Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

ERCC1 mRNA levels can predict the response to cisplatin-based concurrent chemoradiotherapy of locally advanced cervical squamous cell carcinoma

ERCC1 mRNA levels can predict the response to cisplatin-based concurrent chemoradiotherapy of... Background: The purpose of this study was to investigate whether the excision repair cross-complementation group 1 (ERCC1) mRNA expression could predict treatment response of patients with locally advanced cervical squamous cell carcinoma (LACSCC) who underwent cisplatin-based concurrent chemoradiotherapy (CCCRT). Methods: A total of sixty LACSCC patients, treated with radical CCCRT from a single institution were evaluated. ERCC1 mRNA expression was determined by quantitative real-time RT-PCR in pre-treatment tumor tissues. The association of ERCC1 status with clinicopathological characteristics (age, histological grade, tumor size, parametrial invasion, lymph node metastasis and FIGO stage) and treatment response were analyzed. Results: No significant association between ERCC1 mRNA expression and clinicopathological characteristics were observed. Patients with low ERCC1 mRNA level had a significantly higher rate of complete response (86.21%) than patients with high level of ERCC1 expression (19.36%; p < 0.001). In the logistic regression analysis, low ERCC1 mRNA level retained an independent role in predicting complete response to CCCRT (P < 0.001). An ERCC1 expression level of 0.0901 was determined as an optimal cutoff value to identify complete response patients to CCCRT treatment. The sensitivity for detection of a complete response was 81.48% with a specificity of 96.97% (area under the curve, 0.893; 95% confidence interval, 0.804–0.983). Conclusions: This is the first analysis of the association between ERCC1 mRNA levels and treatment response in patients with LACSCC. Low ERCC1 mRNA level appears to be a highly specific predictor of response to CCCRT in LACSCC. Keywords: Excision repair cross-complementation group 1 (ERCC1), Cervical squamous cell carcinoma, Chemoradiotherapy, Response prediction Background severe side effects [2]. Identification of biomarkers which The current standard treatment of locally advanced cer- predict response to CCCRT will allow patients to avoid vical cancer is cisplatin-based concurrent chemora- toxicity associated with the ineffective therapy. diotherapy (CCCRT), followed by brachytherapy [1]. One of the most promising biomarkers for response pre- However, individual patients may show quite different diction is the excision repair cross-complementation patterns of response against CCCRT; some can be cured, group 1 (ERCC1). ERCC1, which is involved in nucleotide but others cannot, and the latter may therefore suffer excision repair and associated with resistance to cisplatin- based chemotherapy or chemoradiotherapy in various types of cancer [3-10]. Earlier in vitro studies have linked * Correspondence: nxzh1961@hotmail.com cisplatin resistance to the expression of ERCC1 mRNA in Equal contributors cell lines of cervical cancers [11]. In a murine xenograft Department of Radiation Oncology, General Hospital of Ningxia Medical University, No.804 Shengli Str, Yinchuan, Ningxia 750004, China model, upregulated ERCC1 expression is associated with Full list of author information is available at the end of the article © 2012 Bai et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Bai et al. Radiation Oncology 2012, 7:221 Page 2 of 6 http://www.ro-journal.com/content/7/1/221 Table 1 Clinicopathological characteristics of the patients radioresistance in tumors derived from cervical carcinoma with LACSCC according to the ERCC1 mRNA levels cells [12]. However, the association of ERCC1 and treat- Characteristic ERCC1 mRNA P ment response in clinical setting, especially for cervical squamous cell carcinoma, has not be well documented. High level Low level The purpose of present study was to evaluate whether the Age, y ERCC1 mRNA expression levels could predict the treat- ≤50 14 13 ment response of patients with locally advanced cervical >50 15 18 0.622 squamous cell carcinoma (LACSCC) who underwent Histologic grade CCCRT. Well and moderately differentiated 12 19 Patients and methods Poorly differentiated 17 12 0.123 Patients and samples Tumor size, cm Cervical squamous cell carcinoma tissues and correspond- ≤48 12 ing non-tumorous tissues were obtained with informed >4 21 19 0.361 consent from sixty consecutive LACSCC patients who Parametrial invasion underwent biopsy before CCCRT at Ningxia Medical No 14 15 University General Hospital, between June 2009 and June 2010, and frozen in liquid nitrogen until further analysis. Unilateral 12 11 Patients had a median age of 53 years (range 36 to 80 years) Bilateral 3 5 0.774 and no patient received previous radiotherapy or chemo- Clinical lymph node involvement therapy. Histologically, all primary tumors were squamous N0 18 26 cell carcinoma. Staging was performed according to Inter- N1 11 5 0.056 national Federation of Gynecology and Obstetrics (FIGO) FIGO stage staging system classification. Clinicopathological charac- teristics of these patients are listed in Table 1. This study II 14 22 was approved by the ethics committee of our hospital. III 15 9 0.073 Hemoglobin levels at diagnosis, g/dL Treatment and response ≤11.3 8 5 The pretreatment evaluation included a review of the >11.3 21 26 0.282 patient’s history, physical examination, performance status, Platelets at diagnosis, ×10 /L biopsy and gynecologic examination under general anesthesia, chest X-ray, complete blood count, blood ≤320 26 24 chemistry, and abdominal-pelvic magnetic resonance im- >320 3 7 0.204 aging. Cystoscopy and sigmoidoscopy were performed Abbreviations: LACSCC locally advanced cervical squamous cell carcinomas, ERCC1 excision repair cross-complementation group 1, FIGO International when indicated. Federation of Gynecology and Obstetrics. Radiotherapy included external beam radiotherapy up to 50 Gy and low-dose rate brachytherapy, six applications of 6 Gy. Chemotherapy consisted of weekly intravenous from the cancerous and corresponding non-tumorous tis- cisplatin administration (40 mg/m ) for 5 cycles concomi- sues. Concentration of total RNA was estimated by a tant with external pelvic radiation. Treatment response SmarSpec Plus spectrophotometer (BIO-RAD, Hercules, was clinically