Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Co-production of polyhydroxybutyrate (PHB) and coenzyme Q10 (CoQ10) via no-sugar fermentation—a case by Methylobacterium sp. XJLW

Co-production of polyhydroxybutyrate (PHB) and coenzyme Q10 (CoQ10) via no-sugar fermentation—a... Purpose: To explore a competitive PHB-producing fermentation process, this study evaluated the potential for Methylobacterium sp. XJLW to produce simultaneously PHB and coenzyme Q (CoQ ) using methanol as sole 10 10 carbon and energy source. Methods: The metabolic pathways of PHB and CoQ biosynthesis in Methylobacterium sp. XJLW were first mined based on the genomic and comparative transcriptomics information. Then, real-time fluorescence quantitative PCR (RT-qPCR) was employed for comparing the expression level of important genes involved in PHB and CoQ10 synthesis pathways’ response to methanol and glucose. Transmission electron microscope (TEM), gas chromatography/mass spectrometry (GC-MS), nuclear magnetic resonance (NMR), Fourier transformation infrared spectrum (FT-IR), and liquid chromatography/mass spectrometry (LC-MS) methods were used to elucidate the yield and structure of PHB and CoQ , respectively. PHB and CoQ productivity of Methylobacterium sp. XJLW were 10 10 evaluated in Erlenmeyer flask for medium optimization, and in a 5-L bioreactor for methanol fed-batch strategy according to dissolved oxygen (DO) and pH control. Results: Comparative genomics analysis showed that the PHB and CoQ biosynthesis pathways co-exist in Methylobacterium sp. XJLW. Transcriptomics analysis showed that the transcription level of key genes in both pathways responding to methanol was significantly higher than that responding to glucose. Correspondingly, strain Methylobacterium sp. XJLW can produce PHB and CoQ simultaneously with higher yield using cheap and abundant methanol than using glucose as sole carbon and energy source. The isolated products showed the structure characteristics same to that of standard PHB and CoQ . The optimal medium and cultural conditions for -1 PHB and CoQ co-production by Methylobacterium sp. XJLW was in M3 medium containing 7.918 g L methanol, -1 -1 0.5 g L of ammonium sulfate, 0.1% (v/v) of Tween 80, and 1.0 g L of sodium chloride, under 30 °C and pH 7.0. In -1 a 5-L bioreactor coupled with methanol fed-batch process, a maximum DCW value (46.31 g L ) with the highest -1 -1 yields of PHB and CoQ , reaching 6.94 g L and 22.28 mg L , respectively. (Continued on next page) * Correspondence: whzhong@zjut.edu.cn Equal contributors Peiwu Cui and Yunhai Shao contributed equally to this work. College of Biotechnology and Bioengineering, Zhejiang University of Technology, Hangzhou 310032, People’s Republic of China Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Cui et al. Annals of Microbiology (2021) 71:20 Page 2 of 15 (Continued from previous page) Conclusion: Methylobacterium sp. XJLW is potential for efficiently co-producing PHB and CoQ employing methanol as sole carbon and energy source. However, it is still necessary to further optimize fermentation process, and genetically modify strain pathway, for enhanced production of PHB and CoQ simultaneously by Methylobacterium sp. XJLW. It also suggests a potential strategy to develop efficiently co-producing other high- value metabolites using methanol-based bioprocess. Keywords: Methylobacterium sp. XJLW, Metabolic pathway mining, Methanol-based process, PHB, CoQ , Fed-batch fermentation Introduction and it is a good clinic biological drug for removing free Nowadays, along with the increasing demands for poly- radicals in the body, keeping biological membrane stable, mer plastics, which can be widely used from product anti-lipid peroxidation, and strengthening the nonspe- packing and daily tools to equipment parts and con- cific immune (Ernster and Dallner 1995; Qiu et al. 2012; struction sectors, the growing serious petroleum-based Lu et al. 2013). Thus, PHB and CoQ were selected as plastic pollution has drawn more attractive attention due representatives of biopolymers and quinone metabolites, to its less biodegradation property (Cardoso et al. 2020; respectively, to evaluate the potential for their co- Mostafa et al. 2020). In order to solve this global circum- production via methanol-based process. stance, many scientists have put great efforts on bio- In our previous work, a new formaldehyde-degradable degradable polymer production. For showing similar methylotrophic bacterium was isolated and identified as thermoplastic, elastomeric, and other physical–chemical Methylobacterium sp. XJLW (Qiu et al. 2014; Shao et al. properties to conventional plastics, polydroxyalkanoates 2019a). Its completed genome has been sequenced (Shao (PHAs) are regarded as the most potential substituent, et al. 2019b). Comparative genomic analysis exhibited which can be completely degraded to CO and H O Methylobacterium sp. XJLW contains both pathways of 2 2 (Sukruansuwan and Napathorn 2018; Mostafa et al. CoQ and PHB biosynthesis (Fig. 1), suggesting the 2020). However, the high cost of PHA production from possibility to develop a new fermentation process to costly substrates has seriously limited the utilization of realize co-production of PHB and CoQ with the abun- PHAs in commercial fields, which forces scientists to ex- dant methanol as sole carbon source at the same time, plore alternative approaches to produce it at a lower which will provide a more economic process for PHB price (Parveez et al. 2015). The production costs of production. PHAs depend on many factors including strains, sub- In the present study, the aim was to (1) verify the po- strates, cultivation conditions, extraction, and purifica- tential of PHB and CoQ co-production by Methylobac- tion processes (Gamez-Perez et al. 2020). Carbon source terium sp. XJLW with different carbon sources, glucose, is regarded as the major factor that accounts for 70–80% and methanol; (2) elucidate the expression difference of of the total expenses of PHAs (Mohandas et al. 2017), the key genes in both pathways of PHB and CoQ bio- because PHAs are usually synthesized under a specific synthesis in Methylobacterium sp. XJLW response to condition of limitation of nutrients, and excess of carbon methanol and glucose; (3) evaluate the effects of medium source (Cardoso et al. 2020). Thus, development of a composition and cultivation conditions on PHB and PHA-producing process with a cheap and renewable CoQ co-production in Erlenmeyer flasks and in a 5-L substrate is still necessary. As one of the common indus- stirred bioreactor employing methanol fed-batch strat- trial by-products and a cheaper and renewable chemical egy. This study provided a new reference of strategy for feedstock, methanol has been widely used as carbon and improving value-added product productivity with energy source in methylotroph fermentation processes methanol-based fermentation process employing for value-added chemical production (Zaldivar Carrillo methylotrophs. et al. 2018; Zhang et al. 2019). Hence, methanol-based fermentation for PHA production is still a highly prom- Materials and methods ising process without sugar consumption. Chemicals Among all PHAs, polyhydroxybutyrate (PHB) is con- PHB (purity above 95%, CAS no: 26063-00-3) and sidered as the most competitive biopolymer because of CoQ (purity above 99.9%, CAS no: 303-98-0) were its good biocompatibility, biodegradability, and similar purchased from Sigma-Aldrich, China. Alcohol (HPLC properties to polypropylene (Parveez et al. 2015; Sharma grade, purity above 99.5%) was purchased from Tjshield 2019). Meanwhile, coenzyme Q (CoQ ) is the most 10 10 fine chemicals Co., Ltd. (Tianjin, China). Other valuable product among all natural quinone metabolites, Cui et al. Annals of Microbiology (2021) 71:20 Page 3 of 15 Fig. 1 (See legend on next page.) Cui et al. Annals of Microbiology (2021) 71:20 Page 4 of 15 (See figure on previous page.) Fig. 1 Genetic organization of genes and core pathway responsible for CoQ (a, c) and PHB (b, d) synthesis in XJLW strain via comparative genomic analysis. The EC No. in yellow-backed textboxes in a and b meant that they cannot be found in genomic data of XJLW strain. The green color and (+) symbol-labelled genes were upregulated expressed in the methanol group, while the red color and (-) symbol-labelled genes were downregulated expressed in methanol compared with glucose. The black-backed gene in c suggests that the expression level of this gene was not affected by methanol or glucose chemicals were analytical reagents and purchased from a Cell morphology observation via transmission electron local company. microscope Cells in 1 mL culture broth was harvested by centrifuga- tion at 5790 × g for 10 min at 4 °C in a high-speed freez- Microorganism and maintenance ing centrifuge (TGL-16M, Bioridge, China), and then Methylobacterium sp. XJLW was isolated from Huang- were suspended in 4% (v/v) pre-cooled glutaraldehyde yan Sewage Treatment Plant, Zhejiang Province, China. and immobilized for 1 h at 4 °C. The ultrathin section of Now, it has been deposited at China Center for Type immobilized cell was observed under transmission elec- Culture Collection (CCTCC) under the accession num- tron microscope (HITACHI H-7650, Japan) at the mag- ber CCTCC M2012065. nification of 15,000 ×. After the broth OD of strain XJLW cultured in li- quid M3 mineral medium containing 1.0% methanol Physiological characteristic analysis combined with RNA- reaches about 0.6, about 750 μL broth was mixed with seq and RT-qPCR 250 μL 80% sterile glycerol in a 1.5-mL centrifuge tube, The cell growth and simultaneous production ability of and then stored in – 80 °C refrigerator. When activation PHB and CoQ was detected in M3 medium supple- -1 -1 is required, the stored strains are taken out and thawed, mented with 7.4232 g L glucose or 7.918 g L metha- inoculated into an M3 liquid medium containing metha- nol, respectively. Meanwhile, the cells were harvested for nol, and activated on a shaker at 30 °C and 180 rpm. RNA-seq and RT-qPCR. RNA-Seq data analysis Culture condition After culture in M3 containing methanol or glucose as -1 Medium M3 (Bourque et al. 1995) contained (g L ) carbon source, respectively, at 30 °C to log phase (OD (NH ) SO 0.5, KH PO 1.305, Na HPO ·7H O 4.02, 0.8), Methylobacterium sp. XJLW cells were harvested 4 2 4 2 4 2 4 2 MgSO ·7H O 0.45, CaCl 2H O 0.02, FeSO ·H O 0.02, via centrifugation at 2000 × g for 10 min at 4 °C in a 4 2 2 2 4 2 -1 and 1 mL L trace element solution. The trace element high-speed freezing centrifuge (TGL-16M, Bioridge, -1 solution contained (g L )MnSO ·H O 4.9, ZnSO ·7H O China). Then, cell pellets were immediately mixed with 4 2 4 2 2.6, CuSO ·5H O 0.8, Na MoO ·2H O 0.8, CoCl ·6H O RNA protect Bacteria Reagent (QIAGEN China Co. 4 2 2 4 2 2 2 0.8, and H BO 0.6. Ltd), and then stored at – 80 °C for RNA extraction. A 3 3 Mineral salt medium (MSM) (Qiu et al. 2014) con- total amount of 1 μg qualified RNA sample was used as -1 tained (g L )KH PO 0.7, K HPO 0.85, (NH ) SO 1.2, input material for the library preparation. Library con- 2 4 2 4 4 2 4 MgSO ·7H O 0.1, CaCl 0.01, FeSO ·7H O 0.001, and 1 centration was measured using Qubit® RNA Assay Kit in 4 2 2 4 2 -1 mL L trace element solution. The trace element solu- Qubit® 3.0 (Thermo Fisher Scientific, USA) to prelimin- -1 tion contained (g L )H BO 6, CoCl ·6H O4, ary quantify. Insert size was assessed using the Bioanaly- 3 3 2 2 ZnSO ·7H O2,MnCl 4H O 0.6, Na MoO ·2H O 0.6, zer 2100 system (Agilent, USA), after the insert size is 4 2 2 2 2 4 2 NiCl ·4H O 0.4, and CuCl ·2H O 0.2. consistent with expectations, qualified fragment was ac- 2 2 2 2 Initial pH of the above media was adjusted to 7.0 with curately quantified using qPCR by Step One Plus Real- -1 -1 1 mol L NaOH. Methanol, 7.918 g L , was added to Time PCR system (ABI, USA). The raw reads were fil- the two media used as sole carbon source after being tered by removing reads containing adaptors, ploy-N autoclaved at 115 °C for 30 min. Fifty microliters sus- (i.e., unrecognized bases, reads with a recall ratio less pension of frozen stock Methylobacterium sp. XJLW was than 5%), and low-quality reads (the number of base ≤ inoculated into a 250-mL Erlenmeyer flask containing 10 and occupied less than 50% of the entire read) for 50 mL medium M3, and incubated for 96 h. Then 2-mL subsequent analysis. Firstly, Tophat2 (Kim et al. 2013) culture was inoculated into 250-mL Erlenmeyer flasks was used to evaluate the sequencing data by comparison containing 50 mL fermentation medium and incubated with the genomic sequences of reference strains. Based for 5 days in a rotary incubator (SPH-2102, SHIPING, on the Tophat2 alignment results, Cufflinks-2.2.1 (Trap- China) with the parameter settings at 30 °C and 400 nell et al. 2010) was used to perform quantitative gene rpm, respectively. expression analysis. Gene expression is calculated as Cui et al. Annals of Microbiology (2021) 71:20 Page 5 of 15 follows: FPKM (expected number of Fragments Per Kilo- effects of methanol concentration, ammonium sulfate base of transcript sequence per Million of sequenced concentration, fermentation temperature, initial pH of base pairs). In general, the screening criteria for signifi- medium, different types of oxygen carriers and osmotic cantly differentially expressed genes are: |log fold pressure regulated by adding different concentration of change| ≥ 1 and p value ≤ 0.05. Scatter plot and volcano sodium chloride on Methylobacterium sp. XJLW grow- map are used to present the overall profile of gene ex- ing and target metabolites biosynthesis. The value ranges pression differences. of the above mentioned culture condition variables are listed in Table 2. RNA extraction and quantitative RT-qPCR The cells in the early exponential stage, cultured in Cultivation of Methylobacterium sp. XJLW on bench -1 M3 medium supplemented with 7.4232 g L glucose bioreactor using fed-batch strategy -1 or 7.918 g L methanol respectively, were centrifuged After investigation of fermentation conditions in Erlen- at 2000 × g for 10 min at 4 °C in a high-speed freez- meyer flask, a fed-batch fermentation was carried out in ing centrifuge (TGL-16M, Bioridge, China). The total a 5-L stirred tank reactor (Biostat-Bplus-5L, B.Braun RNA was extracted by using RNA isolator (Vazyme Germany) with a working volume of 3.0 L, at 30 °C, 400 Biotech Co., Ltd., Nanjing). And then, HiScript II Q rpm and pH 5.5 (controlled using aqueous NH OH so- RT SuperMix qPCR kit (Vazyme Biotech Co., Ltd., lution), and with a dissolved oxygen concentration above Nanjing) was used to develop reverse transcription re- 20% of air saturation. Firstly, the basal salts of optimal actions. The reaction buffer system of RT-qPCR was medium were dissolved in 2670 mL ddH O and were prepared with ChamQ SYBR qPCR Master Mix, and autoclaved in the bioreactor. To start the fermentation, the quantitative PCR with Bio-Rad CFX real-time 30 mL methanol and 300 mL inoculum suspension PCR system was performed. The