, long-term culture, characterization, and cryopreservation of the cell lines were also conducted. Five gonad-derived cell lines were stably established and cultured continuously over at least the 73th passage and 402 culture days under the media containing 20 % fetal bovine serum at 28 °C. All cell lines consisted of two main cell types based on morphology even if the ratio of the two cell types was different depending on cell lines. Despite long-term culture, all cell lines maintained diploid DNA contents and expression of several genes that are known to express in the A. baerii gonad. After freezing and thawing of the cell lines, post-thaw cell viabilities between 57.6 and 92.9 % depending on cell lines were indentified, suggesting that stable cryopreservation is possible. The results and the cell lines established in this study will contribute to the development of an in vitro system for A. baerii germline stem cell culture. Keywords: Sturgeon, Acipenser baerii, Feeder cells, Long-term culture, Germline stem cells Background Yoshizaki, 2010; Lacerda et al., 2013). Therefore, establish- Germline stem cells are a very important cell type taking ment of an in vitro culture system for germline stem cells charge of gamete production (Brinster, 2007; Spradling derived from the economically valuable fish is one of the et al., 2011; Lehmann, 2012). Due to their high application upcoming challenges in the field of fish transgenic possibilities to animal transgenic research as a mediator research. As one of the important aquaculture fish, the conveying new traits to the next generation, lots of trials Siberian sturgeon (Acipenser baerii) provides valuable for in vitro culture and manipulation of them have been food resources including a luxury food and caviar and has conducted in many mammalian (Guan et al., 2006; a merit in culture due to its ability to tolerate the changes Aponte et al., 2008; Lee et al., 2013; Tiptanavattana et al., of environmental factors such as temperature and low O 2013; Lee et al., 2014) and some avian species (Park et al., concentration (Gisbert and Ruban, 2003). Thus, to fulfill 2008; Song et al., 2014). In fish, similar studies have been the improvement of the breed of this species, applying performed in small fish models (Sakai, 2002; Hong et al., transgenic technology is a worthwhile work in regard to 2004; Fan et al., 2008; Kawasaki et al., 2012; Wong and commercial aspect. Moreover, establishment of germline Collodi, 2013; Wong et al., 2013; Li et al., 2014), but the stem cells can contribute to species preservation of this related ones dealing with large farmed fish have been endangered fish species (Ruban and Zhu, 2010; Hong rarely conducted (Shikina et al., 2008; Shikina and et al., 2011; Lacerda et al., 2014). To establish germline stem cell culture system in A. * Correspondence: gongsp@pknu.ac.kr baerii, developing appropriate feeder cell lines that can Department of Marine Biomaterials and Aquaculture, Pukyong National support germline stem cells in vitro is a top priority. In University, Busan 608-737, South Korea general, cell lines derived from gonads are known to Department of Fisheries Biology, Pukyong National University, Busan 608-737, South Korea possess a capacity to support survival, maintenance, Full list of author information is available at the end of the article © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 2 of 8 growth, and differentiation of germline stem cells during surgical blade and incubated for 30 min at 28 °C. After in vitro culture (Hofmann et al., 2003; Nagano et al., digestion, enzyme was inactivated by adding 10 % (v/v) 2003; Hong et al., 2004). It has been reported that mouse fetal bovine serum (FBS; Gibco)-containing L15. All the spermatogonial stem cells formed colonies and main- tissue derivatives were filtered on 40-μm cell strainers tained its characteristics for 5 months on testis-derived (BDFalcon™, San Jose, CA, USA), and the isolated cells feeder cells during in vitro culture (Kanatsu-Shinohara were retrieved by centrifugation at 400×g for 4 min. et al., 2012). In fish, trout spermatocytes showed longer Viable cells were counted with a hemocytometer survival on Sertoli cells from testis than those without (Paul Marienfeld GmbH & Co. KG, Lauda-Königshofen, somatic cells in culture (Loir, 1989). Moreover, zebrafish Germany) after trypan blue (Gibco) staining, and 5 × 10 ovarian-somatic feeder cells supported cell growth, sur- live cells were seeded in 24-well culture plates (SPL Life vival, and germline competency of female germline stem Sciences) with L15 containing 20 % (v/v) FBS and 1 % cells in culture (Wong et al., 2013). (v/v) P/S. The cells were cultured at 28 °C with an air Therefore, in this study, we tried to establish A. baerii atmosphere, and the culture media were changed every gonad-derived cell lines as a first step toward culturing 2 to 3 days. Subcultures were conducted when the cells A. baerii germline stem cells. Subsequently, we evalu- reached 90 to 100 % confluency. For subculture, the cells ated optimal growth conditions of the established cell were washed twice using DPBS supplemented with 1 % lines and characterized them within the framework (v/v) P/S and detached by 0.05 % trypsin EDTA at room of the morphology, DNA contents, and expression of temperature for 5 min. After trypsin inactivation by genes that are known to express in A. baerii gonad. In adding one volume of 10 % (v/v) FBS-containing L15, addition, considering the legal and ethical limitation the detached cell suspension was centrifuged at 400×g about killing this endangered species repeatedly to se- for 4 min. Then, the harvested cells were resuspended cure a large amount of feeder cells, we tested the feasi- with culture media and subcultured at a 1:3 ratio up to bility of long-term culture and cryopreservation of the the 7th passage and since then at a 1:5 ratio. established cell lines. Measurement of growth rate Methods To investigate the growth rates under different culture Fish conditions, 2.5 × 10 cells from each of three cell lines Siberian sturgeons (A. baerii) were reared by a water re- (designated as ABG1, ABG3, and ABG5) at passages cycling system in hatchery of Pukyong National University 24 to 29 were seeded in 96-well microplates (Thermo (Busan, Korea) at ambient temperature and fed an artifi- Scientific, Vernon Hills, IL, USA) filled with L15 con- cial feed (Millennium Plus; Woosung Feed Corp., Daejeon, taining 20 % (v/v)FBS and1%(v/v)P/S and cultured Korea). Five 1-year-old fish were used in this study, and under four different temperatures of 24, 26, 28, and the average body length and weight were 39.6 ± 3.3 cm 30 °C. Cell viability of each group was measured at and 192.3 ± 54.8 g, respectively. All procedures for animal days 1, 3, 5, and 7 after cell seeding using Cell Count- management, euthanasia, and surgery were complied with ing Kit-8 (CCK-8; Dojindo, Kushu, Japan) according to the guidelines of Institutional Animal Care and Use the manufacturer’s instructions. After determination Committee (IACUC) of Pukyong National University and of optimal culture temperature, a test for determining the ethical guidelines published by International Council optimal FBS concentration for cell growth was con- for Laboratory Animal Science (ICLAS). ducted under the optimal culture temperature. The same protocols with temperature test were used, but Cell isolation and culture the cells were cultured in five different media consist- Gonad tissues were dissected from the body with sterile ing of L15 containing different FBS concentrations of scissors and tweezers following disinfection with 70 % 0, 5, 10, 15, and 20 % under a fixed culture temperature. ethanol (SK Chemicals, Sungnam, Korea). Each gonad This experiment was conducted in triplicate. was washed twice with Dulbecco’s Phosphate-Buffered Saline (DPBS; Gibco, Grand Island, NY, USA) containing Analysis of DNA contents 1% (v/v) penicillin and streptomycin (P/S; Gibco) in From each cell line, 1 × 10 cells at passages 54 to 55 petri dishes (SPL Life Sciences, Pocheon, Korea) and were harvested by trypsinization and centrifugation. Cell placed in a 35-mm petri dish (SPL Life Science) filled pellets were suspended in 1 mL DPBS at room with digestive solution consisting of a Leibovitz’s L-15 temperature and were transferred into 4 mL absolute Medium (L15; Gibco) supplemented with 500 U/mL col- ethanol at −20 °C. After overnight at −20 °C, the cells lagenase type I (Worthington Biochemical Corporation, were harvested by centrifugation and rehydrated in Lakewood Township, NJ, USA) and 0.05 % trypsin 5 mL DPBS for 15 min at room temperature. After that, EDTA (Gibco). Then, the tissues were chopped using a RNase A (Bioneer, Daejeon, Korea) was treated with a Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 3 of 8 final concentration of 200 μg/mL in DPBS for 30 min at L15 containing 10 % (v/v) dimethyl sulfoxide (DMSO; room temperature