Access the full text.
Sign up today, get DeepDyve free for 14 days.
CDLC Lima, LA Lima, MMOP Cerqueira, EG Ferreira, CA Rosa (2009)
Lactic acid bacteria and yeasts associated with the artisanal Minas cheese produced in the region of Serra do Salitre, Minas Gerais Arquivo Brasileiro de MedicinaVet Zootec, 61
RCR Martinez, M Wachsman, NI Torres, JG LeBlanc, SD Todorov, BDGM Franco (2013)
Biochemical, antimicrobial and molecular characterization of a noncytotoxic bacteriocin produced by Lactobacillus plantarum ST71KSFood Microbiol, 34
S-H Seo, M Jung, WJ Kim (2014)
Antilisterial and amylase-sensitive bacteriocin producing Enterococcus faecium SH01 from Mukeunji, a Korean over-ripened kimchiFood Sci Biotechnol, 23
OZ Gurira, EM Buys (2005)
Characterization and antimicrobial activity of Pediococcus species isolated from South African farm-style cheeseFood Microbiol, 22
H Albano, SD Todorov, CA Reenen, T Hogg, LMT Dicks, P Teixeira (2007)
Characterization of two bacteriocins produced by Pediococcus acidilactici isolated from “Alheira”, a fermented sausage traditionally produced in PortugalInt J Food Microbiol, 116
SM Castro, M Kolomeytseva, R Casquete, J Silva, JA Saraiva, P Teixeira (2015)
Effect of high pressure on growth and bacteriocin production of Pediococcus acidilactici HA-6111-2High Pressure Res, 35
PS Malheiros, V Sant Anna, SD Todorov, BDGM Franco (2015)
Optimization of growth and bacteriocin production by Lactobacillus sakei subsp. sakei2aBraz J Microbiol, 46
S Abbasiliasi, JS Tan, TA Tengku Ibrahim, F Bashokouh, NR Ramakrishnan, S Mustafa, AB Ariff (2017)
Fermentation factors influencing the production of bacteriocins by lactic acid bacteria: a reviewRSC Adv, 7
R Freitas, MA Brito, LA Nero, AF Carvalho (2013)
Microbiological safety of Minas Frescal Cheese (MFC) and tracking the contamination of Escherichia coli and Staphylococcus aureus in MFC processingFoodborne Pathog Dis, 10
S Ammor, G Tauveron, E Dufour, I Chevallier (2006)
Antibacterial activity of lactic acid bacteria against spoilage and pathogenic bacteria isolated from the same meat small-scale facility: 1—screening and characterization of the antibacterial compoundsFood Control, 17
H Holo, Z Jeknic, M Daeschel, S Stevanovic, IF Nes (2001)
Plantaricin W from Lactobacillus plantarum belongs to a new family of two-peptide lantibioticsMicrobiology, 147
H Sharafi (2013)
Antibacterial activity and probiotic potential of Lactobacillus plantarum HKN01: a new insight into the morphological changes of antibacterial compound-treated Escherichia coli by electron microscopyJ Microbiol Biotechnol, 23
V Miteva (1998)
Detection and characterization of a novel antibacterial substance produced by a Lactobacillus delbrueckii strain 1043J Appl Microbiol, 85
SK Stephens (1998)
Molecular analysis of the locus responsible for production of plantaricin S, a two-peptide bacteriocin produced byLactobacillus plantarum LPCO10Appl Environ Microbiol, 64
AF Londoño-Zapata, MM Durango-Zuleta, JU Sepúlveda-Valencia, CX Moreno Herrera (2017)
Characterization of lactic acid bacterial communities associated with a traditional Colombian cheese: double cream cheeseLWT Food Sci Technol, 82
S Schirru (2012)
Sardinian goat’s milk as source of bacteriocinogenic potential protective culturesFood Control, 25
MF Kruger, B MdS, A Miranda, M Landgraf, MT Destro, SD Todorov, BD Gombossy de Melo Franco (2013)
Isolation of bacteriocinogenic strain of Lactococcus lactis subsp. lactis from rocket salad (Eruca sativa Mill.) and evidences of production of a variant of nisin with modification in the leader-peptideFood Control, 33
V Mandal, SK Sen, NC Mandal (2008)
Optimized culture conditions for bacteriocin production by Pediococcus acidilactici LAB 5 and its characterizationIndian J Biochem Biophys, 45
KMO Santos (2014)
Brazilian artisanal cheeses as a source of beneficial Enterococcus faecium strains: characterization of the bacteriocinogenic potentialAnn Microbiol, 64
JE Powell, RC Witthuhn, SD Todorov, LMT Dicks (2007)
Characterization of bacteriocin ST8KF produced by a kefir isolate Lactobacillus plantarum ST8KFInt Dairy J, 17
E Tomé, SD Todorov, PA Gibbs, PC Teixeira (2009)
Partial characterization of nine bacteriocins produced by lactic acid bacteria isolated from cold-smoked salmon with activity against listeria monocytogenesFood Biotechnol, 23
SD Todorov, W Holzapfel, LA Nero (2016)
Characterization of a novel bacteriocin produced by Lactobacillus plantarum ST8SH and some aspects of its mode of actionAnn Microbiol, 66
A Casaburi, V Martino, P Ferranti, L Picariello, F Villani (2016)
Technological properties and bacteriocins production by Lactobacillus curvatus 54M16 and its use as starter culture for fermented sausage manufactureFood Control, 59
KMO Santos (2015)
Artisanal Coalho cheeses as source of beneficial Lactobacillus plantarum and Lactobacillus rhamnosus strainsDairy Sci Technol, 95
G Wang (2014)
Partial characterisation of an anti-listeria substance produced by Pediococcus acidilactici P9Int Dairy J, 34
LM Cintas, P Casaus, C Herranz, LS Håvarstein, H Holo, PE Hernández, IF Nes (2000)
Biochemical and genetic evidence that Enterococcus faecium L50 produces enterocins L50A and L50B, the sec-dependent enterocin p, and a novel bacteriocin secreted without an N-terminal extension termed enterocin QJ Bacteriol, 182
A Felske, H Rheims, A Wolterink, E Stackebrandt, ADL Akkermans (1997)
Ribosome analysis reveals prominent activity of an uncultured member of the class Actinobacteria in grassland soilsMicrobiology, 143
A Piva, DR Headon (1994)
Pediocin A, a bacteriocin produced by Pediococcus pentosaceus FBB61Microbiology, 140
R Yang, MC Johnson, B Ray (1992)
Novel method to extract large amounts of bacteriocins from lactic acid bacteriaAppl Environ Microbiol, 58
VQ Cavicchioli, AC Camargo, SD Todorov, LA Nero (2017)
Novel bacteriocinogenic Enterococcus hirae and Pediococcus pentosaceus strains with antilisterial activity isolated from Brazilian artisanal cheeseJ Dairy Sci, 100
M Toit, CM Franz, LM Dicks, WH Holzapfel (2000)
Preliminary characterization of bacteriocins produced by Enterococcus faecium and Enterococcus faecalis isolated from pig faecesJ Appl Microbiol, 88
M Ghanbari, M Jami, W Kneifel, KJ Domig (2013)
Antimicrobial activity and partial characterization of bacteriocins produced by lactobacilli isolated from sturgeon fishFood Control, 32
M Papagianni, S Anastasiadou (2009)
Pediocins: the bacteriocins of Pediococci. Sources, production, properties and applicationsMicrob Cell Factories, 8
DN Furtado, SD Todorov, M Landgraf, MT Destro, BDGM Franco (2014)
Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: characterization of the bacteriocinBraz J Microbiol, 45
JM Martins, É Galinari, NJ Pimentel-Filho, JI Ribeiro Jr, MM Furtado, CLLF Ferreira (2015)
Determining the minimum ripening time of artisanal Minas cheese, a traditional Brazilian cheeseBraz J Microbiol, 46
LM Perin, B Dal Bello, S Belviso, G Zeppa, AFD Carvalho, L Cocolin, LA Nero (2015)
Microbiota of Minas cheese as influenced by the nisin producer Lactococcus lactis subsp. lactis GLc05Int J Food Microbiol, 214
SD Todorov, M Vaz-Velho, BDG Melo Franco, WH Holzapfel (2013)
Partial characterization of bacteriocins produced by three strains of Lactobacillus sakei, isolated from salpicao, a fermented meat product from north-west of PortugalFood Control, 30
LMP Luiz, RD Castro, SHC Sandes, JG Silva, LG Oliveira, GA Sales, MR Souza (2017)
Isolation and identification of lactic acid bacteria from Brazilian Minas artisanal cheeseCyTA—J Food, 15
H Khan, S Flint, P-L Yu (2010)
Enterocins in food preservationInt J Food Microbiol, 141
LGG Neto, MR Souza, AC Nunes, JR Nicoli, WLM Santos (2005)
Antimicrobial activity of lactic acid bacteria isolated from artisanal and industrial “coalho” cheese against indicator microorganisms Arquivo Brasileiro de MedicinaVet Zootec, 57
A Maldonado, JL Ruiz-Barba, R Jiménez-Díaz (2003)
Purification and genetic characterization of plantaricin NC8, a novel coculture-inducible two-peptide Bacteriocin from lactobacillus plantarum NC8Appl Environ Microbiol, 69
PM Moraes, GN Vicosa, AK Yamazi, MB Ortolani, LA Nero (2009)
Foodborne pathogens and microbiological characteristics of raw milk soft cheese produced and on retail sale in BrazilFoodborne Pathog Dis, 6
A Murua, SD Todorov, ADS Vieira, RCR Martinez, A Cencič, BDGM Franco (2013)
Isolation and identification of bacteriocinogenic strain of Lactobacillus plantarum with potential beneficial properties from donkey milkJ Appl Microbiol, 114
HA Nel, R Bauer, EJ Vandamme, LMT Dicks (2001)
Growth optimization of Pediococcus damnosus NCFB 1832 and the influence of pH and nutrients on the production of pediocin PD-1J Appl Microbiol, 91
H Schagger (2006)
Tricine-SDS-PAGENat Protoc, 1
SD Todorov (2010)
Characterisation of an antiviral pediocin-like bacteriocin produced by Enterococcus faeciumFood Microbiol, 27
SD Todorov, LMT Dicks (2005)
Pediocin ST18, an anti-listerial bacteriocin produced by Pediococcus pentosaceus ST18 isolated from boza, a traditional cereal beverage from BulgariaProcess Biochem, 40
B Vijay Simha, SK Sood, R Kumariya, AK Garsa (2012)
Simple and rapid purification of pediocin PA-1 from Pediococcus pentosaceous NCDC 273 suitable for industrial applicationMicrobiol Res, 167
V Biscola, SD Todorov, VSC Capuano, H Abriouel, A Gálvez, BDGM Franco (2013)
Isolation and characterization of a nisin-like bacteriocin produced by a Lactococcus lactis strain isolated from charqui, a Brazilian fermented, salted and dried meat productMeat Sci, 93
M Cytryńska, A Zdybicka-Barabas, P Jabłoński, T Jakubowicz (2001)
Detection of antibacterial polypeptide activity in situ after sodium dodecyl sulfate–polyacrylamide gel electrophoresisAnal Biochem, 299
JD Marugg (1992)
Cloning, expression, and nucleotide sequence of genes involved in production of pediocin PA-1, and bacteriocin from Pediococcus acidilactici PAC1.0Appl Environ Microbiol, 58
V Suganthi, V Mohanasrinivasan (2015)
Optimization studies for enhanced bacteriocin production by Pediococcus pentosaceus KC692718 using response surface methodologyJ Food Sci Technol, 52
