Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Characterization of the complete mitochondrial genome of Mauritian sardinella, Sardinella jussieu (Lacepède, 1803), collected in the Banten Bay, Indonesia

Characterization of the complete mitochondrial genome of Mauritian sardinella, Sardinella jussieu... Fishes in genus Sardinella are small pelagic species, which plays an important role in marine ecosystem as the first consumer. Those species are also commercially important, whose total catch reaches 278,600 tons in 2011 in Indonesia, but their identification has been difficult for their morphological similarity. In this study, we reported Sardinella jussieu for the first time in Indonesian coastal area (Banten Bay, Indonesia, 6° 0′ 50.00″ S–106° 10′ 21.00″ E). We were able to confirm the species by both its morphological characteristics including the black spot at dorsal fin origin, the dusky pigmentation at caudal fin, 31 total scute numbers, and DNA sequence identity in the GenBank database by the molecular analysis. Its total mitochondrial genome was determined by the combination of next- generation sequencing and typical PCR strategy. The total mitochondrial genome of Sardinella jussieu (16,695 bp) encoded 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs, and the putative control region. All protein-coding genes started with ATG and typical stop codon and ended with TAA or TAG except for ND4 in which AGA is used. Phylogenetic analyses of both COI region and full mitochondrial genome showed that S. jussieu is most closely related to Sardinella albella and Sardinella gibbosa. Keywords: Barcode, Mitochondrial genome, Sardinella, Indonesia, Next-generation sequencing Background Sardinella. Sardinella is important not only in marine food Sardinella is a genus of fish in the family Clupeidae webs as a base consumer supporting tuna, seabirds, and found in the Atlantic, Indian, and the Pacific Ocean. The marine mammals (Willette et al. 2011) but also in industry paddle-shaped supramaxilla bones are major characteris- as the protein source with a low cost using as a bait for tics, which help distinguish Sardinella from other genera. large fish or a feed in aquaculture. Morphological characters distinguish Sardinella from all Seven species in the genus Sardinella are currently other clupeoid genera with the presence of two fleshy out- known in Indonesian waters including Sardinella growths on the hind margin of the gill opening (Whitehead fimbriata, Sardinella gibbosa, Sardinella lemuru, Sardi- 1985). According to FishBase (http://www.fishbase.org/), nella albella, Sardinella atricauda, Sardinella branchy- there are currently 22 recognized species in the genus soma,and Sardinella melanura, whose total catch in Indonesia reaches 278,600 tons in 2011 (MMAF 2012). Morphological identification in Sardinella is mainly characterized by their gill raker, pelvic scute, scales, * Correspondence: kimhw@pknu.ac.kr 1 and otolith (Homayuni et al. 2013; Bräger and Moritz Interdisciplinary Program of Biomedical, Mechanical and Electrical Engineering, Pukyong National University, Busan 48513, Republic of Korea Department of Marine Biology, Pukyong National University, Busan 48513, Republic of Korea Full list of author information is available at the end of the article © The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 2 of 9 2016; Begg and Waldman 1999). However, species no perforation on hind part (Whitehead 1985). After identification in the genus Sardinella is often hard confirmation of the species by the molecular COI for its broad geographical ranges, overlapping distri- markers, its total mitochondrial genome sequence butions (Willette et al. 2011) and morphological was determined by the combination of the traditional similarities (Sivakumaran et al. 1987) especially in PCR methods and next-generation sequencing (NGS) larval stages (Ditty et al. 1994), which makes it diffi- techniques. cult to manage the Sardinella resources in Indonesia. In addition to the traditional morphological identifica- Methods tion, the genetic information is now alternatively used Sample collection and morphological measurement for the species identification for its fast and exact results. Five individuals of S. jussieu were collected in the Banten The most widely used genetic markers are partial mito- Bay, Indonesia (6° 0′ 50.00″–S106° 10′ 21.00″ E), in chondrial DNA sequences such as cytochrome C oxidase January 2016 as the part of the regular fish survey (Fig. 1). I (COI) or cytochrome B (CytB) (Palumbi et al. 1991; Collected fish were directly stored in 96% ethanol and Ward et al. 2005; Vrijenhoek 1994). However, full mito- kept at − 20 °C until the further analysis (Knebelsberger chondrial genome sequences provide more information and Stöger 2012). Morphological identification was made about its biogeographical or evolutional information by their body shape, type of scale, fin feature, morphomet- than those fragmental sequences. Therefore, more than ric (i.e., standard length, body width, and head length), 5000 mitochondrial genomes have been deposited in and meristic characteristic (total number of scutes) GenBank database (www.ncbi.nlm.nih.gov) from 33,500 (Whitehead 1985; Strauss and Bond 1990). species identified based on morphological characteristics (www.fishbase.org). Genomic DNA extraction and next-generation sequencing In this study, we report the Mauritian sardinella, Genomic DNA was extracted using an AccuPrep® Sardinella jussieu, for the first time in Indonesian Genomic DNA Extraction Kit (Bioneer) according to the coastal waters, which was collected from the Banten manufacturer’s instruction. A small portion of tail fin Bay. S. jussieu was previously reported only in the was dissected, which was further homogenized by the Western Indian Ocean, Taiwan, Hong Kong, and TissueLyser II (Qiagen). Purified genomic DNA was Vietnam (www.fishbase.org). Morphological character- quantified with nanoDrop (Thermofisher Scientific istics of Sardinella jussieu are distinguished within D1000), aliquoted, and stored at the − 70 °C for further other Sardinella species with the presence of black analysis. spot at dorsal fin origin and dusky pigmentation at Two universal primer sets targeting cytochrome c caudal fin, total scute measurement which is 31, and oxidase I (COI) region, Fish F1 and Fish R1 (Ward et vertical striae on a scale not meeting at center and al. 2005), and targeting cytochrome b (cyt-B) region, Fig. 1 Sampling location in Banten Bay, Indonesia (red square) Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 3 of 9 Table 1 Primers used for the mitochondrial genome of (Table 1). Each PCR reaction (30 μL) contained 19.7 μL Sardinella jussieu ultrapure water, 1 μL of each primer (0.5 μM), 0.3 μLEx Name Sequence (5' to 