and, subsequently, stained by propi- Sigma-Aldrich) and 20 % (v/v) FBS, and the cell sus- dium iodide (Invitrogen, Carlsbad, CA, USA) with a final pensions were transferred into 1.2-mL cryovials concentration of 10 μg/mL in the dark for 1 h at room (Corning, Corning, NY, USA). Subsequently, the cryovials temperature. Finally, DNA content was measured by an were frozen in pre-chilled freezing containers (Nalgene, Accuri C6 flow cytometer (BD Biosciences, San Jose, CA, Rochester, NY, USA) with the cooling rate of −1°C/min. USA). A previously established A. baerii heart-derived cell After 12 h in a deep freezer at −75 °C, the cryovials were line, the ploidy of which was confirmed (Kim et al., 2014), stored in liquid nitrogen (−196 °C) for 24 to 27 days. The was used as a control of normal diploidy. cells were thawed in a 37 °C water bath for 2 min, 30 s and harvested by centrifugation. The post-thaw cells were RT-PCR suspended with culture media, and 1 × 10 cells were Total RNA was extracted from each cell line using the seeded in 96-well microplates. Cell viability was measured RNeasy Plus Mini Kit (Qiagen, Valencia, CA, USA) at using CCK-8. Non-frozen cells were used as a control, passages 15 to 16 and passages 54 to 55. Extracted total and cell viability was calculated as absorbance / sample RNA was treated by DNase I (Sigma-Aldrich, St. Louis, absorbance × 100. This experiment was conducted in control MO, USA) to eliminate genomic DNA, and first-strand triplicate. complementary DNA (cDNA) was synthesized from 1 μg total RNA using a M-MLV cDNA Synthesis Kit Statistical analysis (Enzynomics, Daejeon, Korea). PCR was conducted with The Statistical Analysis System (SAS Institute, Cary, NC, the primers specific for six genes including ar, lh, USA) program was used to analyze the effect of each cyp17a1, sox9, star, and β-actin under the following con- treatment. When analysis of variance (ANOVA) detected dition: initial denaturation step (94 °C for 5 min), cycling a significant main effect, treatments were analyzed sub- step (30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C sequently by Duncan’s method. Significant differences for 45 s), and the final extension step (72 °C for 10 min). among treatments were defined by a p value <0.05. The PCR products mixed with LoadingSTAR (DyneBio, Seongnam, Korea) were size fractionated by 1.2 % (w/v) Results agarose gel (Lonza, Rockland, ME, USA) electrophoresis Establishment of A. baerii gonad-derived cell lines and visualized with a UV transilluminator. The primer Five gonad-dissociated cells derived from five individuals sequences are listed in Table 1. were subjected to in vitro culture. All cell populations were attached to substrata after 1 day of culture and Measurement of viability of frozen-thawed cells reached 90 to 100 % confluency in 4 to 6 days through To investigate cell viability after freezing and thawing, continuous proliferation. They were subcultured con- 5 6 2×10 cells from each cell line at passages 52 to 57 tinuously, and 1 × 10 cells of each were frozen at least were suspended with freezing solution consisting of once before the 10th passage. Each cell line was named Table 1 Primer sequences used in this study Genes Primer sequences (5′ >3′) Product size (bp) Accession number ar Forward, TGAAGAAGATGAAGGGAGCAGAAGAT 231 DQ388357.1 Reverse, TCTCCCCCAGTTCATTCAAGC cyp17a1 Forward, TCACACACTCCAGTATTGGTG 92 HQ026486.1 Reverse, CCATTCCTTTTCATCGTGATG lh Forward, CTGCAGAGAAGGAGGAATGT 140 AJ251656.1 Reverse, GCGAAGATCCTTATAGGTGCA sox9 Forward, AGCAGCAAAAACAAGCCTCA 113 EU241882.1 Reverse, AGCTCCGCGTTGTGAAGAT star Forward, CAGAAGTCAATCAGCATCCT 79 FJ205610.1 Reverse, TCAGCACCTTGTCTCCATTG β-actin Forward, CCCTGTTCCAGCCATCCTTC 155 JX027376.1 Reverse, GTCTGCAATGCCAGGGTACA Primer sequences for ar, cyp17a1, lh, sox9, and star genes were referred from Berbejillo et al. (2012) ar androgen receptor, cyp17a1 cytochrome P450, family 17, subfamily a, polypeptide 1, lh luteinizing hormone, sox9 sry-box containing gene 9, star steroidogenic acute regulatory protein Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 4 of 8 as ABG1, ABG3, ABG5, ABG6, and ABG7 (Table 2). Up some differences among cell lines appeared at a late to date, all the five cell lines have been cultured stably passage (passage nos. 54 to 55). The ABG1 and ABG5 and constantly over at least the 73th passage and 402 lines have maintained a high ratio of wide-spread cells, culture days. For preservation and future use, all cell whereas the ABG3 and ABG6 lines contained domin- lines were cryopreserved in liquid nitrogen with a suffi- antly small polygonal cells. In the ABG7 line, two cell cient number of vials containing each cell lines at an types were mixed at a similar ratio (Fig. 2a). To evalu- interval of about 5 passages (Table 2). ate ploidy of the cell lines after long-term culture, DNA contents of each cell line at late passage were measured Determination of optimal growth condition by flow cytometry. As shown in Fig. 2b, all the five cell To decide optimal growth conditions for A. baerii lines showed diploid DNA contents similar to the gonad-derived cell lines, the effects of temperature and control cell line despite long-term culture. Two peaks FBS concentration on cellular growth were evaluated. As within diploid peak of the ABG7 line are seemed to be shown in Fig. 1, similar effects of temperature on cellular causedbythe property of theABG7linein which two growth were observed in the three cell lines tested. cell types existed at the same ratio. Next, RT-PCR ana- Significant high cell growth was detected at both 28 and lysis was conducted to identify the expression of a set 30 °C (p < 0.05), and it was decreased as temperature of genes that are known to be expressed in A. baerii gonad goes down. In 24 °C, the lowest cell growth was tissue in the established cell lines at both early and late observed, but the cells kept attaching on the substrata, passages. As the results, the expression of ar, lh,and sox9 maintained normal morphology, and grew slowly. To genes was maintained at late passage, more or less, in all test the effects of FBS concentration on cellular growth, the cell lines, but the cyp17a1 gene was not expressed at culture temperature was fixed at 28 °C according to the all in both early and late passages of all the cell lines. In result of temperature test. As expected, absence of FBS case of the star gene, overall expression was weak with no in the culture did not induce both cell growth and expression in the ABG1 line and its expression in the attachment in all the cell lines tested and growth rate ABG5 line was lost at late passage (Fig. 2c). was increased in a dose-dependent manner. The ABG3 and ABG5 lines grew better significantly in the media Post-thaw cell viability of A. baerii gonad-derived cell lines containing 15 and 20 % FBS relative to the other media To evaluate the feasibility of cryopreservation of the while the ABG1 line showed maximum growth in the established cell lines, the viabilities of post-thaw cells media containing 20 % FBS (p < 0.05). which were frozen and stored in liquid nitrogen (−196 °C) for 24 to 27 days were measured in each cell line. High Characterization of A. baerii gonad-derived cell lines post-thaw cell viabilities of more than 79.6 % were de- During the culture period, all the cell lines were com- tected in four cell lines including ABG1, 3, 5, and 7 (92.9, posed of mainly two types of cells based on morpho- 79.6, 86.4, and 90.0 %, respectively), but the ABG6 line logical criteria: wide-spread cells that occupy a wide showed significant low post-thaw cell viability of 57.6 % surface area and small polygonal cells that grow (Fig. 3; p <0.05). densely. At an early passage (passage nos. 15 to 16), a ratio of wide-spread cells was relatively higher than that Discussion of small polygonal cells in all cell lines and a certain In this study, we successfully established five A. baerii difference among cell lines was not observed visually. gonad-derived cell lines from five trials (success rate, As the cell lines were subcultured consistently, a ratio 5/5 = 100 %) and all established cell lines could grow of small polygonal cells was relatively increased and stably during a long period of more than 1 year without Table 2 Information of Acipenser baerii gonad-derived cell lines established in this study a b Name of Culture Cryopreservation cell line Passage no. in current Culture period (day) First passage no. Final passage no. Total no. of frozen cryopreserved cryopreserved vials stored ABG1 80 504 9 80 46 ABG3 73 434 7 73 58 ABG5 80 405 8 80 39 ABG6 78 525 5 70 54 ABG7 83 402 6 83 62 Composition of culture media was Leibovitz’s L-15 medium supplemented with 20 % (v/v) fetal bovine serum and 1 % (v/v) penicillin and streptomycin All cell lines were frozen and stored in liquid nitrogen (−196 °C) Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 5 of 8 Fig. 1 Determination of optimal growth conditions