I Ivanova, P Kabadjova, A Pantev, S Danova, X Dousset (2000)
Detection, purification and partial characterization of a novel bacteriocin substance produced by Lactococcus lactis subsp. lactis B14 isolated from boza-Bulgarian traditional cereal beverageBiocatalysis, 41
JL Parada, CR Caron, ABP Medeiros, CR Soccol (2007)
Bacteriocins from lactic acid bacteria: purification, properties and use as biopreservativesBraz Arch Biol Technol, 50
N Udhayashree, D Senbagam, B Senthilkumar, K Nithya, R Gurusamy (2012)
Production of bacteriocin and their application in food productsAsian Pac J Trop Biomed, 2
S Anastasiadou, M Papagianni, G Filiousis, I Ambrosiadis, P Koidis (2008)
Pediocin SA-1, an antimicrobial peptide from Pediococcus acidilactici NRRL B5627: production conditions, purification and characterizationBioresour Technol, 99
SD Todorov, RP Oliveira, M Vaz-Velho (2012)
Media optimization of Bacteriocin ST22CH production by Lactobacillus sakei ST22CH isolated from salpicão, traditional meat-product from PortugalChem Eng Trans, 2
UK Laemmli (1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4Nature, 227
SD Todorov, LM Dicks (2009)
Bacteriocin production by Pediococcus pentosaceus isolated from marula (Scerocarya birrea)Int J Food Microbiol, 132
SD Todorov, LMT Dicks (2005)
Lactobacillus plantarum isolated from molasses produces bacteriocins active against Gram-negative bacteriaEnzym Microb Technol, 36
B Kaur, N Garg, A Sachdev (2013)
Optimization of bacteriocin production in Pediococcus acidilactici BA28 using response surface methodologyAsian J Pharm Clin Res, 6
Interest in obtaining bacteriocin-producing strains of lactic acid bacteria (LAB) from different sources has been increasing in recent years due to their multiple applications in health and food industries. This study focused on the isolation and character- ization of metabolically active populations of bacteriocinogenic LAB and the evaluation of their antimicrobial substances as well as of some nutritional requirements of them. One hundred and fifty colonies of LAB from artisanal cheeses produced in Minas Gerais state (Brazil) were isolated and screened for their antimicrobial activity. According to their activity against Listeria monocytogenes, ten strains were selected and subsequently identified using biochemical and molecular techniques including 16s rRNA amplification and sequencing as Enterococcus faecalis, Lactobacillus spp., and Pediococcus pentosaceus. Antimicrobial substances produced by four of the selected strains, P. pentosaceus 63, P. pentosaceus 145, P. pentosaceus 146, and P. pentosaceus 147, were biochemically characterized, and presented sensitivity to proteolytic enzymes (suggesting their proteinaceous nature) and to extreme pH. Antimicrobial activity showed stability after treatment with lipase, catalase, α-amylase, and chemicals. Growth kinetics of the P. pentosaceus selected showed maximal bacteriocin production at 37 °C during the end of the exponential growth phase (25,600 AU/mL) and stable production during 24 h of incubation. Dextrose, maltose, and a mixture of peptone, meat extract, and yeast extract increased bacteriocin production. This study demonstrated that dairy products provide a good alternative for obtaining LAB, with the ability to produce antimicrobial substances such as bacteriocins that have potential use as biopreservatives in food. . . . Keywords Antimicrobial activity Bacteriocin Lactic acid bacteria Pediococcus Introduction Electronic supplementary material The online version of this article (https://doi.org/10.1007/s13213-018-1345-z) contains supplementary material, which is available to authorized users. Milk and dairy products represent important ecological niches that are sources of bacteriocinogenic strains of lactic acid bac- * Carolina Gutiérrez-Cortés teria (LAB) (Furtado et al. 2014). Minas cheese, produced in cgutierrezco@unal.edu.co Brazil (Minas Gerais state), is an artisanal product which is a ripened cheese made mostly from raw cow’s milk. Producers Héctor Suarez require approximately 60 days to complete maturation of the hsuarezm@unal.edu.co product and, during this period, a reduction of the most com- Gustavo Buitrago mon pathogen population (Martins et al. 2015; Perin et al. gbuitragoh@unal.edu.co 2015)suchas Listeria monocytogenes, Salmonella spp., Luis Augusto Nero Escherichia coli,and Staphylococcus aureus occurs (Freitas nero@ufv.br et al. 2013). After this time, cheeses reach quality standards Svetoslav Dimitrov Todorov according to Brazilian food production regulations of L. slavi310570@abv.bg monocytogenes and Salmonella spp. absence and 10 CFU/g 1 as maximal count of coagulase-positive staphylococci (CPS) Sede Bogotá, Universidad Nacional de Colombia, Carrera 45 #26-85, (Moraes et al. 2009). The LAB isolated from dairy products Bogota, Colombia 2 belong to genera Lactobacillus, Enterococcus, Pediococcus, Departamento de Veterinária, Universidade Federal de Viçosa, and Lactococcus (Luiz et al. 2017) and have as important Campus UFV, Vicosa, MG, Brazil 384 Ann Microbiol (2018) 68:383–398 characteristics the production of organic acids, carbon diox- dilutions of the homogenized cheese were prepared, plated ide, hydrogen peroxide, diacetyl, and bacteriocins (Ammor et onto man, rogosa, sharpe (MRS) agar (Difco, BD), and cov- al. 2006;Khan et al. 2010). Pediocins are class II bacteriocins ered with a thin layer of bacteriological agar. Plates were in- produced by Pediococcus strains as a primary metabolite with cubated at 37 °C for 24–48 h and total microbial populations antimicrobial activity against Listeria monocytogenes. were counted. Plates with less than 50 separated colonies were Pediocins are generally small peptides (with 36–48 residues) covered with BHI medium containing 1.0% (w/v)agar and non-modified after translation, with some exceptions such (Oxoid) and inoculated with a culture of Listeria as pediocin AcH/PA-1 (Papagianni and Anastasiadou 2009). monocytogenes 104, L. monocytogenes 712, or L. Different studies of Pediococcus strains have been focused monocytogenes ATCC 7644 (final concentration of on their antimicrobial activity. Numerous strains of 10 CFU/mL). After incubation for an additional 24 h at Pediococcus spp. have been reported to be producers of var- 37 °C, 150 colonies that presented inhibition zones were se- ious bacteriocins, including pediocin PA-1/AcH (P. lectedandculturedinMRS broth(Difco, BD)for 24h. acidilactici PAC 1.0, P. acidilactici H, E, F, and M), JD (P. Bioactivity of the selected strains against L. monocytogenes acidilactici SJ-1), pediocin 5 (P. acidilactici UL5), pediocin A 104, L. monocytogenes 712, and L. monocytogenes ATCC (P. pentosaceus FBB-61), pediocin N5p (P. pentosaceus), 7644 was verified using the agar spot-test according to pediocin ST18 (P. pentosaceus), and pediocin PD-1 (P. Murua et al. (2013). Briefly, cell-free supernatants (CFS) of damnosus) (Anastasiadou et al. 2008). A recent study reported isolated LAB were obtained by centrifugation (8000×g at 4 °C a bacteriocinogenic strain Pediococcus pentosaceus for 10 min). The pH of the supernatants was adjusted to 6.0 ST65ACC from Minas cheese with activity against two strains with sterile 1 N NaOH to eliminate the effect of lactic acid of Listeria monocytogenes (Cavicchioli et al. 2017). produced by the strains. Potential generation of proteolytic Application of bacteriocins, such as pediocins from enzymes and H O was prevented by heat treatment of CFS 2 2 Pediococcus spp. strains, is an alternative means of control- (10 min at 80 °C). ling food-borne pathogenic bacteria and may lead to reduced Antimicrobial activity was measured using the spot-on-the- use of chemical preservatives and the production of healthier law method. Twofold dilutions of the CFS were made in phos- food products (Udhayashree et al. 2012). phate buffer (100 mM, pH 6.5). Aliquots (10 μL) of each Knowledge of the optimal production conditions for bac- dilution were spotted onto soft BHI agar (1% agar) inoculated teriocins is important for obtaining maximum activity. with 10 CFU/mL of L. monocytogenes 104. Tests were con- Information on inoculation conditions, environmental factors ducted in three independent repetitions. Antimicrobial activity (pH and temperature), and nutritional requirements are key to was expressed as arbitrary units per milliliter (AU/mL) and obtain amounts of bacteriocins that of use in industrial appli- defined as the reciprocal of the highest dilution showing a cations (Malheiros et al. 2015). Studies investigating these clear zone of growth inhibition and calculated according to requirements are necessary because some nutrients can stim- the equation: ulate or limit expression of bacteriocins (Todorov et al. 2012; AU Abbasiliasi et al. 2017). ¼ a 100 mL In the present study, we report on the isolation, identifica- tion, and characterization of LAB with bacteriocinogenic po- where a = 2 (factor dilution) and b = value of the highest dilu- tential from Minas cheese. Based on a preliminary screening, tion showing at least 2-mm inhibition zone (Murua et al. 2013). four strains of Pediococcus pentosaceus were selected and a Morphology of the studied cultures was examined using biochemical and molecular characterization of their bacterio- Gram staining. Pure cultures were stored at − 20 °C in MRS cins was conducted. Finally, the effect of modifications to the broth supplemented with 20% (w/v)glycerol. growth medium on bacteriocin production was studied. Differentiation and identification Materials and methods Basing on preliminary screening for bacteriocin production, Isolation of bacteriocin-producing strains conducted with L. monocytogenes 104, L. monocytogenes 712, and L. monocytogenes ATCC 7644, 150 colonies with Two different samples of Minas cheese were obtained from a potential for bacteriocin production were isolated. However, dairy store selling artisanal products in Viçosa (Minas Gerais 18 isolates were confirmed to be