Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Application of tylosin antibiotics to olive flounder (Paralichthys olivaceus) infected with Streptococcus parauberis

Application of tylosin antibiotics to olive flounder (Paralichthys olivaceus) infected with... Background: Olive flounder, Paralichthys olivaceus, is an economically important aquaculture species in Korea. Olive flounders have been heavily damaged by streptococcal infections every year and are treated with antibiotics. However, antibiotic abuse is causing the emergence of resistant strains, and to overcome this, research has shown that new antibiotics must be applied. Tylosin is a relatively safe antibiotic and has good activity against Gram- positive bacteria and mycoplasma. We studied the therapeutic effects and side effects of tylosin on Streptococcus parauberis-infected olive flounder. Methods: After artificial infection of olive flounder with S. parauberis SPOF18J3, an appropriate dose of tylosin was confirmed by intramuscular injection (I.M.) at 2.5, 5, 10, and 15 mg/kg, and oral administration at 10 and 20 mg/kg. After I.M. and oral administration dosing of tylosin, side effects were confirmed by serological analysis, histopathological analysis, and median lethal dose (LD ) analysis at both an appropriate concentration and a high concentration. Statistical analysis was performed using one-way analysis of variance (ANOVA) and Tukey’s test (p <0.05). Results: The appropriate I.M. and oral administration concentration of tylosin administered to olive flounder infected with S. parauberis SPOF18J3 was found to be 10 mg/kg. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were showed not significantly different between the control group and the experimental groups. The histopathologic results showed mild inflammatory responses in muscle and tubular vacuolization and tubular atrophy appeared, but there were no significant differences between the groups. The LD was confirmed to be 461 mg/kg. Conclusion: In this study, an effective treatment method was provided by verifying the treatment effects and side effects of tylosin in olive flounder infected with S. parauberis, which can be applied directly to aquaculture sites. In addition, these results may be used as a reference for evaluation required upon request to obtain approval for tylosin antibiotics as fishery antibiotics in Korea. After approval, it is possible that a fishery disease manager will be able to prescribe and sell the antibiotic tylosin. Keywords: Tylosin, Olive flounder, Streptococcus parauberis, Treatment effects, Side effects * Correspondence: vinus96@hanmail.net Institute of Marine Industry, College of Marine Science, Gyeongsang National University, 455, Tongyeong 650-160, Republic of Korea Full list of author information is available at the end of the article © The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 2 of 18 Background Table 1 Specific primer for S. parauberis detection The olive flounder Paralichthys olivaceus is an econom- Primer Sequences (5′ → 3′) Target gene Product size (bp) ically important aquaculture species in Korea. The Ko- Spa2152 TTTCGTCTGAGGCAATGTTG 23 s rRNA 718 bp rean Statistical Information Service (KOSIS) suggested Spa2870 GCTTCATATATCGCTATACT that in the first half of 2019, olive flounder production was 25,016 M/T, which is 58.1% of the total fish aqua- culture production of South Korea. However, various diseases occur in olive flounder every year, causing large economic damages. has been increasing. To solve this problem, applying In 2011, 13.57% of the total mortality of olive new antibiotics is necessary, and research on the veterin- flounder was found to be caused by streptococcal in- ary medicines that have good effects on fish disease bac- fection in 70 olive flounder farms in South Korea teria is also required. (Kim et al. 2012). From May to October 2012, 12.8% Tylosin, a macrolide antibiotic, was commercialized of the mortality in the whole Korean inland olive in 1962 from the soil microorganism Streptomyces flounder aquafarm was caused by streptococcal infec- fradiae, and more than 1800 t are produced per year tion (Jee et al. 2014). In addition, by analyzing the worldwide (JECFA 2009). Tylosin is known to have causes of mortality in olive flounder aquafarms in strong antimicrobial activity against Gram-positive Jeonnam and Jeju, the rates of mortality caused by bacteria and mycoplasma (Prescott and Baggot 1988), streptococcal infection were 9.76% in 2015, 7% in and antibiotics based on tylosin are used in various 2016, and 2% in 2017 (Shim et al. 2019). livestock that show symptoms such as mycoplasma Streptococcal-infected olive flounders have symptoms disease, porcine proliferative enteropathy, and swine such as hemorrhagic septicaemia, exophthalmia, men- dysentery (Gingerich et al., 1997). However, tylosin is ingitis with abnormal swimming, and ascites (Mishra only used in livestock, and there are no studies on et al. 2018). In order to treat streptococcal disease, the effects and side effects in fish. various fishery antibiotics are being used at aquacul- In order to apply tylosin-based antibiotics in fisher- ture sites (Kim et al. 2014). ies, studies on the appropriate concentrations, However, the abuse of previously used fishery antibi- methods, and safety to the fish are necessary. There- otics has had negative impacts on the safety of aquatic fore, in this study, we investigated the therapeutic ef- products and fish (Katz and Brady 2000) and has caused fects and side effects of tylosin on Streptococcus the emergence of resistant strains (Smith et al. 1994). parauberis-infected olive flounder, and these results With the emergence of resistant strains, illegal use of could be used as basic data for applying tylosin-based veterinary medicines that are prohibited for use in fish antibiotics in fisheries. Fig. 1 Determination of cumulative mortality from each concentration of tylosin I.M. injection against olive flounder infected with S. parauberis SPOF18J3 Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 3 of 18 Table 2 The cumulative mortality, infection rate, and relative survival rate of therapeutic studies in S. parauberis SPOF18J3-infected olive flounder by tylosin I.M. injection Group Con (−) Con (+) 2.5 mg/kg 5 mg/kg 10 mg/kg 15 mg/kg Cumulative mortality (%) 0 (0/7) 100 (7/7) 29 (6/21) 33 (7/21) 10 (2/21) 10 (2/21) Relative survival rate (%) 100 – 71 67 90 90 Infection rate (%) in survival fish 0 (0/7) – 73 (11/15) 