3') Product size (bp) Taq Hot Start Version DNA polymerase (TAKARA, Japan), 3 μL 10× Buffer, 3 μL dNTPs (1 mM, Takara, Fish F1 TCAACCAACCACAAAGACATTGGCAC 652 Japan), and 100 ng genomic DNA as template. PCR was Fish R1 TAGACTTCTGGGTGGCCAAAGAATCA carried out with two-step PCR protocol for long PCR GLUDG-L TGACTTGAARAAYCGTTG 451 under the following condition: initial denaturation step GB2-H CCCTCAGAATGATATTTGTCCTCA at 94 °C for 3 min, followed by 30 cycles of denaturation CYTB-F GCCTACGAAAAACCCACCCGCTCC 8.2 k at 98 °C for 10s, and annealing and extension at 68 °C CO1-R GTAAGGTCTACGGATGCCCCTGCG for 10 min. The process was completed with a final ex- tension at 72 °C for 10 min. Two large PCR products CYTB-R AACGGAGGAGAAAGCGGTTGCGATG 8.7 k were pooled together in equal concentration and frag- CO1-F CTTCCTGCTTCTCCTGGCCTCCTC mented to ~ 350 bp in length by Covaris M220 (Covaris SARD F TTAAAGTCCTCCCTGAGGCCC 683 Inc.). TruSeq® sample preparation kit V2 (Illumina, SARD R TTAGGAGGGAGTCGTCAAATGC USA) was used for the construction of a library from fragmented sequence and quality and quantity of the con- structed library was measured using 2100 Bioanalyzer GLUDG-L and CB2-H (Palumbi et al. 1991), were used (Agilent Technologies, Santa Clara, CA, USA). Sequencing to obtain the partial sequences of each gene, respect- was performed by Illumina Miseq platform (2 × 300 bp ively (Table 1). The quality of all the primers used in pair ends) (Illumina, USA). this experiment was analyzed by the OligoAnalyzer 3.1 (http://sg.idtdna.com/calc/analyzer) and commercially Assembly of mitochondrial genome by the bioinformatic synthesized by Bioneer Co. (Korea). Each PCR mixture analysis (20 μL) contained 12.8 μL ultrapure water, 1 μL primer Raw reads from MiSeq sequencer, with under Qv 20 and (0.5 μM, forward and reverse), 0.2 μLEx Taq DNA poly- more than ambiguous nucleotides, were removed from merase (TaKaRa, Japan), 2 μL 10× Buffer, 2 μLdNTPs raw read using CLC Genomic Workbench v 7.5 (CLC BIO (1 μM, TaKaRa, Japan), and 100 ng genomic DNA as tem- Aarhus, Denmark). Mothür software was used to pairing plate. PCR was carried out under the following condition: forward and reverse sequence with more than 7 bp over- initial denaturation step at 95 °C for 3 min, followed by lapped and without any mismatch. Paired sequence then 35 cycles of denaturation at 95 °C for 30 s, annealing at assembled using Geneious R8 with minimum 20 bp of 50 °C for 30 s, and extension at 72 °C for 45 s (COI target overlapping sequence and 100% overlap identity. Ambigu- sequence) or 30 s (Cyt-B target sequence). The process ous sequences of the D-loop region were reconfirmed by was completed with a final extension at 72 °C for 10 min. the typical end-point PCR and with sequence-specific Two PCR products targeting partial sequences of COI and primers (Sard_F and Sard_R) and DNA sequencing of its Cyt B were then purified with AccuPrep Gel purification PCR products by Sanger sequencing method (Table 1). kit (Bioneer, Korea) and ligated into a cloning vector (Promega, USA), sequenced in both directions. Results and discussion In order to obtain two large PCR products (~ 8 kb), Morphological and molecular identification of Sardinella two pairs of sequence-specific primer sets (CYT-F and jussieu CO1-R and CO1-F and CYT B-R) were designed based As the result of morphometric measurements, we de- on the obtained partial sequences of each region termined that the collected five fish were S. jussieu. Table 2 General morphometric and meristic (total scute) of S. jussieu Sample Measurement Standard length/SL Body depth/BD Head length/HL Eye diameter/ED BD/SL (%) HL/SL (%) ED/SL (%) HL/ED (%) Total scute (mm) (mm) (mm) (mm) 1 50 13.5 12 3.5 27.0 24.0 7.0 29.2 30 2 47 12.5 11 3 26.6 23.4 6.4 27.3 31 3 45 12.5 11 3 27.8 24.4 6.7 27.3 31 4 41 11.5 11 3 28.0 26.8 7.3 27.3 31 5 52 14.5 13 3.5 27.9 25.0 6.7 26.9 32 Average 47 12.9 11.6 3.2 27.5 24.7 6.8 27.6 31 Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 4 of 9 Fig. 2 Mauritian sardinella (S. jussieu) collected from Banten Bay, Indonesia (a). The fish scale of S. jussieu presents no perforations and vertical striated with not meeting at center (b) according to Whitehead (1985) (c). Black scale bar = 1 cm Among the morphologically similar fish Sardinella spe- (Table 3). Molecular identification of five Sardinella cies including S. albella, S. atricauda, S. fimbriata, S. samples confirmed the morphological identification. marquesensis, S. sindensis,and S. gibbosa, the scale and The COI region of five individuals (652 bp) exhibited pigmentation patterns are useful characteristics to iden- 100% sequence identity to Sardinella sp. (GenBank acces- tify species (Bräger and Moritz 2016; Strauss and Bond sion number: KJ566769) collected from the coastal water 1990). The average ratio of body depth (BD) to stand- in Thailand and 99% to S. jussieu (GenBank accession no.: ard length (SL) of the collected samples was 27.5%, and HQ231358) collected from the Philippines (Quilang et al. total scute numbers were 31 (Table 2). Vertical striae 2011). Based on the morphological characteristics and on scales did not meet at center with no perforations DNA sequence identity, we concluded that five Sardinella on hind part of the scale, and the pigmented dorsal and samples collected in the Banten Bay, Indonesia, were caudal fins were also identified (Fig. 2). Those morpho- Mauritian sardinella, Sardinella jussieu. logical characteristics suggested that the collected sam- ples were S. jussieu. The most closely related Sardinella Complete mitochondrial genome of the Sardinella jussieu species, S. albella and S. gibbosa, are distinguished In order to have additional information of S. jussieu, from S. jussieu in the presence of scale perforations the complete mitochondrial genome sequence was Table 3 Comparison of morphological characteristic of seven Sardinella species Name Scale Fin Striae connected/overlapped Perforations Dark spot at dorsal fin origin Dark spot at caudal fin S. fimbriata √√ √ S. gibbosa √√ √ S. albella √√ √ S. atricauda √√ √ S. brachysoma √√ √ √ S. melanura √√ √ S. jussieu √√ Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 5 of 9 Fig. 3 Mitochondrial genomic organization of Sardinella jussieu determined by the NGS and bioinformatic sequence encoded by H strand (Fig. 3). Although all 13 genes assembly. Its mitochondrial genome was 16,695 bp begin with typical start codon, ATG, there were in length consisting of 13 protein-coding genes, 22 several stop codons including typical ones such as tRNA genes, 2 ribosomal RNA genes, and the puta- TAA (CO1, COII, ATP8, ATP6, COIII, ND4L, ND5, tive control region (Fig. 3). The base composition CYTB), TAG (ND2, ND3, ND6, ND1), and excep- was 4415 A (26%), 4132 T (25%), 4900 C (29%), and tional AGA in ND4 gene (Table 4). Overlapping 3248 G (19%). The purines and pyrimidines are A+T nucleotides were identified in three pairs of content (51%) slightly higher than G+C content protein-coding genes (10 nucleotides for ATP8 and (49%). The highest A+T content was observed in the ATP6, seven for ND4L and ND4, and four for ND5 putative control region (66%), which is similar to the and ND6). other previous studies. The H strands encode 28 The mitochondrial genome of S. jussieu contained genes while the L strands encode 9 genes (Table 4). 