for Acipenser baerii gonad-derived cell lines on temperature and fetal bovine serum (FBS) concentration. Three cell lines were cultured in 96-well microplates under different temperatures, and FBS concentrations and cell growth were measured on days 1, 3, 5, and 7. FBS concentration was fixed at 20 % in temperature test, and temperature was fixed at 28 °C in FBS concentration test. Significant high cell growth was observed in the cell groups cultured at 28 and 30 °C in all the three cell lines tested. In case of FBS concentration, 15 and 20 % FBS induced significant high cell growth in the ABG3 and ABG5 lines, while the ABG1 line showed the maximum cell growth under 20 % FBS. All data are mean ± SD of three independent experiments. Different letters indicate significant differences, p <0.05 any significant growth retardation and marked deterior- continuous supply of feeder cells (Evans and Kaufman ation in culture. Furthermore, these cell lines showed high 1981; Matsui et al., 1992; Kanatsu-Shinohara et al., post-thaw cell viabilities of more than 79.6 % except one 2003; Takahashi and Yamanaka, 2006; Jing et al., 2010; line that showed 57.6 % post-thaw cell viability suggesting Pacchiarotti et al., 2010). Thus, in case of the feeder the feasibility of stable cryopreservation. These advantages cells that have a relatively short lifespan like mouse em- of easiness in cell line derivation, long-term maintenance, bryonic fibroblasts that are feeder cells for culturing and cryopreservation can maximize the availability of human and mouse embryonic stem cells, sacrifice of these cell lines as the feeder cells for culturing A. baerii animals and labor-intensive work for cell preparation germline stem cells. Culture of most stem cells requires should be conducted repeatedly (Amit et al., 2003). Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 6 of 8 Fig. 2 Characterization of five Acipenser baerii gonad-derived cell lines. a Morphologies of each cell line were observed at early and late passages. Early and late passages indicate the cells at passages 15 to 16 and passages 54 to 55, respectively. Two cell types were observed in culture: wide- spread cells that occupy a wide surface area and small polygonal cells that grow densely. A different ratio of two cell types in culture was observed depending on cell lines and passage number. Scale bar = 100 μm. b Flow cytometry was performed to analyze DNA contents of the cell lines at the late passage. A diploid A. baerii heart-derived cell line was used as a control (red lines). All cell lines maintained normal diploid state in spite of long-term culture. c RT-PCR analysis was performed to identify the expression of several genes including ar, cyp17a1, lh, sox9, and star in the cell lines at both early and late passages. All cell lines regardless of passage number expressed ar, lh,and sox9 but not expressed cyp17a1. Expression of star gene was very weak or not detected depending on cell lines. E, early passage; L, late passage Unlike this, the cell lines that can grow long-term and study. However, other conditions also can be attractive be stored stably are free to such limitations. In addition, based on our results. We found that the established cell limitation of using A. baerii as an endangered species lines could be cultured in a wide range of culture temper- also can be overcome by the advantages. On the other atures from 24 to 30 °C even though significant high cell side,these cell linesare able to playarolein universal growth was observed in 28 and 30 °C conditions. Culture biological studies such as toxicology and drug discov- in various temperatures may have a potential merit as ery, functional studies for genes and proteins, and study feeder cells because co-culture with germline stem cells for cell-pathogen interaction (Lakra et al., 2011). In- may require a different optimal culture temperature as in deed, there is a report that conducted virus susceptibil- the case of mammalian species (Lee et al., 2013). In ity test on Chinese sturgeon A. sinensis tail fin cell line addition, the results showed that 15 % FBS also induced to verify the feasibility of fish virus culture and isolation significant high cell growth at a similar level with 20 % using a cultured cell line (Zhou et al., 2008). FBS in the ABG3 and ABG5 lines, suggesting that the For cell culture, we used 28 °C culture temperature and application of a cell line-specific protocol can save overall the media containing 20 % FBS based on our previous re- cost by diminishing the use of high-cost FBS. port that cultured A. baerii heart-derived cell lines (Kim In general, tissue-derived primary cell populations in et al., 2014) and the results from the experiment in this culture undergo a selection process by various factors Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 7 of 8 To establish gonad-derived cell lines, we used a 1- year-old A. baerii of which sex cannot be indentified externally (Keyvanshokooh and Gharaei, 2010). Unfortu- nately, we could not carry out histological inspection of gonad tissues from which the cell lines were originated due to a lack of available sample. Moreover, because there is no marker to discriminate sex at a cellular level in this species, sex of the cell lines established in this study is not clear. Therefore, it remains to be demonstrated if which germline stem cells, female or male, the established cell lines can support better. In previous reports, in vitro culture of germline stem cells requires several growth factors such as fibroblast growth factor (FGF), glial cell- derived neurotrophic factor (GDNF), leukemia inhibitory Fig. 3 Cell viability after freezing and thawing of five Acipenser baerii factor (LIF), or stem cell factor (SCF) (Matsui et al., 1992; gonad-derived cell lines. Cell viability was measured immediately after Kubota et al., 2004; Zhang et al., 2011 in mammalian; thawing of frozen cells that were stored for 24 to 27 days in liquid Hong et al., 2004; Wong et al., 2013; Li et al., 2014 in fish). nitrogen. More than 79.6 % post-thaw cell viability was observed in all the cell lines except ABG6 that showed 57.6 % cell viability. These growth factors can be supplied by feeder cells or ex- Non-frozen cells were used as a control. All data are mean ± SD of ogenously. However, because commercially available three the independent experiments. Different letters indicate growth factors are usually of human or mouse origin, sup- significant differences, p <0.05 ply of them by feeder cells seems to be more appropriate in fish germline stem cell culture (Wong et al., 2013). In such as cellular damage in isolation, cell attachment, this study, we did not identify the expression of the limitations in nutrient or substrates, and growth compe- growth factors in the cell lines due to the absence of avail- tition between different cells. Thus, one or two cell types able information about them. Considering the importance are eventually remained when a cell line forms in most of the growth factors in supporting germline stem cells case (Freshney, 2010). Likewise, we observed that two in vitro, identification of their expression should be cell types were dominant in the culture of A. baerii checked in future studies. Otherwise, the cell lines gonad-dissociated cells in morphological criteria. At the can be manipulated artificially so as to express stably initial stage of culture, it looked that wide-spread cells such growth factors. were more predominant than small polygonal cells but the proportion of one of the two cell types was increased Conclusions as the culture was progressed in all the cell lines except This study reports the establishment of five A. baerii the ABG7 line that showed a similar ratio of the two cell gonad-derived cell lines that stable long-term culture types. This indicates that both cell types can be easily and cryopreservation were possible. These cell lines can adapted in the culture environment used in this study be utilized as a basic material to develop the culture and they are the major targets for further study. In system for germline stem cells in sturgeon species as another aspect, two cell types may represent each cell well as a tool for general biological studies. population at different differentiation stages in a com- Acknowledgements mon cell lineage. This work was supported by a Research Grant of Pukyong National University All cell lines showed diploid DNA contents at passages (year 2014). 54 to 55, indicating that all cell lines maintained an ori- Authors’ contributions ginal normal state without cell transformation featured JHR carried out the experiments and participated to write the manuscript. by aneuploidy or heteroploidy (Freshney, 2010). More- YKN conceived of the study and participated in its design. SPG conceived and designed the study, analyzed the data, and wrote the manuscript. All over, the genes expressed at early passage were still authors read and approved the final manuscript. expressed at late passage in all except the star gene of the ABG5 line. Although the data is very limited in Competing interests terms of the number of genes tested, this result implies The authors declare that they have no competing interests. that the cell lines maintained their original characteris- Author details tics in some degree at least up to passages 54 to 55. 