assessed according to the RECIST criteria CA,USA) and stored at −80°C. [13]. We categorized patients into two response groups: After treatment with DNAfree (Ambion, Austin, TX, the sensitive group and the resistant group. The sensitive USA) to remove chromosomal DNA, complementary DNA group included those patients who achieved a complete (cDNA) was synthesized using SuperScript III Reverse response (CR as indicated in the RECIST criteria) and Transcriptase (Invitrogen, Carlsbad, CA, USA) and stored remained in remission throughout the follow-up period. at −20°C until use. Theresistant groupincludedpatients who hadpersistent The mRNA expression levels of ERCC1 and beta-actin disease (PR, SD and PD as indicated in the RECIST criteria) were measured by quantitative RT-PCR using IQ 5 after treatment or developed a relapse after remission. Multicolor Real-Time PCR Detection Systerm (BIO-RAD, Hercules, CA, USA). The cycling conditions were as fol- RNA Extraction, reverse transcription and quantitative lows: 10 min of an initial denaturation step at 95°C, fol- real time RT-PCR (QRT-PCR) assays lowed by 40 cycles of 30 sec at 95°C, 30 sec at 58°C and RNA was isolated using the Trizol reagent (Invitrogen, 30 sec at 72°C. The following primers were used: ERCC1, Carlsbad, CA, USA) following the manufacturer’sprotocol Bai et al. Radiation Oncology 2012, 7:221 Page 3 of 6 http://www.ro-journal.com/content/7/1/221 forward: CCTCAGACCTACGCCGAATA; reverse: GCT CACAATGATGCTGTTGG [14]; and beta-actin, forward: TGACGTGGACATCCGCAAAG; Reverse: CTGGAAGGT GGACAGCGAGG.PCR products were scanned, and quan- tification was performed by the Quantity One program (Bio-Rad, Hercules, CA, USA). The expression of beta- actin was used as an internal control. The ERCC1 expres- sion level was normalized to the beta-actin mRNA level -△△Ct using the 2 method [15]. Statistical analysis The median relative ERCC1 mRNA expression level stan- dardized for beta-actin was selected as cut-off value of high and low level ERCC1 expression. Associations between dichotomized ERCC1 mRNA levels and clinicopathological Figure 1 The mean value of ERCC1 mRNA expression between characteristics were assessed for statistical significance sensitive and resistant groups. using a chi-square test. Logistic regression models were used to identify independent predictive factors for treat- ment response. Cut-off values for discrimination of ERCC1 sensitivity for detection of a complete response was 81.48% mRNA levels and treatment response were derived from re- with a specificity of 96.97% (area under the curve, 0.893; ceiver operating curve data (ROC; area under the curve 95% confidence interval, 0.804–0.983) (Figure 2). and the 95% confidence interval). All reported P values are two-sided, and P less than 0.05 was considered statistically Discussions significant. SPSS 13.0 (SPSS Inc., Chicago, IL) was used for The addition of concurrent cisplatin-based chemotherapy the statistical analysis. to standard radiotherapy could reduce the risk of recur- rence and disease-related death rates from locally advanced Results cervical cancer by as much as 50% [16,17]. However, those ERCC1 mRNA expression levels were successfully mea- without a response will have toxicity helplessly. It would be sured in sixty patients. The median measured value of useful to predict the response and to search for novel ERCC1 mRNA was 23.06 (range, 18.78–25.46). The median approaches for non-responders [18]. relative ERCC1 mRNA expression level standardized for ERCC1 plays an important role in recognizing and re- beta-actin was 0.0347 (range, 0.0028–5.4264). Thirty-one moving cisplatin–induced DNA adducts and repairs inter- (51.67%) patients were classified as having high level. No strand cross-links in DNA and recombination processes significant differences were found in the clinicopathological [19,20]. Several preclinical and clinical studies have investi- characteristics between the patients with high ERCC1 gated the expression of ERCC1 mRNA and protein in mul- mRNA level and those with low level (Table 1). tiple cancer types and have demonstrated a correlation All patients received the external beam radiotherapy and between the ERCC1 expression levels and the treatment re- brachytherapy as indicated in the protocol. For myelosurp- sponse to platinum-based therapy and/or survival outcome pression and infectious complications, only 34 (56.67%) [3-10]. These results suggest that ERCC1 expression may patients received 5 cycles cisplatin-based concurrent assist in selecting patients most likely to benefit from plat- chemotherapy. The treatment response was evaluated by inum agent-based chemotherapy or chemoradiotherapy. CT imaging after treatment completion. Of the 60 patients There are three other studies evaluated the relationship who entered the study, 33 (55%) patients had complete re- of ERCC1 status and the treatment response or survival of sponse. Patients with low ERCC1 mRNA level had a sig- the patients with cervical carcinoma who received radio- nificantly higher complete response rate (86.21%) than therapy or chemoradiotherapy. Liang et al. assessed the patients with high expression levels (19.36%; p < 0.001) ERCC1 expression of 50 patients with cervical squamous (Figure 1). In the logistic regression analysis, only low cell carcinomas who received cisplatin-based concur- ERCC1 mRNA level retained an independent role in pre- rent chemoradiotherapy by immunohistochemistry (IHC) dicting complete response to CCCRT (Table 2). method. They found ERCC1-negative patients had a ROC analysis was applied to determine an ERCC1 significantlyhighercompleteresponseratethanERCC1- mRNA value that best segregates patients into complete re- positive patients (P = 0.015). The 5-year overall survival sponse or non-complete response. An ERCC1 expression (OS) rates for the ERCC1-positive and ERCC1-negative level of 0.0901 was determined as an optimal cutoff value groups were 50.0% and 85.3%, respectively. For OS, lack of to identify complete response to CCCRT treatment. The ERCC1 expression was an independent prognostic factor Bai et al. Radiation Oncology 2012, 7:221 Page 4 of 6 http://www.ro-journal.com/content/7/1/221 Table 2 Results of logistic regression analysis for clinical factors and response to CCCRT B SE Wald P value OR 95% CI for OR Age −0.104 0.064 2.599 0.107 0.902 0.795-1.023 Histologic grade −0.450 1.090 0.171 0.680 