22 tRNA genes (Fig. 4), which showed the difference Among the protein-coding genes, three overlap nu- in their sizes from 68 bp (tRNA–Phe) to 71 (tRNA– cleotides up to 10 bp, ATP8–ATP6, ND4L–ND4, Gln). Fourteen tRNA genes encode in H strand and 8 and ND5–ND6, were detected. The transfer RNA genes encoded in L strand (Fig. 3). The 12S rRNA −Ile −Gln −Thr gene pair tRNA –tRNA and t RNA –tRNA gene (951 bp) of S. jussieu was located between the −Pro overlaps 1 bp as well. A total of 1292 bp of tRNA–Phe and tRNA–Val, whereas 1686 bp of 16S noncoding nucleotides are apparent in the S. jussieu rRNA was between tRNA–Val and tRNA–Leu. with 1029 bp at putative control region, and 263 re- Twenty-one tRNA structures were predicted to have mains spread over 11 intergenic nucleotides; 68.3% typical three arms except for tRNA , which showed ser (11.397 bp) of total mitochondrial genome sequence two arms. That result was also identified in the other encoded 13 proteins and the size of each gene Sardinella species (Lavoué et al. 2007). The putative ranged from 168 bp (ATP8) to 1836 bp (ND5). control region of S. jussieu (1029 bp) was longest Except for ND6, all protein-coding genes were among three other Sardinella species including S. Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 6 of 9 Table 4 Organization of the full-length mitochondrial genome of Sardinella jussieu Feature Position Size Strand Intergenic Codon Anticodon/position numbers (bp) nucleotides Start Stop tRNA–Phe 1–68 68 H –– – GAA/31–33 12S rRNA 69–1019 951 H 0 –– – tRNA–Val 1020–1091 72 H 0 –– TAC/1053–1055 16S rRNA 1092–2777 1686 H 0 –– – tRNA–Leu 2779–2853 75 H 1 –– TAA/2814–2816 ND1 2854–3828 975 H 0 ATG TAG – tRNA–Ile 3837–3908 72 H 8 –– GAT/3869–3871 tRNA–Gln 3908–3978 71 L − 1 –– TTG/3944–3946 tRNA–Met 3978–4046 69 H − 1 –– CAT/4008–4010 ND2 4020–5093 1074 H − 27 ATG TAG – tRNA–Trp 5092–5163 72 H − 2 –– TCA/5125–5127 tRNA–Ala 5165–5233 69 L 1 –– TGC/5173–5175 tRNA–Asn 5236–5308 73 L 2 –– GTT/5273–5275 tRNA–Cys 5345–5410 66 L 36 –– GCA/5366–5368 tRNA–Tyr 5414–5484 71 L 3 –– GTA/5450–5452 COX1 5678–7036 1359 H 193 ATG TAA – tRNA–Ser 7037–7107 71 L 0 –– TGA/7073–7075 tRNA–Asp 7112–7180 69 H 4 –– GTC/7142–7144 COII 7193–7897 705 H 12 ATG TAA – tRNA–Lys 7884–7957 74 H − 14 –– TTT/7918–7920 ATP8 7959–8126 168 H 1 ATG TAA – ATP6 8117–8800 684 H − 10 ATG TAA – COIII 8800–9585 786 H − 1 ATG TAA – tRNA–Gly 9585–9656 72 H 0 –– TCC/9618–9620 ND3 9600–10007 408 H − 57 ATG TAG – tRNA–Arg 10006–10075 70 H − 2 –– TCG/1037–10039 ND4L 10076–10372 297 H 0 ATG TAA – ND4 10366–11751 1386 H − 7 ATG AGA – tRNA–His 11747–11815 69 H − 5 –– GTG/11747–11815 tRNA–Ser 11816–11883 68 H 0 –– GCT/11842–11844 tRNA–LEu 11884–11955 72 H 0 –– TAG/11916–11918 ND5 11956–13791 1836 H 0 ATG TAA – ND6 13788–14309 522 L − 4 ATG TAG – tRNA–Glu 14310–14378 69 L 0 TTC/14346–14348 CYTB 14385–15581 1197 H 6 ATG TAA – tRNA–Thr 15526–15597 72 H − 56 –– TGT/15558–15560 tRNA–Pro 15597–15666 70 L − 1 –– TGG/15620–15622 Control region 15667–16695 1029 H 0 –– – longiceps (958 bp) (GenBank accession number: Total mitochondrial DNA sequence of S. jussieu NC033407), S. albella (986 bp) (GenBank accession showed 84–93% identity with those of currently known number: NC016726), and S. maderensis (986 bp) three other Sardinella species among which S. albella (GenBank accession number: NC009587). is the most closely related to S. jussieu (Fig.5a).In Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 7 of 9 Fig. 4 Putative secondary structure tRNA genes in mitochondrial genomic. Proposed structure of 22 tRNA genes encoded in the mitochondrial of Sardinella jussieu order to know the better evolutional relationship of S. mitochondrial genome would be the good candidate jussieu, its COI sequence was compared with those of to discriminate them. the other 12 Sardinella species (Fig. 5b). As shown in In this study, we identified that S. jussieu inhabits in theanalysisbythe full mitochondrialgenomes, S. jus- Java island, Indonesia, as well as the two previously sieu showed the most closely related to S. albella with known Sardinella species, S. albella and S. gibbosa. Al- 96% sequence identity. In fact, DNA sequence identity though S. jussieu is originally distributed in the western of two species S. albella and Sardinella gibbosa was too Indian Ocean from the western coast of southern India high to be distinct with each other in the COI region from Bombay South to Sri Lanka also Madagascar and (Figs. 5b). Although morphological keys to discrimin- Mauritius, the recent information is also caught in atetwo specieswereproposed, thepost-pelvic ventral Taiwan (Hu et al. 2015), Hong Kong (Leung 1997), and scutes and gill rakers number on a lower limb (Stern the Philippines (Quilang et al. 2011). The result strongly et al. 2016), S. albella and S. gibbosa frequently mis- supported that S. jussieu is more widely distributed than identified as shown in the COI barcodes. From the we have thought and the large-scale survey should be reason, it is required to compare full-length made to know the spatiotemporal distribution of four mitochondrial sequences of two species for the better Sardinella species in Indonesia. We here reported the classification. As the lowest sequence identity to full-length mitochondrial genome sequence of S. jussieu other Sardinella species, control region of S. jussieu collected from Java island, which would provide the Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 8 of 9 Fig. 5 a Phylogenetic tree of mitochondrial genome of four species belonging to Sardinella. The phylogenetic tree was constructed using molecular evolutionary genetic analysis ver.6.0 (MEGA 6, MEGA Inc. Englewood, NJ), program with the minimum evolution algorithm, the evolutionary distances were computed using Kimura 2-Parameter method and b Phylogenetic tree of CO1 sequences of 18 species belonging to genus Sardinella. The phylogenetic tree was constructed using molecular evolutionary genetic analysis ver.6.0 (MEGA 6, MEGA Inc. Englewood, NJ), program with the minimum evolution algorithm, the evolutionary distances were computed using Kimura 2-Parameter method important information for the scientific management of Indonesia, for the first time. The mtDNA sequence is Sardinella species in