expression level of (OD = 3.0) were added to the bioreactor by peristaltic the 16S rRNA gene was used as internal reference. pump. Filter-sterilized air was the source of oxygen and Each reaction was repeated at least three times. The was supplied at a flow rate of 3 vvm. After initial added primers used for RT-qPCR are listed in Table 1. methanol was completely exhausted implied by the dis- solved oxygen level rising up to 100%, additional metha- Effect of culture conditions on Methylobacterium sp. XJLW nol (mixed with 1% trace element solution) was pulse fermentation in Erlenmeyer flask fed into the reactor regulated by the dissolved oxygen Firstly, to choose a better initial medium, the cell growth monitor to further increase the cell density. At the same and biosynthesis of target products of Methylobacterium time, pH was also adjusted at a stable level of 5.7 by add- sp. XJLW cultivated in M3 and MSM were evaluated. A ing NH OH solution which could supply nitrogen one-factor-at-a-time design was employed to analyze the source simultaneously. If needed, increasing stirred speed strategy was also employed to increase dissolved Table 1 Primers used in this study oxygen level. The whole fermentation period was about Genes Primers Sequence 5 to 7 days. 16S rDNA 16S-F GTTGGTGGAACTGCGAGTGTAGAG Separation of CoQ and PHB 16S-R CCCCAGGCGGAATGCTCAAAG After fermentation, cell biomass was separated by centri- ubiA ubiA-F GCTGGTGGCTCCTCCTCCTG fugation at 8000 × g, 4 °C for 10 min (Biofuge Stratos ubiA-R GGCATCGGCATGACCCGTTTC Sorvall, Thermo, Germany), then 20 mL alcohol was ubiG ubiG-F CTGGACGGGCTTTCGATCTGC added to the pellets for suspending cells. Subsequently, ubiGR CAGCCAGCCGAGCACGTATTC the cell suspension was subjected to sonication in an ultrasonicator (Scientz-IID, China) at 500 W for 12 min ubiD ubiD -F CGTGACCCTGTGCCCAAAGC with a pulse of 15 s on and 10 s off. After cell disruption, ubiD -R AACTGAGCGGTTTCTGCGGATG the suspension was centrifuged at 8000 × g, 4 °C for 10 ubiH ubiH-F TGGTGCTCTCGCTCGCCTATC min, and then the supernatant was sampled for CoQ ubiH-R TGGAAGCTCGGAAACGTGATGATG Table 2 Ranges of the culture condition variables ubiX ubiX -F AAGAGAGCCGCGAGGGTGAG Variables Ranges of values ubiX-R CCCTGCTCCTGTACCTGATCTGG Methanol concentration (%, v/v) 0.5, 1.0, 1.5, 2.0, 2.5 hmgl hmgl-F CGTCAAGCAGCTCGCCAAGAG Ammonium sulfate (%, w/v) 0.5, 1.0, 1.5, 2.0, 2.5 hmgl-R GAGGCTCTCCATCACGTTGAACAC Temperature (°C) 25, 30, 37 Initial pH 5, 6, 7, 8, 9 phaC-3 phaC-3-F ACGCCGAAGGATCTGGTCTGG Oxygen carriers Triton X-100, Tween 80, H O 2 2 phaC-3-R TTCGCCGCCTCCTGGATGAC Sodium chloride (g/L) 1.0, 5.0, 10.0 Cui et al. Annals of Microbiology (2021) 71:20 Page 6 of 15 analysis, while the precipitation was sampled and kept in capillary column (HP5MS), 30 m × 0.25 mm, film thick- a 45 °C oven to a constant weight before PHB ness 0.25 μm; injection temperature 250 °C, ion source extraction. temperature 200 °C, and transfer line temperature 275 For PHB extraction, 10 mL chloroform was added to a °C; oven temperature programming: initially at 60 °C, digestion tube with threaded cap containing less than 100 then heating to 250 °C at the speed of 20 °C per min mg of the dry disruption cell for 1 h extraction at 60 °C. and keeping for 15.5 min. The carried gas was helium Then, the PHB extract was separated by vacuum filtration and column flow was 40 cm/s. 1 13 and air dried as the crude PHB, which was further purified Proton ( H) and carbon ( C) NMR spectra were re- by adding acetone–methanol-mixed liquor (volume ratio corded by using an Anance III spectrometer (Bruker, 7:2) and washing twice to remove the pigment. The puri- Switzerland) at 400 MHz and 100 MHz, respectively, at fied PHB was obtained after drying at 45 °C. the following experimental conditions: 0.5% (w/v) poly- mer sample was dissolved in spectrochem-grade deuter- Assay methods ochloroform (CDCl ) and tetramethylsilane (TMS) was Methanol was analyzed by gas chromatography (GC; used as an internal reference. The chemical shift scale Shimadzu-2010, Japan) equipped with flame ionization de- was in parts per million (ppm). tector (FID) and elastic quartz capillary column (AT-FFAP). For FT-IR analysis, 2 mg polymer sample was thor- Chromatographic condition: injection temperature 200 °C, oughly mixed with 100 mg spectroscopic grade KBr with detector temperature 250 °C, temperature programming: the help of mortar and pestle. From this mixture, 15 mg keeping at 70 °C for 4 min, then heating to 150 °C at the was used for making KBr pellets. The pellets were kept speed of 50 °C per min and keeping for 1 min. The carried in an oven at 100 °C for 4 h to remove atmospheric gas was nitrogen, and column flow was 3.0 mL/min, split moisture from the sample. The IR spectrum of the poly- ratio of 10/L, and a sampling quantity of 1 μL. mer sample was recorded with a Nicolet 6700 FT-IR Cell biomass was measured by analyzing the optical spectrophotometer (Thermo, America) in the range -1 density at 600 nm using UV1800 spectrophotometer 4000–600 cm . (Shimadzu, Japan). Firstly, 1 mL culture samples were CoQ concentration was analyzed by high- centrifuged at 6000 × g for 10 min at 4 °C; the cells were performance liquid chromatography (HPLC; Agilent washed twice in distilled water, centrifuged at the same 1200, America) equipped with Agilent SB-C18 (5 μm, condition, and finally were diluted by adding distilled 4.6 × 150 mm) (Park et al. 2005). The conditions for water to the linear concentration range according to the HPLC analysis were: temperature, 40 °C; mobile phase, standard curve describing the fitting relation between 100% alcohol (HPLC grade); flow rate, 1.0 mL/min; in- dry cell weight (DCW) and absorbance at 600 nm jection volume, 20 μL; and detector, UV detector at 275 (OD ), OD was tested, and DCW would be calcu- nm. A standard curve was created by serial dilutions of 600 600 lated according to a standard curve of the relationship CoQ standard. The molecular structure of CoQ from 10 10 between optical density of cells and DCW of Methylo- Methylobacterium sp. XJLW was identified by liquid bacterium sp. XJLW. Each sample was in triplicate. chromatography-mass spectrometry (LC-MS) method PHB content analysis was according to Pal A’s method using Esquire 6000 (Bruker Daltonics, Germany). (Pal et al. 2009). Firstly, 10 mg PHB sample was turned into crotonic acid by treatment with 10 mL concentrated Statistical analyses H SO in the boiling water bath for 30 min, then the The mean and standard deviation were calculated from 2 4 tube was naturally cooled to room temperature, and the samples in triplicate using Microsoft Excel 2013. absorbance was tested under 235 nm by the UV-1800 spectrophotometer (Shimadzu, Japan) with concentrated Results H SO as the blank. The standard curve was drawn by Methylobacterium sp. XJLW can produce PHB and CoQ 2 4 10 the same method. The chemical structure of PHB was simultaneously identified by gas chromatography-mass spectrometry Transmission electron microscope observation results (GC-MS), nuclear magnetic resonance (NMR) spectros- (Fig. 2) showed that there were many white particles copy, and Fourier transform infrared (FT-IR) spectros- with high refraction inside strain Methylobacterium sp. copy, respectively. XJLW cells, occupying nearly half or more space. It sug- To find the polymer composition, the purified PHB gested high content of PHAs inside the Methylobacter- -1 was dissolved in chloroform (5 mg PHB mL ), 1 μLof ium sp. XJLW cells. which was injected into a GC-MS instrument (Agilent After isolation and purification, the exact structure of Technologies 7890A GC System, America; Bruker es- PHAs from Methylobacterium sp. XJLW was identified quire 6000 MS instrument, German). The column and via GC-MS, NMR, and IR analysis methods, respectively. temperature profile used for GC analysis were as follows: Fig. S1A shows the GC spectra of PHA extracts of Cui et al. Annals of Microbiology (2021) 71:20 Page 7 of 15 shown in Fig.S4. It was found that the peak of CoQ in sample appeared at the retention time same to that of CoQ standard. Although the target peak area of sam- ple looked lower than that of other unidentified peaks, the mass-to-charge ratio of CoQ sample extracted from Methylobacterium sp. XJLW strain exhibited a mo- lecular peak (m/s, 885.6) same to that of CoQ stand- ard. The result suggested that the Methylobacterium sp. XJLW has the ability of CoQ biosynthesis. However, further purification of the sample CoQ and enhanced production of CoQ in Methylobacterium sp. XJLW are required in future research. Higher biomass, PHB, and CoQ10 yield in M3 with Fig. 2 Micrography of the Methylobacterium sp. XJLW under transmission electron microscope (15,000 ×, HITACHI H-7650 TEM) methanol than with glucose As shown in Fig. 3, Methylobacterium sp. XJLW exhib- ited much higher biomass and yield of both PHB and Methylobacterium sp. XJLW strain, and the 7.59-min CoQ when incubated in M3 medium supplemented peak corresponded to the hydrolyzed product of PHB with methanol than glucose as sole carbon source, re- according to standards. In order to obtain an exact spectively. It is interesting that the expression level of structure of this polyester, a further MS analysis of the some genes coding the key enzymes in the pathway of 7.59-min peak fragment was carried out, and the spectra PHB and CoQ biosynthesis of Methylobacterium sp. are shown in Fig. S1(B). The 101.0 m/z molecular frag- XJLW in methanol medium was also significantly higher ment was identical to the 3-hydroxybutyrate, while the than that in glucose medium (Fig. 4). The expression molecular fragments of 85.0 m/z represented butyrate. level of much more genes was also compared based on 1 13 The H- and C-NMR spectra of PHB standards and the RNA-seq results (Tables 3 and 4). Besides, the data PHAs produced by Methylobacterium sp. XJLW are of quantitative RT-qPCR of selected genes involved in shown in Fig. S2. The H-NMR spectra show the pres- PHB synthesis pathway indicated that PHB may be syn- ence of three signals in both spectra of the two polymer thesized by different pathways or be regulated by differ- samples, which corresponded to the methyl group (CH ent isoenzymes under different substrates or different at 1.28 ppm), methylene group (CH at 2.61 ppm), and cultivating conditions. In the RT-qPCR analysis, phaC-3 methine group (CH at 5.26 ppm), respectively (Fig. encoding poly(R)-hydroxyalkanoic acid synthase (class S2A). The methyl group (CH ), methylene group (CH ), III) was chosen for analysis, results showed that phaC-3 3 2 methyne group (CH), and carbonyl group (C=O) are was significantly upregulated by methanol, which was found at 19.8, 40.8, 67.6, and 169.2 ppm, respectively identified with RNA-seq results. However, phaC-1 cata- 1 13 (Fig. S2B). The chemical shifts of both H- and C- lyzing the same step in the pathway was downregulated NMR of PHAs from Methylobacterium sp. XJLW are in by methanol, indicating different isoenzymes were regu- good agreement with the data of PHB standards. IR lated by different factors. Meanwhile, totally 5 acat spectra of PHB standards and PHAs from Methylobac- genes, 3 paaH genes, 2 fadN genes, and 2 phaZ genes terium sp. XJLW are shown in Fig. S3. It shows mainly were found in PHB synthesis pathway in Methylobacter- -1 two intense absorption bands at about 1280–1291 cm , ium sp. XJLW showing different responses to methanol -1 -1 1725 cm , and 2925–2978 cm corresponding to C-O, (Table 4), which indicated that there was a more com- C=O, and C-H stretching groups, respectively. The plex regulation system in Methylobacterium sp. XJLW -1 3436.8 cm absorption band indicates a small number responsible for PHB production. From genomic data of O–H existing in PHAs from Methylobacterium sp. mining, it was also found no gene encoding XJLW and PHB standards referring to the terminal hy- hydroxybutyrate-dimer hydrolase (EC: 3.1.1.22) and droxyl. Meanwhile, the great similarity of IR spectra hydroxymethylglutaryl-CoA synthase (EC: 2.3.3.10) characteristic indicates chemical group composition in existing in Methylobacterium sp. XJLW strain, suggest- PHAs from Methylobacterium sp. XJLW is the same to ing PHB were mainly synthesized through FadJ- that of PHB standards. All the above evidences demon- catalyzed branch pathway. Besides, in CoQ synthetic strate PHB should be produced by Methylobacterium sp. pathway of Methylobacterium sp. XJLW, it was also XJLW. found no gene encoding decaprenyl-diphosphate syn- LC-MS results of CoQ standard and the sample ex- thase (EC: 2.5.1.91) existed in the genomic data, but the tracted from Methylobacterium sp. XJLW cells are LC-MS had strickly verified the product of CoQ10 from Cui et al. Annals of Microbiology (2021) 71:20 Page 8 of 15 Fig. 3 Different effects of glucose and methanol (same carbon atom amount) on the strain XJLW cell growth and its yield of CoQ and PHB. * ** Significant differences from glucose group are indicated by p < 0.05; p < 0.01 this strain. So, it is very possible that there is another medium exhibited more superiority for cell growth than new branch pathway or unannotated gene responsible MSM, and 5 days was the best harvest time with max- for decaprenyl-diphosphate, an important precursor of imum dry cell density. Meanwhile, the ability of PHB CoQ , biosynthesis in Methylobacterium sp. XJLW. and CoQ production by Methylobacterium sp. XJLW 10 10 in M3 and MSM was also evaluated respectively. The re- Effects of medium composition and cultivation conditions sults (Fig. 5b) also showed that Methylobacterium sp. on cell growth, PHB, and CoQ productivity in XJLW exhibited better PHB and CoQ biosynthesis 10 10 Erlenmeyer flask level capacity in medium M3 than in MSM. M3 was then se- Both medium M3 and MSM are recommended as suit- lected as initial medium for the optimization of Methylo- able medium for Methylotroph strain cultivating (Bour- bacterium sp. XJLW fermentation in the following que et al. 1995) with methanol as sole carbon and experiments. energy source. Thus, the growth behaviors of Methylo- As medium components, carbon source and nitrogen bacterium sp. XJLW in M3 and MSM were evaluated in source play the significant role in the fermentation prod- Erlenmeyer flasks. The results (Fig. 5a) showed that M3 uctivity according to previous reports (Wei et al. 2012; Fig. 4 Effect of carbon source on the express of key genes in CoQ (a) and PHB (b) biosynthesis pathway via RT-qPCR. Significant differences * ** from glucose group are indicated by p < 0.05; p < 0.01 Cui et al. Annals of Microbiology (2021) 71:20 Page 9 of 15 Table 3 FPKM values of CoQ synthesis-related genes based on RNA-seq analysis Locus Genes Enzymes FPKM in FPKM in Log2 Up or glucose methanol FPKM (M/ down G) A3862_ dxr 1-Deoxy-D-xylulose-5-phosphate reductoisomerase 99.9563 148.212 0.568293 Up RS14500 A3862_ ispDF Bifunctional 2-C-methyl-D-erythritol 4-phosphate Cytidylyltransferase/2-C-me- 92.8581 149.282 0.684941 Up RS20315 thyl-D-erythritol 2,4-Cyclodiphosphate synthase A3862_ ispE 