bacteriocin producers ac- state, Brazil). Screening for LAB bacteriocin-producing cording to the applied agar spot-on-lawn test reported by strains was performed as previously described by Todorov et Murua et al. (2013). Random amplification of polymorphic al. (2010). Eleven grams of Minas cheese were homogenized DNA (RAPD-PCR) analysis was performed in order to obtain in 99 mL of physiological solution (0.85% NaCl, w/v). Serial differentiation of the selected 18 isolates with primers OPL- Ann Microbiol (2018) 68:383–398 385 04, OPL-05, and OPL-20 (www.operon.com/products/ tion was performed using a DNA MasterCycler® with a downloads/OperonsRAPD10merSequences.xls). Total DNA 20-μL reaction volume containing 0.1 μL of each primer from the 18 LAB isolates was extracted using ZR Fungal/ 10 mM, 2 μL buffer (BioLab), 8 μLof5mM MgCl2 Bacterial DNA Kit (Zymo Research, Irvine, CA, USA). The (Fermentas), 1.95 μL dNTP (Fermentas), and 0.05 μL DNA concentration was estimated on a NanoDrop 2000 spec- Taq DNA polymerase (BioLab). Amplification conditions trophotometer (Thermo Scientific Inc., Waltham, MA, USA). were as follows: initial denaturation at 94 °C for 5 min, Amplification reactions were performed according to Dos 35 cycles of 5 min at 94 °C, and 10 s at 61 °C, followed Santos et al. (2015). The 25 μLreaction volumecontained by an increase to 72 °C for 2 min. Final extension of the the following: 2 μL total DNA, 5 μLof10 mMprimer, 2. amplified product was at 72 °C for 75 min. The obtained 5 μL of buffer (BioLab), 10 μL of 5 mM MgCl (Fermentas), amplicons were purified with a QIAquick PCR 1 μLMilli-Qwater, 4 μL dNTP (Fermentas), and 0.5 μLTaq Purification Kit (Qiagen), following the manufacturer’s DNA polymerase (BioLab). Amplifications were performed instructions, and submitted to sequencing at the Center on a DNA MasterCycler® (Eppendorf Scientific, Hamburg, for Human Genome Studies, Institute of Biomedical Germany) as follows: 45 cycles of 1 min at 94 °C and 1 min at Sciences, University of Sao Paulo, Brazil. The sequences 28 °C, followed by an increase to 72 °C for 2 min. Extension were compared to those deposited in GenBank, using the of the amplified product was at 72 °C for 5 min. Amplified BLAST algorithm (http://www.ncbi.nlm.nih.gov/BLAST). products were separated by electrophoresis on 1.2% (w/v) After identification, four of the isolates were used for agarose gels in TAE buffer at 120 V for 1 h. Gels were stained analysis. with GelRed (Biotium Inc., Hayward, CA, USA). A 100-bp DNA ladder (Fermentas) was used as a molecular weight Screening for the presence of bacteriocin genes marker. Bacteriocin-producing LAB strains were identified ac- Total DNAwas isolated as previously described and amplified cording to physiological and biochemical characteristics by PCR using primers, targeting different bacteriocin genes as previously described by Todorov et al. (2013). (nisin, pediocin PA-1, enterocin A, enterocin B, enterocin Carbohydrate fermentation profiles were recorded using L50B, enterocin P, plantaricin W, plantaricin S, and APICHL50 (Biomérieux, Marcy-l′Etoile, France). In addi- plantaricin NC8). PCRs were performed using a DNA tion, molecular identification was confirmed by 16s rRNA MasterCycler® with conditions based on previous studies sequencing. Total DNA was isolated and quantified as (Stephens et al. 1998;du Toitet al. 2000;Holoet al. 2001; described previously. PCR was performed with primers Maldonado et al. 2003; Kruger et al. 2013; Todorov et al. 8F: 5′-AGTTTGATCCTGGCTCAG-3′ and 1512R: 5′- 2016) and based on the specification of the primers, which ACGGCTACCTTGTTACGACTT-3′, according to the are summarized in Table 1. The amplified products were vi- method described by Felske et al. (1997). PCR amplifica- sualized on agarose gel and stained with GelRed. Table 1 Primers Target gene Primers Annealing, T° Fragment size (bp) Ref. Nisin ATGAGTACAAAAGATTTCAACTT 48 °C 203 Kruger et al. (2013) TTATTTGCTTACGTGAACGC Pediocin PA-1 CAAGATCGTTAACCAGTTT 44 °C 1238 Todorov et al. (2016) CCGTTGTTCCCATAGTCTAA Enterocin A AAATATTATGGAAATGGAGTGTAT 34 °C 452 du Toit et al. (2000) GCACTTCCCTGGAATTGCTC Enterocin B GAAAATGATCACAGAATGCCTA 41 °C 159 du Toit et al. (2000) GTTGCATTTAGAGTATACATTTG Enterocin L50B STGGGAGCAATCGCAAAATTAG 44 °C 135 du Toit et al. (2000) ATTGCCCATCCTTCTCCAAT Enterocin P TATGGTAATGGTGTTTATTGTAAT 41 °C 216 du Toit et al. (2000) ATGTCCCATACCTGCCAAAC Plantaricin NC8 GGTCTGCGTATAAGCATCGC 35 °C 207 Maldonado et al. (2003) AAATTGAACATATGGGTGCTTTAAATTCC Plantaricin S GCCTTACCAGAGTAATGCCC 45 °C 450 Stephens et al. (1998) CTGGTGATGCAATCGTTAGTTT Plantaricin W TCACACGAAATATTCCA 41 °C 165 Holo et al. (2001) GGCAAGCGTAAGAAATAAATGAG 386 Ann Microbiol (2018) 68:383–398 Effect of enzymes, temperature, pH, and surfactants 24 h. Antimicrobialactivity wasmeasured every3husing the on bacteriocin activity spot-on-the-law method (Murua et al. 2013). Twofold dilu- tions of the CFS were made in phosphate buffer (100 mM, Strains were grown in MRS broth for 18 h at 37 °C. Cells were pH 6.5). Aliquots (10 μL) of each dilution were spotted onto separated by centrifugation (8000 g, 10 min, 4 °C), and the soft BHI agar (1% agar) inoculated with 10 UFC/mL of L. CFS was adjusted to pH 6.0 with 1 M NaOH. One milliliter of monocytogenes 104. CFS was incubated for 1 h at 37 °C in the presence of 1 mg/ mL (1%) proteinase K, papain, pepsin, and lipase and 0.1 mg/ Growth of Listeria monocytogenes 104 mL α-amylase and catalase (all from Sigma-Aldrich). In a in the presence of CFS separate experiment, 1% (w/v) sodium dodecyl sulfate (SDS), Tween 80, Triton X-100, and NaCl (all from Sigma- One hundred milliliters of BHI was inoculated with 2 mL Aldrich) were added to the CFS; these were also were incu- overnight culture of L. monocytogenes 104 and incubated at bated for 1 h at 37 °C. Untreated CFS and chemicals at their 37 °C. After 3 h of incubation, 20 mL aliquots of CFS (pH 6.5) respective concentrations in water were used as controls. of P. pentosaceus 63, P. pentosaceus 145, P. pentosaceus 146, Effect of different pH on the activity of bacteriocins was tested or P. pentosaceus 147 were filter-sterilized (0.20 mm, by correcting pH of the CFS, prepared as described before, to Millipore) and added. The incubation was continued. pH 2.0, 4.0, 6.0, 8.0, and 10 adjusted with sterile 1 M NaOH Control without addition of CFS served as a comparison of or 1 M HCl. Samples were incubated for 1 h at 25 °C, and after L. monocytogenes 104 growth. Optical density measurements incubation, they were re-adjusted to pH 6.5 with sterile 1 M (600 nm) were recorded at 1-h intervals during the subsequent NaOH or 1 M HCl. Effect of temperature on the bacteriocin 12 h according to Todorov et al. (2010). Tests were conducted activity was tested by incubating CFS at 4, 25, 30, 37, 45, 60, in three independent repetitions. 80, and 100 °C for 1 h and at 121 °C for 20 min. After each treatment, antimicrobial activity was tested by using the agar Adsorption onto target cell spot test method, as previously described and L. monocytogenes 104 was used as the target strain. Results were The adsorption of the bacteriocins produced by P. pentosaceus expressed as percentages of reduction of activity by compar- 63, P. pentosaceus 145, P. pentosaceus 146, and P. ing the diameters of the inhibition zones of treated CFS with pentosaceus 147 onto L. monocytogenes104, Lb. sakei untreated CFS (control). Tests were conducted in three inde- ATCC 15521, and Enterococcus faecalis ATCC 19443 was pendent repetitions. measured according to Biscola et al. (2013). The target micro- organisms were grown overnight in 10 mL of BHI (for L. Adsorption of bacteriocin on producer cells monocytogenes 104) and MRS broth (for Lb. sakei and E. faecalis) at 37 °C. Biomass was recovered by centrifugation Determination of the adsorbed bacteriocin onto the surface of (8000×g, 15 min, 4 °C). Cells were washed twice with sterile the producer cells was performed as previously proposed by 5 mM phosphate buffer (pH 6.5) and re-suspended in the same Yang et al. (1992). Briefly, after incubation in MRS broth for buffer to reach an equal to 1.0 of OD600. One milliliter of 18 h at 37 °C, the cultures were adjusted to pH 6.0 with 1 M each cell suspension was mixed with 1 mL of CFS prepared as NaOH and the cells then harvested (10,000 g,15min,4 °C) described before and incubated at 37 °C for 1 h. The antimi- and washed with 10 mL of sterile phosphate buffer (0.1 M, crobial activity, using the spot-on-the-law method against L. pH 6.5). The CFS samples were stored for use as controls. The monocytogenes 104 as previously described, of unbound bac- cells were re-suspended in 10 mL 100 mM NaCl (pH 2.0), teriocin in the CFS was measured after removal of cells stirred for 1 h at 4 °C, and then harvested (12,000×g,15min, (8000×g, 15 min, 4 °C). Reduction of bacteriocin activity 4 °C). The CFS supernatant obtained was neutralized to results in adsorption of bacteriocin onto cell surface of target pH 7.0 with sterile 1 N NaOH and tested for activity using cells and being unavailable for detection in cell-free superna- the agar spot-test (Murua et al. 2013). Tests were conducted in tant. In addition, the effect of pH (4.0, 6.0, 8.0, and 10.0), three independent repetitions. temperature (4, 25, 30, and 37 °C), and the presence of 1% (w/v) of NaCl, Tween 80, glycerol, and SDS on the adsorption Growth dynamics and bacteriocin production of the bacteriocin was determined (Biscola et al. 2013). The adsorbed bacteriocins were determined as follows: Growth dynamics and bacteriocin production were evaluated using the turbidity and spot-on-the-law methods, respectively. AU=mL %Adsorption ¼ 100− 100 MRS broth (100 mL) was inoculated with 2% overnight cul- AU=mL ture and incubated at 37 °C for 24 h. Changes in optical den- sity at 600 nm (OD600) and pH were monitored hourly for Ann Microbiol (2018) 68:383–398 387 where AU/mL is the bacteriocin activity before treatment, SDS-PAGE electrophoresis was performed according to and AU/mL is the bacteriocin activity after treatment. Tests Laemmli (1970), and sample preparation was performed ac- were conducted in three independent repetitions. cordingtoSchagger(2006). All examined fractions were loaded in duplicate, and SDS-PAGE electrophoresis was per- formed at 200 Vand 60 mA for first 10 min and then at 200 V Effect of medium composition on the production and 35 mA. One part of the gel was stained with Coomassie of bacteriocins Blue, as described by Schagger (2006), and the second part was used for an overlay assay, according to Cytryńska et al. To investigate the effect of nitrogen and carbon sources and (2001). Overlay gel was irradiated with UV for 30 min to also the requirements of micronutrients on the growth and prevent potential antimicrobial contamination and covered antimicrobial activity of the studied strains, different modified with a soft BHI agar (1%) inoculated with Listeria MRS broths were developed. Strains were grown in 10 mL monocytogenes 104 (approx. 