Indonesia. We expect that more 16.695 bp in length and comprises the typical set of 2 Sardinella species may exist in Java island and more in- rRNAs, 22 tRNA genes, 13 protein-coding genes, and formation about the mitochondrial genome of the other putative control region. Mitochondrial genome struc- unreported Sardinella species such as S. gibbosa would ture of S. jussieu was identical to those in other be a useful information for the molecular biological tools Sardinella genus. Phylogenetic analysis using full mito- to discriminate different Sardinella species in Indonesia. chondrial genome exhibits that S. jussieu were most closely related to S. albella. However, comparison in Conclusion the COI region showed that relationship between S. This study determined the complete mitochondrial albella and S. gibbosa was ambiguous and determin- DNA (mtDNA) sequence of S. jussieu in Java Island, ation of the complete mitochondrial DNA sequence of Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 9 of 9 S. gibbosa is required for the better understanding of Hu W, et al. Study on fish life history traits and variation in the Taiwan Strait and its adjacent waters. Acta Oceanol Sin. 2015;34(2):45. evolutional relationship between S. jussieu and those Knebelsberger T, Stöger I. DNA extraction, preservation, and amplification. In: species. Those information would provide the basic in- DNA barcodes: methods and protocols; 2012. p. 311–38. formation for the scientific management of Sardinella Lavoué S, et al. Phylogenetic relationships among anchovies, sardines, herrings and their relatives (Clupeiformes), inferred from whole mitogenome species in Indonesia. sequences. Mol Phylogenet Evol. 2007;43(3):1096–105. Leung A. The epibenthic ichthyofauna of Tolo Harbour and Hong Kong’s Abbreviations northeastern waters: a long term record of change. In: Proceedings of the COI region: Cytochrome c oxidase subunit 1 region; Cyt-B: Cytochrome B Eighth International Marine Biological Workshop: The Marine Flora and Fauna of subunit; mtDNA: Mitochondrial DNA; ND4: NADH dehydrogenase subunit 4; Hong Kong and Southern China, Hong Kong University Press, Hong Kong; 1997. ND5: NADH dehydrogenase subunit 5; ND6: NADH dehydrogenase subunit MMAF. Capture fisheries statistics of Indonesia, 2011. Jakarta: Directorate General 6; NGS: Next-generation sequencing of Capture Fisheries; 2012. p. 190. Palumbi S, et al. The simple fool’s guide to PCR, version 2.0, privately published Acknowledgements document compiled by S. Palumbi. Dept. Honolulu: Zoology, Univ. Hawaii; All authors thank the funding of grant from the Pukyong National University, 1991. p. 96822. and authors also thank the Jakarta fisheries University students who helped Quilang JP, et al. DNA barcoding of the Philippine endemic freshwater sardine for collecting the fish samples. Sardinella tawilis (Clupeiformes: Clupeidae) and its marine relatives. Philipp Agric Sci. 2011;94(3) Funding Sivakumaran K, Manickasundaram M, Ramaiyan V. Problems of identification This work was supported by a grant from the Pukyong National University in among species of Sardinella. In: CMFRI Bulletin National Symposium on Research and Development in Marine Fisheries Sessions I & II 1987. Kochi: CMFRI; 1987. Availability of data and materials Stern N, Rinkevich B, Goren M. Integrative approach revises the frequently The dataset(s) supporting the conclusions of this article is(are) included misidentified species of Sardinella (Clupeidae) of the Indo-West Pacific within the article. Ocean. J Fish Biol. 2016;89(5):2282–305. Strauss RE, Bond CE. Taxonomic methods: morphology. Methods for fish biology. Bethesda: American Fisheries Society; 1990. p. 109–40. Authors’ contributions Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c SPS carried out the whole process, participated in the whole experiment, oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol and drafted the manuscript. SA added and drafted the final phylogenetic Biotechnol. 1994;3(5):294–9. analysis. HWK participated in the design of the study and edited the Ward RD, et al. DNA barcoding Australia's fish species. Philos Trans R Soc Lond B manuscript. All authors read and approved the final manuscript. Biol Sci. 2005;360(1462):1847–57. Whitehead P. FAO species catalogue vol. 7. Clupeoid fishes of the world Ethics approval and consent to participate (suborder Clupeoidei): an annotated and illustrated catalogue of the herrings, Not applicable. sardines, pilchards, sprats, shads, anchovies and wolf-herrings. Rome: Food and Agriculture Organization of the United Nations; 1985. Consent for publication Willette D, Santos M, Aragon M. First report of the Taiwan sardinella Sardinella Not applicable. hualiensis (Clupeiformes: Clupeidae) in the Philippines. J Fish Biol. 2011;79(7): 2087–94. Competing interests The authors declare that they have no competing interests. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author details Interdisciplinary Program of Biomedical, Mechanical and Electrical Engineering, Pukyong National University, Busan 48513, Republic of Korea. Department of Marine Biology, Pukyong National University, Busan 48513, Republic of Korea. Aquaculture Technology Study Program, Jakarta Fisheries University, Jl. AUP Pasar Minggu Jakarta Selatan, Jakarta 12520, Indonesia. Fisheries and Marine Faculty, C Campus Jl. Mulyorejo, Surabaya 60115, Indonesia. Universitas Airlangga, Surabaya, East Java, Indonesia. Received: 12 July 2017 Accepted: 28 September 2017 Submit your next manuscript to BioMed Central and we will help you at every step: References • We accept pre-submission inquiries Begg GA, Waldman JR. An holistic approach to fish stock identification. Fish Res. 1999;43(1):35–44. � Our selector tool helps you to find the most relevant journal Bräger Z, Moritz T. A scale atlas for common Mediterranean teleost fishes. Vertebr � We provide round the clock customer support Zool. 2016;66 � Convenient online submission Ditty JG, Houde ED, Shaw RF. Egg and larval development of Spanish sardine, Sardinella aurita (Family Clupeidae), with a synopsis of characters � Thorough peer review to identify clupeid larvae from the northern Gulf of Mexico. Bull Mar Sci. � Inclusion in PubMed and all major indexing services 1994;54(2):367–80. � Maximum visibility for your research Homayuni H, Marjani M, Mousavi-Sabet H. Descriptive key to the otoliths of three Sardinella species (Pisces, Clupeidae) from the northern Oman Sea. AACL Submit your manuscript at Bioflux. 2013;6(3):211-21. www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Fisheries and Aquatic Sciences Springer Journals

Characterization of the complete mitochondrial genome of Mauritian sardinella, Sardinella jussieu (Lacepède, 1803), collected in the Banten Bay, Indonesia

Loading next page...