1 Department of Marine Biomaterials and Aquaculture, Pukyong National Taken together, these findings suggest that the A. baerii University, Busan 608-737, South Korea. Department of Fisheries Biology, Pukyong National University, Busan 608-737, South Korea. Laboratory of Cell gonad-derived cell lines might be able to maintain their Biotechnology, Department of Marine Biomaterials and Aquaculture, College primary supportive role in germline stem cells in spite of of Fisheries Science, Pukyong National University, Busan 608-737, South long-term culture. Korea. Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 8 of 8 Received: 27 January 2016 Accepted: 19 May 2016 Loir M. Trout Sertoli cells and germ cells in primary culture: morphological and ultrastructural study. Gamete Res. 1989;24:151–69. Matsui Y, Zsebo K, Hogan BL. Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell. 1992;70:841–7. Nagano M, Ryu BY, Brinster CJ, Avarbock MR, Brinster RL. Maintenance of mouse References male germ line stem cells in vitro. Biol Reprod. 2003;68:2207–14. Amit M, Margulets V, Segev H, Shariki C, Laevsky I, Coleman R, et al. Human Pacchiarotti J, Maki C, Ramos T, Marh J, Howerton K, Wong J, et al. Differentiation feeder layers for human embryonic stem cells. Biol Reprod. 2003;68:2150–6. potential of germ line stem cells derived from the postnatal mouse ovary. Aponte PM, Soda T, Teerds KJ, Mizrak SC, van de Kant HJ, de Rooij DG. Differentiation. 2010;79:159–70. Propagation of bovine spermatogonial stem cells in vitro. Reproduction. Park TS, Kim MA, Lim JM, Han JY. Production of quail (Coturnix japonica) germline 2008;136:543–57. chimeras derived from in vitro-cultured gonadal primordial germ cells. Mol Berbejillo J, Martinez-Bengochea A, Bedo G, Brunet F, Volff JN, Vizziano-Cantonnet D. Reprod Dev. 2008;75:274–81. Expression and phylogeny of candidate genes for sex differentiation in a Ruban G, Zhu B. Acipenser baerii, The IUCN Red List of Threatened Species 2010: primitive fish species, the Siberian sturgeon, Acipenser baerii. Mol Reprod Dev. e.T244A13046607. 2010. 2012;79:504–16. Sakai N. Transmeiotic differentiation of zebrafish germ cells into functional sperm Brinster RL. Male germline stem cells: from mice to men. Science. 2007;316:404–5. in culture. Development. 2002;129:3359–65. Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from Shikina S, Yoshizaki G. Improved in vitro culture conditions to enhance the mouse embryos. Nature. 1981;292:154–6. survival, mitotic activity, and transplantability of rainbow trout type a Fan L, Moon J, Wong TT, Crodian J, Collodi P. Zebrafish primordial germ cell spermatogonia. Biol Reprod. 2010;83:268–76. cultures derived from vasa::Rfp transgenic embryos. Stem Cells Dev. Shikina S, Ihara S, Yoshizaki G. Culture conditions for maintaining the survival and 2008;17:585–97. mitotic activity of rainbow trout transplantable type A spermatogonia. Mol Freshney RI. Culture of animal cells: a manual of basic technique and specialized Reprod Dev. 2008;75:529–37. applications. 6th ed. Hoboken: Wiley-Blackwell; 2010. Song Y, Duraisamy S, Ali J, Kizhakkayil J, Jacob VD, Mohammed MA, et al. Gisbert E, Ruban GI. Ontogenetic behavior of Siberian sturgeon, Acipenser baerii: Characteristics of long-term cultures of avian primordial germ cells and a synthesis between laboratory tests and field data. Environ Biol Fish. 2003; gonocytes. Biol Reprod. 2014;90:15. 67:311–9. Spradling A, Fuller MT, Braun RE, Yoshida S. Germline stem cells. Cold Spring Guan K, Nayernia K, Maier LS, Wagner S, Dressel R, Lee JH, et al. Pluripotency of Harb Perspect Biol. 2011;3:a002642. spermatogonial stem cells from adult mouse testis. Nature. 2006;440:1199–203. TakahashiK,YamanakaS.Induction of pluripotent stem cells from mouse embryonic Hofmann MC, van Der Wee KS, Dargart JL, Dirami G, Dettin L, Dym M. and adult fibroblast cultures by defined factors. Cell. 2006;126:663–76. Establishment and characterization of neonatal mouse Sertoli cell lines. J Tiptanavattana N, Thongkittidilok C, Techakumphu M, Tharasanit T. Androl. 2003;24:120–30. Characterization and in vitro culture of putative spermatogonial stem cells Hong Y, Liu T, Zhao H, Xu H, Wang W, Liu R, et al. Establishment of a normal derived from feline testicular tissue. J Reprod Dev. 2013;59:189–95. medakafish spermatogonial cell line capable of sperm production in vitro. Wong TT, Collodi P. Dorsomorphin promotes survival and germline competence Proc Natl Acad Sci U S A. 2004;101:8011–6. of zebrafish spermatogonial stem cells in culture. PLoS ONE. 2013;8:e71332. Hong N, Li Z, Hong Y. Fish stem cell cultures. Int J Biol Sci. 2011;7:392–402. Wong TT, Tesfamichael A, Collodi P. Production of zebrafish offspring from Jing D, Fonseca AV, Alakel N, Fierro FA, Muller K, Bornhauser M, et al. cultured female germline stem cells. PLoS ONE. 2013;8:e62660. Hematopoietic stem cells in co-culture with mesenchymal stromal Zhang Y, Yang Z, Yang Y, Wang S, Shi L, Xie W, et al. Production of transgenic cells—modeling the niche compartments in vitro. Haematologica. mice by random recombination of targeted genes in female germline stem 2010;95:542–50. cells. J Mol Cell Biol. 2011;3:132–41. Kanatsu-Shinohara M, Ogonuki N, Inoue K, Miki H, Ogura A, Toyokuni S, et al. Zhou GZ, Gui L, Li ZQ, Yuan XP, Zhang QY. Establishment of a Chinese sturgeon Long-term proliferation in culture and germline transmission of mouse male Acipenser sinensis tail-fin cell line and its susceptibility to frog iridovirus. J Fish germline stem cells. Biol Reprod. 2003;69:612–6. Biol. 2008;73:2058–67. Kanatsu-Shinohara M, Inoue K, Takashima S, Takehashi M, Ogonuki N, Morimoto H, et al. Reconstitution of mouse spermatogonial stem cell niches in culture. Cell Stem Cell. 2012;11:567–78. Kawasaki T, Saito K, Sakai C, Shinya M, Sakai N. Production of zebrafish offspring from cultured spermatogonial stem cells. Genes to Cells. 2012;17:316–25. Keyvanshokooh S, Gharaei A. A review of sex determination and searches for sex-specific markers in sturgeon. Aquac Res. 2010;41:e1–7. Kim MS, Nam YK, Park C, Kim HW, Ahn J, Lim JM, et al. Establishment condition and characterization of heart-derived cell culture in Siberian sturgeon (Acipenser baerii). In Vitro Cell Dev Biol Anim. 2014;50:909–17. Kubota H, Avarbock MR, Brinster RL. Growth factors essential for self-renewal and expansion of mouse spermatogonial stem cells. Proc Natl Acad Sci U S A. 2004;101:16489–94. Lacerda SM, Costa GM, da Silva MA, Campos-Junior PH, Segatelli TM, Peixoto MT, et al. Phenotypic characterization and in vitro propagation and transplantation of the Nile tilapia (Oreochromis niloticus) spermatogonial stem Submit your next manuscript to BioMed Central cells. Gen Comp Endocrinol. 2013;192:95–106. Lacerda SM, Costa GM, de França LR. Biology and identity of fish spermatogonial and we will help you at every step: stem cell. Gen Comp Endocrinol. 2014;207:56–65. • We accept pre-submission inquiries Lakra WS, Swaminathan TR, Joy KP. Development, characterization, conservation and storage of fish cell lines: a review. Fish Physiol Biochem. 2011;37:1–20. � Our selector tool helps you to find the most relevant journal Lee WY, Park HJ, Lee R, Lee KH, Kim YH, Ryu BY, et al. Establishment and in vitro � We provide round the clock customer support culture of porcine spermatogonial germ cells in low temperature culture � Convenient online submission conditions. Stem Cell Res. 2013;11:1234–49. Lee KH, Lee R, Lee WY, Kim DH, Chung HJ, Kim JH, et al. Identification and � Thorough peer review in vitro derivation of spermatogonia in beagle testis. PLoS ONE. 2014;9: � Inclusion in PubMed and all major indexing services e109963. � Maximum visibility for your research Lehmann R. Germline stem cells: origin and destiny. Cell Stem Cell. 2012;10:729–39. Li Z, Li M, Hong N, Yi M, Hong Y. Formation and cultivation of medaka primordial Submit your manuscript at germ cells. Cell Tissue Res. 2014;357:71–81. www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Fisheries and Aquatic Sciences Springer Journals

Establishment and long-term culture of the cell lines derived from gonad tissues of Siberian sturgeon (Acipenser baerii)

Ryu, Jun; Nam, Yoon; Gong, Seung
Fisheries and Aquatic Sciences , Volume 19 (1) – Jun 4, 2016
Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/establishment-and-long-term-culture-of-the-cell-lines-derived-from-jL6R3qDQTP

References (47)

Publisher
Springer Journals
Copyright
Copyright © 2016 by The Author(s)
Subject
Life Sciences; Fish & Wildlife Biology & Management; Marine & Freshwater Sciences; Animal Ecology
eISSN