71 (10/14) 5 (1/19) 11 (2/19) Materials and methods with 1% NaCl. Pure colonies were used after passage for Fish 24 h in BHI broth. In addition, in order to identify the We purchased olive flounder from a farm in Geoje, strain, the species was identified through polymerase chain Gyeongsangnam-do, with a mean length of 14.5 ± 1.2 reaction (PCR) using a primer (Mata et al. 2004) specific cm and a mean body weight of 47 g ± 8.5 g. The fish for the 23S rRNA sequence of streptococci (Table 1). The TM were maintained in seawater tanks with a flow rate of amplifications were carried out in a T-100 Thermal Cy- approximately 2 L/min for 2 weeks at 23–26 °C. cler (Bio-Rad) with the following parameters: an initial de- naturation step of 94 °C for 2 min; 25 serial cycles of a Tylosin antibiotics denaturation step of 92 °C for 1 min, annealing at 55°C for Tylosin inj. 200 (SF Co., Ltd., Korea) was used for intra- 1 min, and extension at 72 °C for 90 s; and a final exten- muscular injection (I.M.), and Ty-gold (Daehan New sion step of 72 °C for 5 min. The identified streptococci Pharm Co., Ltd., Korea) was used for oral administration. were used for infection, and the strains isolated during the experiment were also identified to confirm the species. Strain The S. parauberis SPOF18J3 strain isolated from olive Investigation of the efficacy of tylosin I.M. flounder in Seogwipo, Jeju, Korea, was purchased from The efficacy of tylosin I.M. against S. parauberis-infected Fish Disease Prevention Lab in Pukyong National Univer- olive flounder was confirmed. The S. parauberis sity. The strain was incubated for 24 h at 27 °C using brain SPOF18J3 strain was suspended in phosphate-buffered heart infusion agar (BHIA; Difco, USA) supplemented saline (PBS) at a concentration of 1 × 10 CFU/mL and Fig. 2 Determination of cumulative mortality from each concentration of tylosin oral administration against olive flounder infected with S. parauberis SPOF18J3 Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 4 of 18 Table 3 The cumulative mortality, infection rate, and relative survival rate of therapeutic studies in S. parauberis SPOF18J3-infected olive flounder by tylosin O.A. Group Con (−) Con (+) 2.5 mg/kg 5 mg/kg Cumulative mortality (%) 0 (0/10) 70 (7/10) 0 (0/30) 0 (0/30) Relative survival rate (%) 100 30 100 100 Infection rate (%) in survival fish 0 (0/10) 100 (3/3) 0 (0/30) 7 (2/30) artificially infected by subcutaneously injection of 100 μL The water temperature was maintained at 25 °C, and the to the base of the dorsal fin of the olive flounders. mortality rate was observed for 14 days. The surviving Twenty-four hours after artificial infection, tylosin was fish on the 15th day were anesthetized with benzocaine suspended in PBS and diluted to concentrations of 2.5, and sacrificed to investigate the infection rate through 5, 10, and 15 mg/kg per 100 μL, and administered by the kidneys and spleen. I.M. to olive flounders. Fish in the negative control group were injected with the same volume of PBS in- Investigation of the efficacy of tylosin oral administration stead of the strain and tylosin. Fish in the positive con- The efficacy of tylosin oral administration against S. trol group were administered PBS I.M. instead of tylosin parauberis-infected olive flounder was confirmed. Fish after artificial infection. There were 7 fish in each group, were artificially infected in the same way as described in and the experimental groups were tested in 3 replicates. the analysis of the efficacy of I.M. tylosin. Twenty-four Fig. 3 AST and ALT levels in the plasma of the olive flounders that were injected I.M. (a, c) and oral administration (b, d) with tylosin at each concentration Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 5 of 18 hours after artificial infection, tylosin was suspended in liver, muscle, and blood) and oral administration group PBS and diluted to concentrations of 10 and 20 mg/kg (kidney, intestine, liver, stomach, and blood) were col- per 100 μL and administered orally to stomach of olive lected 1, 2, 5, 10, and 20 days after treatment. The con- flounders using oral zoned needle once a day for 5 days. trol group was injected with PBS. The collected blood Fish in the negative control group were injected with the was centrifuged at 7000 rpm for 10 min to separate same volume of PBS instead of the strain and tylosin. serum, and alanine aminotransferase (ALT) and aspar- Fish in the positive control group were administered or- tate aminotransferase (AST) levels were analyzed with a ally PBS instead of tylosin after artificial infection. There serum analyzer (FUJI DRI-CHEm 4000i, Japan). Signifi- were 10 fish in each group, and the experimental groups cant differences between the derived results were con- were tested in 3 replicates. The water temperature was firmed by one-way analysis of variance (ANOVA) and maintained at 25 °C, and the mortality rate was observed Tukey’s test (p < 0.05). Tissues were fixed in 10% neutral for 14 days. The surviving fish on the 15th day were buffered formalin. After fixation, standard histological anesthetized with benzocaine and sacrificed to investi- procedures were used for tissue dehydration and paraffin gate the infection rate through the kidneys and spleen. embedding. Tissue sections were then stained with hematoxylin and eosin (H&E). The pathological symp- Investigation of the side effects of tylosin toms observed were classified as normal, mild, moderate, The side effects after I.M. or oral administration of tylo- and deep. sin on various tissues were confirmed through histo- pathological and hematological analysis. The fish I.M. Investigation of the acute toxicity of tylosin injected with tylosin at dose of 10 and 40 mg/kg and the The LD was examined to determine the acute toxicity oral administration groups were treated once a day for 5 of tylosin. Tylosin was I.M. injected into olive flounder days. The tissues from the I.M. groups (trunk kidney, at concentrations of 350, 400, 450, and 500 mg/kg. Fig. 4 Histopathological results of trunk kidney, liver, and muscle (injected part) after PBS I.M. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 6 of 18 Mortality rates were measured for 96 h, and LD values died 9 days after infection. The mortality rates of the 2.5 were estimated (Finney et al. 1971). mg/kg and 5 mg/kg groups were 29% and 33%, respect- ively. The mortality rates of the 10 mg/kg and 15 mg/kg Results groups were the lowest at 10% (Fig. 1). The infection Efficacy of tylosin I.M. rate of the surviving fish was 0% in the negative control The cumulative mortality rate of the negative control group. The infection rates of the 2.5 mg/kg and 5 mg/kg group was 0%, and all of the positive control group fish groups were 79% and 71%, respectively. The infection Fig. 5 Histopathological results of trunk kidney, liver, and muscle (injected part) 1 day after tylosin I.M Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 7 of 18 rate of the 10 mg/kg group was 13%, and the infection occurred in the negative control, 10 mg/kg, and 20 mg/ rate of the 15 mg/kg group was 9% (Table 2). kg groups (Fig. 2). At the end of the experiment, the in- fection rate was confirmed to be 0% for both the nega- Efficacy of tylosin oral administration tive control group and the 10 mg/kg group. All surviving The final cumulative mortality rate of the positive con- fish in the positive control group were infected, and 7% trol group was found to be 70%, and no mortality were infected in the 20 mg/kg group (Table 3). Fig. 6 Histopathological results of trunk kidney, liver, and muscle (injected part) 2 days after tylosin I.M. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 8 of 18 Fig. 7 Histopathological results of trunk kidney, liver, and muscle (injected part) 5 days after tylosin I.M. AST and ALT levels Histopathological analysis The AST level was slightly higher in the experimental Mild fatty liver and liver atrophy were observed in most group than in the control group after I.M., but there samples, including the control group (Figs. 4, 5, 6, 7, 8, was no significant difference in all sections between 9, 10, 11, 12, 13, 14, and 15). Some muscle tissues I.M. and oral administration (Fig. 3). Likewise, no sig- showed an inflammatory response (Figs. 6c, 7i, r, and nificant difference was found in the ALT levels be- 8o), but most of the muscle tissues were normal. Mild tween the control and experimental groups (Fig. 3). renal tubule vacuolization was detected in the Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 9 of 18 Fig. 8 Histopathological results of trunk kidney, liver, and muscle (injected part) 10 days after tylosin I.M. experimental group (Fig. 5a, d, and j, 6a, d, and m, and mg/kg group (Fig. 12b), and on the fifth day, renal tubu- Fig. 7a, m), and renal tubule atrophy (Fig. 6j) appeared. lar vacuolization was found in the kidneys of the 40 mg/ After oral administration, fatty changes in the liver and kg group (Fig. 13m). Except for these groups, there were liver atrophy occurred in most of the samples, including no significant differences compared to the control. Sum- the control. On the second day after oral administration, maries of histopathological results after tylosin I.M. or intestinal epithelial cell atrophy was observed in the 10 oral administration are shown in Tables 4 and 5. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 10 of 18 Fig. 9 Histopathological results of trunk kidney, liver, and muscle (injected part) 20 days after tylosin I.M. Acute toxicity 1977). The mechanism of tylosin is the inhibition of pro- The mortality rates after I.M. of tylosin are shown in Table 6, tein synthesis, prevention of the aminoacyl portion of and the LD valuewas foundtobeapproximately461mg/kg. aminoacyl-tRNA binding to ribosomes, and inhibition of the formation of the mRNA-aminoacyl-tRNA-ribosome Discussion complex (Prescott and Baggot 1988). The binding por- Macrolide antibiotics are generally known to bind to ri- tion of tylosin is the 50S subunit of the ribosome, and bosomes and inhibit protein synthesis (Corcoran et al. tylosin is known as a safe antibiotic that has a wide Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 11 of 18 Fig. 10 Histopathological results of trunk kidney, intestine, liver, and stomach after PBS oral administration range of antimicrobial activity, such as against Gram- was effective. Therefore, it was found that the appropri- positive bacteria, Gram-negative bacteria, and myco- ate treatment concentration in this study was similar to plasma, and has little effect on humans or animals. the previous study. In addition, according to the final re- In this study, as a result of confirming the therapeutic port of the National Institute of Fisheries Science of effect of various concentrations of tylosin on olive floun- Korea, it was confirmed that the MIC of tylosin against der infected with S. parauberis, I.M. showed the lowest the S. parauberis SPOF18J3 strain was 1 μg/mL (NIFS mortality and infection rate at 10 mg/kg (Fig. 1, Table 2019). In order to show antibiotic activity, a concentra- 2). In these results, there was no concentration- tion 10–100 times the MIC is the general range used dependent relative survival rate tendency, possibly be- (Widmer 2001). In addition, since the recommended cause the number of olive flounder was not large commercial injectable tylosin concentration is 2–10 mg/ enough, and there was a slight variation in weight be- kg, the most appropriate treatment concentration of tween individuals. However, from the 10 mg/kg group, it tylosin for S. parauberis SPOF18J3-infected flounder is can be concluded that there is a significant decrease in 10 mg/kg. There are many ways to administer antibi- mortality and infection rate. In addition, oral administra- otics, and each has its advantages and disadvantages. tion also showed the lowest mortality and infection rates I.M. of antibiotics shows high bioavailability and rapid at 10 mg/kg (Fig. 2). According to a previous study, I.M. absorption, but requires a lot of manpower and causes of tylosin twice a day for 3 days at 4 mg/lb (approxi- great stress to the fish. On the other hand, oral adminis- mately 8.8 mg/kg) to pigs infected with Lawsonia intra- tration of antibiotics shows low bioavailability and slow cellularis, the causative pathogen of porcine proliferative absorption, but it is very convenient and does not cause enteropathy, was effective (Marsteller et al. 2001), and stress to fish. Therefore, it is important to choose an ad- I.M. of 20% tylosin at 1 mL/20 kg (10 mg/kg tylosin) ministration method suitable for the situation of the once a day for 3 to in sheep and cattle with pneumonia farm. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 12 of 18 Fig. 11 Histopathological results of trunk kidney, intestine, liver, and stomach 1 day after tylosin oral administration AST and ALT are enzymes found primarily in the liver AST. After statistically confirming the changes in the but are also found in organs such as muscle tissue, kid- AST and ALT levels after I.M. and oral administration neys, heart cells, and red blood cells (Huang et al. 2006). of tylosin, there was no significant difference between AST is also used as a clinical indicator for the liver, any of the sections. From a pharmacokinetic point of muscle, and kidney because it correlates with cell dam- view, tylosin is well absorbed by the digestive tract or age. ALT is the mostly distributed in the liver and has a muscle (Lewicki 2006) and shows a bioavailability of more specific response to hepatocellular injury than 22.5–34% after I.M. (Kowalski et al. 2002)and 70–95% Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 13 of 18 Fig. 12 Histopathological results of trunk kidney, intestine, liver, and stomach 2 day after tylosin oral administration after oral administration (Ziv and Sulman 1973; Baggot group in this study, so tylosin is not thought to be toxic 1978; Prats et al. 2002). In addition, the primary and to tissue cells. major metabolism of tylosin occurs in the liver, and me- In addition, in this study, the LD of tylosin I.M. was tabolites are known to be widely distributed in tissues found to be 461 mg/kg. The LD values in mice, rats, such as the liver, kidneys, muscles, and plasma (Lewicki dogs, Bobwhite quails, cockerels, etc. have been identi- 2006). Nevertheless, the levels of AST and ALT did not fied in various previous studies to be 321–695 mg/kg show any significant changes compared to the control after intravenous and intraperitoneal injections, 784– Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 14 of 18 Fig. 13 Histopathological results of trunk kidney, intestine, liver, and stomach 5 day after tylosin oral administration 4083 mg/kg after subcutaneous injections, and at least reaction of the muscles in some fish in the 10 mg/kg and 3650 mg/kg after oral administration (Anderson and 40 mg/kg groups, but it was not significant. There was Worth 1961; Anderson et al. 1966; Quarles 1983; Mor- no inflammatory reaction 5 days after injection. In the ton 1988). This supports tylosin having low toxicity to case of tylosin oral administration, slight intestinal epi- animals. thelial cell atrophy was observed in only one sample, but We confirmed the side effects of tylosin on the various this was also not significant. In addition, it was con- flounder tissues, and there was a slight inflammatory firmed that slight renal tubule vacuolization and renal Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 15 of 18 Fig. 14 Histopathological results of trunk kidney, intestine, liver, and stomach 10 day after tylosin oral administration tubule atrophy occurred in some individuals in the 10 degree of kidney damage depends on the type and dose mg/kg and 40 mg/kg groups. The proximal renal tubules of the antibiotic. Antibiotic glomerulonephritis or renal are the first sites that contact the toxin after it has been tubular lesions in fish have been reported in several spe- filtered by the glomeruli, so damage from toxic sub- cies (Augusto et al. 1996; Reimschuessel and Williams stances can easily occur (Solez 1984). Therefore, the kid- 1995; Reimschuessel et al. 1996). However, in most of ney can be a target tissue for antibiotic toxicity, and the the experimental groups, there was no difference Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 16 of 18 Fig. 15 Histopathological results of trunk kidney, intestine, liver, and stomach 20 day after tylosin oral administration compared to the control group, the symptoms were study, it was found that proper administration of tylosin mild, and the toxicity was considered to be low because to olive flounder infected with S. parauberis SPOF18J3 it did not have a significant effect on the fish. was I.M. or oral administration of 10 mg/kg, and these data can be applied directly to aquaculture sites. In Conclusion addition, histopathological analysis, serological analysis, In this study, we applied tylosin to treat olive flounder and LD verification confirmed that the toxicity of tylo- streptococcal disease for the first time. Through this sin to olive flounder was extremely low. Therefore, it is Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 17 of 18 Table 4 Summary of histopathological results after tylosin I.M. considered appropriate to treat olive flounder infected Days post injection with S. parauberis with tylosin. In addition, pharmacoki- Groups 1 day 2 days 5 days 10 days 20 Notes netic analysis of tylosin on olive flounder is needed, and days these results may be used as basic data for the evalua- 10 Mild renal Inflammatory Inflammatory Mild fatty tions required upon request to obtain approval for tylo- mg/kg tubule response in response in liver and vacuolization muscles muscles liver sin use as fishery antibiotics in Korea. Mild renal Mild renal atrophy in tubule tubule most Acknowledgements vacuolization vacuolization samples including The work was supported by a Grant from the National Institute of Fisheries 40 Mild renal Mild renal Inflammatory Inflammatory the control Science, Republic of Korea (R2020060) and “Smart Aquaculture Research mg/kg tubule tubule response in response group Center” funded by the Ministry of Oceans and Fisheries, Korea. vacuolization vacuolization muscles in muscles Renal tubule Mild renal atrophy tubule Authors’ contributions vacuolization MSJ and SDH designed and conducted the experiment and wrote the paper. These authors contributed equally to this work. KMC and YJK participated in the fish sampling and data analysis. JYH, MGK, JMJ, and JSS participated in the data analysis. JHL prepared the ingredients. HCL designed the experiment. CIP supervised the study. All authors discussed and approved the final manuscript. Funding The study was supported by National Institute of Fisheries Science, Republic of Korea (Grant no. R2020060). Availability of data and materials Please contact author for data requests. Ethics approval and consent to participate All experimental protocols followed the guidelines of the Institutional Animal Care and Use Committee of the Gyeongsang National University. Table 5 Summary of histopathological results after tylosin oral Consent for publication administration Not applicable Days post administration Competing interests Groups 1 2 days 5 days 10 20 Notes The authors declare that they have no competing interests. day days days 10 Intestinal Mild fatty liver and Author details mg/kg epithelial liver atrophy in Institute of Marine Industry, College of Marine Science, Gyeongsang cell most samples National University, 455, Tongyeong 650-160, Republic of Korea. Aquatic atrophy including the Animal Disease Control Center, National Institute of Fisheries Science (NIFS), control group 216 Gijanghaean-ro, Gijang-eup, Gijang-gun, Busan 46083, Republic of Korea. 