4-(Cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase 64.3157 141.036 1.132821 Up RS03995 A3862_ ispG Flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate 425.885 296.847 − 0.52074 Down RS12025 synthase A3862_ ispH 4-Hydroxy-3-methylbut-2-enyl diphosphate reductase 1071.31 683.363 − 0.64865 Down RS10000 A3862_ ggps Geranylgeranyl diphosphate synthase, type II 30.1079 127.672 2.084228 Up RS18005 A3862_ ispA Polyprenyl synthetase family protein 200.033 143.273 − 0.48147 Down RS28415 A3862_ ispB Polyprenyl synthetase family protein 95.6316 164.97 0.786644 Up RS04015 A3862_ ubiA 4-Hydroxybenzoate octaprenyltransferase 73.9099 148.495 1.006575 Up RS03825 A3862_ ubiX UbiX family flavin prenyltransferase 43.2101 92.1585 1.092749 Up RS05140 A3862_ ubiD UbiD family decarboxylase 30.4548 120.907 1.989156 Up RS05150 A3862_ ubiI 2-Polyprenylphenol 6-hydroxylase 54.8386 146.31 1.415765 Up RS18730 A3862_ ubiG Bifunctional 2-Polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3- 68.382 118.171 0.789188 Up RS01610 O-methyltransferase UbiG A3862_ ubiH FAD-dependent monooxygenase 65.993 170.113 1.366108 Up RS13590 A3862_ ubiE Bifunctional demethylmenaquinone methyltransferase/2-methoxy-6- 99.1489 146.834 0.566517 Up RS18735 polyprenyl-1,4-benzoquinol methylase UbiE A3862_ ubiF UbiH/UbiF family hydroxylase 84.6668 194.111 1.197014 Up RS22985 Mozumder et al. 2014). Thus, the effect of carbon and ni- further research. However, no significant increase of PHB trogen sources is also very necessary to be evaluated for and CoQ10 yield was detected when ammonium sulfate -1 -1 the optimization of Methylobacterium sp. XJLW fermen- concentration ranged from 0.5 g L to 1.5 g L ,thus 0.5 g -1 tation process. In the previous publications, methanol and L was selected for the following study. Besides medium ammonium sulfate had been approved to be the suitable components, cultural condition such as culture carbon and nitrogen source for Methylobacterium (Bour- temperature and initial pH also play important roles in que et al. 1995; Yezza et al. 2006). Therefore, the effect of microbial fermentation. Thus, the effect of culture different concentrations of methanol (Fig. 6a) and ammo- temperature and initial pH on Methylobacterium sp. nium sulfate (Fig. 6b) on PHB and CoQ productivity of XJLW fermentation was then evaluated in Erlenmeyer Methylobacterium sp. XJLW was evaluated respectively in flask. The results (Fig. 6c and d) showed that the best -1 the present study. It was found that 7.918 g L methanol cultural temperature is 30 °C, and the optimal initial -1 led to maximal CoQ concentration of 1.26 mg L while pH is 7.0. As fermentation broth may turn to lower the optimal biomass and PHB concentration was obtained pH caused by carbon metabolism of Methylobacter- -1 under 11.877 g L methanol. The phenomenon may re- ium sp. XJLW, feeding ammonium hydroxide to sult from the different biosynthesis pathways of CoQ neutralize the excess formic acid derived from metha- and PHB. In order to avoid cell intoxication caused by nol metabolism is very important. Thus, the optimal -1 high methanol concentration, 7.918 g L methanol was initial pH and cultural temperature were selected as selected as the optimal carbon source concentration in 7.0 and 30 °C, respectively. Cui et al. Annals of Microbiology (2021) 71:20 Page 10 of 15 Table 4 FPKM values of PHB synthesis-related genes based on RNA-seq analysis Locus Genes Enzymes FPKM in FPKM in Log2 FPKM Up or glucose methanol (M/G) down A3862_ acat-1 Acetyl-CoA C-acetyltransferase 181.947 195.674 0.104934 Up RS02265 A3862_ acat-2 Acetyl-CoA C-acetyltransferase 1101.5 455.904 − 1.27267 Down RS05695 A3862_ acat-3 Beta-ketothiolase BktB 117.494 160.747 0.452205 Up RS09310 A3862_ acat-4 Acetyl-CoA C-acyltransferase 72.2701 163.337 1.176381 Up RS25790 A3862_ acat-5 Acetyl-CoA acetyltransferase 302.52 199.266 − 0.60233 Down RS27615 A3862_ phbB Acetoacetyl-CoA reductase 775.466 472.896 − 0.71354 Down RS05690 A3862_ phaC- Class I poly(R)-hydroxyalkanoic acid synthase 266.759 198.599 − 0.42568 Down RS05930 1 A3862_ phaC- Polyhydroxyalkanoic acid synthase 111.896 382.12 1.771867 Up RS11350 2 A3862_ phaC- Class III poly(R)-hydroxyalkanoic acid synthase subunit 90.7047 116.952 0.366667 Up RS19105 3 PhaC A3862_ phaE Poly-beta-hydroxybutyrate polymerase subunit 133.443 134.851 0.015143 Up RS19110 A3862_ paaH- 3-Hydroxybutyryl-CoA dehydrogenase 60.5688 125.351 1.049327 Up RS05165 1 A3862_ paaH- 3-Hydroxybutyryl-CoA dehydrogenase 487.68 218.354 − 1.15927 Down RS17305 2 A3862_ paaH- 3-Hydroxyacyl-CoA dehydrogenase family protein 33.7683 105.064 1.637527 Up RS21635 3 A3862_ fadJ Enoyl-CoA hydratase/isomerase family protein 155.264 191.337 0.301393 Up RS02250 A3862_ fadN-1 3-Hydroxyacyl-CoA dehydrogenase/enoyl-CoA 93.6416 170.494 0.864499 Up RS15330 A3862_ fadN-2 Enoyl-CoA hydratase/isomerase family protein 40.528 110.806 1.451045 Up RS25795 A3862_ scoA Succinyl-CoA--3-ketoacid-CoA transferase/CoA transferase 737.041 126.763 − 2.53961 Down RS06255 subunit A A3862_ scoB Succinyl-CoA--3-ketoacid-CoA transferase/CoA transferase 1515.36 206.479 − 2.87559 Down RS06260 subunit B A3862_ bdh 3-Hydroxybutyrate dehydrogenase 426.046 159.7 − 1.41564 Down RS14320 A3862_ phaZ- Polyhydroxyalkanoate depolymerase 397.233 383.709 − 0.04997 Down RS09710 1 A3862_ phaZ- Polyhydroxyalkanoate depolymerase 150.142 139.807 − 0.10289 Down RS17340 2 A3862_ hmgl Hydroxymethylglutaryl-CoA lyase 64.564 145.106 1.168305 Up RS12335 Due to the poor solubility of oxygen in aqueous oxygen supply, including two different surfactants (Tri- medium, the dissolved oxygen (DO) supply is another ton X-100 and Tween 80) and hydrogen dioxide. Com- key factor affecting the productivity in aerobic fermenta- pared with the control group, 0.1% (v/v) of different tion process, and one of the most effective strategies for oxygen carriers was added to Methylobacterium sp. improving oxygen mass transfer efficiency is adding oxy- XJLW fermentation system, respectively. The results gen carrier to the aerobic fermentation system (Lai et al. (Fig. 6e) showed that Tween 80 exhibits positive effects 2002;Xia 2013; Vieira et al. 2015). In this study, three especially in the level of CoQ and PHB biosynthesis, different oxygen carriers were chosen to enhance the meanwhile the productivities of the Triton X-100 group Cui et al. Annals of Microbiology (2021) 71:20 Page 11 of 15 Fig. 5 Cell growth (a) and PHB/CoQ production (b) of XJLW in M3 and MSM, respectively. Significant differences from MSM group are indicated * ** by p < 0.05; p < 0.01 and the hydrogen dioxide group were both lower than level of metabolites in many microorganisms (Xu et al. the control group. Perhaps excessive emulsification of 2013; Mozumder et al. 2015), so the effects of osmotic Triton X-100 and denaturation of membrane protein pressure on Methylobacterium sp. XJLW metabolism caused by hydrogen dioxide can both inhibit normal me- were discussed through adding different concentrations tabolism of Methylobacterium sp. XJLW. Tween-80, a of sodium chloride. The results (Fig. 6f) showed that the -1 non-ionic surfactant, could improve the cell membrane group adding 1.0 g L of sodium chloride exhibited the permeability and the specific surface area of oxygen at highest cell yield and target product concentration, so appropriate concentration, so it may also exhibit positive this regulation strategy was chosen in the subsequent promotion for intracellular metabolite biosynthesis. Ac- research. cording to these data, 0.1% (v/v) of Tween 80 was Based on the above, the optimal medium and cultural chosen as the best oxygen carrier in the following conditions for CoQ and PHB co-production through research. Methylobacterium sp. XJLW strain fermentation were -1 -1 As an important environmental factor, osmotic pres- M3 medium containing 7.918 g L methanol, 0.5 g L sure may affect the mass transfer and the accumulation of ammonium sulfate, 0.1% (v/v) of Tween 80, and 1.0 g Fig. 6 Effects of methanol concentration (a), ammonium sulfate concentration (b), fermentation temperature (c), initial pH of medium (d), different oxygen carriers (e), and sodium chloride concentration (f) on XJLW biomass, PHB and CoQ biosynthesis. Significant differences from -1 -1 selected group (7.918 g L methanol group for a, 0.5 g L (NH ) SO group for b, 30 °C group for c, pH 7.0 group for d, Tween 80 group for e, 4 2 4 -1 * ** and 1.0 g L sodium chloride group for f, respectively) are indicated by p < 0.05; p < 0.01 Cui et al. Annals of Microbiology (2021) 71:20 Page 12 of 15 -1 L of sodium chloride under the fermentation increased in the same trend, implying both PHB and temperature and initial medium pH of 30 °C and 7.0, CoQ were biosynthesized in association with cell respectively. growth. During the whole process, the total exhausted methanol volume is 830 mL, coupled with feeding Methylobacterium sp. XJLW fermentation in a 5-L 113.05 mL ammonium hydroxide. Finally, a maximum -1 fermenter DCW value of 46.31 g L was obtained, and the highest -1 Based on the above results, a methanol feeding strategy yields of PHB and CoQ reached 6.94 g L and 22.28 -1 coupled with pH and dissolved oxygen (DO) controlling mg L , respectively. Thus, the final productivities of was employed in a 5-L stirred tank reactor for a high- PHB and CoQ in this fed-batch fermentation system -1 -1 density fermentation. During the whole cultivation period, reached 0.15 g g of DCW and 0.48 mg g of DCW, re- DO, stir speed, and pH were captured by online monitors, spectively. These results suggest that the feeding metha- and the acquisition curves are shown in Fig. 7a. Mean- nol coupled with DO controlled through adding while, the changes of methanol concentration, biomass, ammonium hydroxide strategy should be an effective and PHB and CoQ productivity during the whole method to increase the cell density and productivities in process are shown in Fig. 7b. During the first 36 h, the Methylobacterium sp. XJLW submerged fermentation consumption of methanol added before fermentation was system. speeded up gradually until DO rebounding to 100%, meaning that there was no methanol enough for cell Discussion growth in the medium. From then on, methanol was fed As carbon source storage in microbial cells, PHAs are at a pulsed pace to ensure sufficient carbon source in the usually synthesized and accumulated under imbalanced fermentation system without toxicity caused by excessive growth conditions by limiting a nutritional element, methanol. With cell density increasing, the limited dis- such as nitrogen, phosphate, or oxygen (Mozumder solved oxygen became another key factor affecting cell et al. 2014). PHAs could accumulate inside a membrane growth. Thus, stir speed also gradually increased to ensure enclosed inclusion in many bacteria at a high content up the DO level between 10 and 50%. During the whole fed- to 80% of the dry cell weight (Khosravi-Darani et al. batch process, pH of broth was controlled at 5.7 approxi- 2013). Thus, if a strain has the potential for PHA pro- mately rather than 7.0, for excessive ammonium hydrox- duction, there will be many polymer particles inside the ide used for adjusting pH may inhibit PHB accumulation cell suggesting PHA existence. In this study, the cell according to previous report (Pieja et al. 2012). After 106 morphology of Methylobacterium sp. XJLW under a h when methanol accumulation occurred, methanol feed- transmission electron microscope (TEM) also showed a ing ceased, and DO quickly rose up to 100%, indicating high content of polymer particles (Fig. 1), which is simi- the respiration intensity of XJLW cells weakened sharply lar to most PHA-producing strains. with little methanol consumption in the final period. For Methylotrophs cultivating with methanol as sole It was also found that low content of PHB and CoQ carbon and energy source, both medium M3 and MSM were detected during the first 36 h, suggesting initially are recommended as suitable medium (Bourque et al. added methanol was almost completely exhausted for 1995). However, M3 medium exhibited superiority for cell respiration and growth. Later, along with feeding Methylobacterium sp. XJLW cell growth than MSM. As substrates, concentration of biomass, PHB, and CoQ medium components, carbon source and nitrogen Fig. 7 Online parameter acquisition curve (a) and CoQ and PHB fermentation of XJLW via fed-batch process (b) in a 5-L stirred tank reactor. The arrow demarcates the feeding event Cui et al. Annals of Microbiology (2021) 71:20 Page 13 of 15 -1 source usually play the significant role in the fermenta- cell density of DCW 46.31 g L with a PHB concentra- -1 tion productivity according to previous reports (Wei tion of 6.94 g L , and a CoQ concentration of 22.28 -1 et al. 2012; Mozumder et al. 2014). For Methylobacter- mg L were achieved in a 5 L bioreactor, which were ium strains, methanol and ammonium sulfate had been 30-fold, 6-fold, and 17-fold higher than that in Erlen- approved to be the suitable carbon and nitrogen source meyer flasks, respectively. Although the productivity of -1 (Bourque et al. 1995; Yezza et al. 2006). In the present CoQ was 0.48 mg g of DCW, which was lower than study, a methanol utilized strain Methylobacterium sp. that of previous reported strains such as Rhodobacter -1 XJLW, which was isolated as formaldehyde degrading sphaeroides (2.01 mg g of DCW) (Kalaiyezhini and -1 strain in our previous study (Qiu et al. 2014), also grows Ramachandran. 2015), the volumetric yield of 22.3 mg L better in the M3 than in BSM containing methanol as of Methylobacterium sp. XJLW was higher than that of sole carbon source (Fig. 5). several previous reported strains including the mutant -1 In order to develop its potential applications in biotech- strain of Rhodobacter sphaeroides (14.12 mg L )(Bule nological industry, PHB and CoQ were selected as rep- and Singhal. 2011), Paracoccus dinitrificans NRRL B-3785 -1 resentatives of biopolymers and quinone metabolites, (10.81 mg L ) (Tian et al. 2010), and Sphingomonas sp. -1 respectively, to evaluate the potential for their co- ZUTEO3 (1.14 mg L )(Zhonget al. 2009). Meanwhile, production via methanol-based culture process of Methy- Methylobacterium sp. XJLW could accumulate PHB at the -1 lobacterium sp. XJLW. An increasing number of PHB- productivity level of 0.15 g g of DCW. The PHB yield of producing strains have been reported, including Methylo- Methylobacterium sp. XJLW was lower than several re- bacterium extorquens (Ueda et al. 1992; Bourque et al. ported strains such as Methylobacterium extorquens -1 1995), Paracoccus denitrificans (Ueda et al. 1992; Kalaiyez- DSMZ 1340 (0.62 g g of DCW) (Mokhtari-Hosseini hini and Ramachandran. 2015), Alcaligenes latus (Yamane et al. 2009)and Methylobacterium extorquens ATCC -1 et al. 1996), Methylobacterium sp. ZP24 (Nath et al. 2008), 55366 (0.46 g g of DCW) (Bourque et al. 1995), but the Bacillus thuringiensis (Pal et al. 2009), Cupriavidus neca- volumetric yield of PHB of Methylobacterium sp. XJLW in -1 tor (Mozumder et al. 2015), Halomonas campaniensis this study (6.94 g L ) was higher than that of Methylobac- -1 (Chen et al. 2019), Bacillus drentensis (Gamez-Perez et al. terium sp. ZP24 (3.91 g L ) (Nath et al. 2008). 