0.638 0.075-5.399 Tumor size 2.908 1.567 3.445 0.063 18.315 0.850-394.766 Parametrial invasion 2.773 1.878 2.180 0.140 16.011 0.403-635.705 Lymph node status −0.274 1.060 0.067 0.796 0.760 0.095-6.074 FIGO stage 2.471 1.797 1.891 0.169 11.836 0.349-400.843 Hemoglobin levels at diagnosis −0.326 1.252 0.068 0.795 0.722 0.062-8.398 Platelets at diagnosis −0.166 1.309 0.016 0.899 0.847 0.065-11.013 ERCC1 mRNA status 5.003 1.408 12.624 0.000 148.869 9.424-2351.736 Chemotherapy cycles −0.932 1.073 0.755 0.385 0.394 0.048-3.225 Abbreviations: CCCRT cisplatin-based concurrent chemoradiotherapy, B regression coefficient, SE standard error, Wald Wald value, OR odds ratio, CI confidence interval, FIGO International Federation of Gynecology and Obstetrics, ERCC1 excision repair cross-complementation group 1. [21]. Doll et al. evaluated the association of ERCC1 expres- Although the results of our study are similar to Liang’s sion, using both mRNA and protein expression analysis, and Hasegawa’s study, which are opposite to Doll’sstudy. with clinical outcome in cervical cancer patients treated The first reason of these differences is the histology type with radical radiotherapy. ERCC1 mRNA level was deter- of enrolled patients was different. Squamous cell carcin- mined by real-time PCR, and ERCC1 protein expression oma comprises around 85% to 90% of uterine cervical can- (FL297, 8F1) was measured using quantitative IHC. cer [24,25]. It has different biology behavior and treatment ERCC1 protein expression levels using both FL297 and response when compared with adenocacinoma [2,26]. In 8F1 antibodies were determined for 112 patients; mRNA Doll’s study, there are 11% patients with cervical adenocar- analysis was performed in 32 patients. In the 112 patients, cinoma. The second reason is that the treatment method 99 patients were squamous cell carcinomas, and 33 was different between two studies. In Doll’sstudy, they patients were adenocarcinomas. Low ERCC1 mRNA ex- used radiation alone. In fact, ERCC1 expression and the pression status was associated with worse OS (p = 0.046). response of chemotherapy also have interaction [10]. ERCC1 protein expression using the FL297 antibody, but There are some shortages in this study. Firstly, we did not the 8F1 antibody, was significantly associated with not perform IHC. High ERCC1 mRNA only signifies both OS (p = 0.002) [22]. Hasegawa et al. analyzed the ERCC1 DNA transcription and does not necessarily reflect ERCC1 expression of 36 patients with cervical adenocar- cinoma by IHC method. Among the 25 patients who received cisplatin-based chemotherapy or chemora- diotherapy with cisplatin, those with high ERCC1 expres- sion experienced significantly worse disease-free survival than those with low ERCC1 expression (P =0.002). More- over, univariate and multivariate analyses revealed that high ERCC1 expression was an independent prognostic factor in patients receiving cisplatin-based chemotherapy or chemoradiotherapy with cisplatin [23]. Our study is the first analysis of the association between ERCC1 mRNA ex- pression and treatment response in patients with cervical squamous cell carcinomas who received radical cisplatin- based concurrent chemoradiotherapy. Sixty patients were evaluated in this study, which is the largest number among these studies. We firstly found that cervical squamous cell carcinomas patients with low ERCC1 mRNA level had a significantly higher rate of complete response than patients with high level of ERCC1 expression (P < 0.001). In the lo- gistic regression analysis, low ERCC1 mRNA level retained Figure 2 ROC curve depicting sensitivity and specificity of an independent role in predicting complete response to ERCC1 mRNA levels in predicting complete response of CCCRT. CCCRT (P < 0.001). Bai et al. Radiation Oncology 2012, 7:221 Page 5 of 6 http://www.ro-journal.com/content/7/1/221 the production of functional ERCC1 protein, which could Oncology Genitourinary Group: Gene expression of ERCC1 as a novel prognostic marker in advanced bladder cancer patients receiving be assessed by IHC. We will evaluate the ERCC1 protein cisplatin-based chemotherapy. Ann Oncol 2007, 18(3):522–528. expression and the treatment response of LACSCC in fur- 7. Scheil-Bertram S, Tylus-Schaaf P, du Bois A, Harter P, Oppitz M, ther study. Secondly, the number of patients was small. Ewald-Riegler N, Fisseler-Eckhoff A: Excision repair cross-complementation group 1 protein overexpression as a predictor of poor survival for We need do further research to validate the results in high-grade serous ovarian adenocarcinoma. Gynecol Oncol 2010, large number patients. Lastly, due to the short follow-up 119(2):325–331. time, the association of ERCC1 mRNA levels and survival 8. Handra-Luca A, Hernandez J, Mountzios G, Taranchon E, Lacau-St-Guily J, Soria JC, Fouret P: Excision repair cross complementation group 1 was not performed in present study at this point. immunohistochemical expression predicts objective response and cancer-specific survival in patients treated by Cisplatin-based induction Conclusions chemotherapy for locally advanced head and neck squamous cell carcinoma. Clin Cancer Res 2007, 13(13):3855–3859. This is the first study to evaluate the relationship of 9. Warnecke-Eberz U, Metzger R, Miyazono F, Baldus SE, Neiss S, Brabender J, ERCC1 mRNA levels and complete response of LACSCC Schaefer H, Doerfler W, Bollschweiler E, Dienes HP, Mueller RP, Danenberg who underwent CCCRT. We have shown that ERCC1 ex- PV, Hoelscher AH, Schneider PM: High specificity of quantitative excision repair cross-complementing 1 messenger RNA expression for prediction pression patterns in pretreatment cancerous specimens of minor histopathological response to neoadjuvant radiochemotherapy can be effectively used to predict response to CCCRT. in esophageal cancer. Clin Cancer Res 2004, 10(11):3794–3799. These results suggest that ERCC1 expression may assist in 10. Metzger R, Bollschweiler E, Hölscher AH, Warnecke-Eberz U: ERCC1: impact in multimodality treatment of upper gastrointestinal cancer. selecting patients most likely to benefit from CCCRT. Fur- Future Oncol 2010, 6(11):1735–1749. ther investigation is required to determine whether these 11. Britten RA, Liu D, Tessier A, Hutchison MJ, Murray D: ERCC1 expression as a assays are sufficiently reliable to use routinely as a basis to molecular marker of cisplatin resistance in human cervical tumor cells. Int J Cancer 2000, 89(5):453–457. select specific patient treatments. 