10 CFU/mL) in order to local- MRS broth at 37 °C for 18 h. Aliquots (100 μL) of the cultures ize the protein bands with antibacterial activity. were used to inoculate 10 mL of the following media: (a) MRS broth without organic nutrients, supplemented with pep- tone (25 g/L), meat extract (25 g/L), and yeast extract (25 g/L) Results and discussion or supplemented with combinations of peptone (12.5 g/L) plus meat extract (12.5 g/L), peptone (15 g/L) plus yeast extract Isolation, differentiation, and identification (7.5 g/L), meat extract (15 g/L) plus yeast extract (7.5 g/L), or peptone (10 g/L), meat extract (10 g/L), and yeast extract (5 g/ One hundred and fifty LAB grown on MRS agar, and that had L); (b) MRS broth, replacing the carbon source with fructose, formed clear inhibition zones against Listeria spp. incorporat- sucrose, lactose, mannose, raffinose, mannitol, or maltose ed in the third agar layer, were isolated from two samples of (20 g/L); (c) MRS broth modified to contain 0, 2, 5, or 10 g/ artisanal cheese produced in Viçosa municipality (Minas LK HPO ; (d) MRS broth modified to contain 0, 0.1, or 0.5 g/ 2 4 Gerais, Brazil). According to the results of additional antimi- LofMgSO and 0, 0.05, or 0.20 g/L of MnSO ; (e) MRS 4 4 crobial tests (Murua et al. 2013) using the CFS (pH 6.5) of the broth supplemented with 0, 0.5, 1, 2, 5, or 10 g/L glycerol; (f) 150 isolated colonies, on spot agar test 18 of them (isolates 54, MRS broth modified to contain 0, 2, or 5 g/L of ammonium 56, 59, 63, 64, 65, 66, 67, 68, 70, 87, 91, 127, 145, 146, 147, citrate; (g) MRS broth modified to contain 0, 1, 2, or 5 g/L of 148, and 149) produced more than 10 mm of inhibition zones Tween 80; and (h) MRS broth with pH adjusted to 2, 4, 6, 8, using the Listeria spp. strains (the other strains did not pro- 10, or 12. Incubation in all tests was at 37 °C for 24 h. Activity duce inhibition after pH correction) and were selected for levels of bacteriocins were determined as described before in further analysis. Based on RAPD-PCR performed with 18 the BIsolation of bacteriocin-producing strains^ section. Tests selected isolates, 10 presented unique profile and were select- were conducted in three independent repetitions. ed for further studies. From them, seven presented cocci and three rods morphology. Analysis of the 16s rRNA amplified Partial bacteriocin purification and determination fragments showed that isolates 54, 87, and 91 presented ho- of approximate molecular mass by SDS-PAGE mology with Enterococcus faecalis (Enterococcus faecalis 54, Enterococcus faecalis 87, and Enterococcus faecalis 91), Partial bacteriocin purification was performed according to isolates 56 and 127 with Lactobacillus plantarum (Lb. Martinez et al. (2013), with some modifications. Strains were plantarum 56 and Lb. plantarum 127), and isolate 70 with cultured in 1 L of MRS for 18 h at 37 °C and CFS then Lactobacillus rhamnosus (Lb. rhamnosus 70). Isolates 63, obtained by centrifugation for 15 min at 12000×g at 4 °C. 145, 146, and 147 presented homology with Pediococcus Proteins from the CFS were precipitated by 80% saturation pentosaceus (P. pentosaceus 63, P. pentosaceus 145, P. with ammonium sulfate at 4 °C (overnight), and the precipi- pentosaceus 146, and P. pentosaceus 147). Biochemical char- tate was then centrifuged for 60 min at 12,000 g at 4 °C. The acterization of the 10 selected strains was performed using pellets were resuspendend in 10 mL of 25 mM phosphate carbohydrate fermentation reactions and was recorded accord- buffer (pH 6.5), and antimicrobial activity against L. ing to the API50CHL® test. monocytogenes 104 was determined as described before. In Artisanal cheeses produced in Minas Gerais state the next step, the resulting material was loaded on an activated (Brazil) are considered to be a cultural heritage and are SepPakC18 column (Waters, Millipore, MA, USA) and dif- traditional products made with raw milk and serum col- ferent fractions were eluted using 20, 40, 60, and 80% lected from cheeses prepared the previous day (Lima et al. isopropanol in 25 mM phosphate buffer (pH 6.5). 2009). Lima et al. (2009)reportedon Lactococcus lactis, Antimicrobial activity of the obtained fractions was deter- Enterococcus spp., Enterococcus faecalis,and mined as described previously, using L. monocytogenes 104. Streptococcus agalactiae, isolated from Minas cheese. 388 Ann Microbiol (2018) 68:383–398 Another type of Brazilian cheese made with raw milk is Listeria innocua N27 (Albano et al. 2007). Another study the coalho cheese, a traditional product of the North-West reported higher activity (6400 AU/mL) for the previously region of Brazil. Different species of Lactobacillus spp. mentioned P. acidilactici HA-6111-2 under high pressure such as Lb. acidophilus, Lb.casei,Lb.fermentum,and Lb. (Castro et al. 2015). Cavicchioli et al. (2017)isolated rhamnosus and Lactococcus spp. such as Lc. lactis and Enterococcus hirae ST57ACC and P. pentosaceus Lc. raffinolactis were reported to be isolated from this ST65ACC from Minas cheese; these two bacteriocinogenic type of cheese (Neto et al. 2005). LAB belonging to the strains showed antimicrobial activity against 101 different genera Pediococcus have rarely been isolated from dairy strains of Listeria spp.,8 Enterococcus spp.,9 Lactobacillus products, generally being isolated from meat products. spp.,1 Leuconostoc spp.,2 Pediococcus spp.,and2 Nevertheless, there are some reports on the occurrence Streptococcus spp. In another study, P. pentosaceus FBBGl of Pediococcus spp. strains in Minas cheese in Brazil (ATCC 43200) presented antimicrobial activity of 3200 AU/ (Cavicchioli et al. 2017;Luizetal. 2017). Strains of P. mL (Piva and Headon 1994). Pediococcus strains isolated in acidilactici and P. pentosaceus, isolated from South this study presented activity of 51,200 AU/mL, recorded African farm-style cheese (pasteurized Gouda, young against L. monocytogenes 104. E. faecalis 54, E. faecalis 87, and matured; un-pasteurized aged Bouquet, aged and ma- and E. faecalis 91 showed activity of 3200 AU/mL, recorded tured Gouda), were also reported (Gurira and Buys 2005). against L. monocytogenes 104. Activity of E. faecium SD1, In another study, strains of P. acidilactici were isolated SD2, SD3, and SD4 strains, isolated from goat’s milk, was from traditional Colombian double-cream cheese (non- reported as 51,200 AU/mL for strains SD1 and SD2, matured acid cheese), prepared from a mixture of fresh 3200 AU/mL for SD3, and 800 AU/mL for SD4 (Schirru et and acidified cow milk. The process of milk acidification al. 2012). Casaburietal. (2016) described activity of of the Colombian cheese as well as maturation of Minas 6400 AU/mL for Lactobacillus curvatus 54 M16, isolated cheese occurs naturally as a result of native microbiota from traditional fermented sausages of Campania region containing LAB, which promotes the organoleptic, (Italy). In the present study, activities of 200, 800, and physico-chemical, and microbiological characteristics of 3200 AU/mL were reported for Lb. plantarum 56, Lb. the finished product (Londoño-Zapata et al. 2017). rhamnosus 70, and Lb. plantarum 127, respectively. Similar Table 2 shows the bioactivity of the 10 identified strains results of 800 AU/mL were reported for Lb. rhamnosus against Listeria monocytogenes 104 using the agar spot-test. EM253 (dos Santos et al. 2015) and less than 800 AU/mL The most active were the Pediococcus strains; Lactobacillus for Lb. plantarum HKN01 isolated from dairy products presented the lowest activity, while the Enterococcus present- (Sharafi et al. 2013). However, these levels of activity may ed intermediate activity. Similar results have been reported for be unreliable, since bacteriocin activity depends on the spec- these genera. Two strains of Pediococcus acidilactici HA- ificity of the expressed antibacterial protein and on the specific 6111-2 and HA-5692-3 were isolated from alheira and characteristics of the microorganisms investigated. The opti- showed 1600 AU/mL of antimicrobial activity against mal scenario would be if the same test microorganisms were used in all studies, which would facilitate comparison of the investigated bacteriocins. Table 2 Antimicrobial activity (AU/mL) of isolates recorded against L. Screening for the presence of bacteriocin genes monocytogenes 104 in total DNA Isolates AU/mL When total DNA was screened for presence of genes re- Enterococcus faecalis 54 3200 lated to bacteriocin production, positive results were only Lactobacillus plantarum 56 200 generated for the presence of pediocin PA-1 gene in DNA Pediococcus pentosaceus 63 51,200 obtained from P. pentosaceus 63, 145, 146, and 147 Lactobacillus rhamnosus 70 800 strains. There was no evidence of the presence of genes Enterococcus faecalis 87 3200 related to nisin, enterocin A, enterocin B, enterocin L50B, Enterococcus faecalis 91 3200 enterocin P, plantaricin NC8, plantaricin S, or plantaricin Lactobacillus plantarum 127 3200 W. Figure 1 shows the bands obtained with the Pediococcus pentosaceus 