40 Renal Department of Fisheries Science, Aquatic Life Medicine, Pukyong National mg/kg tubular University, Busan, Korea. vacuolization Received: 6 April 2020 Accepted: 13 July 2020 References Anderson RC, Harris PN, Lee CC, Maze N, Small RM, Worth HM. The toxicology and pharmacology of tylosin, an antibiotic, and some salts of tylosin. Unpublished report No. VAR.100/c/9 from Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, IN, USA. Submitted to WHO by Elanco Animal Health, Division of Eli Lilly and Company, Indianapolis, IN, USA. 1966. Anderson RC, Worth HM. The acute toxicity of tylosin phosphate. Unpublished study No. 893/TACUTE/AM from Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, IN, USA. Submitted to WHO by Elanco Animal Health, Division of Eli Lilly and Company, Indianapolis, IN, USA. 1961. Augusto J, Smith B, Smith S, Robertson J, Reimschuessel R. Gentamicin-induced nephrotoxicity and nephroneogenesis in Oreochromis nilotica, a tilapian fish. Dis. Aquat. Org. 1996;26(1):49–58. Table 6 The cumulative mortality rate of acute toxicity study in Baggot JD. Some aspects of clinical pharmacokinetics in veterinary medicine: principles of pharmacokinetics. J. Vet. Pharmacol. Ther. 1978;1:111–8. olive flounder by tylosin I.M. Corcoran JW, Huber ML, Huber FM. Relationship of ribosomal binding and Group 350 mg/ 400 mg/ 450 mg/ 500 mg/ antibacterial properties of tylosin-type antibiotics. J. Antibiot. 1977;30(11): kg kg kg kg 1012–4. Finney DJ. Probit analysis. 3rd ed. Cambridge: Cambridge University Press; 1971. Cumulative mortality 0 (0/10) 30 (3/10) 50 (5/10) 60 (6/10) Gingerich DA, Baggot JD, Kowalski JJ. Tylosin antimicrobial activity and (%) pharmacokinetics in cows. Can. Vet. J. 1997;18(4):96–100. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 18 of 18 Huang XJ, Choi YK, Im HS, Yarimaga O, Yoon E, Kim HS. Aspartate aminotransferase (AST/GOT) and alanine aminotransferase (ALT/GPT) detection techniques. Sensors. 2006;6(7):756–82. Jee BY, Shin KW, Lee DW, Kim YJ, Lee MK. Monitoring of the mortalities and medications in the inland farms of olive flounder, Paralichthys olivaceus,in South Korea. J. Fish Pathol. 2014;27(1):77–83. Joint FAO/WHO Expert Committee on Food Additives (JECFA). Toxicological evaluation of certain veterinary drug residues in food: Tylosin. 2009. Katz SE, Bardy MS. Antibiotic residues in food and their significance. Food Biotechnol. 2000;14(3):147–71. Kim JW, Cho MY, Jee BY, Park MA, Kim NY. Administration and use of aquaculture drugs in Korea. J. Fish Pathol. 2014;17(1):67–75. Kim JW, Lee HN, Jee BY, Woo SH, Kim YJ, Lee MK. Monitoring of the mortalities in the aquaculture farms of South Korea. J. Fish Pathol. 2012;25(3):271–7. Kowalski C, Roliński Z, Zań R, Wawron W. Pharmacokinetics of tylosin in broiler chickens. Pol. J. Vet. Sci. 2002;5:127–30. Lewicki J. Tylosin. A review of pharmacokinetics, residues in food animals and analytic methods. Available at the website of FAO at: ftp://ftp.fao.org/ag/agn/ food/tylosin_2006.pdf (Accessed 10 August 2008). 2006. Marsteller T, Winkelman N, Gebhart C, Armbruster G, Weldon W, Muller PR, Weatherford PJ, Symanowski J. Efficacy of intramuscular tylosin for the treatment and control of porcine proliferative enteropathy caused by Lawsonia intracellularis. Vet. Ther. 2001;3(1):5–7. Mata AI, Gibello A, Casamayor A, Blanco MM, Domínguez L, Fernández- Garayzábal JF. Multiplex PCR assay for detection of bacterial pathogens associated with warm-water Streptococcosis in fish. Appl. Environ. Microbiol. 2004;70:3183–7. Mishra A, Nam GH, Gim JA, Lee HE, Jo A, Kim HS. Current challenges of Streptococcus infection and effective molecular, cellular, and environmental control methods in aquaculture. Mol. Cells. 2018;41:495–505. Morton DM. Tylan products. Expert report on toxicological documentation. Unpublished report from Lilly research Laboratories, Eli Lilly and Company, Greenfield, IN, USA. Submitted to WHO by Elanco Animal Health, Division of Eli Lilly and Company, Indianapolis, IN, USA, 1988. NIFS. Investigation of safety and efficacy of fishery antibiotics customized by fish species. 2019. Final report. Prats C, El Korchi G, Francech R, Arboix M, Perez B. Disposition kinetics of tylosin administered intravenously and intramuscularly to pigs. Res. Vet. Sci. 2002;73: 141–4. rd Prescott JF, Baggot JD. Antimicrobial therapy in veterinary medicine. 3 edn. Iowa State University Press, Ames, IA, USA. 1988. Quarles JP. Acute comparative intravenous toxicity testing of tylosin, desmycosin and macrocin in the ICR mouse. Unpublished studies Nos M-V-46-83, M-V- 45-83 and M-V-44-83 from the Toxicology Division, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, IN, USA. Submitted to WHO by Elanco Animal Health, Division of Eli Lilly and Company, Indianapolis, IN, USA. 1983. Reimschuessel R, Chamie SJ, Kinnel M. Evaluation of gentamicin-induced nephrotoxicosis in toadfish. J. Am. Vet. Med. Assoc. 1996;209(1):137–9. Reimschuessel R, Williams D. Development of new nephrons in adult kidneys following gentamicin-induced nephrotoxicity. Ren. Fail. 1995;17(2):101–96. Shim JD, Hwang SD, Jang SY, Kim TW, Jeong JM. Monitoring of the mortalities in oliver flounder (Paralichthys olivaceus) farms of Korea. J. Fish Pathol. 2019; 32(1):029–35. Smith P, Hiney MP, Samuelsen OB. Bacterial resistance to antimicrobial agents used in fish farming: a critical evaluation of method and meaning. Annu. Rev. Fish Dis. 1994;4:273–313. Solez K. The pathology and pathogenesis of human “acute tubular necrosis”,In Solez, K. and Whelton, A. Acute renal failure: correlations between morphology and function. Marcel Dekker, Inc., New York. 1984; pp.17-42. Widmer AF. New development in diagnosis and treatment of infection in orthopaedic implants. Clin. Infect. Dis. 2001;33:S94–106. Ziv G, Sulman FG. Serum and milk concentrations of spectinomycin and tylosin in cows and ewes. Am. J. Vet. Res. 1973;34:329–33. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Fisheries and Aquatic Sciences Springer Journals

Application of tylosin antibiotics to olive flounder (Paralichthys olivaceus) infected with Streptococcus parauberis

Loading next page...