12. Hampson L, El Hady ES, Moore JV, Kitchener H, Hampson IN: The HPV16 E6 and E7 proteins and the radiation resistance of cervical carcinoma. Competing interests FASEB J 2001, 15(8):1445–1447. The authors declare that they have no competing interests. 13. Therasse P, Arbuck SG, Eisenhauer EA, Wanders J, Kaplan RS, Rubinstein L, Verweij J, Van Glabbeke M, van Oosterom AT, Christian MC, Gwyther SG: Authors’ contributions New guidelines to evaluate the response to treatment in solid tumors. ZL Bai and YY Wang participated in acquiring clinical and laboratory data, data European Organization for Research and Treatment of Cancer, National analysis and interpretation, acquiring clinical samples, follow-up clinical Cancer Institute of the United States, National Cancer Institute of information and final writing of the manuscript. H Zhe, JL He and P Hai Canada. J Natl Cancer Inst 2000, 92(3):205–216. participated in acquiring clinical and laboratory data, data analysis and data 14. Sonnenberg M, van der Kuip H, Haubeis S, Fritz P, Schroth W, Friedel G, interpretation and drafted the manuscript. All authors read and approved the Simon W, Mürdter TE, Aulitzky WE: Highly variable response to cytotoxic final manuscript. chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast. BMC Cancer 2008, 8:364. Author details 15. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using Graduate School, Ningxia Medical University, No.1160 Shengli Str, Yinchuan, real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Ningxia 750004, China. Department of Radiation Oncology, General Hospital Methods 2001, 25(4):402–408. of Ningxia Medical University, No.804 Shengli Str, Yinchuan, Ningxia 750004, 16. Eifel PJ: Concurrent chemotherapy and radiation: a major advance for China. women with cervical cancer. J Clin Oncol 1999, 17(5):1334–1335. 17. Green JA, Kirwan JM, Tierney JF, Symonds P, Fresco L, Collingwood M, Received: 13 June 2012 Accepted: 17 December 2012 Williams CJ: Survival and recurrence after concomitant chemotherapy Published: 23 December 2012 and radiotherapy for cancer of the uterine cervix: a systematic review and meta-analysis. Lancet 2001, 358(9284):781–786. References 18. Klopp AH, Eifel PJ: Biological predictors of cervical cancer response to 1. Haie-Meder C, Morice P, Castiglione M, ESMO Guidelines Working Group: radiation therapy. Semin Radiat Oncol 2012, 22(2):143–150. Cervical cancer: ESMO clinical recommendations for diagnosis, treatment 19. Sancar A: Mechanisms of DNA excision repair. Science 1994, and follow-up. Ann Oncol 2009, 20(Suppl 4):iv27–iv28. 266(5193):1954–1956. 2. Quinn MA, Benedet JL, Odicino F, Maisonneuve P, Beller U, Creasman WT, 20. Reed E: Platinum-DNA adduct, nucleotide excision repair and platinum Heintz AP, Ngan HY, Pecorelli S: Carcinoma of the cervix uteri. FIGO 26th based anti-cancer chemotherapy. Cancer Treat Rev 1998, 24(5):331–344. Annual Report on the Results of Treatment in Gynecological Cancer. 21. Liang ZL, Song EK, Ko YB, Lee NR, Yhim HY, Noh HT, Yun HJ, Suh KS, Jo DY, Int J Gynaecol Obstet 2006, 95(Suppl 1):S43–S103. Kim S, Kim JS, Kim JM, Lee HJ: Excision repair cross-complementation 3. Olaussen KA, Dunant A, Fouret P, Brambilla E, André F, Haddad V, group 1 expression predicts response and survival in locally advanced Taranchon E, Filipits M, Pirker R, Popper HH, Stahel R, Sabatier L, Pignon JP, cervical carcinoma patients treated with concurrent chemoradiotherapy. Tursz T, Le Chevalier T, Soria JC, IALT Bio Investigators: DNA repair by Histopathology 2011, 59(3):564–567. ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant 22. Doll CM, Prystajecky M, Eliasziw M, Klimowicz AC, Petrillo SK, Craighead PS, chemotherapy. N Engl J Med 2006, 355(10):983–991. Hao D, Diaz R, Lees-Miller SP, Magliocco AM: Low ERCC1 mRNA and 4. Metzger R, Leichman CG, Danenberg KD, Danenberg PV, Lenz HJ, Hayashi K, protein expression are associated with worse survival in cervical cancer Groshen S, Salonga D, Cohen H, Laine L, Crookes P, Silberman H, Baranda J, patients treated with radiation alone. Radiother Oncol 2010, 97(2):352–359. Konda B, Leichman L: ERCC1 mRNA levels complement thymidylate 23. Hasegawa K, Kato R, Torii Y, Ichikawa R, Oe S, Udagawa Y: The relationship synthase mRNA levels in predicting response and survival for gastric between ERCC1 expression and clinical outcome in patients with FIGO cancer patients receiving combination cisplatin and fluorouracil stage I to stage II uterine cervical adenocarcinoma. chemotherapy. J Clin Oncol 1998, 16(1):309–316. Int J Gynecol Cancer 2011, 21(8):1479–1485. 5. Kim MK, Cho KJ, Kwon GY, Park SI, Kim YH, Kim JH, Song HY, Shin JH, Jung 24. Smith HO, Tiffany MF, Qualls CR, Key CR: The rising incidence of HY, Lee GH, Choi KD, Kim SB: ERCC1 predicting chemoradiation resistance adenocarcinoma relative to squamous cell carcinoma of the uterine and poor outcome in oesophageal cancer. Eur J Cancer 2008, 44(1):54–60. cervix in the United States–a 24-year population-based study. 6. Bellmunt J, Paz-Ares L, Cuello M, Cecere FL, Albiol S, Guillem V, Gallardo E, Gynecol Oncol 2000, 78(2):97–105. Carles J, Mendez P, de la Cruz JJ, Taron M, Rosell R, Baselga J, Spanish Bai et al. Radiation Oncology 2012, 7:221 Page 6 of 6 http://www.ro-journal.com/content/7/1/221 25. Chan PG, Sung HY, Sawaya GF: Changes in cervical cancer incidence after three decades of screening US women less than 30 years old. Obstet Gynecol 2003, 102(4):765–773. 26. Yeasmin S, Nakayama K, Rahman MT, Rahman M, Ishikawa M, Katagiri A, Iida K, Nakayama N, Otuski Y, Kobayashi H, Nakayama S, Miyazaki K: Biological and clinical significance of NAC1 expression in cervical carcinomas: a comparative study between squamous cell carcinomas and adenocarcinomas/adenosquamous carcinomas. Hum Pathol 2012, 43(4):506–519. doi:10.1186/1748-717X-7-221 Cite this article as: Bai et al.: ERCC1 mRNA levels can predict the response to cisplatin-based concurrent chemoradiotherapy of locally advanced cervical squamous cell carcinoma. Radiation Oncology 2012 7:221. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Radiation Oncology Springer Journals

ERCC1 mRNA levels can predict the response to cisplatin-based concurrent chemoradiotherapy of locally advanced cervical squamous cell carcinoma

Download PDF
6 pages

Loading next page...