 
/lp/springer-journals/characterization-of-the-complete-mitochondrial-genome-of-mauritian-omrFVohatI
Publisher
Springer Journals
Copyright
Copyright © 2017 by The Author(s)
Subject
Life Sciences; Fish & Wildlife Biology & Management; Marine & Freshwater Sciences; Zoology; Animal Ecology
eISSN
2234-1757
DOI
10.1186/s41240-017-0072-x
Publisher site
See Article on Publisher Site

Abstract

Fishes in genus Sardinella are small pelagic species, which plays an important role in marine ecosystem as the first consumer. Those species are also commercially important, whose total catch reaches 278,600 tons in 2011 in Indonesia, but their identification has been difficult for their morphological similarity. In this study, we reported Sardinella jussieu for the first time in Indonesian coastal area (Banten Bay, Indonesia, 6° 0′ 50.00″ S–106° 10′ 21.00″ E). We were able to confirm the species by both its morphological characteristics including the black spot at dorsal fin origin, the dusky pigmentation at caudal fin, 31 total scute numbers, and DNA sequence identity in the GenBank database by the molecular analysis. Its total mitochondrial genome was determined by the combination of next- generation sequencing and typical PCR strategy. The total mitochondrial genome of Sardinella jussieu (16,695 bp) encoded 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs, and the putative control region. All protein-coding genes started with ATG and typical stop codon and ended with TAA or TAG except for ND4 in which AGA is used. Phylogenetic analyses of both COI region and full mitochondrial genome showed that S. jussieu is most closely related to Sardinella albella and Sardinella gibbosa. Keywords: Barcode, Mitochondrial genome, Sardinella, Indonesia, Next-generation sequencing Background Sardinella. Sardinella is important not only in marine food Sardinella is a genus of fish in the family Clupeidae webs as a base consumer supporting tuna, seabirds, and found in the Atlantic, Indian, and the Pacific Ocean. The marine mammals (Willette et al. 2011) but also in industry paddle-shaped supramaxilla bones are major characteris- as the protein source with a low cost using as a bait for tics, which help distinguish Sardinella from other genera. large fish or a feed in aquaculture. Morphological characters distinguish Sardinella from all Seven species in the genus Sardinella are currently other clupeoid genera with the presence of two fleshy out- known in Indonesian waters including Sardinella growths on the hind margin of the gill opening (Whitehead fimbriata, Sardinella gibbosa, Sardinella lemuru, Sardi- 1985). According to FishBase (http://www.fishbase.org/), nella albella, Sardinella atricauda, Sardinella branchy- there are currently 22 recognized species in the genus soma,and Sardinella melanura, whose total catch in Indonesia reaches 278,600 tons in 2011 (MMAF 2012). Morphological identification in Sardinella is mainly characterized by their gill raker, pelvic scute, scales, * Correspondence: kimhw@pknu.ac.kr 1 and otolith (Homayuni et al. 2013; Bräger and Moritz Interdisciplinary Program of Biomedical, Mechanical and Electrical Engineering, Pukyong National University, Busan 48513, Republic of Korea Department of Marine Biology, Pukyong National University, Busan 48513, Republic of Korea Full list of author information is available at the end of the article © The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 2 of 9 2016; Begg and Waldman 1999). However, species no perforation on hind part (Whitehead 1985). After identification in the genus Sardinella is often hard confirmation of the species by the molecular COI for its broad geographical ranges, overlapping distri- markers, its total mitochondrial genome sequence butions (Willette et al. 2011) and morphological was determined by the combination of the traditional similarities (Sivakumaran et al. 1987) especially in PCR methods and next-generation sequencing (NGS) larval stages (Ditty et al. 1994), which makes it diffi- techniques. cult to manage the Sardinella resources in Indonesia. In addition to the traditional morphological identifica- Methods tion, the genetic information is now alternatively used Sample collection and morphological measurement for the species identification for its fast and exact results. Five individuals of S. jussieu were collected in the Banten The most widely used genetic markers are partial mito- Bay, Indonesia (6° 0′ 50.00″–S106° 10′ 21.00″ E), in chondrial DNA sequences such as cytochrome C oxidase January 2016 as the part of the regular fish survey (Fig. 1). I (COI) or cytochrome B (CytB) (Palumbi et al. 1991; Collected fish were directly stored in 96% ethanol and Ward et al. 2005; Vrijenhoek 1994). However, full mito- kept at − 20 °C until the further analysis (Knebelsberger chondrial genome sequences provide more information and Stöger 2012). Morphological identification was made about its biogeographical or evolutional information by their body shape, type of scale, fin feature, morphomet- than those fragmental sequences. Therefore, more than ric (i.e., standard length, body width, and head length), 5000 mitochondrial genomes have been deposited in and meristic characteristic (total number of scutes) GenBank database (www.ncbi.nlm.nih.gov) from 33,500 (Whitehead 1985; Strauss and Bond 1990). species identified based on morphological characteristics (www.fishbase.org). Genomic DNA extraction and next-generation sequencing In this study, we report the Mauritian sardinella, Genomic DNA was extracted using an AccuPrep® Sardinella jussieu, for the first time in Indonesian Genomic DNA Extraction Kit (Bioneer) according to the coastal waters, which was collected from the Banten manufacturer’s instruction. A small portion of tail fin Bay. S. jussieu was previously reported only in the was dissected, which was further homogenized by the Western Indian Ocean, Taiwan, Hong Kong, and TissueLyser II (Qiagen). Purified genomic DNA was Vietnam (www.fishbase.org). Morphological character- quantified with nanoDrop (Thermofisher Scientific istics of Sardinella jussieu are distinguished within D1000), aliquoted, and stored at the − 70 °C for further other Sardinella species with the presence of black analysis. spot at dorsal fin origin and dusky pigmentation at Two universal primer sets targeting cytochrome c caudal fin, total scute measurement which is 31, and oxidase I (COI) region, Fish F1 and Fish R1 (Ward et vertical striae on a scale not meeting at center and al. 2005), and targeting cytochrome b (cyt-B) region, Fig. 1 Sampling location in Banten Bay, Indonesia (red square) Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 3 of 9 Table 1 Primers used for the mitochondrial genome of (Table 1). Each PCR reaction (30 μL) contained 19.7 