145 51,200 Pediococcus strains using the primer to amplify the gene Pediococcus pentosaceus 146 51,200 of PA-1 (1044 bp). Pediococcus pentosaceus 147 51,200 P. pentosaceus 63, P. pentosaceus 145, P. pentosaceus 146, and P. pentosaceus 147 harbor a 1044 bp fragment corre- All data represent an average of three repeats. The values recorded in sponding to that reported for pediocin PA-1 (Fig. 1). The size each experiment did not vary by more than 5%, and single data points are presented in the table without standard deviation of the obtained amplicon was consistent with that reported for Ann Microbiol (2018) 68:383–398 389 Fig. 1 Amplification of total DNA from Pediococcus strains using a primer of PA-1 gen. P63 P. pentosaceus 63, P145 P. pentosaceus 145, P146 P. pentosaceus 146, P147 P. pentosaceus 147 pediocin PA-1 by Marugg et al. (1992). Pediocin PA-1 bio- Effect of enzymes, temperature, pH, and surfactants synthesis involves a DNA fragment of approximately 3.5 kb on bacteriocin activity with the presence of four genes pedA, pedB, pedC, and pedD (Marugg et al. 1992). However, amplicon sequencing can All tests were performed with CFS from each strain in MRS confirm the fact that P. pentosaceus 63, P. pentosaceus 145, broth incubated at 37 °C for 24 h and pH was corrected P. pentosaceus 146, and P. pentosaceus 147 studied are pro- (pH 6.5) each time. Table 3 shows percentage reduction of ducers of pediocin PA-1. activity for each isolate. CFS from P. pentosaceus 63 lost at Table 3 Percentages of reduction of activity after different treatments P. pentosaceus 63 P. pentosaceus 145 P. pentosaceus 146 P. pentosaceus 147 Enzymes Proteinase K 53 95 95 94 Papain 95 95 50 50 Pepsin 53 63 95 94 Lipase 74 47 45 39 Catalase 37 42 50 39 α-Amylase 32 42 45 33 Chemicals NaCl 16 11 15 17 SDS 0 0 0 0 Tween 80 32 26 25 0 Triton X-100 11 11 0 0 Skim milk 21 21 25 22 pH 2 21 16 20 11 4 21 0 15 0 611 11 15 0 811 21 25 6 10 16 16 20 6 Temperatures 25 37 32 35 17 30 37 32 35 28 37 32 32 30 22 60 32 32 35 22 80 21 32 30 28 100 21 26 30 22 20 min at 121 °C 32 32 35 28 All data represent an average of three repeats. The values recorded in each experiment did not vary by more than 5%, and single data points are presented in the table without standard deviation 390 Ann Microbiol (2018) 68:383–398 least 50% of its activity by treatment with proteinase K, and Dicks (2005a, b) reported that pediocin ST18 produced by pepsin. Papain produced a reduction almost of the 100% and Pediococcus pentosaceus ST18, isolated from boza (a lipase 74%. An antimicrobial activity reduction of 95% of cereal-fermented non-alcoholic beverage from Bulgaria), CFS from P. pentosaceus 145 was produced by proteinase K was not sensitive to SDS, Tween 20, Tween80, urea, N- and papain, less reduction was obtained with pepsin (63%). lauroylsarcosine, or Triton X-100. The effect of different Lipase, catalase and α-amylase produced a reduction almost chemicals, pH, and temperature is dependent on the specific of the 50%. P. pentosaceus 146 and P. pentosaceus 147 lost structure and amino acid sequence of the bacteriocins studied. almost 100% of their activity with proteinase K and pepsin Moreover, these results may have a practical application in and the rest of the enzymes caused 50% or least reduction. The subsequent experiments, including in their planning, and in- effect of α-amylase was very low for all isolates. The CFS of vestigations of bacteriocin use in food biopreservation. each strain presented a small partial loss of activity at 25, 30, and 37 °C, remaining active after 1 h at 60, 80, and 100 °C, Adsorption on the cell surface of producer cells also with the treatment at 121 °C for 20 min. This heat toler- ance, characteristic of the bacteriocins, obeys to their small Secretion of the bacteriocins normally is performed via ABC size and makes them a good option as biopreservatives in transporter system or sec-dependent (Cintas et al. 2000; foods ((Karumathil et al. 2016;Parada etal. 2007). Similar Kumar et al. 2011). Yang et al. (1992) showed that some results have been reported by different authors (Todorov and bacteriocins can be secreted and then be adsorbed onto the Dicks 2005a;Albano etal. 2007; Murua et al. 2013; Seo et al. cell surface of the producer cells. This adsorption could be a 2014). Low pH, such as 2.0 and 4.0, had little effect on anti- result of some affinity or because of charge-specific interac- microbial activity, as did pH 8.0. Ghanbari et al. (2013)re- tion. High levels of adsorbed bacteriocins on the cell surface ported this tolerance to low pH with bacteriocins produced by of producer cells could be considered an opportunity to facil- Lb. casei AP8 and Lb. plantarum H5, isolated from the intes- itate the purification process of produced bacteriocins, and this tinal bacterial flora of beluga (Huso huso) and Persian stur- was applied by Yang et al. (1992). However, in the case of the geon (Acipenser persicus); inactivation at pH 10.0 was report- bacteriocins studied here, only low levels were found to be ed to be due to proteolytic degradation, protein aggregation, adsorbed on the surface of P. pentosaceus 63, P. pentosaceus and instability of proteins. 147, P. pentosaceus 146, and P. pentosaceus 147 (Fig. 2). This Treatment with Triton X-100, Tween 80, SDS, NaCl, or was found to be the case for most of the investigated bacte- skimmed milk had no significant effect on the antimicrobial riocins. For instance, similar results were reported for bacte- activity. Sharafi et al. (2013) reported the lack of effect of riocins produced by Lactococcus lactis subsp.lactis B14 iso- these treatments in bacteriocins from Lb. plantarum HKN01 lated from boza (Ivanova et al. 2000)and forbacteriocin isolated from Iranian traditional dairy products. Todorov and bacST8KF produced by L. plantarum ST8KF isolated from Fig. 2 Adsorption of the bacteriocins produced to the own surfaces of the studied strains of Pediococcus. Antimicrobial activity (AU/mL) of the isolates. Light gray column: recovered from cell surface (after desadsorption) and black column: in cell-free supernatant. Titles presented reduction along the de- velopment of the study. All data represent an average of three re- peats. The values recorded in each experiment did not vary by more than 5%, and single data points are presented in the figures with- out standard deviation bars Ann Microbiol (2018) 68:383–398 391 kefir (Powell et al. 2007). Two bacteriocins from Lb. curvatus presenting 25,600 AU/mL at 24 h and OD600 of 3.588 (Fig. and Lb. sakei, isolated from salpicao, a traditional fermented 3c). P. pentosaceus 147 reached maximum activity in the pork sausage produced in Portugal, also presented low levels middle of the exponential phase with OD600 of 1.13 and of bacteriocin adsorption onto the cell surface of producer continued until 24 h with OD600 of 3.58 (Fig. 3d). The re- cells (Todorov et al. 2013). sults are according to other studies that report optimal pro- duction on stationary phase, for example, of bacteriocins Growth dynamics and bacteriocin production EM485 and EM925 (produced by E. faecium EM485 and E. faecium EM925 isolated from Brazilian cheese) (dos Figure 3 shows the relationship between bacterial growth of Santos et al. 2014) and bacteriocins produced by E. faecium the selected strains and produced bacteriocin with activity ET05, ET12, and ET88 isolated from smoked salmon that were produced during stationary growth (Tomé et al. 2009). against L. monocytogenes 104 during a 24-h period of culture in MRS broth at 37 °C. P. pentosaceus 63 reached its station- Maximal production occurs during the stationary phase, ary phase at 15 h with OD600 of 4.82. Antimicrobial activity which suggests that bacteriocins are secondary metabolites, wasreportedearlyinthe exponentialgrowth phase (3h),with according to other studies (Albano et al. 2007). Another bacteriocin levels of 1600 AU/mL and at 6 h increased to study reported pediocin PD-1 production by P. damnosus 3200 AU/mL. Maximum activity was recorded after 9 h of NCFB 1832 during logarithmic phase (1600 AU/mL) and incubation (12,800 AU/mL) and remained stable until 24 h, an increment during the stationary phase (Nel et al. 2001). with an OD600 of 4.692 (Fig. 3a). Antimicrobial activity of P. acidilactici P9, isolated from pickles, started production at bacteriocin produced by P. pentosaceus 145 started during 8 h and, during the stationary phase (after 16 h of incubation), the exponential phase, with 1600 AU/mL and OD600 of reached maximum production, and remained constant until 0.298 at 3 h; maximum activity (25,600 AU/mL) was after 24 h of incubation (Wang et al. 2014). For strains of Lactobacillus spp., production was reported during the log- the beginning of the stationary phase after 12 h of incubation, with OD600 of 3.368; at 24 h, OD600 was 3.49 (Fig. 3b). arithmic phase of growth, as in the case of Lb. plantarum Similar dynamics were observed with P. pentosaceus 146, ST71KS, with maximum production (6400 AU/mL) during Fig. 3 Growth dynamics. a P. pentosaceus 63. b P. pentosaceus 145. c P. pentosaceus 146. d P. pentosaceus 147. Optical density (OD600) (filled diamond); pH (filled square). Bars represent antimicrobial activity (kAU/mL) (1 kAU/mL = 1000 AU/mL) 392 Ann Microbiol (2018) 68:383–398 the stationary phase (Martinez et al. 2013), similar results et al. 2017) and for L. casei AP8 isolated from sturgeon fish were reported for Lb. curvatus 54 M16 (Casaburi et al. 2016). against L. monocytogenes ATCC 19115 (Ghanbari et al. 2013). Growth of Listeria monocytogenes 104 in the presence of CFS Adsorption onto target cell Visualization of the effect of bacteriocin containing CFS on The aim of this test is to find how much bacteriocin was able actively growing L. monocytogenes 104 is presented in Fig. 4. to bind to the target cell surface comparing antimicrobial ac- After 3 h of incubation of L. monocytogenes 104, values of tivity before and after contact of CFS with target cells. OD600 reached an average of 0.64. The addition of