 
/lp/springer-journals/ercc1-mrna-levels-can-predict-the-response-to-cisplatin-based-RXhIs0b8v7

References (29)

Publisher
Springer Journals
Copyright
Copyright © 2012 by Bai et al.; licensee BioMed Central Ltd.
Subject
Medicine & Public Health; Oncology; Radiotherapy
eISSN
1748-717X
DOI
10.1186/1748-717X-7-221
pmid
23259415
Publisher site
See Article on Publisher Site

Abstract

Background: The purpose of this study was to investigate whether the excision repair cross-complementation group 1 (ERCC1) mRNA expression could predict treatment response of patients with locally advanced cervical squamous cell carcinoma (LACSCC) who underwent cisplatin-based concurrent chemoradiotherapy (CCCRT). Methods: A total of sixty LACSCC patients, treated with radical CCCRT from a single institution were evaluated. ERCC1 mRNA expression was determined by quantitative real-time RT-PCR in pre-treatment tumor tissues. The association of ERCC1 status with clinicopathological characteristics (age, histological grade, tumor size, parametrial invasion, lymph node metastasis and FIGO stage) and treatment response were analyzed. Results: No significant association between ERCC1 mRNA expression and clinicopathological characteristics were observed. Patients with low ERCC1 mRNA level had a significantly higher rate of complete response (86.21%) than patients with high level of ERCC1 expression (19.36%; p < 0.001). In the logistic regression analysis, low ERCC1 mRNA level retained an independent role in predicting complete response to CCCRT (P < 0.001). An ERCC1 expression level of 0.0901 was determined as an optimal cutoff value to identify complete response patients to CCCRT treatment. The sensitivity for detection of a complete response was 81.48% with a specificity of 96.97% (area under the curve, 0.893; 95% confidence interval, 0.804–0.983). Conclusions: This is the first analysis of the association between ERCC1 mRNA levels and treatment response in patients with LACSCC. Low ERCC1 mRNA level appears to be a highly specific predictor of response to CCCRT in LACSCC. Keywords: Excision repair cross-complementation group 1 (ERCC1), Cervical squamous cell carcinoma, Chemoradiotherapy, Response prediction Background severe side effects [2]. Identification of biomarkers which The current standard treatment of locally advanced cer- predict response to CCCRT will allow patients to avoid vical cancer is cisplatin-based concurrent chemora- toxicity associated with the ineffective therapy. diotherapy (CCCRT), followed by brachytherapy [1]. One of the most promising biomarkers for response pre- However, individual patients may show quite different diction is the excision repair cross-complementation patterns of response against CCCRT; some can be cured, group 1 (ERCC1). ERCC1, which is involved in nucleotide but others cannot, and the latter may therefore suffer excision repair and associated with resistance to cisplatin- based chemotherapy or chemoradiotherapy in various types of cancer [3-10]. Earlier in vitro studies have linked * Correspondence: nxzh1961@hotmail.com cisplatin resistance to the expression of ERCC1 mRNA in Equal contributors cell lines of cervical cancers [11]. In a murine xenograft Department of Radiation Oncology, General Hospital of Ningxia Medical University, No.804 Shengli Str, Yinchuan, Ningxia 750004, China model, upregulated ERCC1 expression is associated with Full list of author information is available at the end of the article © 2012 Bai et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Bai et al. Radiation Oncology 2012, 7:221 Page 2 of 6 http://www.ro-journal.com/content/7/1/221 Table 1 Clinicopathological characteristics of the patients radioresistance in tumors derived from cervical carcinoma with LACSCC according to the ERCC1 mRNA levels cells [12]. However, the association of ERCC1 and treat- Characteristic ERCC1 mRNA P ment response in clinical setting, especially for cervical squamous cell carcinoma, has not be well documented. High level Low level The purpose of present study was to evaluate whether the Age, y ERCC1 mRNA expression levels could predict the treat- ≤50 14 13 ment response of patients with locally advanced cervical >50 15 18 0.622 squamous cell carcinoma (LACSCC) who underwent Histologic grade CCCRT. Well and moderately differentiated 12 19 Patients and methods Poorly differentiated 17 12 0.123 Patients and samples Tumor size, cm Cervical squamous cell carcinoma tissues and correspond- ≤48 12 ing non-tumorous tissues were obtained with informed >4 21 19 0.361 consent from sixty consecutive LACSCC patients who Parametrial invasion underwent biopsy before CCCRT at Ningxia Medical No 14 15 University General Hospital, between June 2009 and June 2010, and frozen in liquid nitrogen until further analysis. Unilateral 12 11 Patients had a median age of 53 years (range 36 to 80 years) Bilateral 3 5 0.774 and no patient received previous radiotherapy or chemo- Clinical lymph node involvement therapy. Histologically, all primary tumors were squamous N0 18 26 cell carcinoma. Staging was performed according to Inter- N1 11 5 0.056 national Federation of Gynecology and Obstetrics (FIGO) FIGO stage staging system classification. Clinicopathological charac- teristics of these patients are listed in Table 1. This study II 14 22 was approved by the ethics committee of our hospital. III 15 9 0.073 Hemoglobin levels at diagnosis, g/dL Treatment and response ≤11.3 8 5 The pretreatment evaluation included a review of the >11.3 21 26 0.282 patient’s history, physical examination, performance status, Platelets at diagnosis, ×10 /L biopsy and gynecologic examination under general anesthesia, chest X-ray, complete blood count, blood ≤320 26 24 chemistry, and abdominal-pelvic magnetic resonance im- >320 3 7 0.204 aging. Cystoscopy and sigmoidoscopy were performed Abbreviations: LACSCC locally advanced cervical squamous cell carcinomas, ERCC1 excision repair cross-complementation group 1, FIGO International when indicated. Federation of Gynecology and Obstetrics. Radiotherapy included external beam radiotherapy up to 50 Gy and low-dose rate brachytherapy, six applications of 6 Gy. Chemotherapy consisted of weekly intravenous from the cancerous and corresponding non-tumorous tis- cisplatin administration (40 mg/m ) for 5 cycles concomi- sues. Concentration of total RNA was estimated by a tant with external pelvic