2234-1757
DOI
10.1186/s41240-016-0015-y
Publisher site
See Article on Publisher Site

Abstract

To culture germline stem cells in vitro, establishment of the cell lines that can be used as the feeder cells is a prerequisite. In this study, we tried to establish gonad-derived cell lines in Siberian sturgeon (Acipenser baerii). Five 1-year-old A. baerii were used as a donor of gonad tissues, and gonad-dissociated cells were cultured in vitro. Subsequently, determination of growth conditions, long-term culture, characterization, and cryopreservation of the cell lines were also conducted. Five gonad-derived cell lines were stably established and cultured continuously over at least the 73th passage and 402 culture days under the media containing 20 % fetal bovine serum at 28 °C. All cell lines consisted of two main cell types based on morphology even if the ratio of the two cell types was different depending on cell lines. Despite long-term culture, all cell lines maintained diploid DNA contents and expression of several genes that are known to express in the A. baerii gonad. After freezing and thawing of the cell lines, post-thaw cell viabilities between 57.6 and 92.9 % depending on cell lines were indentified, suggesting that stable cryopreservation is possible. The results and the cell lines established in this study will contribute to the development of an in vitro system for A. baerii germline stem cell culture. Keywords: Sturgeon, Acipenser baerii, Feeder cells, Long-term culture, Germline stem cells Background Yoshizaki, 2010; Lacerda et al., 2013). Therefore, establish- Germline stem cells are a very important cell type taking ment of an in vitro culture system for germline stem cells charge of gamete production (Brinster, 2007; Spradling derived from the economically valuable fish is one of the et al., 2011; Lehmann, 2012). Due to their high application upcoming challenges in the field of fish transgenic possibilities to animal transgenic research as a mediator research. As one of the important aquaculture fish, the conveying new traits to the next generation, lots of trials Siberian sturgeon (Acipenser baerii) provides valuable for in vitro culture and manipulation of them have been food resources including a luxury food and caviar and has conducted in many mammalian (Guan et al., 2006; a merit in culture due to its ability to tolerate the changes Aponte et al., 2008; Lee et al., 2013; Tiptanavattana et al., of environmental factors such as temperature and low O 2013; Lee et al., 2014) and some avian species (Park et al., concentration (Gisbert and Ruban, 2003). Thus, to fulfill 2008; Song et al., 2014). In fish, similar studies have been the improvement of the breed of this species, applying performed in small fish models (Sakai, 2002; Hong et al., transgenic technology is a worthwhile work in regard to 2004; Fan et al., 2008; Kawasaki et al., 2012; Wong and commercial aspect. Moreover, establishment of germline Collodi, 2013; Wong et al., 2013; Li et al., 2014), but the stem cells can contribute to species preservation of this related ones dealing with large farmed fish have been endangered fish species (Ruban and Zhu, 2010; Hong rarely conducted (Shikina et al., 2008; Shikina and et al., 2011; Lacerda et al., 2014). To establish germline stem cell culture system in A. * Correspondence: gongsp@pknu.ac.kr baerii, developing appropriate feeder cell lines that can Department of Marine Biomaterials and Aquaculture, Pukyong National support germline stem cells in vitro is a top priority. In University, Busan 608-737, South Korea general, cell lines derived from gonads are known to Department of Fisheries Biology, Pukyong National University, Busan 608-737, South Korea possess a capacity to support survival, maintenance, Full list of author information is available at the end of the article © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 2 of 8 growth, and differentiation of germline stem cells during surgical blade and incubated for 30 min at 28 °C. After in vitro culture (Hofmann et al., 2003; Nagano et al., digestion, enzyme was inactivated by adding 10 % (v/v) 2003; Hong et al., 2004). It has been reported that mouse fetal bovine serum (FBS; Gibco)-containing L15. All the spermatogonial stem cells formed colonies and main- tissue derivatives were filtered on 40-μm cell strainers tained its characteristics for 5 months on testis-derived (BDFalcon™, San Jose, CA, USA), and the isolated cells feeder cells during in vitro culture (Kanatsu-Shinohara were retrieved by centrifugation at 400×g for 4 min. et al., 2012). In fish, trout spermatocytes showed longer Viable cells were counted with a hemocytometer survival on Sertoli cells from testis than those without (Paul Marienfeld GmbH & Co. KG, Lauda-Königshofen, somatic cells in culture (Loir, 1989). Moreover, zebrafish Germany) after trypan blue (Gibco) staining, and 5 × 10 ovarian-somatic feeder cells supported cell growth, sur- live cells were seeded in 24-well culture plates (SPL Life vival, and germline competency of female germline stem Sciences) with L15 containing 20 % (v/v) FBS and 1 % cells in culture (Wong et al., 2013). (v/v) P/S. The cells were cultured at 28 °C with an air Therefore, in this study, we tried to establish A. baerii atmosphere, and the culture media were changed every gonad-derived cell lines as a first step toward culturing 2 to 3 days. Subcultures were conducted when the cells A. baerii germline stem cells. Subsequently, we evalu- reached 90 to 100 % confluency. For subculture, the cells ated optimal growth conditions of the established cell were washed twice using DPBS supplemented with 1 % lines and characterized them within the framework (v/v) P/S and detached by 0.05 % trypsin EDTA at room of the morphology, DNA contents, and expression of temperature for 5 min. After trypsin inactivation by genes that are known to express in A. baerii gonad. In adding one volume of 10 % (v/v) FBS-containing L15, addition, considering the legal and ethical limitation the detached cell suspension was centrifuged at 400×g about killing this endangered species repeatedly to se- for 4 min. Then, the harvested cells were resuspended cure a large amount of feeder cells, we tested the feasi- with culture media and subcultured at a 1:3 ratio up to bility of long-term culture and cryopreservation of the the 7th passage and since then at a 1:5 ratio. established cell lines. Measurement of growth rate Methods To investigate the growth rates under different culture Fish conditions, 2.5 × 10 cells from each of three cell lines Siberian sturgeons (A. baerii) were reared by a water re- (designated as ABG1, ABG3, and ABG5) at passages cycling system in hatchery of Pukyong National University 24 to 29 were seeded in 96-well microplates (Thermo (Busan, Korea) at ambient temperature and fed an artifi- Scientific, Vernon Hills, IL, USA) filled with L15 con- cial feed (Millennium Plus; Woosung Feed Corp., Daejeon, taining 20 % (v/v)FBS and1%(v/v)P/S and cultured Korea). Five 1-year-old fish were used in this study, and under four different temperatures of 24, 26, 28, and the average body length and weight were 39.6 ± 3.3 cm 30 °C. Cell viability of each group was measured at and 192.3 ± 54.8 g, respectively. All procedures for animal days 1, 3, 5, and 7 after cell seeding using Cell Count- management, euthanasia, and surgery were complied with ing Kit-8 (CCK-8; Dojindo, Kushu, Japan) according to the guidelines of Institutional Animal Care and Use the manufacturer’s instructions. After determination Committee (IACUC) of Pukyong National University and of optimal culture temperature, a test for determining the ethical guidelines published by International Council optimal FBS concentration for cell growth was con- for Laboratory Animal Science (ICLAS). ducted under the optimal culture temperature. The same protocols with temperature test were used, but Cell isolation and culture the cells were cultured in five different media consist- Gonad tissues were dissected from the body with sterile ing of L15 containing different FBS concentrations of scissors and tweezers following disinfection with 70 % 0, 5, 10, 15, and 20 % under a fixed culture temperature. ethanol (SK Chemicals, Sungnam, Korea). Each gonad This experiment was conducted in triplicate. was washed twice with Dulbecco’s Phosphate-Buffered Saline (DPBS; Gibco, Grand Island, NY, USA) containing Analysis of DNA contents 1% (v/v) penicillin and streptomycin (P/S; Gibco) in From each cell line, 1 × 10 cells at passages 54 to 55 petri dishes (SPL Life Sciences, Pocheon, Korea) and were harvested by trypsinization and centrifugation. Cell placed in a 35-mm petri dish (SPL Life Science) filled pellets were suspended in 1 mL DPBS at room with digestive solution consisting of a Leibovitz’s L-15 temperature and were transferred into 4 mL absolute Medium (L15; Gibco) supplemented with 500 U/mL col- ethanol at −20 °C. After overnight at −20 °C, the cells lagenase