2020). After process and culture condition optimization, the yield of PHB has reached a high level more than 100 g Conclusions -1 L PHB from methanol via high-cell-density fed-batch In summary, it is feasible to develop a co-production culture of methylotrophic bacteria (Ueda et al. 1992; process of two valuable metabolites by Methylobacter- Yamane et al. 1996). Based on the above, methylotrophic ium sp. XJLW from methanol. However, compared with bacteria seem the potential industrial strains for PHB pro- the cost of chemical polymers and the productivity of duction via methanol-based biotechnology. PHB or CoQ10 high yield strains, it is still necessary to Meanwhile, CoQ is another important compound 10 further optimize fermentation process, and genetically which can be widely used as potent antioxidative dietary modify strain pathway, for enhanced production of PHB supplement in treating cardiovascular disease, cancer, and CoQ simultaneously by Methylobacterium sp. periodontal disease, and hypertension acting (Hofer XJLW. This study also presented a potential strategy to et al. 2010; Lu et al. 2013). There are also a number of develop efficiently co-producing other high-value metab- strains capable of producing CoQ . However, no publi- 10 olites using methanol-based bioprocess. cation was found about CoQ synthesis in methylo- Abbreviations trophic bacteria. In this study, it was found that both CGMCC: China General Microbiological Culture Collection Center; metabolic pathways of PHB and CoQ biosynthesis CoQ : Coenzyme Q ; DCW: Dry cell weight; DO: Dissolved oxygen; FT- 10 10 exist in Methylobacterium sp. XJLW based on the gen- IR: Fourier transformation infrared spectrum; GC-MS: Gas chromatography/ mass spectrometry; HPLC: High-performance liquid chromatography; LC- omic and comparative transcriptomics information (Fig. MS: Liquid chromatography/mass spectrometry; OD : Optical density at 600 1). RT-qPCR results also showed the transcription level nm; PCR: Polymerase chain reaction; NMR: Nuclear magnetic resonance; of key genes in both pathways’ response to methanol PHAs: Polyhydroxy-alkanoates; PHB: Poly-β-hydroxybutyrate was significantly higher than that response to glucose (Fig. 4). Correspondingly, Methylobacterium sp. XJLW Supplementary Information The online version contains supplementary material available at https://doi. can produce PHB and CoQ simultaneously with higher org/10.1186/s13213-021-01632-w. yield using methanol than using glucose as sole carbon and energy source (Fig. 3). To our knowledge, it is the Additional file 1: Fig. S1 GC-MS spectra of PHAs extracted from Methy- first report on PHB and CoQ production simultan- lobacterium sp. XJLW, A is the GC spectra while B shows the MS spectra 1 13 eously by methylotrophic bacteria. of the 7.59 min peak in A. Fig. S2 Comparison of H- spectra (A) and C- NMR spectra (B) between PHB standards and PHAs extracted from Methy- After optimization of medium composition and the lobacterium sp. XJLW. Fig. S3 Comparison of IR spectra between PHB culture conditions on PHB and CoQ biosynthesis, a 10 Cui et al. Annals of Microbiology (2021) 71:20 Page 14 of 15 Kalaiyezhini D, Ramachandran KB (2015) Biosynthesis of poly-3-hydroxybutyrate standards and PHAs extracted from Methylobacterium sp. XJLW. Fig. S4 (PHB) from glycerol by Paracoccus denitrificans in a batch bioreactor: effect LC-MS spectra of CoQ standards (A) and CoQ sample extracted from 10 10 of process variables. Prep Biochem Biotechnol 45(1):69–83. https://doi.org/1 Methylobacterium sp. XJLW (B). 0.1080/10826068.2014.887582 Additional file 2:. Supplementary Material-Table of Samples. Khosravi-Darani K, Mokhtari ZB, Amai T, Tanaka K (2013) Microbial production of poly(hydroxybutyrate) from C(1) carbon sources. Appl Microbiol Biotechnol 97(4):1407–1424. https://doi.org/10.1007/s00253-012-4649-0 Authors’ contributions Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL (2013) TopHat2: WZ conceived of the study. PC, YS, YW, RZ, and HZ designed and performed accurate alignment of transcriptomes in the presence of insertions, deletions the experiments. YS and WZ supervised and implemented the statistical and gene fusions. Genome Biol 14(4):R36. https://doi.org/10.1186/gb-2 analysis. PC and WZ wrote the manuscript. The authors read and approved 013-14-4-r36 the final manuscript. Lai LS, Tsai TH, Wang TC (2002) Application of oxygen vectors to Aspergillus terreus cultivation. J Biosci Bioeng 94(5):453–459. https://doi.org/10.1016/S13 Funding 89-1723(02)80224-9 This work was financially supported by National Natural Science Foundation Lu W, Shi Y, He S, Fei Y, Yu K, Yu H (2013) Enhanced production of CoQ by of China (81973211), Innovation Platform and Talent Plan of Hunan Province constitutive overexpression of 3-demethyl ubiquinone-9 3-methyltransferase (2015JC3073), Scientific Research Project of Hunan Education Department under tac promoter in Rhodobacter sphaeroides. Biochem Eng J 72:42–47. (18B249), The Key Discipline of Biological Engineering of Hunan University of https://doi.org/10.1016/j.bej.2012.12.019 Chinese Medicine (2018) No.3. Mohandas SP, Balan L, Lekshmi N, Cubelio SS, Philip R, Bright Singh IS (2017) Production and characterization of polyhydroxybutyrate from Vibrio harveyi Availability of data and materials MCCB 284 utilizing glycerol as carbon source. J Appl Microbiol 122(3):698– The genome of Methylobacterium sp. XJLW is available in GenBank (accession 707. https://doi.org/10.1111/jam.13359 no. CP016429), while its transcriptomics data are available in this article Mokhtari-Hosseini ZB, Vasheghani-Farahani E, Heidarzadeh-Vazifekhoran A, (Supplemental Material-Table of Samples FPKM). Shojaosadati SA, Karimzadeh R, Darani KK (2009) Statistical media optimization for growth and PHB production from methanol by a Declarations methylotrophic bacterium. Bioresour Technol 100(8):2436–2443. https://doi. org/10.1016/j.biortech.2008.11.024 Ethics approval and consent to participate Mostafa YS, Alrumman ASA, Otaif KA, Mostafa MS, Alfaify AM (2020) Bioplastic Not applicable (poly-3-hydroxybutyrate) production by the marine bacterium Pseudodonghicola xiamenensis through date syrup valorization and structural Consent for publication assessment of the biopolymer. Sci Rep 10(1):8815. https://doi.org/10.1038/s41 Not applicable 598-020-65858-5 Mozumder MSI, De Wever H, Volcke EIP, Garcia-Gonzalez L (2014) A robust fed- Competing interests batch feeding strategy independent of the carbon source for optimal The authors declare that they have no competing interests. polyhydroxybutyrate production. Process Biochem 49(3):365–373. https://doi. org/10.1016/j.procbio.2013.12.004 Author details Mozumder MSI, Garcia-Gonzalez L, De Wever H, Volcke EIP (2015) Effect of College of Biotechnology and Bioengineering, Zhejiang University of sodium accumulation on heterotrophic growth and polyhydroxybutyrate Technology, Hangzhou 310032, People’s Republic of China. College of (PHB) production by Cupriavidus necator. Bioresour Technol 191:213–218. Pharmacy, Hunan University of Chinese Medicine, Changsha, Hunan 410208, https://doi.org/10.1016/j.biortech.2015.04.110 People’s Republic of China. Nath A, Dixit M, Bandiya A, Chavda S, Desai AJ (2008) Enhanced PHB production and scale up studies using cheese whey in fed batch culture of Received: 18 February 2021 Accepted: 30 April 2021 Methylobacterium sp. ZP24. Bioresour Technol 99(13):5749–5755. https://doi. org/10.1016/j.biortech.2007.10.017 Pal A, Prabhu A, Kumar AA, Rajagopal B, Dadhe K, Ponnamma V, Shivakumar S References (2009) Optimization of process parameters for maximum poly(-beta- Bourque D, Pomerleau Y, Groleau D (1995) High cell density production of poly- )hydroxybutyrate (PHB) production by Bacillus thuringiensis IAM 12077. Pol J beta-hydroxybutyrate (PHB) from methanol by Methylobacterium extorquens: Microbiol 58(2):149–154 production of high-molecular-mass PHB. Appl Microbiol Biotechnol 44(3-4): Park YC, Kim SJ, Choi JH, Lee WH, Park KM, Kawamukai M, Ryu YW, Seo JH (2005) 367–376. https://doi.org/10.1007/BF00169931 Batch and fed-batch production of coenzyme Q in recombinant Escherichia Bule MV, Singhal RS (2011) Fermentation kinetics of production of ubiquinone-10 coli containing the decaprenyl diphosphate synthase gene from by Paracoccus dinitrificans NRRL B-3785: effect of type and concentration of Gluconobacter suboxydans. Appl Microbiol Biotechnol 67(2):192–196. https:// carbon and nitrogen sources. Food Sci Biotechnol 20(3):607–613. https://doi. doi.org/10.1007/s00253-004-1743-y org/10.1007/s10068-011-0086-6 Parveez GK, Bahariah B, Ayub NH, Masani MY, Rasid OA, Tarmizi AH, Ishak Z Cardoso LOB, Karolski B, Gracioso LH, CAO d N, Perpetuo EA (2020) Increased (2015) Production of polyhydroxybutyrate in oil palm (Elaeis guineensis Jacq.) P3HB accumulation capacity of Methylorubrum sp. in response to mediated by microprojectile bombardment of PHB biosynthesis genes into discontinuous methanol addition. Appl Biochem Biotechnol 192(3):846–860. embryogenic calli. Front Plant Sci 6:598 https://doi.org/10.1007/s12010-020-03369-9 Pieja AJ, Sundstrom ER, Criddle CS (2012) Cyclic, alternating methane and Chen L, Qiao GQ, Shuai BW, Song KN, Yao WX, Jiang XR, Chen GQ (2019) nitrogen limitation increases PHB production in a methanotrophic Engineering self-flocculating Halomonas campaniensis for wastewaterless community. Bioresour Technol 107(0): 385-392, DOI: https://doi.org/10.1016/j. open and continuous fermentation. Biotechnol Bioeng 116(4) 805-815. biortech.2011.12.044. Ernster L, Dallner G (1995) Biochemical, physiological and medical aspects of Qiu L, Chen W, Zhong L, Wu W, Wu S, Chen J, Zhang F, Zhong W (2014) ubiquinone function. Biochimica Et Biophysica Acta 1271(1):195–204. https:// Formaldehyde biodegradation by immobilized Methylobacterium sp. XJLW doi.org/10.1016/0925-4439(95)00028-3 cells in a three-phase fluidized bed reactor. Bioprocess Biosyst Eng 37(7): Gamez-Perez J, Penkhrue W, Jendrossek D, Khanongnuch C, Pathom-aree W, 1377–1384. https://doi.org/10.1007/s00449-013-1110-4 Aizawa T, Behrens RL, Lumyong S (2020) Response surface method for Qiu L, Ding H, Wang W, Kong Z, Li X, Shi Y, Zhong W (2012) Coenzyme Q(10) polyhydroxybutyrate (PHB) bioplastic accumulation in Bacillus drentensis BP17 production by immobilized Sphingomonas sp. ZUTE03 via a conversion- using pineapple peel. Plos One 15(3):e0230443 extraction coupled process in a three-phase fluidized bed reactor. Enzyme Hofer P, Choi YJ, Osborne MJ, Miguez CB, Vermette P, Groleau D (2010) Microbiol Technol 50(2):137–142 Production of functionalized polyhydroxyalkanoates by genetically modified Shao Y, Li J, Wang Y, Yi F, Zhang Y, Cui P, Zhong W (2019a) Comparative Methylobacterium extorquens strains. Microb Cell Fact 9(1):70. https://doi.org/1 genomics and transcriptomics insights into the C1 metabolic model of a 0.1186/1475-2859-9-70 Cui et al. Annals of Microbiology (2021) 71:20 Page 15 of 15 formaldehyde-degrading strain Methylobacterium sp. XJLW. Mol Omics 15(2): 138–149. https://doi.org/10.1039/C8MO00198G Shao Y, Wang Y, Yi F, Zhang Y, Liu W, Yang C, Meng H, Cui P, Zhong W (2019b) Gaseous formaldehyde degrading by Methylobacterium sp. XJLW. Appl Biochem Biotechnol 15:138–149 Sharma N (2019) Polyhydroxybutyrate (PHB) production by bacteria and its application as biodegradable plastic in various industries. Academic Journal of Polymer Science 2(3):555587 Sukruansuwan V, Napathorn SC (2018) Use of agro-industrial residue from the canned pineapple industry for polyhydroxybutyrate production by Cupriavidus necator strain A-04. Biotechnol Biofuels 11(1):202. https://doi. org/10.1186/s13068-018-1207-8 Tian Y, Yue T, Yuan Y, Soma PK, Lo YM (2010) Improvement of cultivation medium for enhanced production of coenzyme Q by photosynthetic Rhodospirillum rubrum. Biochem Eng J 51(3):160–166. https://doi.org/10.1016/ j.bej.2010.06.011 Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ, Pachter L (2010) Transcript assembly and quantification by RNA- Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28(5):511–515 https://doi.org/10.1038/nbt.1621 Ueda S, Mataumoto S, Takagi A, Yamane T (1992) Synthesis of poly (3- hydroxybutyrate-co-3-hydroxyvalerate) from methanol and N-amyl alcohol by the methylotrophic bacteria Paracoccus denitrificans and Methylobacterium extorquens. Appl Environ Microbiol 58(11):3574–3579. https://doi.org/10.112 8/AEM.58.11.3574-3579.1992 Vieira ES, de Oliveira Fontes TK, Pereira MM, Alexandre HV, da Silva DP, Soares CM, Lima AS (2015) New strategy to apply perfluorodecalin as an oxygen carrier in lipase production: minimisation and reuse. Bioprocess Biosyst Eng 38(4):721–728. https://doi.org/10.1007/s00449-014-1312-4 Wei ZH, Bai L, Deng Z, Zhong JJ (2012) Impact of nitrogen concentration on validamycin A production and related gene transcription in fermentation of Streptomyces hygroscopicus 5008. Bioprocess Biosys Eng 35(7):1201–1208. https://doi.org/10.1007/s00449-012-0707-3 Xia Z (2013) Effect of Tween 80 on the production of curdlan by Alcaligenes faecalis ATCC 31749. Carbohydr Poly 98(1):178–180. https://doi.org/10.1016/j. carbpol.2013.05.073 Xu YN, Xia XX, Zhong JJ (2013) Induced effect of Na on ganoderic acid biosynthesis in static liquid culture of Ganoderma lucidum via calcineurin signal transduction. Biotechnol Bioeng 110(7):1913–1923. https://doi.org/10.1 002/bit.24852 Yamane T, Fukunaga M, Lee YW (1996) Increased PHB productivity by high-cell- density fed-batch culture of Alcaligenes latus, a growth-associated PHB producer. Biotechnol Bioeng 50(2):197–202. https://doi.org/10.1002/(SICI)1 097-0290(19960420)50:2<197::AID-BIT8>3.0.CO;2-H Yezza A, Fournier D, Halasz A, Hawari J (2006) Production of polyhydroxyalkanoates from methanol by a new methylotrophic bacterium Methylobacterium sp. GW2. Appl Microbiol Biotechnol 73(1):211–218. https:// doi.org/10.1007/s00253-006-0458-7 Zaldivar Carrillo JA, Stein LY, Sauvageau D (2018) Defining nutrient combinations for optimal growth and polyhydroxybutyrate production by Methylosinus trichosporium OB3b using response surface methodology. Front Microbiol 9: 1513. https://doi.org/10.3389/fmicb.2018.01513 Zhang M, Yuan XJ, Zhang C, Zhu LP, Mo XH, Chen WJ, Yang S (2019) Bioconversion of methanol into value-added chemicals in native and synthetic methylotrophs. Curr Issues Mol Biol 33:225–236. https://doi.org/1 0.21775/cimb.033.225 Zhong W, Fang J, Liu H, Wang X (2009) Enhanced production of CoQ by newly isolated Sphingomonas sp. ZUTEO3 with a coupled fermentation-extraction process. J Ind Microbiol Biotechnol 36(5):687–693. https://doi.org/10.1007/s1 0295-009-0538-7 Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

Co-production of polyhydroxybutyrate (PHB) and coenzyme Q10 (CoQ10) via no-sugar fermentation—a case by Methylobacterium sp. XJLW

Download PDF
15 pages

Loading next page...