μL Sardinella jussieu ultrapure water, 1 μL of each primer (0.5 μM), 0.3 μLEx Name Sequence (5' to 3') Product size (bp) Taq Hot Start Version DNA polymerase (TAKARA, Japan), 3 μL 10× Buffer, 3 μL dNTPs (1 mM, Takara, Fish F1 TCAACCAACCACAAAGACATTGGCAC 652 Japan), and 100 ng genomic DNA as template. PCR was Fish R1 TAGACTTCTGGGTGGCCAAAGAATCA carried out with two-step PCR protocol for long PCR GLUDG-L TGACTTGAARAAYCGTTG 451 under the following condition: initial denaturation step GB2-H CCCTCAGAATGATATTTGTCCTCA at 94 °C for 3 min, followed by 30 cycles of denaturation CYTB-F GCCTACGAAAAACCCACCCGCTCC 8.2 k at 98 °C for 10s, and annealing and extension at 68 °C CO1-R GTAAGGTCTACGGATGCCCCTGCG for 10 min. The process was completed with a final ex- tension at 72 °C for 10 min. Two large PCR products CYTB-R AACGGAGGAGAAAGCGGTTGCGATG 8.7 k were pooled together in equal concentration and frag- CO1-F CTTCCTGCTTCTCCTGGCCTCCTC mented to ~ 350 bp in length by Covaris M220 (Covaris SARD F TTAAAGTCCTCCCTGAGGCCC 683 Inc.). TruSeq® sample preparation kit V2 (Illumina, SARD R TTAGGAGGGAGTCGTCAAATGC USA) was used for the construction of a library from fragmented sequence and quality and quantity of the con- structed library was measured using 2100 Bioanalyzer GLUDG-L and CB2-H (Palumbi et al. 1991), were used (Agilent Technologies, Santa Clara, CA, USA). Sequencing to obtain the partial sequences of each gene, respect- was performed by Illumina Miseq platform (2 × 300 bp ively (Table 1). The quality of all the primers used in pair ends) (Illumina, USA). this experiment was analyzed by the OligoAnalyzer 3.1 (http://sg.idtdna.com/calc/analyzer) and commercially Assembly of mitochondrial genome by the bioinformatic synthesized by Bioneer Co. (Korea). Each PCR mixture analysis (20 μL) contained 12.8 μL ultrapure water, 1 μL primer Raw reads from MiSeq sequencer, with under Qv 20 and (0.5 μM, forward and reverse), 0.2 μLEx Taq DNA poly- more than ambiguous nucleotides, were removed from merase (TaKaRa, Japan), 2 μL 10× Buffer, 2 μLdNTPs raw read using CLC Genomic Workbench v 7.5 (CLC BIO (1 μM, TaKaRa, Japan), and 100 ng genomic DNA as tem- Aarhus, Denmark). Mothür software was used to pairing plate. PCR was carried out under the following condition: forward and reverse sequence with more than 7 bp over- initial denaturation step at 95 °C for 3 min, followed by lapped and without any mismatch. Paired sequence then 35 cycles of denaturation at 95 °C for 30 s, annealing at assembled using Geneious R8 with minimum 20 bp of 50 °C for 30 s, and extension at 72 °C for 45 s (COI target overlapping sequence and 100% overlap identity. Ambigu- sequence) or 30 s (Cyt-B target sequence). The process ous sequences of the D-loop region were reconfirmed by was completed with a final extension at 72 °C for 10 min. the typical end-point PCR and with sequence-specific Two PCR products targeting partial sequences of COI and primers (Sard_F and Sard_R) and DNA sequencing of its Cyt B were then purified with AccuPrep Gel purification PCR products by Sanger sequencing method (Table 1). kit (Bioneer, Korea) and ligated into a cloning vector (Promega, USA), sequenced in both directions. Results and discussion In order to obtain two large PCR products (~ 8 kb), Morphological and molecular identification of Sardinella two pairs of sequence-specific primer sets (CYT-F and jussieu CO1-R and CO1-F and CYT B-R) were designed based As the result of morphometric measurements, we de- on the obtained partial sequences of each region termined that the collected five fish were S. jussieu. Table 2 General morphometric and meristic (total scute) of S. jussieu Sample Measurement Standard length/SL Body depth/BD Head length/HL Eye diameter/ED BD/SL (%) HL/SL (%) ED/SL (%) HL/ED (%) Total scute (mm) (mm) (mm) (mm) 1 50 13.5 12 3.5 27.0 24.0 7.0 29.2 30 2 47 12.5 11 3 26.6 23.4 6.4 27.3 31 3 45 12.5 11 3 27.8 24.4 6.7 27.3 31 4 41 11.5 11 3 28.0 26.8 7.3 27.3 31 5 52 14.5 13 3.5 27.9 25.0 6.7 26.9 32 Average 47 12.9 11.6 3.2 27.5 24.7 6.8 27.6 31 Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 4 of 9 Fig. 2 Mauritian sardinella (S. jussieu) collected from Banten Bay, Indonesia (a). The fish scale of S. jussieu presents no perforations and vertical striated with not meeting at center (b) according to Whitehead (1985) (c). Black scale bar = 1 cm Among the morphologically similar fish Sardinella spe- (Table 3). Molecular identification of five Sardinella cies including S. albella, S. atricauda, S. fimbriata, S. samples confirmed the morphological identification. marquesensis, S. sindensis,and S. gibbosa, the scale and The COI region of five individuals (652 bp) exhibited pigmentation patterns are useful characteristics to iden- 100% sequence identity to Sardinella sp. (GenBank acces- tify species (Bräger and Moritz 2016; Strauss and Bond sion number: KJ566769) collected from the coastal water 1990). The average ratio of body depth (BD) to stand- in Thailand and 99% to S. jussieu (GenBank accession no.: ard length (SL) of the collected samples was 27.5%, and HQ231358) collected from the Philippines (Quilang et al. total scute numbers were 31 (Table 2). Vertical striae 2011). Based on the morphological characteristics and on scales did not meet at center with no perforations DNA sequence identity, we concluded that five Sardinella on hind part of the scale, and the pigmented dorsal and samples collected in the Banten Bay, Indonesia, were caudal fins were also identified (Fig. 2). Those morpho- Mauritian sardinella, Sardinella jussieu. logical characteristics suggested that the collected sam- ples were S. jussieu. The most closely related Sardinella Complete mitochondrial genome of the Sardinella jussieu species, S. albella and S. gibbosa, are distinguished In order to have additional information of S. jussieu, from S. jussieu in the presence of scale perforations the complete mitochondrial genome sequence was Table 3 Comparison of morphological characteristic of seven Sardinella species Name Scale Fin Striae connected/overlapped Perforations Dark spot at dorsal fin origin Dark spot at caudal fin S. fimbriata √√ √ S. gibbosa √√ √ S. albella √√ √ S. atricauda √√ √ S. brachysoma √√ √ √ S. melanura √√ √ S. jussieu √√ Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 5 of 9 Fig. 3 Mitochondrial genomic organization of Sardinella jussieu determined by the NGS and bioinformatic sequence encoded by H strand (Fig. 3). Although all 13 genes assembly. Its mitochondrial genome was 16,695 bp begin with typical start codon, ATG, there were in length consisting of 13 protein-coding genes, 22 several stop codons including typical ones such as tRNA genes, 2 ribosomal RNA genes, and the puta- TAA (CO1, COII, ATP8, ATP6, COIII, ND4L, ND5, tive control region (Fig. 3). The base composition CYTB), TAG (ND2, ND3, ND6, ND1), and excep- was 4415 A (26%), 4132 T (25%), 4900 C (29%), and tional AGA in ND4 gene (Table 4). Overlapping 3248 G (19%). The purines and pyrimidines are A+T nucleotides were identified in three pairs of content (51%) slightly higher than G+C content protein-coding genes (10 nucleotides for ATP8 and (49%). The highest A+T content was observed in the ATP6, seven for ND4L and ND4, and four for ND5 putative control region (66%), which is similar to the and ND6). other previous studies. The H strands encode 28 The mitochondrial genome of S. jussieu contained genes while the L strands encode 9 genes (Table 4). 