type I (Worthington Biochemical Corporation, were harvested by centrifugation and rehydrated in Lakewood Township, NJ, USA) and 0.05 % trypsin 5 mL DPBS for 15 min at room temperature. After that, EDTA (Gibco). Then, the tissues were chopped using a RNase A (Bioneer, Daejeon, Korea) was treated with a Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 3 of 8 final concentration of 200 μg/mL in DPBS for 30 min at L15 containing 10 % (v/v) dimethyl sulfoxide (DMSO; room temperature and, subsequently, stained by propi- Sigma-Aldrich) and 20 % (v/v) FBS, and the cell sus- dium iodide (Invitrogen, Carlsbad, CA, USA) with a final pensions were transferred into 1.2-mL cryovials concentration of 10 μg/mL in the dark for 1 h at room (Corning, Corning, NY, USA). Subsequently, the cryovials temperature. Finally, DNA content was measured by an were frozen in pre-chilled freezing containers (Nalgene, Accuri C6 flow cytometer (BD Biosciences, San Jose, CA, Rochester, NY, USA) with the cooling rate of −1°C/min. USA). A previously established A. baerii heart-derived cell After 12 h in a deep freezer at −75 °C, the cryovials were line, the ploidy of which was confirmed (Kim et al., 2014), stored in liquid nitrogen (−196 °C) for 24 to 27 days. The was used as a control of normal diploidy. cells were thawed in a 37 °C water bath for 2 min, 30 s and harvested by centrifugation. The post-thaw cells were RT-PCR suspended with culture media, and 1 × 10 cells were Total RNA was extracted from each cell line using the seeded in 96-well microplates. Cell viability was measured RNeasy Plus Mini Kit (Qiagen, Valencia, CA, USA) at using CCK-8. Non-frozen cells were used as a control, passages 15 to 16 and passages 54 to 55. Extracted total and cell viability was calculated as absorbance / sample RNA was treated by DNase I (Sigma-Aldrich, St. Louis, absorbance × 100. This experiment was conducted in control MO, USA) to eliminate genomic DNA, and first-strand triplicate. complementary DNA (cDNA) was synthesized from 1 μg total RNA using a M-MLV cDNA Synthesis Kit Statistical analysis (Enzynomics, Daejeon, Korea). PCR was conducted with The Statistical Analysis System (SAS Institute, Cary, NC, the primers specific for six genes including ar, lh, USA) program was used to analyze the effect of each cyp17a1, sox9, star, and β-actin under the following con- treatment. When analysis of variance (ANOVA) detected dition: initial denaturation step (94 °C for 5 min), cycling a significant main effect, treatments were analyzed sub- step (30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C sequently by Duncan’s method. Significant differences for 45 s), and the final extension step (72 °C for 10 min). among treatments were defined by a p value <0.05. The PCR products mixed with LoadingSTAR (DyneBio, Seongnam, Korea) were size fractionated by 1.2 % (w/v) Results agarose gel (Lonza, Rockland, ME, USA) electrophoresis Establishment of A. baerii gonad-derived cell lines and visualized with a UV transilluminator. The primer Five gonad-dissociated cells derived from five individuals sequences are listed in Table 1. were subjected to in vitro culture. All cell populations were attached to substrata after 1 day of culture and Measurement of viability of frozen-thawed cells reached 90 to 100 % confluency in 4 to 6 days through To investigate cell viability after freezing and thawing, continuous proliferation. They were subcultured con- 5 6 2×10 cells from each cell line at passages 52 to 57 tinuously, and 1 × 10 cells of each were frozen at least were suspended with freezing solution consisting of once before the 10th passage. Each cell line was named Table 1 Primer sequences used in this study Genes Primer sequences (5′ >3′) Product size (bp) Accession number ar Forward, TGAAGAAGATGAAGGGAGCAGAAGAT 231 DQ388357.1 Reverse, TCTCCCCCAGTTCATTCAAGC cyp17a1 Forward, TCACACACTCCAGTATTGGTG 92 HQ026486.1 Reverse, CCATTCCTTTTCATCGTGATG lh Forward, CTGCAGAGAAGGAGGAATGT 140 AJ251656.1 Reverse, GCGAAGATCCTTATAGGTGCA sox9 Forward, AGCAGCAAAAACAAGCCTCA 113 EU241882.1 Reverse, AGCTCCGCGTTGTGAAGAT star Forward, CAGAAGTCAATCAGCATCCT 79 FJ205610.1 Reverse, TCAGCACCTTGTCTCCATTG β-actin Forward, CCCTGTTCCAGCCATCCTTC 155 JX027376.1 Reverse, GTCTGCAATGCCAGGGTACA Primer sequences for ar, cyp17a1, lh, sox9, and star genes were referred from Berbejillo et al. (2012) ar androgen receptor, cyp17a1 cytochrome P450, family 17, subfamily a, polypeptide 1, lh luteinizing hormone, sox9 sry-box containing gene 9, star steroidogenic acute regulatory protein Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 4 of 8 as ABG1, ABG3, ABG5, ABG6, and ABG7 (Table 2). Up some differences among cell lines appeared at a late to date, all the five cell lines have been cultured stably passage (passage nos. 54 to 55). The ABG1 and ABG5 and constantly over at least the 73th passage and 402 lines have maintained a high ratio of wide-spread cells, culture days. For preservation and future use, all cell whereas the ABG3 and ABG6 lines contained domin- lines were cryopreserved in liquid nitrogen with a suffi- antly small polygonal cells. In the ABG7 line, two cell cient number of vials containing each cell lines at an types were mixed at a similar ratio (Fig. 2a). To evalu- interval of about 5 passages (Table 2). ate ploidy of the cell lines after long-term culture, DNA contents of each cell line at late passage were measured Determination of optimal growth condition by flow cytometry. As shown in Fig. 2b, all the five cell To decide optimal growth conditions for A. baerii lines showed diploid DNA contents similar to the gonad-derived cell lines, the effects of temperature and control cell line despite long-term culture. Two peaks FBS concentration on cellular growth were evaluated. As within diploid peak of the ABG7 line are seemed to be shown in Fig. 1, similar effects of temperature on cellular causedbythe property of theABG7linein which two growth were observed in the three cell lines tested. cell types existed at the same ratio. Next, RT-PCR ana- Significant high cell growth was detected at both 28 and lysis was conducted to identify the expression of a set 30 °C (p < 0.05), and it was decreased as temperature of genes that are known to be expressed in A. baerii gonad goes down. In 24 °C, the lowest cell growth was tissue in the established cell lines at both early and late observed, but the cells kept attaching on the substrata, passages. As the results, the expression of ar, lh,and sox9 maintained normal morphology, and grew slowly. To genes was maintained at late passage, more or less, in all test the effects of FBS concentration on cellular growth, the cell lines, but the cyp17a1 gene was not expressed at culture temperature was fixed at 28 °C according to the all in both early and late passages of all the cell lines. In result of temperature test. As expected, absence of FBS case of the star gene, overall expression was weak with no in the culture did not induce both cell growth and expression in the ABG1 line and its expression in the attachment in all the cell lines tested and growth rate ABG5 line was lost at late passage (Fig. 2c). was increased in a dose-dependent manner. The ABG3 and ABG5 lines grew better significantly in the media Post-thaw cell viability of A. baerii gonad-derived cell lines containing 15 and 20 % FBS relative to the other media To evaluate the feasibility of cryopreservation of the while the ABG1 line showed maximum growth in the established cell lines, the viabilities of post-thaw cells media containing 20 % FBS (p < 0.05). which were frozen and stored in liquid nitrogen (−196 °C) for 24 to 27 days were measured in each cell line. High Characterization of A. baerii gonad-derived cell lines post-thaw cell viabilities of more than 79.6 % were de- During the culture period, all the cell lines were com- tected in four cell lines including ABG1, 3, 5, and 7 (92.9, posed of mainly two types of cells based on morpho- 79.6, 86.4, and 90.0 %, respectively), but the ABG6 line logical criteria: wide-spread cells that occupy a wide showed significant low post-thaw cell viability of 57.6 % surface area and small polygonal cells that grow (Fig. 3; p <0.05). densely. At an early passage (passage nos. 15 to 16), a ratio of wide-spread cells was relatively higher than that Discussion of small polygonal cells in all cell lines and a certain In this study, we successfully established five A. baerii difference among cell lines was not observed visually. gonad-derived cell lines from five trials (success rate, As the cell lines were subcultured consistently, a ratio 5/5 = 100 %) and all established cell lines could grow of small polygonal cells was relatively increased and stably during a long period of more than 1 year without Table 2 Information of Acipenser baerii gonad-derived cell lines established in this study a b Name of Culture Cryopreservation cell line Passage no. in current Culture period (day) First passage no. Final