bacterio- Bacteriocin adsorption is considered as first step for bacterio- cin containing CFS of P. pentosaceus 63, P. pentosaceus 145, cin mode of action. This information about potential efficacy P. pentosaceus 146, and P. pentosaceus 147 to the L. of the bacteriocin and its ability to bind on the surface is monocytogenes 104 actively growing in culture resulted in important for the technological applications of bacteriocins growth inhibition after 1 h (hour 4, Fig. 4)with P. pentosaceus exploration. CFS from Pediococcus strains were incubated 63 seeing almost no change of OD600 from 0.511 (hour 3) to with Lb. sakei and E. faecalis during 1 h on 5 mM phosphate 0.585 (hour 4), the same happened with P. pentosaceus 146 buffer, a short time and poor nutritional conditions that did not (OD600 from 0.574 to 0.594) and P. pentosaceus 147 (OD600 allow the target strains to produce bacteriocins to interfere from 0.749 to 0.620). P. pentosaceus 145 allowed initial with the test. Figure 5 shows the effect of different conditions growth of L. monocytogenes 104, and the values of OD600 on the adsorption of bacteriocins onto L. monocytogenes 104, were very close to the control (without CFS). However, 2 h E. faecalis ATCC 19443, and Lb. sakei ATCC 15521. Under after the addition of CFS, growth was limited and similar natural conditions (pH 6.5 and 25 °C), the highest adsorption OD600 values were observed in all cases and remained at this for P. pentosaceus 63, P. pentosaceus 145, P. pentosaceus 146, level. The control reached a maximum OD600 after 8 h of and P. pentosaceus 147 was with L. monocytogenes 104 (98.4, incubation (6.128); this decreased to 4.296 at the end of the 96.9, 96.9, and 98.4%, respectively). Adsorption onto E. test. The results suggest that CFS of isolates can inhibit grow- faecalis ATCC 19443 surface was 93.8% for all isolates, ex- ing cultures of L. monocytogenes 104. Similar results have cept P. pentosaceus 145 which presented a lower value been reported for P. pentosaceus ST65ACC against L. (87.5%). P. pentosaceus 63 showed 96.9% of adsorption to monocytogenes 211 and L. monocytogenes 422 (Cavicchioli Lb. sakei ATCC 15521, and P. pentosaceus 145 and P. pentosaceus 146 presented 93.8%. The lowest adsorption val- ue was for P. pentosaceus 147 with 70%. Very low influence of temperature over adsorption of bac- teriocins was observed in tests with L. monocytogenes 104. An increase in adsorption of P. pentosaceus 63 and P. pentosaceus 146 at 37 °C onto E. faecalis ATCC 19443 and a reduction at 4 °C were observed. For Lb. sakei ATCC 15521, P. pentosaceus 63, P. pentosaceus 145, and P. pentosaceus 146, the lowest adsorption was at 37 °C and 4 °C, and for P. pentosaceus 147, the lowest adsorption was at 25 °C. Low pH affected the adsorption of all isolates onto L. monocytogenes 104. The same effect occurred with E. faecalis ATCC 19443 and, at pH 10.0, adsorption also decreased. Adsorption onto Lb. sakei ATCC 15521 increased at low pH with P. pentosaceus 63 and P. pentosaceus 146 and decreased with P. pentosaceus 147. P. pentosaceus 146 had decreased adsorp- tion onto Lb. sakei ATCC 15521 at pH 8.0. Percentage of adsorption of all isolates decreased in the presence of Fig. 4 Growth kinetics of L. monocytogenes 104 on BHI with added CFS chemicals. SDS was the chemical that most affected adsorp- of the studied P. pentosaceus strains. Optical density (at 600 nm) measurements of the medium with the following: circle: P. pentosaceus tion onto target cells, especially onto L. monocytogenes 104. 63, diamond: P. pentosaceus 145, triangle: P. pentosaceus 146, square: P. Glycerol only affected adsorption onto L. monocytogenes 104. pentosaceus 147, and asterisk: control without CFS. All data represent an Adsorption onto E. faecium ATCC 19443 was affected by all average of three repeats. The values recorded in each experiment did not chemicals, except glycerol with P. pentosaceus 63 and P. vary by more than 5%, and single data points are presented in the figures without standard deviation bars pentosaceus 145. Ann Microbiol (2018) 68:383–398 393 Fig. 5 Percentage of adsorption of bacteriocins onto target cells under different treatments of the CFS. a L. monocytogenes 104. b E. faecalis ATCC 19443. c Lb. sakei ATCC 15521. □: P. pentosaceus 63, : P. pentosaceus 145; : P. pentosaceus 146, ≡: P. pentosaceus 147 It is important to note that different conditions common in P. pentosaceus 63 produced the maximum antimicrobial ac- the food industry can affect the ability of bacteriocins to bind tivity using dextrose and maltose as carbon sources (12,800 to the microorganism surface; nevertheless, the results report- and 25,600 AU/mL, respectively); with raffinose and manni- ed demonstrate the high affinity of bacteriocins for target cells tol, production was minimal. Antimicrobial activity of and indicate that bacteriocins have a potential use in industry 6400 AU/mL was obtained using peptone, meat extract, and for controlling growth of microorganisms because they yeast extract; in combination, these generated 128,000 AU/ showed that bacteriocins continue active. Other studies have mL. Without K HPO or with K HPO at more than 2 g/L, 2 4 2 4 also investigated the effect of pH, temperature, and chemical production decreased to 6400 AU/mL. The absence of agents and concluded that effect of temperature is minimal, MnSO or MnSO at more than 0.05 g/L also caused de- 4 4 similar to pH with values close to neutrality, and that creased bacteriocin activity by P. pentosaceus 63. The same chemicals may affect adsorption the most (Biscola et al. was observed with different concentrations of sodium acetate. 2013; Furtado et al. 2014). The absence of MgSO and glycerol had no effect, and bac- teriocin production was 12,800 AU/mL. High amounts of Effect of medium composition on the production Tween 80 had no effect on production, but its absence caused of bacteriocins a decrease. The absence of ammonium citrate had no effect on bacteriocin production, but a high amount increased produc- Table 4 shows the results of bacteriocin production, expressed tion. Extreme pH decreased the production of antimicrobial in arbitrary units per milliliter, with each modified MRS broth. compound by P. pentosaceus 63. 394 Ann Microbiol (2018) 68:383–398 Table 4 Antimicrobial activity (AU/mL) on different modified MRS Media UA/mL g/L P. pentosaceus 63 P. pentosaceus 145 P. pentosaceus 146 P. pentosaceus 147 Lactose 20.0 1600 1600 800 3200 Sucrose 20.0 1600 800 400 0 Mannitol 20.0 800 200 400 0 Dextrose 20.0 12,800 12,800 12,800 12,800 Fructose 20.0 6400 6400 12,800 6400 Maltose 20.0 25,600 12,800 12,800 12,800 Raffinose 20.0 400 400 200 0 Peptone 25.0 6400 6400 6400 3200 Meat extract 25.0 6400 6400 12,800 6400 Yeast extract 25.0 6400 6400 12,800 6400 Peptone 12.5 6400 6400 12,800 6400 Meat extract 12.5 Peptone 15.0 6400 6400 12,800 6400 Yeast extract 7.5 Meat extract 15.0 6400 12,800 6400 6400 Yeast extract 7.5 Peptone 10.0 12,800 12,800 12,800 12,800 Meat extract 10.0 Yeast extract 5.0 K HPO 0 6400 6400 6400 6400 2 4 2.0 12,800 12,800 12,800 12,800 5.0 6400 6400 6400 3200 10.0 6400 6400 3200 3200 MgSO 0 12,800 6400 6400 6400 0.1 6400 12,800 12,800 12,800 0.5 6400 6400 6400 6400 MnSO 0 6400 400 12,800 6400 0.05 12,800 12,800 12,800 12,800 0.2 6400 400 6400 6400 Sodium acetate 0 6400 400 6400 6400 5.0 6400 6400 3200 6400 10.0 6400 400 12,800 6400 Ammonium citrate 0 6400 400 6400 6400 2.0 6400 6400 12,800 12,800 5.0 12,800 400 6400 6400 Tween 80 0 3200 400 6400 1600 1.0 12,800 12,800 12,800 12,800 2.0 12,800 400 12,800 6400 5.0 12,800 400 12,800 6400 pH 2 400 400 800 200 4 6400 400 6400 6400 6 12,800 12,800 12,800 12,800 8 6400 400 6400 6400 10 3200 400 3200 3200 12 0 000 Glycerol 0 12,800 25,600 6400 12,800 0.5 6400 12,800 6400 12,800 1.0 6400 12,800 6400 6400 2.0 6400 6400 6400 6400 5.0 6400 6400 6400 6400 10.0 6400 6400 6400 3200 All data represent an average of three repeats. The values recorded in each experiment did not vary by more than 5%, and single data points are presented in the table without standard deviation P. pentosaceus 145 also produced the maximum of antimi- amount of K HPO and MnSO had no effect on production 2 4 4 crobial activity (12,800 AU/mL) using dextrose and maltose and changes in sodium acetate, ammonium citrate, and Tween as carbon source. Maximum production (12,800 AU/mL) was 80 decreased production. Only pH 6.0 of the range of pH obtained with a mixture of yeast (15 g/L) and meat extract values tested registered antimicrobial activity (6400 AU/ (7.5 g/L) or a mixture of peptone (10 g/L), meat extract mL). The absence of glycerol increased production. P. (10 g/L), and yeast extract (5 g/L) as nitrogen sources. The pentosaceus 146, in addition to a preference for dextrose and Ann Microbiol (2018) 68:383–398 395 maltose, exhibited antimicrobial activity of 12,800 AU/mL K HPO (0.2 g/L of each) (Mandal et al. 2008). Suganthi 2 4 with fructose as the carbon source. The use of peptone alone and Mohanasrinivasan (2015) used a process of optimization or meat and yeast mixture caused decrease in production until to obtain maximal production (25,600 AU/mL) of the bacte- (6400 AU/mL). Increasing amounts of K HPO or absence of riocin from P. pentosaceus KC692718, isolated from mixed 2 4 K HPO caused decrease in antimicrobial activity; similar ef- vegetable pickles (India), using sucrose (24 g/L) as a carbon 2 4 fectsoccurredwith0.05g/mLofMgSO or its absence. source and soyatone (10.3 g/L) as a nitrogen source. Kaur et MnSO in 0.05 g/L favored bacteriocin production and the al. (2013) enhanced pediocin BA28 production by P. opposite occurred with sodium acetate. The absence of acidilactici using peptone (10 g/L), beef extract (10 g/L), meat Tween 80 decreased antimicrobial activity and the same oc- extract (10 g/L), tryptone (10 g/L), KH2PO4 (2 g/L), potassi- curred with extreme pH (2.0 or 12). P. pentosaceus 147 had no um sodium tartrate (2 g/L), dextrose (50 g/L), and Tween 80 activity when sucrose, mannitol, or raffinose was used as the 0.1 