 
/lp/springer-journals/co-production-of-polyhydroxybutyrate-phb-and-coenzyme-q10-coq10-via-no-SalbWjeRkD

References (37)

Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2021
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1186/s13213-021-01632-w
Publisher site
See Article on Publisher Site

Abstract

Purpose: To explore a competitive PHB-producing fermentation process, this study evaluated the potential for Methylobacterium sp. XJLW to produce simultaneously PHB and coenzyme Q (CoQ ) using methanol as sole 10 10 carbon and energy source. Methods: The metabolic pathways of PHB and CoQ biosynthesis in Methylobacterium sp. XJLW were first mined based on the genomic and comparative transcriptomics information. Then, real-time fluorescence quantitative PCR (RT-qPCR) was employed for comparing the expression level of important genes involved in PHB and CoQ10 synthesis pathways’ response to methanol and glucose. Transmission electron microscope (TEM), gas chromatography/mass spectrometry (GC-MS), nuclear magnetic resonance (NMR), Fourier transformation infrared spectrum (FT-IR), and liquid chromatography/mass spectrometry (LC-MS) methods were used to elucidate the yield and structure of PHB and CoQ , respectively. PHB and CoQ productivity of Methylobacterium sp. XJLW were 10 10 evaluated in Erlenmeyer flask for medium optimization, and in a 5-L bioreactor for methanol fed-batch strategy according to dissolved oxygen (DO) and pH control. Results: Comparative genomics analysis showed that the PHB and CoQ biosynthesis pathways co-exist in Methylobacterium sp. XJLW. Transcriptomics analysis showed that the transcription level of key genes in both pathways responding to methanol was significantly higher than that responding to glucose. Correspondingly, strain Methylobacterium sp. XJLW can produce PHB and CoQ simultaneously with higher yield using cheap and abundant methanol than using glucose as sole carbon and energy source. The isolated products showed the structure characteristics same to that of standard PHB and CoQ . The optimal medium and cultural conditions for -1 PHB and CoQ co-production by Methylobacterium sp. XJLW was in M3 medium containing 7.918 g L methanol, -1 -1 0.5 g L of ammonium sulfate, 0.1% (v/v) of Tween 80, and 1.0 g L of sodium chloride, under 30 °C and pH 7.0. In -1 a 5-L bioreactor coupled with methanol fed-batch process, a maximum DCW value (46.31 g L ) with the highest -1 -1 yields of PHB and CoQ , reaching 6.94 g L and 22.28 mg L , respectively. (Continued on next page) * Correspondence: whzhong@zjut.edu.cn Equal contributors Peiwu Cui and Yunhai Shao contributed equally to this work. College of Biotechnology and Bioengineering, Zhejiang University of Technology, Hangzhou 310032, People’s Republic of China Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Cui et al. Annals of Microbiology (2021) 71:20 Page 2 of 15 (Continued from previous page) Conclusion: Methylobacterium sp. XJLW is potential for efficiently co-producing PHB and CoQ employing methanol as sole carbon and energy source. However, it is still necessary to further optimize fermentation process, and genetically modify strain pathway, for enhanced production of PHB and CoQ simultaneously by Methylobacterium sp. XJLW. It also suggests a potential strategy to develop efficiently co-producing other high- value metabolites using methanol-based bioprocess. Keywords: Methylobacterium sp. XJLW, Metabolic pathway mining, Methanol-based process, PHB, CoQ , Fed-batch fermentation Introduction and it is a good clinic biological drug for removing free Nowadays, along with the increasing demands for poly- radicals in the body, keeping biological membrane stable, mer plastics, which can be widely used from product anti-lipid peroxidation, and strengthening the nonspe- packing and daily tools to equipment parts and con- cific immune (Ernster and Dallner 1995; Qiu et al. 2012; struction sectors, the growing serious petroleum-based Lu et al. 2013). Thus, PHB and CoQ were selected as plastic pollution has drawn more attractive attention due representatives of biopolymers and quinone metabolites, to its less biodegradation property (Cardoso et al. 2020; respectively, to evaluate the potential for their co- Mostafa et al. 2020). In order to solve this global circum- production via methanol-based process. stance, many scientists have put great efforts on bio- In our previous work, a new formaldehyde-degradable degradable polymer production. For showing similar methylotrophic bacterium was isolated and identified as thermoplastic, elastomeric, and other physical–chemical Methylobacterium sp. XJLW (Qiu et al. 2014; Shao et al. properties to conventional plastics, polydroxyalkanoates 2019a). Its completed genome has been sequenced (Shao (PHAs) are regarded as the most potential substituent, et al. 2019b). Comparative genomic analysis exhibited which can be completely degraded to CO and H O Methylobacterium sp. XJLW contains both pathways of 2 2 (Sukruansuwan and Napathorn 2018; Mostafa et al. CoQ and PHB biosynthesis (Fig. 1), suggesting the 2020). However, the high cost of PHA production from possibility to develop a new fermentation process to costly substrates has seriously limited the utilization of realize co-production of PHB and CoQ with the abun- PHAs in commercial fields, which forces scientists to ex- dant methanol as sole carbon source at the same time, plore alternative approaches to produce it at a lower which will provide a more economic process for PHB price (Parveez et al. 2015). The production costs of production. PHAs depend on many factors including strains, sub- In the present study, the aim was to (1) verify the po- strates, cultivation conditions, extraction, and purifica- tential of PHB and CoQ co-production by Methylobac- tion processes (Gamez-Perez et al. 2020). Carbon source terium sp. XJLW with different carbon sources, glucose, is regarded as the major factor that accounts for 70–80% and methanol; (2) elucidate the expression difference of of the total expenses of PHAs (Mohandas et al. 2017), the key genes in both pathways of PHB and CoQ bio- because PHAs are usually synthesized under a specific synthesis in Methylobacterium sp. XJLW response to condition of limitation of nutrients, and excess of carbon methanol and glucose; (3) evaluate the effects of medium source (Cardoso et al. 2020). Thus, development of a composition and cultivation conditions on PHB and PHA-producing process with a cheap and renewable CoQ co-production in Erlenmeyer flasks and in a 5-L substrate is still necessary. As one of the common indus- stirred bioreactor employing methanol fed-batch strat- trial by-products and a cheaper and renewable chemical egy. This study provided a new reference of strategy for feedstock, methanol has been widely used as carbon and improving value-added product productivity with energy source in methylotroph fermentation processes methanol-based fermentation process employing for value-added chemical production (Zaldivar Carrillo methylotrophs. et al. 2018; Zhang et al. 2019). Hence, methanol-based fermentation for PHA production is still a highly prom- Materials and methods ising process without sugar consumption. Chemicals Among all PHAs, polyhydroxybutyrate (PHB) is con- PHB (purity above 95%, CAS no: 26063-00-3) and sidered as the most competitive biopolymer because of CoQ (purity above 99.9%, CAS no: 303-98-0) were its good biocompatibility, biodegradability, and similar purchased from Sigma-Aldrich, China. Alcohol (HPLC properties to polypropylene (Parveez et al. 2015; Sharma grade, purity above 99.5%) was purchased from Tjshield 2019). Meanwhile, coenzyme Q (CoQ ) is the most 10 10 fine chemicals Co., Ltd. (Tianjin, China). Other valuable product among all natural quinone metabolites, Cui et al. Annals of Microbiology (2021) 71:20 Page 3 of 15 Fig. 1 (See legend on next page.) Cui et al. Annals of Microbiology (2021) 71:20 Page 4 of 15 (See figure on previous page.) Fig. 1 Genetic organization of genes and core pathway responsible for CoQ (a, c) and PHB (b, d) synthesis in XJLW strain via comparative genomic analysis. The EC No. in yellow-backed textboxes in a and b meant that they cannot be found in genomic data of XJLW strain. The green color and (+) symbol-labelled genes were upregulated expressed in the methanol group, while the red color and (-) symbol-labelled genes were downregulated expressed in methanol compared with glucose. The black-backed gene in c suggests that the expression level of this gene was not affected by methanol or glucose chemicals were analytical reagents and purchased from a Cell morphology observation via transmission electron local company. microscope Cells in 1 mL culture broth was harvested by centrifuga- tion at 5790 × g for 10 min at 4 °C in a high-speed freez- Microorganism and maintenance ing centrifuge (TGL-16M, Bioridge, China), and then Methylobacterium sp. XJLW was isolated from Huang- were suspended in 4% (v/v) pre-cooled glutaraldehyde yan Sewage Treatment Plant, Zhejiang Province, China. and immobilized for 1 h at 4 °C. The ultrathin section of Now, it has been deposited at China Center for Type immobilized cell was observed under transmission elec- Culture Collection (CCTCC) under the accession num- tron microscope (HITACHI H-7650, Japan) at the mag- ber CCTCC M2012065. nification of 15,000 ×. After the broth OD of strain XJLW cultured in li- quid M3 mineral medium containing 1.0% methanol Physiological characteristic analysis combined with RNA- reaches about 0.6, about 750 μL broth was mixed with seq and RT-qPCR 250 μL 80% sterile glycerol in a 1.5-mL centrifuge tube, The cell growth and simultaneous production ability of and then stored in – 80 °C refrigerator. When activation PHB and CoQ was detected in M3 medium supple- -1 -1 is required, the stored strains are taken out and thawed, mented with 7.4232 g L glucose or 7.918 g L metha- inoculated into an M3 liquid medium containing metha- nol, respectively. Meanwhile, the cells were harvested for nol, and activated on a shaker at 30 °C and 180 rpm. RNA-seq and RT-qPCR. RNA-Seq data analysis Culture condition After culture in M3 containing methanol or glucose as -1 Medium M3 (Bourque et al. 1995) contained (g L ) carbon source, respectively, at 30 °C to log phase (OD (NH ) SO 0.5, KH PO 1.305, Na HPO ·7H O 4.02, 0.8), Methylobacterium sp. XJLW cells were harvested 4 2 4 2 4 2 4 2 MgSO ·7H O 0.45, CaCl 2H O 0.02, FeSO ·H O 0.02, via centrifugation at 2000 × g for 10 min at 4 °C in a 4 2 2 2 4 2 -1 and 1 mL L trace element solution. The trace element high-speed freezing centrifuge (TGL-16M, Bioridge, -1 solution contained (g L )MnSO ·H O 4.9, ZnSO ·7H O China). Then, cell pellets were immediately mixed with 4 2 4 2 2.6, CuSO ·5H O 0.8, Na MoO ·2H O 0.8, CoCl ·6H O RNA protect Bacteria Reagent (QIAGEN China Co. 4 2 2 4 2 2 2 0.8, and H BO 0.6. Ltd), and then stored at – 80 °C for RNA extraction. A 3 3 Mineral salt medium (MSM) (Qiu et al. 2014) con- total amount of 1 μg qualified RNA sample was used as -1 tained (g L )KH PO 0.7, K HPO 0.85, (NH ) SO 1.2, input material for the library preparation. Library con- 2 4 2 4 4 2 4 MgSO ·7H O 0.1, CaCl 0.01, FeSO ·7H O 0.001, and 1 centration was measured using Qubit® RNA Assay Kit in 4 2 2 4 2 -1 mL L trace element solution. The trace element solu- Qubit® 3.0 (Thermo Fisher Scientific, USA) to prelimin- -1 tion contained (g L )H BO 6, CoCl ·6H O4, ary quantify. Insert size was assessed using the Bioanaly- 3 3 2 2 ZnSO ·7H O2,MnCl 4H O 0.6, Na MoO ·2H O 0.6, zer 2100 system (Agilent, USA), after the insert size is 4 2 2 2 2 4 2 NiCl ·4H O 0.4, and CuCl ·2H O 0.2. consistent with expectations, qualified fragment was ac- 2 2 2 2 Initial pH of the above media was adjusted to 7.0 with curately quantified using qPCR by Step One Plus Real- -1 -1 1 mol L NaOH. Methanol, 7.918 g L , was added to Time PCR system (ABI, USA). The raw reads were fil- the two media used as sole carbon source after being tered by removing reads containing adaptors, ploy-N autoclaved at 115 °C for 30 min. Fifty microliters sus- (i.e., unrecognized bases, reads with a recall ratio less pension of frozen stock Methylobacterium sp. XJLW was than 5%), and low-quality reads (the number of base ≤ inoculated into a 250-mL Erlenmeyer flask containing 10 and occupied less than 50% of the entire read) for 50 mL medium M3, and incubated for 96 h. Then 2-mL subsequent analysis. Firstly, Tophat2 (Kim et al. 2013) culture was inoculated into 250-mL Erlenmeyer flasks was used to evaluate the sequencing data by comparison containing 50 mL fermentation medium and incubated with the genomic sequences of reference strains. Based for 5 days in a rotary incubator (SPH-2102, SHIPING, on the Tophat2 alignment results, Cufflinks-2.2.1 (Trap- China) with the parameter settings at 30 °C and 400 nell et al. 2010) was used to perform quantitative gene rpm, respectively. expression analysis. Gene expression is calculated as Cui et al. Annals of Microbiology (2021) 71:20 Page 5 of 15 follows: FPKM (expected number of Fragments Per Kilo- effects of methanol concentration, ammonium sulfate base of transcript sequence per Million of sequenced concentration, fermentation temperature, initial pH of base pairs). In general, the screening criteria for signifi- medium, different types of oxygen carriers and osmotic cantly differentially expressed genes are: |log fold pressure regulated by adding different concentration of change| ≥ 1 and p value ≤ 0.05. Scatter plot and volcano sodium chloride on Methylobacterium sp. XJLW grow- map are used to present the overall profile of gene ex- ing and target metabolites biosynthesis. The value ranges pression differences. of the above mentioned culture condition variables are listed in Table 2. RNA extraction and quantitative RT-qPCR The cells in the early exponential stage, cultured in Cultivation of Methylobacterium sp. XJLW on bench -1 M3 medium supplemented with 7.4232 g L glucose bioreactor using fed-batch strategy -1 or 7.918 g L methanol respectively, were centrifuged After investigation of fermentation conditions in Erlen- at 2000 × g for 10 min at 4 °C in a high-speed freez- meyer flask, a fed-batch fermentation was carried out in ing centrifuge (TGL-16M, Bioridge, China). The total a 5-L stirred tank reactor (Biostat-Bplus-5L, B.Braun RNA was extracted by using RNA isolator (Vazyme Germany) with a working volume of 3.0 L, at 30 °C, 400 Biotech Co., Ltd., Nanjing). And then, HiScript II Q rpm and pH 5.5 (controlled using aqueous NH OH so- RT SuperMix qPCR kit (Vazyme Biotech Co., Ltd., lution), and with a dissolved oxygen concentration above Nanjing) was used to develop reverse transcription re- 20% of air saturation. Firstly, the basal salts of optimal actions. The reaction buffer system of RT-qPCR was medium were dissolved in 2670 mL ddH O and were prepared with ChamQ SYBR qPCR Master Mix, and autoclaved in the bioreactor. To start the fermentation, the quantitative PCR with Bio-Rad CFX real-time 30 mL methanol and 300 mL inoculum