passage no. Total no. of frozen cryopreserved cryopreserved vials stored ABG1 80 504 9 80 46 ABG3 73 434 7 73 58 ABG5 80 405 8 80 39 ABG6 78 525 5 70 54 ABG7 83 402 6 83 62 Composition of culture media was Leibovitz’s L-15 medium supplemented with 20 % (v/v) fetal bovine serum and 1 % (v/v) penicillin and streptomycin All cell lines were frozen and stored in liquid nitrogen (−196 °C) Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 5 of 8 Fig. 1 Determination of optimal growth conditions for Acipenser baerii gonad-derived cell lines on temperature and fetal bovine serum (FBS) concentration. Three cell lines were cultured in 96-well microplates under different temperatures, and FBS concentrations and cell growth were measured on days 1, 3, 5, and 7. FBS concentration was fixed at 20 % in temperature test, and temperature was fixed at 28 °C in FBS concentration test. Significant high cell growth was observed in the cell groups cultured at 28 and 30 °C in all the three cell lines tested. In case of FBS concentration, 15 and 20 % FBS induced significant high cell growth in the ABG3 and ABG5 lines, while the ABG1 line showed the maximum cell growth under 20 % FBS. All data are mean ± SD of three independent experiments. Different letters indicate significant differences, p <0.05 any significant growth retardation and marked deterior- continuous supply of feeder cells (Evans and Kaufman ation in culture. Furthermore, these cell lines showed high 1981; Matsui et al., 1992; Kanatsu-Shinohara et al., post-thaw cell viabilities of more than 79.6 % except one 2003; Takahashi and Yamanaka, 2006; Jing et al., 2010; line that showed 57.6 % post-thaw cell viability suggesting Pacchiarotti et al., 2010). Thus, in case of the feeder the feasibility of stable cryopreservation. These advantages cells that have a relatively short lifespan like mouse em- of easiness in cell line derivation, long-term maintenance, bryonic fibroblasts that are feeder cells for culturing and cryopreservation can maximize the availability of human and mouse embryonic stem cells, sacrifice of these cell lines as the feeder cells for culturing A. baerii animals and labor-intensive work for cell preparation germline stem cells. Culture of most stem cells requires should be conducted repeatedly (Amit et al., 2003). Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 6 of 8 Fig. 2 Characterization of five Acipenser baerii gonad-derived cell lines. a Morphologies of each cell line were observed at early and late passages. Early and late passages indicate the cells at passages 15 to 16 and passages 54 to 55, respectively. Two cell types were observed in culture: wide- spread cells that occupy a wide surface area and small polygonal cells that grow densely. A different ratio of two cell types in culture was observed depending on cell lines and passage number. Scale bar = 100 μm. b Flow cytometry was performed to analyze DNA contents of the cell lines at the late passage. A diploid A. baerii heart-derived cell line was used as a control (red lines). All cell lines maintained normal diploid state in spite of long-term culture. c RT-PCR analysis was performed to identify the expression of several genes including ar, cyp17a1, lh, sox9, and star in the cell lines at both early and late passages. All cell lines regardless of passage number expressed ar, lh,and sox9 but not expressed cyp17a1. Expression of star gene was very weak or not detected depending on cell lines. E, early passage; L, late passage Unlike this, the cell lines that can grow long-term and study. However, other conditions also can be attractive be stored stably are free to such limitations. In addition, based on our results. We found that the established cell limitation of using A. baerii as an endangered species lines could be cultured in a wide range of culture temper- also can be overcome by the advantages. On the other atures from 24 to 30 °C even though significant high cell side,these cell linesare able to playarolein universal growth was observed in 28 and 30 °C conditions. Culture biological studies such as toxicology and drug discov- in various temperatures may have a potential merit as ery, functional studies for genes and proteins, and study feeder cells because co-culture with germline stem cells for cell-pathogen interaction (Lakra et al., 2011). In- may require a different optimal culture temperature as in deed, there is a report that conducted virus susceptibil- the case of mammalian species (Lee et al., 2013). In ity test on Chinese sturgeon A. sinensis tail fin cell line addition, the results showed that 15 % FBS also induced to verify the feasibility of fish virus culture and isolation significant high cell growth at a similar level with 20 % using a cultured cell line (Zhou et al., 2008). FBS in the ABG3 and ABG5 lines, suggesting that the For cell culture, we used 28 °C culture temperature and application of a cell line-specific protocol can save overall the media containing 20 % FBS based on our previous re- cost by diminishing the use of high-cost FBS. port that cultured A. baerii heart-derived cell lines (Kim In general, tissue-derived primary cell populations in et al., 2014) and the results from the experiment in this culture undergo a selection process by various factors Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 7 of 8 To establish gonad-derived cell lines, we used a 1- year-old A. baerii of which sex cannot be indentified externally (Keyvanshokooh and Gharaei, 2010). Unfortu- nately, we could not carry out histological inspection of gonad tissues from which the cell lines were originated due to a lack of available sample. Moreover, because there is no marker to discriminate sex at a cellular level in this species, sex of the cell lines established in this study is not clear. Therefore, it remains to be demonstrated if which germline stem cells, female or male, the established cell lines can support better. In previous reports, in vitro culture of germline stem cells requires several growth factors such as fibroblast growth factor (FGF), glial cell- derived neurotrophic factor (GDNF), leukemia inhibitory Fig. 3 Cell viability after freezing and thawing of five Acipenser baerii factor (LIF), or stem cell factor (SCF) (Matsui et al., 1992; gonad-derived cell lines. Cell viability was measured immediately after Kubota et al., 2004; Zhang et al., 2011 in mammalian; thawing of frozen cells that were stored for 24 to 27 days in liquid Hong et al., 2004; Wong et al., 2013; Li et al., 2014 in fish). nitrogen. More than 79.6 % post-thaw cell viability was observed in all the cell lines except ABG6 that showed 57.6 % cell viability. These growth factors can be supplied by feeder cells or ex- Non-frozen cells were used as a control. All data are mean ± SD of ogenously. However, because commercially available three the independent experiments. Different letters indicate growth factors are usually of human or mouse origin, sup- significant differences, p <0.05 ply of them by feeder cells seems to be more appropriate in fish germline stem cell culture (Wong et al., 2013). In such as cellular damage in isolation, cell attachment, this study, we did not identify the expression of the limitations in nutrient or substrates, and growth compe- growth factors in the cell lines due to the absence of avail- tition between different cells. Thus, one or two cell types able information about them. Considering the importance are eventually remained when a cell line forms in most of the growth factors in supporting germline stem cells case (Freshney, 2010). Likewise, we observed that two in vitro, identification of their expression should be cell types were dominant in the culture of A. baerii checked in future studies. Otherwise, the cell lines gonad-dissociated cells in morphological criteria. At the can be manipulated artificially so as to express stably initial stage of culture, it looked that wide-spread cells such growth factors. were more predominant than small polygonal cells but the proportion of one of the two cell types was increased Conclusions as the culture was progressed in all the cell lines except This study reports the establishment of five A. baerii the ABG7 line that showed a similar ratio of the two cell gonad-derived cell lines that stable long-term culture types. This indicates that both cell types can be easily and cryopreservation were possible. These cell lines can adapted in the culture environment used in this study be utilized as a basic material to develop the culture and they are the major targets for further study. In system for germline stem cells in sturgeon species as another aspect, two cell types may represent each cell well as a tool for general biological studies. population at different differentiation stages in a com- Acknowledgements mon cell lineage. This work was supported by a Research Grant of Pukyong National University All cell lines showed diploid DNA contents at passages (year 2014). 