radiation. Treatment response SmarSpec Plus spectrophotometer (BIO-RAD, Hercules, was clinically assessed according to the RECIST criteria CA,USA) and stored at −80°C. [13]. We categorized patients into two response groups: After treatment with DNAfree (Ambion, Austin, TX, the sensitive group and the resistant group. The sensitive USA) to remove chromosomal DNA, complementary DNA group included those patients who achieved a complete (cDNA) was synthesized using SuperScript III Reverse response (CR as indicated in the RECIST criteria) and Transcriptase (Invitrogen, Carlsbad, CA, USA) and stored remained in remission throughout the follow-up period. at −20°C until use. Theresistant groupincludedpatients who hadpersistent The mRNA expression levels of ERCC1 and beta-actin disease (PR, SD and PD as indicated in the RECIST criteria) were measured by quantitative RT-PCR using IQ 5 after treatment or developed a relapse after remission. Multicolor Real-Time PCR Detection Systerm (BIO-RAD, Hercules, CA, USA). The cycling conditions were as fol- RNA Extraction, reverse transcription and quantitative lows: 10 min of an initial denaturation step at 95°C, fol- real time RT-PCR (QRT-PCR) assays lowed by 40 cycles of 30 sec at 95°C, 30 sec at 58°C and RNA was isolated using the Trizol reagent (Invitrogen, 30 sec at 72°C. The following primers were used: ERCC1, Carlsbad, CA, USA) following the manufacturer’sprotocol Bai et al. Radiation Oncology 2012, 7:221 Page 3 of 6 http://www.ro-journal.com/content/7/1/221 forward: CCTCAGACCTACGCCGAATA; reverse: GCT CACAATGATGCTGTTGG [14]; and beta-actin, forward: TGACGTGGACATCCGCAAAG; Reverse: CTGGAAGGT GGACAGCGAGG.PCR products were scanned, and quan- tification was performed by the Quantity One program (Bio-Rad, Hercules, CA, USA). The expression of beta- actin was used as an internal control. The ERCC1 expres- sion level was normalized to the beta-actin mRNA level -△△Ct using the 2 method [15]. Statistical analysis The median relative ERCC1 mRNA expression level stan- dardized for beta-actin was selected as cut-off value of high and low level ERCC1 expression. Associations between dichotomized ERCC1 mRNA levels and clinicopathological Figure 1 The mean value of ERCC1 mRNA expression between characteristics were assessed for statistical significance sensitive and resistant groups. using a chi-square test. Logistic regression models were used to identify independent predictive factors for treat- ment response. Cut-off values for discrimination of ERCC1 sensitivity for detection of a complete response was 81.48% mRNA levels and treatment response were derived from re- with a specificity of 96.97% (area under the curve, 0.893; ceiver operating curve data (ROC; area under the curve 95% confidence interval, 0.804–0.983) (Figure 2). and the 95% confidence interval). All reported P values are two-sided, and P less than 0.05 was considered statistically Discussions significant. SPSS 13.0 (SPSS Inc., Chicago, IL) was used for The addition of concurrent cisplatin-based chemotherapy the statistical analysis. to standard radiotherapy could reduce the risk of recur- rence and disease-related death rates from locally advanced Results cervical cancer by as much as 50% [16,17]. However, those ERCC1 mRNA expression levels were successfully mea- without a response will have toxicity helplessly. It would be sured in sixty patients. The median measured value of useful to predict the response and to search for novel ERCC1 mRNA was 23.06 (range, 18.78–25.46). The median approaches for non-responders [18]. relative ERCC1 mRNA expression level standardized for ERCC1 plays an important role in recognizing and re- beta-actin was 0.0347 (range, 0.0028–5.4264). Thirty-one moving cisplatin–induced DNA adducts and repairs inter- (51.67%) patients were classified as having high level. No strand cross-links in DNA and recombination processes significant differences were found in the clinicopathological [19,20]. Several preclinical and clinical studies have investi- characteristics between the patients with high ERCC1 gated the expression of ERCC1 mRNA and protein in mul- mRNA level and those with low level (Table 1). tiple cancer types and have demonstrated a correlation All patients received the external beam radiotherapy and between the ERCC1 expression levels and the treatment re- brachytherapy as indicated in the protocol. For myelosurp- sponse to platinum-based therapy and/or survival outcome pression and infectious complications, only 34 (56.67%) [3-10]. These results suggest that ERCC1 expression may patients received 5 cycles cisplatin-based concurrent assist in selecting patients most likely to benefit from plat- chemotherapy. The treatment response was evaluated by inum agent-based chemotherapy or chemoradiotherapy. CT imaging after treatment completion. Of the 60 patients There are three other studies evaluated the relationship who entered the study, 33 (55%) patients had complete re- of ERCC1 status and the treatment response or survival of sponse. Patients with low ERCC1 mRNA level had a sig- the patients with cervical carcinoma who received radio- nificantly higher complete response rate (86.21%) than therapy or chemoradiotherapy. Liang et al. assessed the patients with high expression levels (19.36%; p < 0.001) ERCC1 expression of 50 patients with cervical squamous (Figure 1). In the logistic regression analysis, only low cell carcinomas who received cisplatin-based concur- ERCC1 mRNA level retained an independent role in pre- rent chemoradiotherapy by immunohistochemistry (IHC) dicting complete response to CCCRT (Table 2). method. They found ERCC1-negative patients had a ROC analysis was applied to determine an ERCC1 significantlyhighercompleteresponseratethanERCC1- mRNA value that best segregates patients into complete re- positive patients (P = 0.015). The 5-year overall survival sponse or non-complete response. An ERCC1 expression (OS) rates for the ERCC1-positive and ERCC1-negative level of 0.0901 was determined as an optimal cutoff value groups were 50.0% and 85.3%, respectively. For OS, lack of to identify complete response to CCCRT treatment. The ERCC1 expression was an independent prognostic factor Bai et al. Radiation Oncology 2012, 7:221 Page 4 of 6 http://www.ro-journal.com/content/7/1/221 Table 2 Results of logistic regression analysis for clinical factors and response to CCCRT B SE Wald P value OR 95% CI