suspension PCR system was performed. The expression level of (OD = 3.0) were added to the bioreactor by peristaltic the 16S rRNA gene was used as internal reference. pump. Filter-sterilized air was the source of oxygen and Each reaction was repeated at least three times. The was supplied at a flow rate of 3 vvm. After initial added primers used for RT-qPCR are listed in Table 1. methanol was completely exhausted implied by the dis- solved oxygen level rising up to 100%, additional metha- Effect of culture conditions on Methylobacterium sp. XJLW nol (mixed with 1% trace element solution) was pulse fermentation in Erlenmeyer flask fed into the reactor regulated by the dissolved oxygen Firstly, to choose a better initial medium, the cell growth monitor to further increase the cell density. At the same and biosynthesis of target products of Methylobacterium time, pH was also adjusted at a stable level of 5.7 by add- sp. XJLW cultivated in M3 and MSM were evaluated. A ing NH OH solution which could supply nitrogen one-factor-at-a-time design was employed to analyze the source simultaneously. If needed, increasing stirred speed strategy was also employed to increase dissolved Table 1 Primers used in this study oxygen level. The whole fermentation period was about Genes Primers Sequence 5 to 7 days. 16S rDNA 16S-F GTTGGTGGAACTGCGAGTGTAGAG Separation of CoQ and PHB 16S-R CCCCAGGCGGAATGCTCAAAG After fermentation, cell biomass was separated by centri- ubiA ubiA-F GCTGGTGGCTCCTCCTCCTG fugation at 8000 × g, 4 °C for 10 min (Biofuge Stratos ubiA-R GGCATCGGCATGACCCGTTTC Sorvall, Thermo, Germany), then 20 mL alcohol was ubiG ubiG-F CTGGACGGGCTTTCGATCTGC added to the pellets for suspending cells. Subsequently, ubiGR CAGCCAGCCGAGCACGTATTC the cell suspension was subjected to sonication in an ultrasonicator (Scientz-IID, China) at 500 W for 12 min ubiD ubiD -F CGTGACCCTGTGCCCAAAGC with a pulse of 15 s on and 10 s off. After cell disruption, ubiD -R AACTGAGCGGTTTCTGCGGATG the suspension was centrifuged at 8000 × g, 4 °C for 10 ubiH ubiH-F TGGTGCTCTCGCTCGCCTATC min, and then the supernatant was sampled for CoQ ubiH-R TGGAAGCTCGGAAACGTGATGATG Table 2 Ranges of the culture condition variables ubiX ubiX -F AAGAGAGCCGCGAGGGTGAG Variables Ranges of values ubiX-R CCCTGCTCCTGTACCTGATCTGG Methanol concentration (%, v/v) 0.5, 1.0, 1.5, 2.0, 2.5 hmgl hmgl-F CGTCAAGCAGCTCGCCAAGAG Ammonium sulfate (%, w/v) 0.5, 1.0, 1.5, 2.0, 2.5 hmgl-R GAGGCTCTCCATCACGTTGAACAC Temperature (°C) 25, 30, 37 Initial pH 5, 6, 7, 8, 9 phaC-3 phaC-3-F ACGCCGAAGGATCTGGTCTGG Oxygen carriers Triton X-100, Tween 80, H O 2 2 phaC-3-R TTCGCCGCCTCCTGGATGAC Sodium chloride (g/L) 1.0, 5.0, 10.0 Cui et al. Annals of Microbiology (2021) 71:20 Page 6 of 15 analysis, while the precipitation was sampled and kept in capillary column (HP5MS), 30 m × 0.25 mm, film thick- a 45 °C oven to a constant weight before PHB ness 0.25 μm; injection temperature 250 °C, ion source extraction. temperature 200 °C, and transfer line temperature 275 For PHB extraction, 10 mL chloroform was added to a °C; oven temperature programming: initially at 60 °C, digestion tube with threaded cap containing less than 100 then heating to 250 °C at the speed of 20 °C per min mg of the dry disruption cell for 1 h extraction at 60 °C. and keeping for 15.5 min. The carried gas was helium Then, the PHB extract was separated by vacuum filtration and column flow was 40 cm/s. 1 13 and air dried as the crude PHB, which was further purified Proton ( H) and carbon ( C) NMR spectra were re- by adding acetone–methanol-mixed liquor (volume ratio corded by using an Anance III spectrometer (Bruker, 7:2) and washing twice to remove the pigment. The puri- Switzerland) at 400 MHz and 100 MHz, respectively, at fied PHB was obtained after drying at 45 °C. the following experimental conditions: 0.5% (w/v) poly- mer sample was dissolved in spectrochem-grade deuter- Assay methods ochloroform (CDCl ) and tetramethylsilane (TMS) was Methanol was analyzed by gas chromatography (GC; used as an internal reference. The chemical shift scale Shimadzu-2010, Japan) equipped with flame ionization de- was in parts per million (ppm). tector (FID) and elastic quartz capillary column (AT-FFAP). For FT-IR analysis, 2 mg polymer sample was thor- Chromatographic condition: injection temperature 200 °C, oughly mixed with 100 mg spectroscopic grade KBr with detector temperature 250 °C, temperature programming: the help of mortar and pestle. From this mixture, 15 mg keeping at 70 °C for 4 min, then heating to 150 °C at the was used for making KBr pellets. The pellets were kept speed of 50 °C per min and keeping for 1 min. The carried in an oven at 100 °C for 4 h to remove atmospheric gas was nitrogen, and column flow was 3.0 mL/min, split moisture from the sample. The IR spectrum of the poly- ratio of 10/L, and a sampling quantity of 1 μL. mer sample was recorded with a Nicolet 6700 FT-IR Cell biomass was measured by analyzing the optical spectrophotometer (Thermo, America) in the range -1 density at 600 nm using UV1800 spectrophotometer 4000–600 cm . (Shimadzu, Japan). Firstly, 1 mL culture samples were CoQ concentration was analyzed by high- centrifuged at 6000 × g for 10 min at 4 °C; the cells were performance liquid chromatography (HPLC; Agilent washed twice in distilled water, centrifuged at the same 1200, America) equipped with Agilent SB-C18 (5 μm, condition, and finally were diluted by adding distilled 4.6 × 150 mm) (Park et al. 2005). The conditions for water to the linear concentration range according to the HPLC analysis were: temperature, 40 °C; mobile phase, standard curve describing the fitting relation between 100% alcohol (HPLC grade); flow rate, 1.0 mL/min; in- dry cell weight (DCW) and absorbance at 600 nm jection volume, 20 μL; and detector, UV detector at 275 (OD ), OD was tested, and DCW would be calcu- nm. A standard curve was created by serial dilutions of 600 600 lated according to a standard curve of the relationship CoQ standard. The molecular structure of CoQ from 10 10 between optical density of cells and DCW of Methylo- Methylobacterium sp. XJLW was identified by liquid bacterium sp. XJLW. Each sample was in triplicate. chromatography-mass spectrometry (LC-MS) method PHB content analysis was according to Pal A’s method using Esquire 6000 (Bruker Daltonics, Germany). (Pal et al. 2009). Firstly, 10 mg PHB sample was turned into crotonic acid by treatment with 10 mL concentrated Statistical analyses H SO in the boiling water bath for 30 min, then the The mean and standard deviation were calculated from 2 4 tube was naturally cooled to room temperature, and the samples in triplicate using Microsoft Excel 2013. absorbance was tested under 235 nm by the UV-1800 spectrophotometer (Shimadzu, Japan) with concentrated Results H SO as the blank. The standard curve was drawn by Methylobacterium sp. XJLW can produce PHB and CoQ 2 4 10 the same method. The chemical structure of PHB was simultaneously identified by gas chromatography-mass spectrometry Transmission electron microscope observation results (GC-MS), nuclear magnetic resonance (NMR) spectros- (Fig. 2) showed that there were many white particles copy, and Fourier transform infrared (FT-IR) spectros- with high refraction inside strain Methylobacterium sp. copy, respectively. XJLW cells, occupying nearly half or more space. It sug- To find the polymer composition, the purified PHB gested high content of PHAs inside the Methylobacter- -1 was dissolved in chloroform (5 mg PHB mL ), 1 μLof ium sp. XJLW cells. which was injected into a GC-MS instrument (Agilent After isolation and purification, the exact structure of Technologies 7890A GC System, America; Bruker es- PHAs from Methylobacterium sp. XJLW was identified quire 6000 MS instrument, German). The column and via GC-MS, NMR, and IR analysis methods, respectively. temperature profile used for GC analysis were as follows: Fig. S1A shows the GC spectra of PHA extracts of Cui et al. Annals of Microbiology (2021) 71:20 Page 7 of 15 shown in Fig.S4. It was found that the peak of CoQ in sample appeared at the retention time same to that of CoQ standard. Although the target peak area of sam- ple looked lower than that of other unidentified peaks, the mass-to-charge ratio of CoQ sample extracted from Methylobacterium sp. XJLW strain exhibited a mo- lecular peak (m/s, 885.6) same to that of CoQ stand- ard. The result suggested that the Methylobacterium sp. XJLW has the ability of CoQ biosynthesis. However, further purification of the sample CoQ and enhanced production of CoQ in Methylobacterium sp. XJLW are required in future research. Higher biomass, PHB, and CoQ10 yield in M3 with Fig. 2 Micrography of the Methylobacterium sp. XJLW under transmission electron microscope (15,000 ×, HITACHI H-7650 TEM) methanol than with glucose As shown in Fig. 3, Methylobacterium sp. XJLW exhib- ited much higher biomass and yield of both PHB and Methylobacterium sp. XJLW strain, and the 7.59-min CoQ when incubated in M3 medium supplemented peak corresponded to the hydrolyzed product of PHB with methanol than glucose as sole carbon source, re- according to standards. In order to obtain an exact spectively. It is interesting that the expression level of structure of this polyester, a further MS analysis of the some genes coding the key enzymes in the pathway of 7.59-min peak fragment was carried out, and the spectra PHB and CoQ biosynthesis of Methylobacterium sp. are shown in Fig. S1(B). The 101.0 m/z molecular frag- XJLW in methanol medium was also significantly higher ment was identical to the 3-hydroxybutyrate, while the than that in glucose medium (Fig. 4). The expression molecular fragments of 85.0 m/z represented butyrate. level of much more genes was also compared based on 1 13 The H- and C-NMR spectra of PHB standards and the RNA-seq results (Tables 3 and 4). Besides, the data PHAs produced by Methylobacterium sp. XJLW are of quantitative RT-qPCR of selected genes involved in shown in Fig. S2. The H-NMR spectra show the pres- PHB synthesis pathway indicated that PHB may be syn- ence of three signals in both spectra of the two polymer thesized by different pathways or be regulated by differ- samples, which corresponded to the methyl group (CH ent isoenzymes under different substrates or different at 1.28 ppm), methylene group (CH at 2.61 ppm), and cultivating conditions. In the RT-qPCR analysis, phaC-3 methine group (CH at 5.26 ppm), respectively (Fig. encoding poly(R)-hydroxyalkanoic acid synthase (class S2A). The methyl group (CH ), methylene group (CH ), III) was chosen for analysis, results showed that phaC-3 3 2 methyne group (CH), and carbonyl group (C=O) are was significantly upregulated by methanol, which was found at 19.8, 40.8, 67.6, and 169.2 ppm, respectively identified with RNA-seq results. However, phaC-1 cata- 1 13 (Fig. S2B). The chemical shifts of both H- and C- lyzing the same step in the pathway was downregulated NMR of PHAs from Methylobacterium sp. XJLW are in by methanol, indicating different isoenzymes were regu- good agreement with the data of PHB standards. IR lated by different factors. Meanwhile, totally 5 acat spectra of PHB standards and PHAs from Methylobac- genes, 3 paaH genes, 2 fadN genes, and 2 phaZ genes terium sp. XJLW are shown in Fig. S3. It shows mainly were found in PHB synthesis pathway in Methylobacter- -1 two intense absorption bands at about 1280–1291 cm , ium sp. XJLW showing different responses to methanol -1 -1 1725 cm , and 2925–2978 cm corresponding to C-O, (Table 4), which indicated that there was a more com- C=O, and C-H stretching groups, respectively. The plex regulation system in Methylobacterium sp. XJLW -1 3436.8 cm absorption band indicates a small number responsible for PHB production. From genomic data of O–H existing in PHAs from Methylobacterium sp. mining, it was also found no gene encoding XJLW and PHB standards referring to the terminal hy- hydroxybutyrate-dimer hydrolase (EC: 3.1.1.22) and droxyl. Meanwhile, the great similarity of IR spectra hydroxymethylglutaryl-CoA synthase (EC: 2.3.3.10) characteristic indicates chemical group composition in existing in Methylobacterium sp. XJLW strain, suggest- PHAs from Methylobacterium sp. XJLW is the same to ing PHB were mainly synthesized through FadJ- that of PHB standards. All the above evidences demon- catalyzed branch pathway. Besides, in CoQ synthetic strate PHB should be produced by Methylobacterium sp. pathway of Methylobacterium sp. XJLW, it was also XJLW. found no gene encoding decaprenyl-diphosphate syn- LC-MS results of CoQ standard and the sample ex- thase (EC: 2.5.1.91) existed in the genomic data, but the tracted from Methylobacterium sp. XJLW cells are LC-MS had strickly verified the product of CoQ10 from Cui et al. Annals of Microbiology (2021) 71:20 Page 8 of 15 Fig. 3 Different effects of glucose and methanol (same carbon atom amount) on the strain XJLW cell growth and its yield of CoQ and PHB. * ** Significant differences from glucose group are indicated by p < 0.05; p < 0.01 this strain. So, it is very possible that there is another medium exhibited more superiority for cell growth than new branch pathway or unannotated gene responsible MSM, and 5 days was the best harvest time with max- for decaprenyl-diphosphate, an important precursor of imum dry cell density. Meanwhile, the ability of PHB CoQ , biosynthesis in Methylobacterium sp. XJLW. and CoQ production by Methylobacterium sp. XJLW 10 10 in M3 and MSM was also evaluated respectively. The re- Effects of medium composition and cultivation conditions sults (Fig. 5b) also showed that Methylobacterium sp. on cell growth, PHB, and CoQ productivity in XJLW exhibited better PHB and CoQ biosynthesis 10 10 Erlenmeyer flask level capacity in medium M3 than in MSM. M3 was then se- Both medium M3 and MSM are recommended as suit- lected as initial medium for the optimization of Methylo- able medium for Methylotroph strain cultivating (Bour- bacterium sp. XJLW fermentation in the following que et al. 1995) with methanol as sole carbon and experiments. energy source. Thus, the growth behaviors of Methylo- As medium components, carbon source and nitrogen bacterium sp. XJLW in M3 and MSM were evaluated in source play the significant role in the fermentation prod- Erlenmeyer flasks. The results (Fig. 5a) showed that M3 uctivity according to previous reports (Wei et al. 2012; Fig. 4 Effect of carbon source on the express of key genes in CoQ (a) and PHB (b) biosynthesis pathway via RT-qPCR. Significant differences * ** from glucose group are indicated by p < 0.05; p < 0.01 Cui et al. Annals of Microbiology (2021) 71:20 Page 9 of 15 Table 3 FPKM values of CoQ synthesis-related genes based on RNA-seq analysis Locus Genes Enzymes FPKM in FPKM in Log2 Up or glucose methanol FPKM (M/ down G) A3862_ dxr 1-Deoxy-D-xylulose-5-phosphate reductoisomerase 99.9563 148.212 0.568293 Up RS14500 A3862_ ispDF Bifunctional 2-C-methyl-D-erythritol 4-phosphate Cytidylyltransferase/2-C-me- 92.8581 149.282 0.684941 Up RS20315 thyl-D-erythritol 