54 to 55, indicating that all cell lines maintained an ori- Authors’ contributions ginal normal state without cell transformation featured JHR carried out the experiments and participated to write the manuscript. by aneuploidy or heteroploidy (Freshney, 2010). More- YKN conceived of the study and participated in its design. SPG conceived and designed the study, analyzed the data, and wrote the manuscript. All over, the genes expressed at early passage were still authors read and approved the final manuscript. expressed at late passage in all except the star gene of the ABG5 line. Although the data is very limited in Competing interests terms of the number of genes tested, this result implies The authors declare that they have no competing interests. that the cell lines maintained their original characteris- Author details tics in some degree at least up to passages 54 to 55. 1 Department of Marine Biomaterials and Aquaculture, Pukyong National Taken together, these findings suggest that the A. baerii University, Busan 608-737, South Korea. Department of Fisheries Biology, Pukyong National University, Busan 608-737, South Korea. Laboratory of Cell gonad-derived cell lines might be able to maintain their Biotechnology, Department of Marine Biomaterials and Aquaculture, College primary supportive role in germline stem cells in spite of of Fisheries Science, Pukyong National University, Busan 608-737, South long-term culture. Korea. Ryu et al. Fisheries and Aquatic Sciences (2016) 19:16 Page 8 of 8 Received: 27 January 2016 Accepted: 19 May 2016 Loir M. Trout Sertoli cells and germ cells in primary culture: morphological and ultrastructural study. Gamete Res. 1989;24:151–69. Matsui Y, Zsebo K, Hogan BL. Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell. 1992;70:841–7. Nagano M, Ryu BY, Brinster CJ, Avarbock MR, Brinster RL. Maintenance of mouse References male germ line stem cells in vitro. Biol Reprod. 2003;68:2207–14. Amit M, Margulets V, Segev H, Shariki C, Laevsky I, Coleman R, et al. Human Pacchiarotti J, Maki C, Ramos T, Marh J, Howerton K, Wong J, et al. Differentiation feeder layers for human embryonic stem cells. Biol Reprod. 2003;68:2150–6. potential of germ line stem cells derived from the postnatal mouse ovary. Aponte PM, Soda T, Teerds KJ, Mizrak SC, van de Kant HJ, de Rooij DG. Differentiation. 2010;79:159–70. Propagation of bovine spermatogonial stem cells in vitro. Reproduction. Park TS, Kim MA, Lim JM, Han JY. Production of quail (Coturnix japonica) germline 2008;136:543–57. chimeras derived from in vitro-cultured gonadal primordial germ cells. Mol Berbejillo J, Martinez-Bengochea A, Bedo G, Brunet F, Volff JN, Vizziano-Cantonnet D. Reprod Dev. 2008;75:274–81. Expression and phylogeny of candidate genes for sex differentiation in a Ruban G, Zhu B. Acipenser baerii, The IUCN Red List of Threatened Species 2010: primitive fish species, the Siberian sturgeon, Acipenser baerii. Mol Reprod Dev. e.T244A13046607. 2010. 2012;79:504–16. Sakai N. Transmeiotic differentiation of zebrafish germ cells into functional sperm Brinster RL. Male germline stem cells: from mice to men. Science. 2007;316:404–5. in culture. Development. 2002;129:3359–65. Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from Shikina S, Yoshizaki G. Improved in vitro culture conditions to enhance the mouse embryos. Nature. 1981;292:154–6. survival, mitotic activity, and transplantability of rainbow trout type a Fan L, Moon J, Wong TT, Crodian J, Collodi P. Zebrafish primordial germ cell spermatogonia. Biol Reprod. 2010;83:268–76. cultures derived from vasa::Rfp transgenic embryos. Stem Cells Dev. Shikina S, Ihara S, Yoshizaki G. Culture conditions for maintaining the survival and 2008;17:585–97. mitotic activity of rainbow trout transplantable type A spermatogonia. Mol Freshney RI. Culture of animal cells: a manual of basic technique and specialized Reprod Dev. 2008;75:529–37. applications. 6th ed. Hoboken: Wiley-Blackwell; 2010. Song Y, Duraisamy S, Ali J, Kizhakkayil J, Jacob VD, Mohammed MA, et al. Gisbert E, Ruban GI. Ontogenetic behavior of Siberian sturgeon, Acipenser baerii: Characteristics of long-term cultures of avian primordial germ cells and a synthesis between laboratory tests and field data. Environ Biol Fish. 2003; gonocytes. Biol Reprod. 2014;90:15. 67:311–9. Spradling A, Fuller MT, Braun RE, Yoshida S. Germline stem cells. Cold Spring Guan K, Nayernia K, Maier LS, Wagner S, Dressel R, Lee JH, et al. Pluripotency of Harb Perspect Biol. 2011;3:a002642. spermatogonial stem cells from adult mouse testis. Nature. 2006;440:1199–203. TakahashiK,YamanakaS.Induction of pluripotent stem cells from mouse embryonic Hofmann MC, van Der Wee KS, Dargart JL, Dirami G, Dettin L, Dym M. and adult fibroblast cultures by defined factors. Cell. 2006;126:663–76. Establishment and characterization of neonatal mouse Sertoli cell lines. J Tiptanavattana N, Thongkittidilok C, Techakumphu M, Tharasanit T. Androl. 2003;24:120–30. Characterization and in vitro culture of putative spermatogonial stem cells Hong Y, Liu T, Zhao H, Xu H, Wang W, Liu R, et al. Establishment of a normal derived from feline testicular tissue. J Reprod Dev. 2013;59:189–95. medakafish spermatogonial cell line capable of sperm production in vitro. Wong TT, Collodi P. Dorsomorphin promotes survival and germline competence Proc Natl Acad Sci U S A. 2004;101:8011–6. of zebrafish spermatogonial stem cells in culture. PLoS ONE. 2013;8:e71332. Hong N, Li Z, Hong Y. Fish stem cell cultures. Int J Biol Sci. 2011;7:392–402. Wong TT, Tesfamichael A, Collodi P. Production of zebrafish offspring from Jing D, Fonseca AV, Alakel N, Fierro FA, Muller K, Bornhauser M, et al. cultured female germline stem cells. PLoS ONE. 2013;8:e62660. Hematopoietic stem cells in co-culture with mesenchymal stromal Zhang Y, Yang Z, Yang Y, Wang S, Shi L, Xie W, et al. Production of transgenic cells—modeling the niche compartments in vitro. Haematologica. mice by random recombination of targeted genes in female germline stem 2010;95:542–50. cells. J Mol Cell Biol. 2011;3:132–41. Kanatsu-Shinohara M, Ogonuki N, Inoue K, Miki H, Ogura A, Toyokuni S, et al. Zhou GZ, Gui L, Li ZQ, Yuan XP, Zhang QY. Establishment of a Chinese sturgeon Long-term proliferation in culture and germline transmission of mouse male Acipenser sinensis tail-fin cell line and its susceptibility to frog iridovirus. J Fish germline stem cells. Biol Reprod. 2003;69:612–6. Biol. 2008;73:2058–67. Kanatsu-Shinohara M, Inoue K, Takashima S, Takehashi M, Ogonuki N, Morimoto H, et al. Reconstitution of mouse spermatogonial stem cell niches in culture. Cell Stem Cell. 2012;11:567–78. Kawasaki T, Saito K, Sakai C, Shinya M, Sakai N. Production of zebrafish offspring from cultured spermatogonial stem cells. Genes to Cells. 2012;17:316–25. Keyvanshokooh S, Gharaei A. A review of sex determination and searches for sex-specific markers in sturgeon. Aquac Res. 2010;41:e1–7. Kim MS, Nam YK, Park C, Kim HW, Ahn J, Lim JM, et al. Establishment condition and characterization of heart-derived cell culture in Siberian sturgeon (Acipenser baerii). In Vitro Cell Dev Biol Anim. 2014;50:909–17. Kubota H, Avarbock MR, Brinster RL. Growth factors essential for self-renewal and expansion of mouse spermatogonial stem cells. Proc Natl Acad Sci U S A. 2004;101:16489–94. Lacerda SM, Costa GM, da Silva MA, Campos-Junior PH, Segatelli TM, Peixoto MT, et al. Phenotypic characterization and in vitro propagation and transplantation of the Nile tilapia (Oreochromis niloticus) spermatogonial stem Submit your next manuscript to BioMed Central cells. Gen Comp Endocrinol. 2013;192:95–106. Lacerda SM, Costa GM, de França LR. Biology and identity of fish spermatogonial and we will help you at every step: stem cell. Gen Comp Endocrinol. 2014;207:56–65. • We accept pre-submission inquiries Lakra WS, Swaminathan TR, Joy KP. Development, characterization, conservation and storage of fish cell lines: a review. Fish Physiol Biochem. 2011;37:1–20. � Our selector tool helps you to find the most relevant journal Lee WY, Park HJ, Lee R, Lee KH, Kim YH, Ryu BY, et al. Establishment and in vitro � We provide round the clock customer support culture of porcine spermatogonial germ cells in low temperature culture � Convenient online submission conditions. Stem Cell Res. 2013;11:1234–49. Lee KH, Lee R, Lee WY, Kim DH, Chung HJ, Kim JH, et al. Identification and � Thorough peer review in vitro derivation of spermatogonia in beagle testis. PLoS ONE. 2014;9: � Inclusion in PubMed and all major indexing services e109963. � Maximum visibility for your research Lehmann R. Germline stem cells: origin and destiny. Cell Stem Cell. 2012;10:729–39. Li Z, Li M, Hong N, Yi M, Hong Y. Formation and cultivation of medaka primordial Submit your manuscript at germ cells. Cell Tissue Res. 2014;357:71–81. www.biomedcentral.com/submit

Journal

Fisheries and Aquatic Sciences – Springer Journals

Published: Jun 4, 2016

There are no references for this article.