22 tRNA genes (Fig. 4), which showed the difference Among the protein-coding genes, three overlap nu- in their sizes from 68 bp (tRNA–Phe) to 71 (tRNA– cleotides up to 10 bp, ATP8–ATP6, ND4L–ND4, Gln). Fourteen tRNA genes encode in H strand and 8 and ND5–ND6, were detected. The transfer RNA genes encoded in L strand (Fig. 3). The 12S rRNA −Ile −Gln −Thr gene pair tRNA –tRNA and t RNA –tRNA gene (951 bp) of S. jussieu was located between the −Pro overlaps 1 bp as well. A total of 1292 bp of tRNA–Phe and tRNA–Val, whereas 1686 bp of 16S noncoding nucleotides are apparent in the S. jussieu rRNA was between tRNA–Val and tRNA–Leu. with 1029 bp at putative control region, and 263 re- Twenty-one tRNA structures were predicted to have mains spread over 11 intergenic nucleotides; 68.3% typical three arms except for tRNA , which showed ser (11.397 bp) of total mitochondrial genome sequence two arms. That result was also identified in the other encoded 13 proteins and the size of each gene Sardinella species (Lavoué et al. 2007). The putative ranged from 168 bp (ATP8) to 1836 bp (ND5). control region of S. jussieu (1029 bp) was longest Except for ND6, all protein-coding genes were among three other Sardinella species including S. Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 6 of 9 Table 4 Organization of the full-length mitochondrial genome of Sardinella jussieu Feature Position Size Strand Intergenic Codon Anticodon/position numbers (bp) nucleotides Start Stop tRNA–Phe 1–68 68 H –– – GAA/31–33 12S rRNA 69–1019 951 H 0 –– – tRNA–Val 1020–1091 72 H 0 –– TAC/1053–1055 16S rRNA 1092–2777 1686 H 0 –– – tRNA–Leu 2779–2853 75 H 1 –– TAA/2814–2816 ND1 2854–3828 975 H 0 ATG TAG – tRNA–Ile 3837–3908 72 H 8 –– GAT/3869–3871 tRNA–Gln 3908–3978 71 L − 1 –– TTG/3944–3946 tRNA–Met 3978–4046 69 H − 1 –– CAT/4008–4010 ND2 4020–5093 1074 H − 27 ATG TAG – tRNA–Trp 5092–5163 72 H − 2 –– TCA/5125–5127 tRNA–Ala 5165–5233 69 L 1 –– TGC/5173–5175 tRNA–Asn 5236–5308 73 L 2 –– GTT/5273–5275 tRNA–Cys 5345–5410 66 L 36 –– GCA/5366–5368 tRNA–Tyr 5414–5484 71 L 3 –– GTA/5450–5452 COX1 5678–7036 1359 H 193 ATG TAA – tRNA–Ser 7037–7107 71 L 0 –– TGA/7073–7075 tRNA–Asp 7112–7180 69 H 4 –– GTC/7142–7144 COII 7193–7897 705 H 12 ATG TAA – tRNA–Lys 7884–7957 74 H − 14 –– TTT/7918–7920 ATP8 7959–8126 168 H 1 ATG TAA – ATP6 8117–8800 684 H − 10 ATG TAA – COIII 8800–9585 786 H − 1 ATG TAA – tRNA–Gly 9585–9656 72 H 0 –– TCC/9618–9620 ND3 9600–10007 408 H − 57 ATG TAG – tRNA–Arg 10006–10075 70 H − 2 –– TCG/1037–10039 ND4L 10076–10372 297 H 0 ATG TAA – ND4 10366–11751 1386 H − 7 ATG AGA – tRNA–His 11747–11815 69 H − 5 –– GTG/11747–11815 tRNA–Ser 11816–11883 68 H 0 –– GCT/11842–11844 tRNA–LEu 11884–11955 72 H 0 –– TAG/11916–11918 ND5 11956–13791 1836 H 0 ATG TAA – ND6 13788–14309 522 L − 4 ATG TAG – tRNA–Glu 14310–14378 69 L 0 TTC/14346–14348 CYTB 14385–15581 1197 H 6 ATG TAA – tRNA–Thr 15526–15597 72 H − 56 –– TGT/15558–15560 tRNA–Pro 15597–15666 70 L − 1 –– TGG/15620–15622 Control region 15667–16695 1029 H 0 –– – longiceps (958 bp) (GenBank accession number: Total mitochondrial DNA sequence of S. jussieu NC033407), S. albella (986 bp) (GenBank accession showed 84–93% identity with those of currently known number: NC016726), and S. maderensis (986 bp) three other Sardinella species among which S. albella (GenBank accession number: NC009587). is the most closely related to S. jussieu (Fig.5a).In Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 7 of 9 Fig. 4 Putative secondary structure tRNA genes in mitochondrial genomic. Proposed structure of 22 tRNA genes encoded in the mitochondrial of Sardinella jussieu order to know the better evolutional relationship of S. mitochondrial genome would be the good candidate jussieu, its COI sequence was compared with those of to discriminate them. the other 12 Sardinella species (Fig. 5b). As shown in In this study, we identified that S. jussieu inhabits in theanalysisbythe full mitochondrialgenomes, S. jus- Java island, Indonesia, as well as the two previously sieu showed the most closely related to S. albella with known Sardinella species, S. albella and S. gibbosa. Al- 96% sequence identity. In fact, DNA sequence identity though S. jussieu is originally distributed in the western of two species S. albella and Sardinella gibbosa was too Indian Ocean from the western coast of southern India high to be distinct with each other in the COI region from Bombay South to Sri Lanka also Madagascar and (Figs. 5b). Although morphological keys to discrimin- Mauritius, the recent information is also caught in atetwo specieswereproposed, thepost-pelvic ventral Taiwan (Hu et al. 2015), Hong Kong (Leung 1997), and scutes and gill rakers number on a lower limb (Stern the Philippines (Quilang et al. 2011). The result strongly et al. 2016), S. albella and S. gibbosa frequently mis- supported that S. jussieu is more widely distributed than identified as shown in the COI barcodes. From the we have thought and the large-scale survey should be reason, it is required to compare full-length made to know the spatiotemporal distribution of four mitochondrial sequences of two species for the better Sardinella species in Indonesia. We here reported the classification. As the lowest sequence identity to full-length mitochondrial genome sequence of S. jussieu other Sardinella species, control region of S. jussieu collected from Java island, which would provide the Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 8 of 9 Fig. 5 a Phylogenetic tree of mitochondrial genome of four species belonging to Sardinella. The phylogenetic tree was constructed using molecular evolutionary genetic analysis ver.6.0 (MEGA 6, MEGA Inc. Englewood, NJ), program with the minimum evolution algorithm, the evolutionary distances were computed using Kimura 2-Parameter method and b Phylogenetic tree of CO1 sequences of 18 species belonging to genus Sardinella. The phylogenetic tree was constructed using molecular evolutionary genetic analysis ver.6.0 (MEGA 6, MEGA Inc. Englewood, NJ), program with the minimum evolution algorithm, the evolutionary distances were computed using Kimura 2-Parameter method