for OR Age −0.104 0.064 2.599 0.107 0.902 0.795-1.023 Histologic grade −0.450 1.090 0.171 0.680 0.638 0.075-5.399 Tumor size 2.908 1.567 3.445 0.063 18.315 0.850-394.766 Parametrial invasion 2.773 1.878 2.180 0.140 16.011 0.403-635.705 Lymph node status −0.274 1.060 0.067 0.796 0.760 0.095-6.074 FIGO stage 2.471 1.797 1.891 0.169 11.836 0.349-400.843 Hemoglobin levels at diagnosis −0.326 1.252 0.068 0.795 0.722 0.062-8.398 Platelets at diagnosis −0.166 1.309 0.016 0.899 0.847 0.065-11.013 ERCC1 mRNA status 5.003 1.408 12.624 0.000 148.869 9.424-2351.736 Chemotherapy cycles −0.932 1.073 0.755 0.385 0.394 0.048-3.225 Abbreviations: CCCRT cisplatin-based concurrent chemoradiotherapy, B regression coefficient, SE standard error, Wald Wald value, OR odds ratio, CI confidence interval, FIGO International Federation of Gynecology and Obstetrics, ERCC1 excision repair cross-complementation group 1. [21]. Doll et al. evaluated the association of ERCC1 expres- Although the results of our study are similar to Liang’s sion, using both mRNA and protein expression analysis, and Hasegawa’s study, which are opposite to Doll’sstudy. with clinical outcome in cervical cancer patients treated The first reason of these differences is the histology type with radical radiotherapy. ERCC1 mRNA level was deter- of enrolled patients was different. Squamous cell carcin- mined by real-time PCR, and ERCC1 protein expression oma comprises around 85% to 90% of uterine cervical can- (FL297, 8F1) was measured using quantitative IHC. cer [24,25]. It has different biology behavior and treatment ERCC1 protein expression levels using both FL297 and response when compared with adenocacinoma [2,26]. In 8F1 antibodies were determined for 112 patients; mRNA Doll’s study, there are 11% patients with cervical adenocar- analysis was performed in 32 patients. In the 112 patients, cinoma. The second reason is that the treatment method 99 patients were squamous cell carcinomas, and 33 was different between two studies. In Doll’sstudy, they patients were adenocarcinomas. Low ERCC1 mRNA ex- used radiation alone. In fact, ERCC1 expression and the pression status was associated with worse OS (p = 0.046). response of chemotherapy also have interaction [10]. ERCC1 protein expression using the FL297 antibody, but There are some shortages in this study. Firstly, we did not the 8F1 antibody, was significantly associated with not perform IHC. High ERCC1 mRNA only signifies both OS (p = 0.002) [22]. Hasegawa et al. analyzed the ERCC1 DNA transcription and does not necessarily reflect ERCC1 expression of 36 patients with cervical adenocar- cinoma by IHC method. Among the 25 patients who received cisplatin-based chemotherapy or chemora- diotherapy with cisplatin, those with high ERCC1 expres- sion experienced significantly worse disease-free survival than those with low ERCC1 expression (P =0.002). More- over, univariate and multivariate analyses revealed that high ERCC1 expression was an independent prognostic factor in patients receiving cisplatin-based chemotherapy or chemoradiotherapy with cisplatin [23]. Our study is the first analysis of the association between ERCC1 mRNA ex- pression and treatment response in patients with cervical squamous cell carcinomas who received radical cisplatin- based concurrent chemoradiotherapy. Sixty patients were evaluated in this study, which is the largest number among these studies. We firstly found that cervical squamous cell carcinomas patients with low ERCC1 mRNA level had a significantly higher rate of complete response than patients with high level of ERCC1 expression (P < 0.001). In the lo- gistic regression analysis, low ERCC1 mRNA level retained Figure 2 ROC curve depicting sensitivity and specificity of an independent role in predicting complete response to ERCC1 mRNA levels in predicting complete response of CCCRT. CCCRT (P < 0.001). Bai et al. Radiation Oncology 2012, 7:221 Page 5 of 6 http://www.ro-journal.com/content/7/1/221 the production of functional ERCC1 protein, which could Oncology Genitourinary Group: Gene expression of ERCC1 as a novel prognostic marker in advanced bladder cancer patients receiving be assessed by IHC. We will evaluate the ERCC1 protein cisplatin-based chemotherapy. Ann Oncol 2007, 18(3):522–528. expression and the treatment response of LACSCC in fur- 7. Scheil-Bertram S, Tylus-Schaaf P, du Bois A, Harter P, Oppitz M, ther study. Secondly, the number of patients was small. Ewald-Riegler N, Fisseler-Eckhoff A: Excision repair cross-complementation group 1 protein overexpression as a predictor of poor survival for We need do further research to validate the results in high-grade serous ovarian adenocarcinoma. Gynecol Oncol 2010, large number patients. Lastly, due to the short follow-up 119(2):325–331. time, the association of ERCC1 mRNA levels and survival 8. Handra-Luca A, Hernandez J, Mountzios G, Taranchon E, Lacau-St-Guily J, Soria JC, Fouret P: Excision repair cross complementation group 1 was not performed in present study at this point. immunohistochemical expression predicts objective response and cancer-specific survival in patients treated by Cisplatin-based induction Conclusions chemotherapy for locally advanced head and neck squamous cell carcinoma. Clin Cancer Res 2007, 13(13):3855–3859. This is the first study to evaluate the relationship of 9. Warnecke-Eberz U, Metzger R, Miyazono F, Baldus SE, Neiss S, Brabender J, ERCC1 mRNA levels and complete response of LACSCC Schaefer H, Doerfler W, Bollschweiler E, Dienes HP, Mueller RP, Danenberg who underwent CCCRT. We have shown that ERCC1 ex- PV, Hoelscher AH, Schneider PM: High specificity of quantitative excision repair cross-complementing 1 messenger RNA expression for prediction pression patterns in pretreatment cancerous specimens of minor histopathological response to neoadjuvant radiochemotherapy can be effectively used to predict response to CCCRT. in esophageal cancer. Clin Cancer Res 2004, 10(11):3794–3799. These results suggest that ERCC1 expression may assist in 10. Metzger R, Bollschweiler E, Hölscher AH, Warnecke-Eberz U: ERCC1: impact in multimodality treatment of upper gastrointestinal cancer. selecting patients most likely to benefit from CCCRT. Fur- Future Oncol 2010, 6(11):1735–1749. ther investigation is required to determine whether these 11. Britten RA, Liu D, Tessier A, Hutchison MJ, Murray D: ERCC1 expression as a assays are sufficiently reliable to use routinely as a basis to molecular marker of cisplatin resistance in human cervical tumor cells. Int J Cancer 2000, 89(5):453–457. select specific patient treatments. 