2,4-Cyclodiphosphate synthase A3862_ ispE 4-(Cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase 64.3157 141.036 1.132821 Up RS03995 A3862_ ispG Flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate 425.885 296.847 − 0.52074 Down RS12025 synthase A3862_ ispH 4-Hydroxy-3-methylbut-2-enyl diphosphate reductase 1071.31 683.363 − 0.64865 Down RS10000 A3862_ ggps Geranylgeranyl diphosphate synthase, type II 30.1079 127.672 2.084228 Up RS18005 A3862_ ispA Polyprenyl synthetase family protein 200.033 143.273 − 0.48147 Down RS28415 A3862_ ispB Polyprenyl synthetase family protein 95.6316 164.97 0.786644 Up RS04015 A3862_ ubiA 4-Hydroxybenzoate octaprenyltransferase 73.9099 148.495 1.006575 Up RS03825 A3862_ ubiX UbiX family flavin prenyltransferase 43.2101 92.1585 1.092749 Up RS05140 A3862_ ubiD UbiD family decarboxylase 30.4548 120.907 1.989156 Up RS05150 A3862_ ubiI 2-Polyprenylphenol 6-hydroxylase 54.8386 146.31 1.415765 Up RS18730 A3862_ ubiG Bifunctional 2-Polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3- 68.382 118.171 0.789188 Up RS01610 O-methyltransferase UbiG A3862_ ubiH FAD-dependent monooxygenase 65.993 170.113 1.366108 Up RS13590 A3862_ ubiE Bifunctional demethylmenaquinone methyltransferase/2-methoxy-6- 99.1489 146.834 0.566517 Up RS18735 polyprenyl-1,4-benzoquinol methylase UbiE A3862_ ubiF UbiH/UbiF family hydroxylase 84.6668 194.111 1.197014 Up RS22985 Mozumder et al. 2014). Thus, the effect of carbon and ni- further research. However, no significant increase of PHB trogen sources is also very necessary to be evaluated for and CoQ10 yield was detected when ammonium sulfate -1 -1 the optimization of Methylobacterium sp. XJLW fermen- concentration ranged from 0.5 g L to 1.5 g L ,thus 0.5 g -1 tation process. In the previous publications, methanol and L was selected for the following study. Besides medium ammonium sulfate had been approved to be the suitable components, cultural condition such as culture carbon and nitrogen source for Methylobacterium (Bour- temperature and initial pH also play important roles in que et al. 1995; Yezza et al. 2006). Therefore, the effect of microbial fermentation. Thus, the effect of culture different concentrations of methanol (Fig. 6a) and ammo- temperature and initial pH on Methylobacterium sp. nium sulfate (Fig. 6b) on PHB and CoQ productivity of XJLW fermentation was then evaluated in Erlenmeyer Methylobacterium sp. XJLW was evaluated respectively in flask. The results (Fig. 6c and d) showed that the best -1 the present study. It was found that 7.918 g L methanol cultural temperature is 30 °C, and the optimal initial -1 led to maximal CoQ concentration of 1.26 mg L while pH is 7.0. As fermentation broth may turn to lower the optimal biomass and PHB concentration was obtained pH caused by carbon metabolism of Methylobacter- -1 under 11.877 g L methanol. The phenomenon may re- ium sp. XJLW, feeding ammonium hydroxide to sult from the different biosynthesis pathways of CoQ neutralize the excess formic acid derived from metha- and PHB. In order to avoid cell intoxication caused by nol metabolism is very important. Thus, the optimal -1 high methanol concentration, 7.918 g L methanol was initial pH and cultural temperature were selected as selected as the optimal carbon source concentration in 7.0 and 30 °C, respectively. Cui et al. Annals of Microbiology (2021) 71:20 Page 10 of 15 Table 4 FPKM values of PHB synthesis-related genes based on RNA-seq analysis Locus Genes Enzymes FPKM in FPKM in Log2 FPKM Up or glucose methanol (M/G) down A3862_ acat-1 Acetyl-CoA C-acetyltransferase 181.947 195.674 0.104934 Up RS02265 A3862_ acat-2 Acetyl-CoA C-acetyltransferase 1101.5 455.904 − 1.27267 Down RS05695 A3862_ acat-3 Beta-ketothiolase BktB 117.494 160.747 0.452205 Up RS09310 A3862_ acat-4 Acetyl-CoA C-acyltransferase 72.2701 163.337 1.176381 Up RS25790 A3862_ acat-5 Acetyl-CoA acetyltransferase 302.52 199.266 − 0.60233 Down RS27615 A3862_ phbB Acetoacetyl-CoA reductase 775.466 472.896 − 0.71354 Down RS05690 A3862_ phaC- Class I poly(R)-hydroxyalkanoic acid synthase 266.759 198.599 − 0.42568 Down RS05930 1 A3862_ phaC- Polyhydroxyalkanoic acid synthase 111.896 382.12 1.771867 Up RS11350 2 A3862_ phaC- Class III poly(R)-hydroxyalkanoic acid synthase subunit 90.7047 116.952 0.366667 Up RS19105 3 PhaC A3862_ phaE Poly-beta-hydroxybutyrate polymerase subunit 133.443 134.851 0.015143 Up RS19110 A3862_ paaH- 3-Hydroxybutyryl-CoA dehydrogenase 60.5688 125.351 1.049327 Up RS05165 1 A3862_ paaH- 3-Hydroxybutyryl-CoA dehydrogenase 487.68 218.354 − 1.15927 Down RS17305 2 A3862_ paaH- 3-Hydroxyacyl-CoA dehydrogenase family protein 33.7683 105.064 1.637527 Up RS21635 3 A3862_ fadJ Enoyl-CoA hydratase/isomerase family protein 155.264 191.337 0.301393 Up RS02250 A3862_ fadN-1 3-Hydroxyacyl-CoA dehydrogenase/enoyl-CoA 93.6416 170.494 0.864499 Up RS15330 A3862_ fadN-2 Enoyl-CoA hydratase/isomerase family protein 40.528 110.806 1.451045 Up RS25795 A3862_ scoA Succinyl-CoA--3-ketoacid-CoA transferase/CoA transferase 737.041 126.763 − 2.53961 Down RS06255 subunit A A3862_ scoB Succinyl-CoA--3-ketoacid-CoA transferase/CoA transferase 1515.36 206.479 − 2.87559 Down RS06260 subunit B A3862_ bdh 3-Hydroxybutyrate dehydrogenase 426.046 159.7 − 1.41564 Down RS14320 A3862_ phaZ- Polyhydroxyalkanoate depolymerase 397.233 383.709 − 0.04997 Down RS09710 1 A3862_ phaZ- Polyhydroxyalkanoate depolymerase 150.142 139.807 − 0.10289 Down RS17340 2 A3862_ hmgl Hydroxymethylglutaryl-CoA lyase 64.564 145.106 1.168305 Up RS12335 Due to the poor solubility of oxygen in aqueous oxygen supply, including two different surfactants (Tri- medium, the dissolved oxygen (DO) supply is another ton X-100 and Tween 80) and hydrogen dioxide. Com- key factor affecting the productivity in aerobic fermenta- pared with the control group, 0.1% (v/v) of different tion process, and one of the most effective strategies for oxygen carriers was added to Methylobacterium sp. improving oxygen mass transfer efficiency is adding oxy- XJLW fermentation system, respectively. The results gen carrier to the aerobic fermentation system (Lai et al. (Fig. 6e) showed that Tween 80 exhibits positive effects 2002;Xia 2013; Vieira et al. 2015). In this study, three especially in the level of CoQ and PHB biosynthesis, different oxygen carriers were chosen to enhance the meanwhile the productivities of the Triton X-100 group Cui et al. Annals of Microbiology (2021) 71:20 Page 11 of 15 Fig. 5 Cell growth (a) and PHB/CoQ production (b) of XJLW in M3 and MSM, respectively. Significant differences from MSM group are indicated * ** by p < 0.05; p < 0.01 and the hydrogen dioxide group were both lower than level of metabolites in many microorganisms (Xu et al. the control group. Perhaps excessive emulsification of 2013; Mozumder et al. 2015), so the effects of osmotic Triton X-100 and denaturation of membrane protein pressure on Methylobacterium sp. XJLW metabolism caused by hydrogen dioxide can both inhibit normal me- were discussed through adding different concentrations tabolism of Methylobacterium sp. XJLW. Tween-80, a of sodium chloride. The results (Fig. 6f) showed that the -1 non-ionic surfactant, could improve the cell membrane group adding 1.0 g L of sodium chloride exhibited the permeability and the specific surface area of oxygen at highest cell yield and target product concentration, so appropriate concentration, so it may also exhibit positive this regulation strategy was chosen in the subsequent promotion for intracellular metabolite biosynthesis. Ac- research. cording to these data, 0.1% (v/v) of Tween 80 was Based on the above, the optimal medium and cultural chosen as the best oxygen carrier in the following conditions for CoQ and PHB co-production through research. Methylobacterium sp. XJLW strain fermentation were -1 -1 As an important environmental factor, osmotic pres- M3 medium containing 7.918 g L methanol, 0.5 g L sure may affect the mass transfer and the accumulation of ammonium sulfate, 0.1% (v/v) of Tween 80, and 1.0 g Fig. 6 Effects of methanol concentration (a), ammonium sulfate concentration (b), fermentation temperature (c), initial pH of medium (d), different oxygen carriers (e), and sodium chloride concentration (f) on XJLW biomass, PHB and CoQ biosynthesis. Significant differences from -1 -1 selected group (7.918 g L methanol group for a, 0.5 g L (NH ) SO group for b, 30 °C group for c, pH 7.0 group for d, Tween 80 group for e, 4 2 4 -1 * ** and 1.0 g L sodium chloride group for f, respectively) are indicated by p < 0.05; p < 0.01 Cui et al. Annals of Microbiology (2021) 71:20 Page 12 of 15 -1 L of sodium chloride under the fermentation increased in the same trend, implying both PHB and temperature and initial medium pH of 30 °C and 7.0, CoQ were biosynthesized in association with cell respectively. growth. During the whole process, the total exhausted methanol volume is 830 mL, coupled with feeding Methylobacterium sp. XJLW fermentation in a 5-L 113.05 mL ammonium hydroxide. Finally, a maximum -1 fermenter DCW value of 46.31 g L was obtained, and the highest -1 Based on the above results, a methanol feeding strategy yields of PHB and CoQ reached 6.94 g L and 22.28 -1 coupled with pH and dissolved oxygen (DO) controlling mg L , respectively. Thus, the final productivities of was employed in a 5-L stirred tank reactor for a high- PHB and CoQ in this fed-batch fermentation system -1 -1 density fermentation. During the whole cultivation period, reached 0.15 g g of DCW and 0.48 mg g of DCW, re- DO, stir speed, and pH were captured by online monitors, spectively. These results suggest that the feeding metha- and the acquisition curves are shown in Fig. 7a. Mean- nol coupled with DO controlled through adding while, the changes of methanol concentration, biomass, ammonium hydroxide strategy should be an effective and PHB and CoQ productivity during the whole method to increase the cell density and productivities in process are shown in Fig. 7b. During the first 36 h, the Methylobacterium sp. XJLW submerged fermentation consumption of methanol added before fermentation was system. speeded up gradually until DO rebounding to 100%, meaning that there was no methanol enough for cell Discussion growth in the medium. From then on, methanol was fed As carbon source storage in microbial cells, PHAs are at a pulsed pace to ensure sufficient carbon source in the usually synthesized and accumulated under imbalanced fermentation system without toxicity caused by excessive growth conditions by limiting a nutritional element, methanol. With cell density increasing, the limited dis- such as nitrogen, phosphate, or oxygen (Mozumder solved oxygen became another key factor affecting cell et al. 2014). PHAs could accumulate inside a membrane growth. Thus, stir speed also gradually increased to ensure enclosed inclusion in many bacteria at a high content up the DO level between 10 and 50%. During the whole fed- to 80% of the dry cell weight (Khosravi-Darani et al. batch process, pH of broth was controlled at 5.7 approxi- 2013). Thus, if a strain has the potential for PHA pro- mately rather than 7.0, for excessive ammonium hydrox- duction, there will be many polymer particles inside the ide used for adjusting pH may inhibit PHB accumulation cell suggesting PHA existence. In this study, the cell according to previous report (Pieja et al. 2012). After 106 morphology of Methylobacterium sp. XJLW under a h when methanol accumulation occurred, methanol feed- transmission electron microscope (TEM) also showed a ing ceased, and DO quickly rose up to 100%, indicating high content of polymer particles (Fig. 1), which is simi- the respiration intensity of XJLW cells weakened sharply lar to most PHA-producing strains. with little methanol consumption in the final period. For Methylotrophs cultivating with methanol as sole It was also found that low content of PHB and CoQ carbon and energy source, both medium M3 and MSM were detected during the first 36 h, suggesting initially are recommended as suitable medium (Bourque et al. added methanol was almost completely exhausted for 1995). However, M3 medium exhibited superiority for cell respiration and growth. Later, along with feeding Methylobacterium sp. XJLW cell growth than MSM. As substrates, concentration of biomass, PHB, and CoQ medium components, carbon source and nitrogen Fig. 7 Online parameter acquisition curve (a) and CoQ and PHB fermentation of XJLW via fed-batch process (b) in a 5-L stirred tank reactor. The arrow demarcates the feeding event Cui et al. Annals of Microbiology (2021) 71:20 Page 13 of 15 -1 source usually play the significant role in the fermenta- cell density of DCW 46.31 g L with a PHB concentra- -1 tion productivity according to previous reports (Wei tion of 6.94 g L , and a CoQ concentration of 22.28 -1 et al. 2012; Mozumder et al. 2014). For Methylobacter- mg L were achieved in a 5 L bioreactor, which were ium strains, methanol and ammonium sulfate had been 30-fold, 6-fold, and 17-fold higher than that in Erlen- approved to be the suitable carbon and nitrogen source meyer flasks, respectively. Although the productivity of -1 (Bourque et al. 1995; Yezza et al. 2006). In the present CoQ was 0.48 mg g of DCW, which was lower than study, a methanol utilized strain Methylobacterium sp. that of previous reported strains such as Rhodobacter -1 XJLW, which was isolated as formaldehyde degrading sphaeroides (2.01 mg g of DCW) (Kalaiyezhini and -1 strain in our previous study (Qiu et al. 2014), also grows Ramachandran. 2015), the volumetric yield of 22.3 mg L better in the M3 than in BSM containing methanol as of Methylobacterium sp. XJLW was higher than that of sole carbon source (Fig. 5). several previous reported strains including the mutant -1 In order to develop its potential applications in biotech- strain of Rhodobacter sphaeroides (14.12 mg L )(Bule nological industry, PHB and CoQ were selected as rep- and Singhal. 2011), Paracoccus dinitrificans NRRL B-3785 -1 resentatives of biopolymers and quinone metabolites, (10.81 mg L ) (Tian et al. 2010), and Sphingomonas sp. -1 respectively, to evaluate the potential for their co- ZUTEO3 (1.14 mg L )(Zhonget al. 2009). Meanwhile, production via methanol-based culture process of Methy- Methylobacterium sp. XJLW could accumulate PHB at the -1 lobacterium sp. XJLW. An increasing number of PHB- productivity level of 0.15 g g of DCW. The PHB yield of producing strains have been reported, including Methylo- Methylobacterium sp. XJLW was lower than several re- bacterium extorquens (Ueda et al. 1992; Bourque et al. ported strains such as Methylobacterium extorquens -1 1995), Paracoccus denitrificans (Ueda et al. 1992; Kalaiyez- DSMZ 1340 (0.62 g g of DCW) (Mokhtari-Hosseini hini and Ramachandran. 2015), Alcaligenes latus (Yamane et al. 2009)and Methylobacterium extorquens ATCC -1 et al. 1996), Methylobacterium sp. ZP24 (Nath et al. 2008), 55366 (0.46 g g of DCW) (Bourque et al. 1995), but the Bacillus thuringiensis (Pal et al. 2009), Cupriavidus neca- volumetric yield of PHB of Methylobacterium sp. XJLW in -1 tor (Mozumder et al. 2015), Halomonas campaniensis this study (6.94 g L ) was higher than that of Methylobac- -1 (Chen et al. 2019), Bacillus drentensis (Gamez-Perez et al. terium sp. ZP24 (3.91 g L ) (Nath et al. 2008). 