g/L. carbon source, and a mixture of peptone (10 g/L), meat extract (10 g/L), and yeast extract (5 g/L) generated maximum activ- Partial bacteriocin purification and determination ity. The absence of K HPO or ammonium citrate or more of approximate molecular mass by SDS-PAGE 2 4 than 2 g/L of each of these chemicals caused decreased anti- microbial activity; the same occurred without MgSO or with Precipitation with 80% ammonium sulfate saturation was suc- MgSO at more than 1 g/L and without MnSO or with cessful in obtaining all antimicrobial proteins produced by the 4 4 MnSO at more than 0.05 g/L. Different amounts of sodium investigated strains. However, when proteins were separated acetate generated the same activity (6400 AU/mL). Less or using SepPack chromatography, almost all fractions presented more than 1 g/mL of Tween 80 added to the broth caused a activity against L. monocytogenes 104. Nevertheless, the most decrease in activity, as well as extreme pH values. active of the isopropanol-eluted fractions was with 60% In all cases, extremely, pH limited bacterial growth gener- isopropanol presenting activities of 25,600, 12,800, 5600, ating very low or no antimicrobial activity. Similar results and 25,600 AU/mL, respectively, for P. pentosaceus 63, P. have been reported in a study of optimization of bacteriocin pentosaceus 145, P. pentosaceus 146, and P. pentosaceus ST22Ch production by Lb. sakei isolated from salpicao in 147. Miteva et al. (1998) reported a difference with this study which glucose, as the carbon source, was found to promote with activity of 50% fractions obtained with a strain of production of the antimicrobial substance. The same study Lactobacillus spp. 1043 against Gram-positive and Gram- reported that a combination of different sources of nitrogen negative indicator strains. (meat and yeast extract or tryptone and meat extract) stimulat- The results presented in Fig. 6, representing the Tricine- ed production. The same happened with high concentrations SDS-PAGE gel, indicate that the approximate molecular of MgSO and Tween 80. The absence of MgSO decreased weight of the bacteriocins studied was between 3.5 and 4 4 production, and the presence of glycerol had no effect 6.5 kDa. The antimicrobial activity was confirmed by inhibi- (Todorov et al. 2012). Another study reported that optimal tion zones against both L. monocytogenes 104 in the same production of P. acidilactici LAB5 isolated from a fermented place as the proteins bands. Similar weights of peptides were meat product was obtained with a mixture of tryptone, yeast reported for bacteriocin PA-1 produced by P. pentosaceus extract as a nitrogen source, glucose as a carbon source, and a NCDC 273 (Vijay Simha et al. 2012); for pediocin ST71KS buffer composed of sodium citrate, sodium acetate, and produced by Lb. plantarum ST71KS, isolated from Fig. 6 Separation of the proteins obtained after precipitation by ammonium sulfate and separation by SepPack and subjected to SDS-PAGE electrophoresis. Stained electrophoresis gel (left) and inhibition zone observed using L. monocytogenes 104 as indicator strain with the non- stained electrophoresis gel (right) 396 Ann Microbiol (2018) 68:383–398 sausage traditionally produced in Portugal. Int J Food Microbiol homemade goat feta cheese (Martinez et al. 2013); for 116:239–247. https://doi.org/10.1016/j.ijfoodmicro.2007.01.011 pediocin ST44AM produced by P. pentosaceus ST44AM Ammor S, Tauveron G, Dufour E, Chevallier I (2006) Antibacterial ac- (Todorov and Dicks 2009); and for bacteriocins BacHA- tivity of lactic acid bacteria against spoilage and pathogenic bacteria 6111-2 and bacHA-5692-3 produced by strains of P. isolated from the same meat small-scale facility: 1—screening and characterization of the antibacterial compounds. Food Control 17: acidilactici (Albano et al. 2007). 454–461. https://doi.org/10.1016/j.foodcont.2005.02.006 Anastasiadou S, Papagianni M, Filiousis G, Ambrosiadis I, Koidis P (2008) Pediocin SA-1, an antimicrobial peptide from Pediococcus acidilactici NRRL B5627: production conditions, purification and Conclusions characterization. Bioresour Technol 99:5384–5390. https://doi.org/ 10.1016/j.biortech.2007.11.015 LAB isolated from dairy products are a good alternative for Biscola V, Todorov SD, Capuano VSC, Abriouel H, Gálvez A, Franco obtaining antimicrobial substances such as bacteriocins. LAB BDGM (2013) Isolation and characterization of a nisin-like bacteri- that occur naturally in dairy products generally belong to spe- ocin produced by a Lactococcus lactis strain isolated from charqui, a Brazilian fermented, salted and dried meat product. Meat Sci 93: cies with well-proven GRAS status. However, additional re- 607–613. https://doi.org/10.1016/j.meatsci.2012.11.021 search is required to confirm safety aspects of isolated LAB in Casaburi A, Di Martino V, Ferranti P, Picariello L, Villani F (2016) order to recommend their application or their expressed bac- Technological properties and bacteriocins production by teriocins as non-hazardous agents in food production. Lactobacillus curvatus 54M16 and its use as starter culture for fermented sausage manufacture. Food Control 59:31–45. https:// Although bacteriocins are recognized to be non-toxic protein- doi.org/10.1016/j.foodcont.2015.05.016 aceous molecules, their safety needs to be carefully examined Castro SM, Kolomeytseva M, Casquete R, Silva J, Saraiva JA, Teixeira P prior to their use as food additives or therapeutic agents. (2015) Effect of high pressure on growth and bacteriocin production Biochemical characteristics of bacteriocins allow better design of Pediococcus acidilactici HA-6111-2. High Pressure Res 35:405– 418. https://doi.org/10.1080/08957959.2015.1101095 for their possible application in the food industry. Pediocins Cavicchioli VQ, Camargo AC, Todorov SD, Nero LA (2017) Novel have been reported to be a good option for food biopreserva- bacteriocinogenic Enterococcus hirae and Pediococcus pentosaceus tion, instead of conventional treatments used to preserve food strains with antilisterial activity isolated from Brazilian artisanal products (Papagianni and Anastasiadou 2009). In our study, cheese. J Dairy Sci 100:2526–2535. https://doi.org/10.3168/jds. strains isolated from Minas cheese presented remarkable anti- 2016-12049 Cintas LM, Casaus P, Herranz C, Håvarstein LS, Holo H, Hernández PE, microbial activity against three L. monocytogenes strains from Nes IF (2000) Biochemical and genetic evidence that Enterococcus different serological groups. Based on the specific character- faecium L50 produces enterocins L50A and L50B, the sec- istics of the bacteriocins studied, produced by four P. dependent enterocin p, and a novel bacteriocin secreted without an pentosaceus strains, it is necessary to be conducted a future N-terminal extension termed enterocin Q. J Bacteriol 182:6806– 6814. https://doi.org/10.1128/JB.182.23.6806-6814.2000 research in order to explore the possibilities of the application Cytryńska M, Zdybicka-Barabas A, Jabłoński P, Jakubowicz T (2001) of the strains as protector cultures or the expressed bacterio- Detection of antibacterial polypeptide activity in situ after sodium cins in the control of food spoilage in fermented food dodecyl sulfate–polyacrylamide gel electrophoresis. Anal Biochem products. 299:274–276. https://doi.org/10.1006/abio.2001.5422 dos Santos KMO et al (2015) Artisanal Coalho cheeses as source of Acknowledgments The authors would like to thank Colciencias beneficial Lactobacillus plantarum and Lactobacillus rhamnosus (Departamento Administrativo de Ciencia, Tecnología e Innovación— strains. Dairy Sci Technol 95:209–230. https://doi.org/10.1007/ Colombia), Coordenação de Aperfeiçoamento de Pessoal de Nível s13594-014-0201-6 Superior (CAPES—Brazil), and the Conselho Nacional de dos Santos KMO et al (2014) Brazilian artisanal cheeses as a source of Desenvolvimento Científico e Tecnológico (CNPq—Brazil). beneficial Enterococcus faecium strains: characterization of the bacteriocinogenic potential. Ann Microbiol 64:1463–1471. https:// doi.org/10.1007/s13213-013-0789-4 Compliance with ethical standards du Toit M, Franz CM, Dicks LM, Holzapfel WH (2000) Preliminary characterization of bacteriocins produced by Enterococcus faecium Conflict of interest The authors declare that they have no conflict of and Enterococcus faecalis isolated from pig faeces. J Appl Microbiol interest. 88:482–494 Felske A, Rheims H, Wolterink A, Stackebrandt E, Akkermans ADL (1997) Ribosome analysis reveals prominent activity of an uncul- tured member of the class Actinobacteria in grassland soils. References Microbiology 143:2983–2989. https://doi.org/10.1099/00221287- 143-9-2983 Abbasiliasi S, Tan JS, Tengku Ibrahim TA, Bashokouh F, Ramakrishnan Freitas R, Brito MA, Nero LA, de Carvalho AF (2013) Microbiological NR, Mustafa S, Ariff AB (2017) Fermentation factors influencing safety of Minas Frescal Cheese (MFC) and tracking the contamina- the production of bacteriocins by lactic acid bacteria: a review. RSC tion of Escherichia coli and Staphylococcus aureus in MFC process- Adv 7:29395–29420. https://doi.org/10.1039/c6ra24579j ing. Foodborne Pathog Dis 10(11):951–955. https://doi.org/10. 