important information for the scientific management of Indonesia, for the first time. The mtDNA sequence is Sardinella species in Indonesia. We expect that more 16.695 bp in length and comprises the typical set of 2 Sardinella species may exist in Java island and more in- rRNAs, 22 tRNA genes, 13 protein-coding genes, and formation about the mitochondrial genome of the other putative control region. Mitochondrial genome struc- unreported Sardinella species such as S. gibbosa would ture of S. jussieu was identical to those in other be a useful information for the molecular biological tools Sardinella genus. Phylogenetic analysis using full mito- to discriminate different Sardinella species in Indonesia. chondrial genome exhibits that S. jussieu were most closely related to S. albella. However, comparison in Conclusion the COI region showed that relationship between S. This study determined the complete mitochondrial albella and S. gibbosa was ambiguous and determin- DNA (mtDNA) sequence of S. jussieu in Java Island, ation of the complete mitochondrial DNA sequence of Sektiana et al. Fisheries and Aquatic Sciences (2017) 20:26 Page 9 of 9 S. gibbosa is required for the better understanding of Hu W, et al. Study on fish life history traits and variation in the Taiwan Strait and its adjacent waters. Acta Oceanol Sin. 2015;34(2):45. evolutional relationship between S. jussieu and those Knebelsberger T, Stöger I. DNA extraction, preservation, and amplification. In: species. Those information would provide the basic in- DNA barcodes: methods and protocols; 2012. p. 311–38. formation for the scientific management of Sardinella Lavoué S, et al. Phylogenetic relationships among anchovies, sardines, herrings and their relatives (Clupeiformes), inferred from whole mitogenome species in Indonesia. sequences. Mol Phylogenet Evol. 2007;43(3):1096–105. Leung A. The epibenthic ichthyofauna of Tolo Harbour and Hong Kong’s Abbreviations northeastern waters: a long term record of change. In: Proceedings of the COI region: Cytochrome c oxidase subunit 1 region; Cyt-B: Cytochrome B Eighth International Marine Biological Workshop: The Marine Flora and Fauna of subunit; mtDNA: Mitochondrial DNA; ND4: NADH dehydrogenase subunit 4; Hong Kong and Southern China, Hong Kong University Press, Hong Kong; 1997. ND5: NADH dehydrogenase subunit 5; ND6: NADH dehydrogenase subunit MMAF. Capture fisheries statistics of Indonesia, 2011. Jakarta: Directorate General 6; NGS: Next-generation sequencing of Capture Fisheries; 2012. p. 190. Palumbi S, et al. The simple fool’s guide to PCR, version 2.0, privately published Acknowledgements document compiled by S. Palumbi. Dept. Honolulu: Zoology, Univ. Hawaii; All authors thank the funding of grant from the Pukyong National University, 1991. p. 96822. and authors also thank the Jakarta fisheries University students who helped Quilang JP, et al. DNA barcoding of the Philippine endemic freshwater sardine for collecting the fish samples. Sardinella tawilis (Clupeiformes: Clupeidae) and its marine relatives. Philipp Agric Sci. 2011;94(3) Funding Sivakumaran K, Manickasundaram M, Ramaiyan V. Problems of identification This work was supported by a grant from the Pukyong National University in among species of Sardinella. In: CMFRI Bulletin National Symposium on Research and Development in Marine Fisheries Sessions I & II 1987. Kochi: CMFRI; 1987. Availability of data and materials Stern N, Rinkevich B, Goren M. Integrative approach revises the frequently The dataset(s) supporting the conclusions of this article is(are) included misidentified species of Sardinella (Clupeidae) of the Indo-West Pacific within the article. Ocean. J Fish Biol. 2016;89(5):2282–305. Strauss RE, Bond CE. Taxonomic methods: morphology. Methods for fish biology. Bethesda: American Fisheries Society; 1990. p. 109–40. Authors’ contributions Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c SPS carried out the whole process, participated in the whole experiment, oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol and drafted the manuscript. SA added and drafted the final phylogenetic Biotechnol. 1994;3(5):294–9. analysis. HWK participated in the design of the study and edited the Ward RD, et al. DNA barcoding Australia's fish species. Philos Trans R Soc Lond B manuscript. All authors read and approved the final manuscript. Biol Sci. 2005;360(1462):1847–57. Whitehead P. FAO species catalogue vol. 7. Clupeoid fishes of the world Ethics approval and consent to participate (suborder Clupeoidei): an annotated and illustrated catalogue of the herrings, Not applicable. sardines, pilchards, sprats, shads, anchovies and wolf-herrings. Rome: Food and Agriculture Organization of the United Nations; 1985. Consent for publication Willette D, Santos M, Aragon M. First report of the Taiwan sardinella Sardinella Not applicable. hualiensis (Clupeiformes: Clupeidae) in the Philippines. J Fish Biol. 2011;79(7): 2087–94. Competing interests The authors declare that they have no competing interests. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author details Interdisciplinary Program of Biomedical, Mechanical and Electrical Engineering, Pukyong National University, Busan 48513, Republic of Korea. Department of Marine Biology, Pukyong National University, Busan 48513, Republic of Korea. Aquaculture Technology Study Program, Jakarta Fisheries University, Jl. AUP Pasar Minggu Jakarta Selatan, Jakarta 12520, Indonesia. Fisheries and Marine Faculty, C Campus Jl. Mulyorejo, Surabaya 60115, Indonesia. Universitas Airlangga, Surabaya, East Java, Indonesia. Received: 12 July 2017 Accepted: 28 September 2017 Submit your next manuscript to BioMed Central and we will help you at every step: References • We accept pre-submission inquiries Begg GA, Waldman JR. An holistic approach to fish stock identification. Fish Res. 1999;43(1):35–44. � Our selector tool helps you to find the most relevant journal Bräger Z, Moritz T. A scale atlas for common Mediterranean teleost fishes. Vertebr � We provide round the clock customer support Zool. 2016;66 � Convenient online submission Ditty JG, Houde ED, Shaw RF. Egg and larval development of Spanish sardine, Sardinella aurita (Family Clupeidae), with a synopsis of characters � Thorough peer review to identify clupeid larvae from the northern Gulf of Mexico. Bull Mar Sci. � Inclusion in PubMed and all major indexing services 1994;54(2):367–80. � Maximum visibility for your research Homayuni H, Marjani M, Mousavi-Sabet H. Descriptive key to the otoliths of three Sardinella species (Pisces, Clupeidae) from the northern Oman Sea. AACL Submit your manuscript at Bioflux. 2013;6(3):211-21. www.biomedcentral.com/submit

Journal

Fisheries and Aquatic SciencesSpringer Journals

Published: Oct 23, 2017

References