2020). After process and culture condition optimization, the yield of PHB has reached a high level more than 100 g Conclusions -1 L PHB from methanol via high-cell-density fed-batch In summary, it is feasible to develop a co-production culture of methylotrophic bacteria (Ueda et al. 1992; process of two valuable metabolites by Methylobacter- Yamane et al. 1996). Based on the above, methylotrophic ium sp. XJLW from methanol. However, compared with bacteria seem the potential industrial strains for PHB pro- the cost of chemical polymers and the productivity of duction via methanol-based biotechnology. PHB or CoQ10 high yield strains, it is still necessary to Meanwhile, CoQ is another important compound 10 further optimize fermentation process, and genetically which can be widely used as potent antioxidative dietary modify strain pathway, for enhanced production of PHB supplement in treating cardiovascular disease, cancer, and CoQ simultaneously by Methylobacterium sp. periodontal disease, and hypertension acting (Hofer XJLW. This study also presented a potential strategy to et al. 2010; Lu et al. 2013). There are also a number of develop efficiently co-producing other high-value metab- strains capable of producing CoQ . However, no publi- 10 olites using methanol-based bioprocess. cation was found about CoQ synthesis in methylo- Abbreviations trophic bacteria. In this study, it was found that both CGMCC: China General Microbiological Culture Collection Center; metabolic pathways of PHB and CoQ biosynthesis CoQ : Coenzyme Q ; DCW: Dry cell weight; DO: Dissolved oxygen; FT- 10 10 exist in Methylobacterium sp. XJLW based on the gen- IR: Fourier transformation infrared spectrum; GC-MS: Gas chromatography/ mass spectrometry; HPLC: High-performance liquid chromatography; LC- omic and comparative transcriptomics information (Fig. MS: Liquid chromatography/mass spectrometry; OD : Optical density at 600 1). RT-qPCR results also showed the transcription level nm; PCR: Polymerase chain reaction; NMR: Nuclear magnetic resonance; of key genes in both pathways’ response to methanol PHAs: Polyhydroxy-alkanoates; PHB: Poly-β-hydroxybutyrate was significantly higher than that response to glucose (Fig. 4). Correspondingly, Methylobacterium sp. XJLW Supplementary Information The online version contains supplementary material available at https://doi. can produce PHB and CoQ simultaneously with higher org/10.1186/s13213-021-01632-w. yield using methanol than using glucose as sole carbon and energy source (Fig. 3). To our knowledge, it is the Additional file 1: Fig. S1 GC-MS spectra of PHAs extracted from Methy- first report on PHB and CoQ production simultan- lobacterium sp. XJLW, A is the GC spectra while B shows the MS spectra 1 13 eously by methylotrophic bacteria. of the 7.59 min peak in A. Fig. S2 Comparison of H- spectra (A) and C- NMR spectra (B) between PHB standards and PHAs extracted from Methy- After optimization of medium composition and the lobacterium sp. XJLW. Fig. S3 Comparison of IR spectra between PHB culture conditions on PHB and CoQ biosynthesis, a 10 Cui et al. Annals of Microbiology (2021) 71:20 Page 14 of 15 Kalaiyezhini D, Ramachandran KB (2015) Biosynthesis of poly-3-hydroxybutyrate standards and PHAs extracted from Methylobacterium sp. XJLW. Fig. S4 (PHB) from glycerol by Paracoccus denitrificans in a batch bioreactor: effect LC-MS spectra of CoQ standards (A) and CoQ sample extracted from 10 10 of process variables. Prep Biochem Biotechnol 45(1):69–83. https://doi.org/1 Methylobacterium sp. XJLW (B). 0.1080/10826068.2014.887582 Additional file 2:. Supplementary Material-Table of Samples. Khosravi-Darani K, Mokhtari ZB, Amai T, Tanaka K (2013) Microbial production of poly(hydroxybutyrate) from C(1) carbon sources. Appl Microbiol Biotechnol 97(4):1407–1424. https://doi.org/10.1007/s00253-012-4649-0 Authors’ contributions Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL (2013) TopHat2: WZ conceived of the study. PC, YS, YW, RZ, and HZ designed and performed accurate alignment of transcriptomes in the presence of insertions, deletions the experiments. YS and WZ supervised and implemented the statistical and gene fusions. Genome Biol 14(4):R36. https://doi.org/10.1186/gb-2 analysis. PC and WZ wrote the manuscript. The authors read and approved 013-14-4-r36 the final manuscript. Lai LS, Tsai TH, Wang TC (2002) Application of oxygen vectors to Aspergillus terreus cultivation. J Biosci Bioeng 94(5):453–459. https://doi.org/10.1016/S13 Funding 89-1723(02)80224-9 This work was financially supported by National Natural Science Foundation Lu W, Shi Y, He S, Fei Y, Yu K, Yu H (2013) Enhanced production of CoQ by of China (81973211), Innovation Platform and Talent Plan of Hunan Province constitutive overexpression of 3-demethyl ubiquinone-9 3-methyltransferase (2015JC3073), Scientific Research Project of Hunan Education Department under tac promoter in Rhodobacter sphaeroides. Biochem Eng J 72:42–47. (18B249), The Key Discipline of Biological Engineering of Hunan University of https://doi.org/10.1016/j.bej.2012.12.019 Chinese Medicine (2018) No.3. Mohandas SP, Balan L, Lekshmi N, Cubelio SS, Philip R, Bright Singh IS (2017) Production and characterization of polyhydroxybutyrate from Vibrio harveyi Availability of data and materials MCCB 284 utilizing glycerol as carbon source. J Appl Microbiol 122(3):698– The genome of Methylobacterium sp. XJLW is available in GenBank (accession 707. https://doi.org/10.1111/jam.13359 no. CP016429), while its transcriptomics data are available in this article Mokhtari-Hosseini ZB, Vasheghani-Farahani E, Heidarzadeh-Vazifekhoran A, (Supplemental Material-Table of Samples FPKM). Shojaosadati SA, Karimzadeh R, Darani KK (2009) Statistical media optimization for growth and PHB production from methanol by a Declarations methylotrophic bacterium. Bioresour Technol 100(8):2436–2443. https://doi. org/10.1016/j.biortech.2008.11.024 Ethics approval and consent to participate Mostafa YS, Alrumman ASA, Otaif KA, Mostafa MS, Alfaify AM (2020) Bioplastic Not applicable (poly-3-hydroxybutyrate) production by the marine bacterium Pseudodonghicola xiamenensis through date syrup valorization and structural Consent for publication assessment of the biopolymer. Sci Rep 10(1):8815. https://doi.org/10.1038/s41 Not applicable 598-020-65858-5 Mozumder MSI, De Wever H, Volcke EIP, Garcia-Gonzalez L (2014) A robust fed- Competing interests batch feeding strategy independent of the carbon source for optimal The authors declare that they have no competing interests. polyhydroxybutyrate production. Process Biochem 49(3):365–373. https://doi. org/10.1016/j.procbio.2013.12.004 Author details Mozumder MSI, Garcia-Gonzalez L, De Wever H, Volcke EIP (2015) Effect of College of Biotechnology and Bioengineering, Zhejiang University of sodium accumulation on heterotrophic growth and polyhydroxybutyrate Technology, Hangzhou 310032, People’s Republic of China. College of (PHB) production by Cupriavidus necator. Bioresour Technol 191:213–218. Pharmacy, Hunan University of Chinese Medicine, Changsha, Hunan 410208, https://doi.org/10.1016/j.biortech.2015.04.110 People’s Republic of China. Nath A, Dixit M, Bandiya A, Chavda S, Desai AJ (2008) Enhanced PHB production and scale up studies using cheese whey in fed batch culture of Received: 18 February 2021 Accepted: 30 April 2021 Methylobacterium sp. ZP24. Bioresour Technol 99(13):5749–5755. https://doi. org/10.1016/j.biortech.2007.10.017 Pal A, Prabhu A, Kumar AA, Rajagopal B, Dadhe K, Ponnamma V, Shivakumar S References (2009) Optimization of process parameters for maximum poly(-beta- Bourque D, Pomerleau Y, Groleau D (1995) High cell density production of poly- )hydroxybutyrate (PHB) production by Bacillus thuringiensis IAM 12077. Pol J beta-hydroxybutyrate (PHB) from methanol by Methylobacterium extorquens: Microbiol 58(2):149–154 production of high-molecular-mass PHB. Appl Microbiol Biotechnol 44(3-4): Park YC, Kim SJ, Choi JH, Lee WH, Park KM, Kawamukai M, Ryu YW, Seo JH (2005) 367–376. https://doi.org/10.1007/BF00169931 Batch and fed-batch production of coenzyme Q in recombinant Escherichia Bule MV, Singhal RS (2011) Fermentation kinetics of production of ubiquinone-10 coli containing the decaprenyl diphosphate synthase gene from by Paracoccus dinitrificans NRRL B-3785: effect of type and concentration of Gluconobacter suboxydans. Appl Microbiol Biotechnol 67(2):192–196. https:// carbon and nitrogen sources. Food Sci Biotechnol 20(3):607–613. https://doi. doi.org/10.1007/s00253-004-1743-y org/10.1007/s10068-011-0086-6 Parveez GK, Bahariah B, Ayub NH, Masani MY, Rasid OA, Tarmizi AH, Ishak Z Cardoso LOB, Karolski B, Gracioso LH, CAO d N, Perpetuo EA (2020) Increased (2015) Production of polyhydroxybutyrate in oil palm (Elaeis guineensis Jacq.) P3HB accumulation capacity of Methylorubrum sp. in response to mediated by microprojectile bombardment of PHB biosynthesis genes into discontinuous methanol addition. Appl Biochem Biotechnol 192(3):846–860. embryogenic calli. Front Plant Sci 6:598 https://doi.org/10.1007/s12010-020-03369-9 Pieja AJ, Sundstrom ER, Criddle CS (2012) Cyclic, alternating methane and Chen L, Qiao GQ, Shuai BW, Song KN, Yao WX, Jiang XR, Chen GQ (2019) nitrogen limitation increases PHB production in a methanotrophic Engineering self-flocculating Halomonas campaniensis for wastewaterless community. Bioresour Technol 107(0): 385-392, DOI: https://doi.org/10.1016/j. open and continuous fermentation. Biotechnol Bioeng 116(4) 805-815. biortech.2011.12.044. Ernster L, Dallner G (1995) Biochemical, physiological and medical aspects of Qiu L, Chen W, Zhong L, Wu W, Wu S, Chen J, Zhang F, Zhong W (2014) ubiquinone function. Biochimica Et Biophysica Acta 1271(1):195–204. https:// Formaldehyde biodegradation by immobilized Methylobacterium sp. XJLW doi.org/10.1016/0925-4439(95)00028-3 cells in a three-phase fluidized bed reactor. Bioprocess Biosyst Eng 37(7): Gamez-Perez J, Penkhrue W, Jendrossek D, Khanongnuch C, Pathom-aree W, 1377–1384. https://doi.org/10.1007/s00449-013-1110-4 Aizawa T, Behrens RL, Lumyong S (2020) Response surface method for Qiu L, Ding H, Wang W, Kong Z, Li X, Shi Y, Zhong W (2012) Coenzyme Q(10) polyhydroxybutyrate (PHB) bioplastic accumulation in Bacillus drentensis BP17 production by immobilized Sphingomonas sp. ZUTE03 via a conversion- using pineapple peel. Plos One 15(3):e0230443 extraction coupled process in a three-phase fluidized bed reactor. Enzyme Hofer P, Choi YJ, Osborne MJ, Miguez CB, Vermette P, Groleau D (2010) Microbiol Technol 50(2):137–142 Production of functionalized polyhydroxyalkanoates by genetically modified Shao Y, Li J, Wang Y, Yi F, Zhang Y, Cui P, Zhong W (2019a) Comparative Methylobacterium extorquens strains. Microb Cell Fact 9(1):70. https://doi.org/1 genomics and transcriptomics insights into the C1 metabolic model of a 0.1186/1475-2859-9-70 Cui et al. Annals of Microbiology (2021) 71:20 Page 15 of 15 formaldehyde-degrading strain Methylobacterium sp. XJLW. Mol Omics 15(2): 138–149. https://doi.org/10.1039/C8MO00198G Shao Y, Wang Y, Yi F, Zhang Y, Liu W, Yang C, Meng H, Cui P, Zhong W (2019b) Gaseous formaldehyde degrading by Methylobacterium sp. XJLW. Appl Biochem Biotechnol 15:138–149 Sharma N (2019) Polyhydroxybutyrate (PHB) production by bacteria and its application as biodegradable plastic in various industries. Academic Journal of Polymer Science 2(3):555587 Sukruansuwan V, Napathorn SC (2018) Use of agro-industrial residue from the canned pineapple industry for polyhydroxybutyrate production by Cupriavidus necator strain A-04. Biotechnol Biofuels 11(1):202. https://doi. org/10.1186/s13068-018-1207-8 Tian Y, Yue T, Yuan Y, Soma PK, Lo YM (2010) Improvement of cultivation medium for enhanced production of coenzyme Q by photosynthetic Rhodospirillum rubrum. Biochem Eng J 51(3):160–166. https://doi.org/10.1016/ j.bej.2010.06.011 Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ, Pachter L (2010) Transcript assembly and quantification by RNA- Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28(5):511–515 https://doi.org/10.1038/nbt.1621 Ueda S, Mataumoto S, Takagi A, Yamane T (1992) Synthesis of poly (3- hydroxybutyrate-co-3-hydroxyvalerate) from methanol and N-amyl alcohol by the methylotrophic bacteria Paracoccus denitrificans and Methylobacterium extorquens. Appl Environ Microbiol 58(11):3574–3579. https://doi.org/10.112 8/AEM.58.11.3574-3579.1992 Vieira ES, de Oliveira Fontes TK, Pereira MM, Alexandre HV, da Silva DP, Soares CM, Lima AS (2015) New strategy to apply perfluorodecalin as an oxygen carrier in lipase production: minimisation and reuse. Bioprocess Biosyst Eng 38(4):721–728. https://doi.org/10.1007/s00449-014-1312-4 Wei ZH, Bai L, Deng Z, Zhong JJ (2012) Impact of nitrogen concentration on validamycin A production and related gene transcription in fermentation of Streptomyces hygroscopicus 5008. Bioprocess Biosys Eng 35(7):1201–1208. https://doi.org/10.1007/s00449-012-0707-3 Xia Z (2013) Effect of Tween 80 on the production of curdlan by Alcaligenes faecalis ATCC 31749. Carbohydr Poly 98(1):178–180. https://doi.org/10.1016/j. carbpol.2013.05.073 Xu YN, Xia XX, Zhong JJ (2013) Induced effect of Na on ganoderic acid biosynthesis in static liquid culture of Ganoderma lucidum via calcineurin signal transduction. Biotechnol Bioeng 110(7):1913–1923. https://doi.org/10.1 002/bit.24852 Yamane T, Fukunaga M, Lee YW (1996) Increased PHB productivity by high-cell- density fed-batch culture of Alcaligenes latus, a growth-associated PHB producer. Biotechnol Bioeng 50(2):197–202. https://doi.org/10.1002/(SICI)1 097-0290(19960420)50:2<197::AID-BIT8>3.0.CO;2-H Yezza A, Fournier D, Halasz A, Hawari J (2006) Production of polyhydroxyalkanoates from methanol by a new methylotrophic bacterium Methylobacterium sp. GW2. Appl Microbiol Biotechnol 73(1):211–218. https:// doi.org/10.1007/s00253-006-0458-7 Zaldivar Carrillo JA, Stein LY, Sauvageau D (2018) Defining nutrient combinations for optimal growth and polyhydroxybutyrate production by Methylosinus trichosporium OB3b using response surface methodology. Front Microbiol 9: 1513. https://doi.org/10.3389/fmicb.2018.01513 Zhang M, Yuan XJ, Zhang C, Zhu LP, Mo XH, Chen WJ, Yang S (2019) Bioconversion of methanol into value-added chemicals in native and synthetic methylotrophs. Curr Issues Mol Biol 33:225–236. https://doi.org/1 0.21775/cimb.033.225 Zhong W, Fang J, Liu H, Wang X (2009) Enhanced production of CoQ by newly isolated Sphingomonas sp. ZUTEO3 with a coupled fermentation-extraction process. J Ind Microbiol Biotechnol 36(5):687–693. https://doi.org/10.1007/s1 0295-009-0538-7 Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Journal

Annals of Microbiology – Springer Journals

Published: May 21, 2021

There are no references for this article.