1089/fpd.2013.1525 Albano H, Todorov SD, van Reenen CA, Hogg T, Dicks LMT, Teixeira P (2007) Characterization of two bacteriocins produced by Furtado DN, Todorov SD, Landgraf M, Destro MT, Franco BDGM (2014) Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi Pediococcus acidilactici isolated from BAlheira^, a fermented Ann Microbiol (2018) 68:383–398 397 isolated from goat milk: characterization of the bacteriocin. Braz J Martinez RCR, Wachsman M, Torres NI, LeBlanc JG, Todorov SD, Microbiol 45:1541–1550 Franco BDGM (2013) Biochemical, antimicrobial and molecular characterization of a noncytotoxic bacteriocin produced by Ghanbari M, Jami M, Kneifel W, Domig KJ (2013) Antimicrobial activity Lactobacillus plantarum ST71KS. Food Microbiol 34:376–381. and partial characterization of bacteriocins produced by lactobacilli https://doi.org/10.1016/j.fm.2013.01.011 isolated from sturgeon fish. Food Control 32:379–385. https://doi. org/10.1016/j.foodcont.2012.12.024 Martins JM, Galinari É, Pimentel-Filho NJ, Ribeiro Jr JI, Furtado MM, Ferreira CLLF (2015) Determining the minimum ripening time of Gurira OZ, Buys EM (2005) Characterization and antimicrobial activity artisanal Minas cheese, a traditional Brazilian cheese. Braz J of Pediococcus species isolated from South African farm-style Microbiol 46:219–230 cheese. Food Microbiol 22:159–168. https://doi.org/10.1016/j.fm. 2004.08.001 Marugg JD et al (1992) Cloning, expression, and nucleotide sequence of Holo H, Jeknic Z, Daeschel M, Stevanovic S, Nes IF (2001) Plantaricin genes involved in production of pediocin PA-1, and bacteriocin from W from Lactobacillus plantarum belongs to a new family of two- Pediococcus acidilactici PAC1.0. Appl Environ Microbiol 58:2360– peptide lantibiotics. Microbiology 147:643–651 2367 Miteva V et al (1998) Detection and characterization of a novel antibac- Ivanova I, Kabadjova P, Pantev A, Danova S, Dousset X (2000) terial substance produced by a Lactobacillus delbrueckii strain 1043. Detection, purification and partial characterization of a novel bacte- J Appl Microbiol 85:603–614. https://doi.org/10.1046/j.1365-2672. riocin substance produced by Lactococcus lactis subsp. lactis B14 1998.853568.x isolated from boza-Bulgarian traditional cereal beverage. Biocatalysis 41:47–53 Moraes PM, Vicosa GN, Yamazi AK, Ortolani MB, Nero LA (2009) Foodborne pathogens and microbiological characteristics of raw Kaur B, Garg N, Sachdev A (2013) Optimization of bacteriocin produc- milk soft cheese produced and on retail sale in Brazil. Foodborne tion in Pediococcus acidilactici BA28 using response surface meth- Pathog Dis 6(2):245–249. https://doi.org/10.1089/fpd.2008.0156 odology. Asian J Pharm Clin Res 6:192–195 Murua A, Todorov SD, Vieira ADS, Martinez RCR, Cencič A, Franco Karumathil, D. P., Upadhyay, A., & Venkitanarayanan, K. (2016). BDGM (2013) Isolation and identification of bacteriocinogenic Chapter 19—antimicrobial packaging for poultry A2—Barros- strain of Lactobacillus plantarum with potential beneficial properties Velázquez, Jorge. Antimicrobial food packaging (pp. 257–268). from donkey milk. J Appl Microbiol 114:1793–1809 San Diego: Academic Press Nel HA, Bauer R, Vandamme EJ, Dicks LMT (2001) Growth optimiza- Khan H, Flint S, Yu P-L (2010) Enterocins in food preservation. Int J tion of Pediococcus damnosus NCFB 1832 and the influence of pH Food Microbiol 141:1–10. https://doi.org/10.1016/j.ijfoodmicro. and nutrients on the production of pediocin PD-1. J Appl Microbiol 2010.03.005 91:1131–1138. https://doi.org/10.1046/j.1365-2672.2001.01486.x Kruger MF, MdS B, Miranda A, Landgraf M, Destro MT, Todorov SD, Gombossy de Melo Franco BD (2013) Isolation of Neto LGG, Souza MR, Nunes AC, Nicoli JR, Santos WLM (2005) Antimicrobial activity of lactic acid bacteria isolated from artisanal bacteriocinogenic strain of Lactococcus lactis subsp. lactis from rocket salad (Eruca sativa Mill.) and evidences of production of a and industrial Bcoalho^ cheese against indicator microorganisms variant of nisin with modification in the leader-peptide. Food Arquivo Brasileiro de Medicina. Vet Zootec 57:245–250 Control 33:467–476. https://doi.org/10.1016/j.foodcont.2013.03. Papagianni M, Anastasiadou S (2009) Pediocins: the bacteriocins of 043 Pediococci. Sources, production, properties and applications. Microb Cell Factories 8:3–3. https://doi.org/10.1186/1475-2859-8-3 Kumar B, Balgir PP, Kaur B, Garg N (2011) Cloning and expression of bacteriocins of Pediococcus spp.: a review. Arch Clin Microbiol 2. Parada JL, Caron CR, Medeiros ABP, Soccol CR (2007) Bacteriocins https://doi.org/10.3823/231 from lactic acid bacteria: purification, properties and use as biopreservatives. Braz Arch Biol Technol 50:512–542 Laemmli UK (1970) Cleavage of structural proteins during the assembly Perin LM, Dal Bello B, Belviso S, Zeppa G, Carvalho AFD, Cocolin L, of the head of bacteriophage T4. Nature 227:680–685 Nero LA (2015) Microbiota of Minas cheese as influenced by the Lima CDLC, Lima LA, Cerqueira MMOP, Ferreira EG, Rosa CA (2009) nisin producer Lactococcus lactis subsp. lactis GLc05. Int J Food Lactic acid bacteria and yeasts associated with the artisanal Minas Microbiol 214:159–167. https://doi.org/10.1016/j.ijfoodmicro. cheese produced in the region of Serra do Salitre, Minas Gerais 2015.08.006 Arquivo Brasileiro de Medicina. Vet Zootec 61:266–272. https:// doi.org/10.1590/S0102-09352009000100037 Piva A, Headon DR (1994) Pediocin A, a bacteriocin produced by Pediococcus pentosaceus FBB61. Microbiology 140:697–702 Londoño-Zapata AF, Durango-Zuleta MM, Sepúlveda-Valencia JU, Moreno Herrera CX (2017) Characterization of lactic acid bacterial Powell JE, Witthuhn RC, Todorov SD, Dicks LMT (2007) Characterization of bacteriocin ST8KF produced by a kefir isolate communities associated with a traditional Colombian cheese: double Lactobacillus plantarum ST8KF. Int Dairy J 17:190–198. https://doi. cream cheese. LWT Food Sci Technol 82:39–48. https://doi.org/10. 1016/j.lwt.2017.03.058 org/10.1016/j.idairyj.2006.02.012 Schagger H (2006) Tricine-SDS-PAGE. Nat Protoc 1:16–22 Luiz LMP, Castro RD, Sandes SHC, Silva JG, Oliveira LG, Sales GA, Souza MR (2017) Isolation and identification of lactic acid bacteria Schirru S et al (2012) Sardinian goat’s milk as source of bacteriocinogenic from Brazilian Minas artisanal cheese. CyTA—J Food 15(1):125– potential protective cultures. Food Control 25:309–320. https://doi. 128. https://doi.org/10.1080/19476337.2016.1219392 org/10.1016/j.foodcont.2011.10.060 Maldonado A, Ruiz-Barba JL, Jiménez-Díaz R (2003) Purification and Seo S-H, Jung M, Kim WJ (2014) Antilisterial and amylase-sensitive genetic characterization of plantaricin NC8, a novel coculture- bacteriocin producing Enterococcus faecium SH01 from inducible two-peptide Bacteriocin from lactobacillus plantarum Mukeunji, a Korean over-ripened kimchi. Food Sci Biotechnol 23: NC8. Appl Environ Microbiol 69:383–389. https://doi.org/10. 1177–1184. https://doi.org/10.1007/s10068-014-0161-x 1128/aem.69.1.383-389.2003 Sharafi H et al (2013) Antibacterial activity and probiotic potential of Malheiros PS, Sant Anna V, Todorov SD, Franco BDGM (2015) Lactobacillus plantarum HKN01: a new insight into the morpholog- Optimization of growth and bacteriocin production by ical changes of antibacterial compound-treated Escherichia coli by Lactobacillus sakei subsp. sakei2a. Braz J Microbiol 46:825–834 electron microscopy. J Microbiol Biotechnol 23:225–236. https:// doi.org/10.4014/jmb.1208.08005 Mandal V, Sen SK, Mandal NC (2008) Optimized culture conditions for bacteriocin production by Pediococcus acidilactici LAB 5 and its Stephens SK et al (1998) Molecular analysis of the locus responsible for haracterization. Indian J Biochem Biophys 45:106–110 production of plantaricin S, a two-peptide bacteriocin produced 398 Ann Microbiol (2018) 68:383–398 byLactobacillus plantarum LPCO10. Appl Environ Microbiol 64: Todorov SD, Vaz-Velho M, de Melo Franco BDG, Holzapfel WH (2013) Partial characterization of bacteriocins produced by three strains of 1871–1877 Suganthi V, Mohanasrinivasan V (2015) Optimization studies for en- Lactobacillus sakei, isolated from salpicao, a fermented meat prod- hanced bacteriocin production by Pediococcus pentosaceus uct from north-west of Portugal. Food Control 30:111–121. https:// KC692718 using response surface methodology. J Food Sci doi.org/10.1016/j.foodcont.2012.07.022 Technol 52:3773–3783. https://doi.org/10.1007/s13197-014-1440-5 Todorov SD et al (2010) Characterisation of an antiviral pediocin-like Todorov SD, Dicks LM (2009) Bacteriocin production by Pediococcus bacteriocin produced by Enterococcus faecium. Food Microbiol pentosaceus isolated from marula (Scerocarya birrea). Int J Food 27:869–879. https://doi.org/10.1016/j.fm.2010.05.001 Microbiol 132:117–126. https://doi.org/10.1016/j.ijfoodmicro. Tomé E, Todorov SD, Gibbs PA, Teixeira PC (2009) Partial characteri- 2009.04.010 zation of nine bacteriocins produced by lactic acid bacteria isolated Todorov SD, Dicks LMT (2005a) Lactobacillus plantarum isolated from from cold-smoked salmon with activity against listeria molasses produces bacteriocins active against Gram-negative bacte- monocytogenes. Food Biotechnol 23:50–73. https://doi.org/10. ria. Enzym Microb Technol 36:318–326 1080/08905430802671956 Todorov SD, Dicks LMT (2005b) Pediocin ST18, an anti-listerial bacte- Udhayashree N, Senbagam D, Senthilkumar B, Nithya K, Gurusamy R riocin produced by Pediococcus pentosaceus ST18 isolated from (2012) Production of bacteriocin and their application in food prod- boza, a traditional cereal beverage from Bulgaria. Process ucts. Asian Pac J Trop Biomed 2:S406–S410 Biochem 40:365–370. https://doi.org/10.1016/j.procbio.2004.01. Vijay Simha B, Sood SK, Kumariya R, Garsa AK (2012) Simple and 011 rapid purification of pediocin PA-1 from Pediococcus pentosaceous Todorov SD, Holzapfel W, Nero LA (2016) Characterization of a novel NCDC 273 suitable for industrial application. Microbiol Res 167: bacteriocin produced by Lactobacillus plantarum ST8SH and some 544–549. https://doi.org/10.1016/j.micres.2012.01.001 aspects of its mode of action. Ann Microbiol 66:949–962. https:// Wang G et al (2014) Partial characterisation of an anti-listeria substance doi.org/10.1007/s13213-015-1180-4 produced by Pediococcus acidilactici P9. Int Dairy J 34:275–279. Todorov SD, Oliveira RP, Vaz-Velho M (2012) Media optimization of https://doi.org/10.1016/j.idairyj.2013.08.005 Bacteriocin ST22CH production by Lactobacillus sakei ST22CH Yang R, Johnson MC, Ray B (1992) Novel method to extract large isolated from salpicão, traditional meat-product from Portugal. amounts of bacteriocins from lactic acid bacteria. Appl Environ Chem Eng Trans 2:283–288 Microbiol 58:3355–3359
Annals of Microbiology – Springer Journals
Published: May 18, 2018
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.