12. Hampson L, El Hady ES, Moore JV, Kitchener H, Hampson IN: The HPV16 E6 and E7 proteins and the radiation resistance of cervical carcinoma. Competing interests FASEB J 2001, 15(8):1445–1447. The authors declare that they have no competing interests. 13. Therasse P, Arbuck SG, Eisenhauer EA, Wanders J, Kaplan RS, Rubinstein L, Verweij J, Van Glabbeke M, van Oosterom AT, Christian MC, Gwyther SG: Authors’ contributions New guidelines to evaluate the response to treatment in solid tumors. ZL Bai and YY Wang participated in acquiring clinical and laboratory data, data European Organization for Research and Treatment of Cancer, National analysis and interpretation, acquiring clinical samples, follow-up clinical Cancer Institute of the United States, National Cancer Institute of information and final writing of the manuscript. H Zhe, JL He and P Hai Canada. J Natl Cancer Inst 2000, 92(3):205–216. participated in acquiring clinical and laboratory data, data analysis and data 14. Sonnenberg M, van der Kuip H, Haubeis S, Fritz P, Schroth W, Friedel G, interpretation and drafted the manuscript. All authors read and approved the Simon W, Mürdter TE, Aulitzky WE: Highly variable response to cytotoxic final manuscript. chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast. BMC Cancer 2008, 8:364. Author details 15. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using Graduate School, Ningxia Medical University, No.1160 Shengli Str, Yinchuan, real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Ningxia 750004, China. Department of Radiation Oncology, General Hospital Methods 2001, 25(4):402–408. of Ningxia Medical University, No.804 Shengli Str, Yinchuan, Ningxia 750004, 16. Eifel PJ: Concurrent chemotherapy and radiation: a major advance for China. women with cervical cancer. J Clin Oncol 1999, 17(5):1334–1335. 17. Green JA, Kirwan JM, Tierney JF, Symonds P, Fresco L, Collingwood M, Received: 13 June 2012 Accepted: 17 December 2012 Williams CJ: Survival and recurrence after concomitant chemotherapy Published: 23 December 2012 and radiotherapy for cancer of the uterine cervix: a systematic review and meta-analysis. Lancet 2001, 358(9284):781–786. References 18. Klopp AH, Eifel PJ: Biological predictors of cervical cancer response to 1. Haie-Meder C, Morice P, Castiglione M, ESMO Guidelines Working Group: radiation therapy. Semin Radiat Oncol 2012, 22(2):143–150. Cervical cancer: ESMO clinical recommendations for diagnosis, treatment 19. Sancar A: Mechanisms of DNA excision repair. Science 1994, and follow-up. Ann Oncol 2009, 20(Suppl 4):iv27–iv28. 266(5193):1954–1956. 2. Quinn MA, Benedet JL, Odicino F, Maisonneuve P, Beller U, Creasman WT, 20. Reed E: Platinum-DNA adduct, nucleotide excision repair and platinum Heintz AP, Ngan HY, Pecorelli S: Carcinoma of the cervix uteri. FIGO 26th based anti-cancer chemotherapy. Cancer Treat Rev 1998, 24(5):331–344. Annual Report on the Results of Treatment in Gynecological Cancer. 21. Liang ZL, Song EK, Ko YB, Lee NR, Yhim HY, Noh HT, Yun HJ, Suh KS, Jo DY, Int J Gynaecol Obstet 2006, 95(Suppl 1):S43–S103. Kim S, Kim JS, Kim JM, Lee HJ: Excision repair cross-complementation 3. Olaussen KA, Dunant A, Fouret P, Brambilla E, André F, Haddad V, group 1 expression predicts response and survival in locally advanced Taranchon E, Filipits M, Pirker R, Popper HH, Stahel R, Sabatier L, Pignon JP, cervical carcinoma patients treated with concurrent chemoradiotherapy. Tursz T, Le Chevalier T, Soria JC, IALT Bio Investigators: DNA repair by Histopathology 2011, 59(3):564–567. ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant 22. Doll CM, Prystajecky M, Eliasziw M, Klimowicz AC, Petrillo SK, Craighead PS, chemotherapy. N Engl J Med 2006, 355(10):983–991. Hao D, Diaz R, Lees-Miller SP, Magliocco AM: Low ERCC1 mRNA and 4. Metzger R, Leichman CG, Danenberg KD, Danenberg PV, Lenz HJ, Hayashi K, protein expression are associated with worse survival in cervical cancer Groshen S, Salonga D, Cohen H, Laine L, Crookes P, Silberman H, Baranda J, patients treated with radiation alone. Radiother Oncol 2010, 97(2):352–359. Konda B, Leichman L: ERCC1 mRNA levels complement thymidylate 23. Hasegawa K, Kato R, Torii Y, Ichikawa R, Oe S, Udagawa Y: The relationship synthase mRNA levels in predicting response and survival for gastric between ERCC1 expression and clinical outcome in patients with FIGO cancer patients receiving combination cisplatin and fluorouracil stage I to stage II uterine cervical adenocarcinoma. chemotherapy. J Clin Oncol 1998, 16(1):309–316. Int J Gynecol Cancer 2011, 21(8):1479–1485. 5. Kim MK, Cho KJ, Kwon GY, Park SI, Kim YH, Kim JH, Song HY, Shin JH, Jung 24. Smith HO, Tiffany MF, Qualls CR, Key CR: The rising incidence of HY, Lee GH, Choi KD, Kim SB: ERCC1 predicting chemoradiation resistance adenocarcinoma relative to squamous cell carcinoma of the uterine and poor outcome in oesophageal cancer. Eur J Cancer 2008, 44(1):54–60. cervix in the United States–a 24-year population-based study. 6. Bellmunt J, Paz-Ares L, Cuello M, Cecere FL, Albiol S, Guillem V, Gallardo E, Gynecol Oncol 2000, 78(2):97–105. Carles J, Mendez P, de la Cruz JJ, Taron M, Rosell R, Baselga J, Spanish Bai et al. Radiation Oncology 2012, 7:221 Page 6 of 6 http://www.ro-journal.com/content/7/1/221 25. Chan PG, Sung HY, Sawaya GF: Changes in cervical cancer incidence after three decades of screening US women less than 30 years old. Obstet Gynecol 2003, 102(4):765–773. 26. Yeasmin S, Nakayama K, Rahman MT, Rahman M, Ishikawa M, Katagiri A, Iida K, Nakayama N, Otuski Y, Kobayashi H, Nakayama S, Miyazaki K: Biological and clinical significance of NAC1 expression in cervical carcinomas: a comparative study between squamous cell carcinomas and adenocarcinomas/adenosquamous carcinomas. Hum Pathol 2012, 43(4):506–519. doi:10.1186/1748-717X-7-221 Cite this article as: Bai et al.: ERCC1 mRNA levels can predict the response to cisplatin-based concurrent chemoradiotherapy of locally advanced cervical squamous cell carcinoma. Radiation Oncology 2012 7:221. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit

Journal

Radiation Oncology – Springer Journals

Published: Dec 23, 2012

There are no references for this article.