 
/lp/springer-journals/application-of-tylosin-antibiotics-to-olive-flounder-paralichthys-Mc0ta5WzR6
Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2020
eISSN
2234-1757
DOI
10.1186/s41240-020-00165-8
Publisher site
See Article on Publisher Site

Abstract

Background: Olive flounder, Paralichthys olivaceus, is an economically important aquaculture species in Korea. Olive flounders have been heavily damaged by streptococcal infections every year and are treated with antibiotics. However, antibiotic abuse is causing the emergence of resistant strains, and to overcome this, research has shown that new antibiotics must be applied. Tylosin is a relatively safe antibiotic and has good activity against Gram- positive bacteria and mycoplasma. We studied the therapeutic effects and side effects of tylosin on Streptococcus parauberis-infected olive flounder. Methods: After artificial infection of olive flounder with S. parauberis SPOF18J3, an appropriate dose of tylosin was confirmed by intramuscular injection (I.M.) at 2.5, 5, 10, and 15 mg/kg, and oral administration at 10 and 20 mg/kg. After I.M. and oral administration dosing of tylosin, side effects were confirmed by serological analysis, histopathological analysis, and median lethal dose (LD ) analysis at both an appropriate concentration and a high concentration. Statistical analysis was performed using one-way analysis of variance (ANOVA) and Tukey’s test (p <0.05). Results: The appropriate I.M. and oral administration concentration of tylosin administered to olive flounder infected with S. parauberis SPOF18J3 was found to be 10 mg/kg. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were showed not significantly different between the control group and the experimental groups. The histopathologic results showed mild inflammatory responses in muscle and tubular vacuolization and tubular atrophy appeared, but there were no significant differences between the groups. The LD was confirmed to be 461 mg/kg. Conclusion: In this study, an effective treatment method was provided by verifying the treatment effects and side effects of tylosin in olive flounder infected with S. parauberis, which can be applied directly to aquaculture sites. In addition, these results may be used as a reference for evaluation required upon request to obtain approval for tylosin antibiotics as fishery antibiotics in Korea. After approval, it is possible that a fishery disease manager will be able to prescribe and sell the antibiotic tylosin. Keywords: Tylosin, Olive flounder, Streptococcus parauberis, Treatment effects, Side effects * Correspondence: vinus96@hanmail.net Institute of Marine Industry, College of Marine Science, Gyeongsang National University, 455, Tongyeong 650-160, Republic of Korea Full list of author information is available at the end of the article © The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 2 of 18 Background Table 1 Specific primer for S. parauberis detection The olive flounder Paralichthys olivaceus is an econom- Primer Sequences (5′ → 3′) Target gene Product size (bp) ically important aquaculture species in Korea. The Ko- Spa2152 TTTCGTCTGAGGCAATGTTG 23 s rRNA 718 bp rean Statistical Information Service (KOSIS) suggested Spa2870 GCTTCATATATCGCTATACT that in the first half of 2019, olive flounder production was 25,016 M/T, which is 58.1% of the total fish aqua- culture production of South Korea. However, various diseases occur in olive flounder every year, causing large economic damages. has been increasing. To solve this problem, applying In 2011, 13.57% of the total mortality of olive new antibiotics is necessary, and research on the veterin- flounder was found to be caused by streptococcal in- ary medicines that have good effects on fish disease bac- fection in 70 olive flounder farms in South Korea teria is also required. (Kim et al. 2012). From May to October 2012, 12.8% Tylosin, a macrolide antibiotic, was commercialized of the mortality in the whole Korean inland olive in 1962 from the soil microorganism Streptomyces flounder aquafarm was caused by streptococcal infec- fradiae, and more than 1800 t are produced per year tion (Jee et al. 2014). In addition, by analyzing the worldwide (JECFA 2009). Tylosin is known to have causes of mortality in olive flounder aquafarms in strong antimicrobial activity against Gram-positive Jeonnam and Jeju, the rates of mortality caused by bacteria and mycoplasma (Prescott and Baggot 1988), streptococcal infection were 9.76% in 2015, 7% in and antibiotics based on tylosin are used in various 2016, and 2% in 2017 (Shim et al. 2019). livestock that show symptoms such as mycoplasma Streptococcal-infected olive flounders have symptoms disease, porcine proliferative enteropathy, and swine such as hemorrhagic septicaemia, exophthalmia, men- dysentery (Gingerich et al., 1997). However, tylosin is ingitis with abnormal swimming, and ascites (Mishra only used in livestock, and there are no studies on et al. 2018). In order to treat streptococcal disease, the effects and side effects in fish. various fishery antibiotics are being used at aquacul- In order to apply tylosin-based antibiotics in fisher- ture sites (Kim et al. 2014). ies, studies on the appropriate concentrations, However, the abuse of previously used fishery antibi- methods, and safety to the fish are necessary. There- otics has had negative impacts on the safety of aquatic fore, in this study, we investigated the therapeutic ef- products and fish (Katz and Brady 2000) and has caused fects and side effects of tylosin on Streptococcus the emergence of resistant strains (Smith et al. 1994). parauberis-infected olive flounder, and these results With the emergence of resistant strains, illegal use of could be used as basic data for applying tylosin-based veterinary medicines that are prohibited for use in fish antibiotics in fisheries. Fig. 1 Determination of cumulative mortality from each concentration of tylosin I.M. injection against olive flounder infected with S. parauberis SPOF18J3 Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 3 of 18 Table 2 The cumulative mortality, infection rate, and relative survival rate of therapeutic studies in S. parauberis SPOF18J3-infected olive flounder by tylosin I.M. injection Group Con (−) Con (+) 2.5 mg/kg 5 mg/kg 10 mg/kg 15 mg/kg Cumulative mortality (%) 0 (0/7) 100 (7/7) 29 (6/21) 33 (7/21) 10 (2/21) 10 (2/21) Relative survival rate (%) 100 – 71 67 90 90 Infection rate (%) in survival fish 0 (0/7) – 73 (11/15) 71 (10/14) 5 (1/19) 11 (2/19) Materials and methods with 1% NaCl. Pure colonies were used after passage for Fish 24 h in BHI broth. In addition, in order to identify the We purchased olive flounder from a farm in Geoje, strain, the species was identified through polymerase chain Gyeongsangnam-do, with a mean length of 14.5 ± 1.2 reaction (PCR) using a primer (Mata et al. 2004) specific cm and a mean body weight of 47 g ± 8.5 g. The fish for the 23S rRNA sequence of streptococci (Table 1). The TM were maintained in seawater tanks with a flow rate of amplifications were carried out in a T-100 Thermal Cy- approximately 2 L/min for 2 weeks at 23–26 °C. cler (Bio-Rad) with the following parameters: an initial de- naturation step of 94 °C for 2 min; 25 serial cycles of a Tylosin antibiotics denaturation step of 92 °C for 1 min, annealing at 55°C for Tylosin inj. 200 (SF Co., Ltd., Korea) was used for intra- 1 min, and extension at 72 °C for 90 s; and a final exten- muscular injection (I.M.), and Ty-gold (Daehan New sion step of 72 °C for 5 min. The identified streptococci Pharm Co., Ltd., Korea) was used for oral administration. were used for infection, and the strains isolated during the experiment were also identified to confirm the species. Strain The S. parauberis SPOF18J3 strain isolated from olive Investigation of the efficacy of tylosin I.M. flounder in Seogwipo, Jeju, Korea, was purchased from The efficacy of tylosin I.M. against S. parauberis-infected Fish Disease Prevention Lab in Pukyong National Univer- olive flounder was confirmed. The S. parauberis sity. The strain was incubated for 24 h at 27 °C using brain SPOF18J3 strain was suspended in phosphate-buffered heart infusion agar (BHIA; Difco, USA) supplemented saline (PBS) at a concentration of 1 × 10 CFU/mL and Fig. 2 Determination of cumulative mortality from each concentration of tylosin oral administration against olive flounder infected with S. parauberis SPOF18J3 Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 4 of 18 Table 3 The cumulative mortality, infection rate, and relative survival rate of therapeutic studies in S. parauberis SPOF18J3-infected olive flounder by tylosin O.A. Group Con (−) Con (+) 2.5 mg/kg 5 mg/kg Cumulative mortality (%) 0 (0/10) 70 (7/10) 0 (0/30) 0 (0/30) Relative survival rate (%) 100 30 100 100 Infection rate (%) in survival fish 0 (0/10) 100 (3/3) 0 (0/30) 7 (2/30) artificially infected by subcutaneously injection of 100 μL The water temperature was maintained at 25 °C, and the to the base of the dorsal fin of the olive flounders. mortality rate was observed for 14 days. The surviving Twenty-four hours after artificial infection, tylosin was fish on the 15th day were anesthetized with benzocaine suspended in PBS and diluted to concentrations of 2.5, and sacrificed to investigate the infection rate through 5, 10, and 15 mg/kg per 100 μL, and administered by the kidneys and spleen. I.M. to olive flounders. Fish in the negative control group were injected with the same volume of PBS in- Investigation of the efficacy of tylosin oral administration stead of the strain and tylosin. Fish in the positive con- The efficacy of tylosin oral administration against S. trol group were administered PBS I.M. instead of tylosin parauberis-infected olive flounder was confirmed. Fish after artificial infection. There were 7 fish in each group, were artificially infected in the same way as described in and the experimental groups were tested in 3 replicates. the analysis of the efficacy of I.M. tylosin. Twenty-four Fig. 3 AST and ALT levels in the plasma of the olive flounders that were injected I.M. (a, c) and oral administration (b, d) with tylosin at each concentration Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 5 of 18 hours after artificial infection, tylosin was suspended in liver, muscle, and blood) and oral administration group PBS and diluted to concentrations of 10 and 20 mg/kg (kidney, intestine, liver, stomach, and blood) were col- per 100 μL and administered orally to stomach of olive lected 1, 2, 5, 10, and 20 days after treatment. The con- flounders using oral zoned needle once a day for 5 days. trol group was injected with PBS. The collected blood Fish in the negative control group were injected with the was centrifuged at 7000 rpm for 10 min to separate same volume of PBS instead of the strain and tylosin. serum, and alanine aminotransferase (ALT) and aspar- Fish in the positive control group were administered or- tate aminotransferase (AST) levels were analyzed with a ally PBS instead of tylosin after artificial infection. There serum analyzer (FUJI DRI-CHEm 4000i, Japan). Signifi- were 10 fish in each group, and the experimental groups cant differences between the derived results were con- were tested in 3 replicates. The water temperature was firmed by one-way analysis of variance (ANOVA) and maintained at 25 °C, and the mortality rate was observed Tukey’s test (p < 0.05). Tissues were fixed in 10% neutral for 14 days. The surviving fish on the 15th day were buffered formalin. After fixation, standard histological anesthetized with benzocaine and sacrificed to investi- procedures were used for tissue dehydration and paraffin gate the infection rate through the kidneys and spleen. embedding. Tissue sections were then stained with hematoxylin and eosin (H&E). The pathological symp- Investigation of the side effects of tylosin toms observed were classified as normal, mild, moderate, The side effects after I.M. or oral administration of tylo- and deep. sin on various tissues were confirmed through histo- pathological and hematological analysis. The fish I.M. Investigation of the acute toxicity of tylosin injected with tylosin at dose of 10 and 40 mg/kg and the The LD was examined to determine the acute toxicity oral administration groups were treated once a day for 5 of tylosin. Tylosin was I.M. injected into olive flounder days. The tissues from the I.M. groups (trunk kidney, at concentrations of 350, 400, 450, and 500 mg/kg. Fig. 4 Histopathological results of trunk kidney, liver, and muscle (injected part) after PBS I.M. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 6 of 18 Mortality rates were measured for 96 h, and LD values died 9 days after infection. The mortality rates of the 2.5 were estimated (Finney et al. 1971). mg/kg and 5 mg/kg groups were 29% and 33%, respect- ively. The mortality rates of the 10 mg/kg and 15 mg/kg Results groups were the lowest at 10% (Fig. 1). The infection Efficacy of tylosin I.M. rate of the surviving fish was 0% in the negative control The cumulative mortality rate of the negative control group. The infection rates of the 2.5 mg/kg and 5 mg/kg group was 0%, and all of the positive control group fish groups were 79% and 71%, respectively. The infection Fig. 5 Histopathological results of trunk kidney, liver, and muscle (injected part) 1 day after tylosin I.M Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 7 of 18 rate of the 10 mg/kg group was 13%, and the infection occurred in the negative control, 10 mg/kg, and 20 mg/ rate of the 15 mg/kg group was 9% (Table 2). kg groups (Fig. 2). At the end of the experiment, the in- fection rate was confirmed to be 0% for both the nega- Efficacy of tylosin oral administration tive control group and the 10 mg/kg group. All surviving The final cumulative mortality rate of the positive con- fish in the positive control group were infected, and 7% trol group was found to be 70%, and no mortality were infected in the 20 mg/kg group (Table 3). Fig. 6 Histopathological results of trunk kidney, liver, and muscle (injected part) 2 days after tylosin I.M. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 8 of 18 Fig. 7 Histopathological results of trunk kidney, liver, and muscle (injected part) 5 days after tylosin I.M. AST and ALT levels Histopathological analysis The AST level was slightly higher in the experimental Mild fatty liver and liver atrophy were observed in most group than in the control group after I.M., but there samples, including the control group (Figs. 4, 5, 6, 7, 8, was no significant difference in all sections between 9, 10, 11, 12, 13, 14, and 15). Some muscle tissues I.M. and oral administration (Fig. 3). Likewise, no sig- showed an inflammatory response (Figs. 6c, 7i, r, and nificant difference was found in the ALT levels be- 8o), but most of the muscle tissues were normal. Mild tween the control and experimental groups (Fig. 3). renal tubule vacuolization was detected in the Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 9 of 18 Fig. 8 Histopathological results of trunk kidney, liver, and muscle (injected part) 10 days after tylosin I.M. experimental group (Fig. 5a, d, and j, 6a, d, and m, and mg/kg group (Fig. 12b), and on the fifth day, renal tubu- Fig. 7a, m), and renal tubule atrophy (Fig. 6j) appeared. lar vacuolization was found in the kidneys of the 40 mg/ After oral administration, fatty changes in the liver and kg group (Fig. 13m). Except for these groups, there were liver atrophy occurred in most of the samples, including no significant differences compared to the control. Sum- the control. On the second day after oral administration, maries of histopathological results after tylosin I.M. or intestinal epithelial cell atrophy was observed in the 10 oral administration are shown in Tables 4 and 5. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 10 of 18 Fig. 9 Histopathological results of trunk kidney, liver, and muscle (injected part) 20 days after tylosin I.M. Acute toxicity 1977). The mechanism of tylosin is the inhibition of pro- The mortality rates after I.M. of tylosin are shown in Table 6, tein synthesis, prevention of the aminoacyl portion of and the LD valuewas foundtobeapproximately461mg/kg. aminoacyl-tRNA binding to ribosomes, and inhibition of the formation of the mRNA-aminoacyl-tRNA-ribosome Discussion complex (Prescott and Baggot 1988). The binding por- Macrolide antibiotics are generally known to bind to ri- tion of tylosin is the 50S subunit of the ribosome, and bosomes and inhibit protein synthesis (Corcoran et al. tylosin is known as a safe antibiotic that has a wide Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 11 of 18 Fig. 10 Histopathological results of trunk kidney, intestine, liver, and stomach after PBS oral administration range of antimicrobial activity, such as against Gram- was effective. Therefore, it was found that the appropri- positive bacteria, Gram-negative bacteria, and myco- ate treatment concentration in this study was similar to plasma, and has little effect on humans or animals. the previous study. In addition, according to the final re- In this study, as a result of confirming the therapeutic port of the National Institute of Fisheries Science of effect of various concentrations of tylosin on olive floun- Korea, it was confirmed that the MIC of tylosin against der infected with S. parauberis, I.M. showed the lowest the S. parauberis SPOF18J3 strain was 1 μg/mL (NIFS mortality and infection rate at 10 mg/kg (Fig. 1, Table 2019). In order to show antibiotic activity, a concentra- 2). In these results, there was no concentration- tion 10–100 times the MIC is the general range used dependent relative survival rate tendency, possibly be- (Widmer 2001). In addition, since the recommended cause the number of olive flounder was not large commercial injectable tylosin concentration is 2–10 mg/ enough, and there was a slight variation in weight be- kg, the most appropriate treatment concentration of tween individuals. However, from the 10 mg/kg group, it tylosin for S. parauberis SPOF18J3-infected flounder is can be concluded that there is a significant decrease in 10 mg/kg. There are many ways to administer antibi- mortality and infection rate. In addition, oral administra- otics, and each has its advantages and disadvantages. tion also showed the lowest mortality and infection rates I.M. of antibiotics shows high bioavailability and rapid at 10 mg/kg (Fig. 2). According to a previous study, I.M. absorption, but requires a lot of manpower and causes of tylosin twice a day for 3 days at 4 mg/lb (approxi- great stress to the fish. On the other hand, oral adminis- mately 8.8 mg/kg) to pigs infected with Lawsonia intra- tration of antibiotics shows low bioavailability and slow cellularis, the causative pathogen of porcine proliferative absorption, but it is very convenient and does not cause enteropathy, was effective (Marsteller et al. 2001), and stress to fish. Therefore, it is important to choose an ad- I.M. of 20% tylosin at 1 mL/20 kg (10 mg/kg tylosin) ministration method suitable for the situation of the once a day for 3 to in sheep and cattle with pneumonia farm. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 12 of 18 Fig. 11 Histopathological results of trunk kidney, intestine, liver, and stomach 1 day after tylosin oral administration AST and ALT are enzymes found primarily in the liver AST. After statistically confirming the changes in the but are also found in organs such as muscle tissue, kid- AST and ALT levels after I.M. and oral administration neys, heart cells, and red blood cells (Huang et al. 2006). of tylosin, there was no significant difference between AST is also used as a clinical indicator for the liver, any of the sections. From a pharmacokinetic point of muscle, and kidney because it correlates with cell dam- view, tylosin is well absorbed by the digestive tract or age. ALT is the mostly distributed in the liver and has a muscle (Lewicki 2006) and shows a bioavailability of more specific response to hepatocellular injury than 22.5–34% after I.M. (Kowalski et al. 2002)and 70–95% Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 13 of 18 Fig. 12 Histopathological results of trunk kidney, intestine, liver, and stomach 2 day after tylosin oral administration after oral administration (Ziv and Sulman 1973; Baggot group in this study, so tylosin is not thought to be toxic 1978; Prats et al. 2002). In addition, the primary and to tissue cells. major metabolism of tylosin occurs in the liver, and me- In addition, in this study, the LD of tylosin I.M. was tabolites are known to be widely distributed in tissues found to be 461 mg/kg. The LD values in mice, rats, such as the liver, kidneys, muscles, and plasma (Lewicki dogs, Bobwhite quails, cockerels, etc. have been identi- 2006). Nevertheless, the levels of AST and ALT did not fied in various previous studies to be 321–695 mg/kg show any significant changes compared to the control after intravenous and intraperitoneal injections, 784– Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 14 of 18 Fig. 13 Histopathological results of trunk kidney, intestine, liver, and stomach 5 day after tylosin oral administration 4083 mg/kg after subcutaneous injections, and at least reaction of the muscles in some fish in the 10 mg/kg and 3650 mg/kg after oral administration (Anderson and 40 mg/kg groups, but it was not significant. There was Worth 1961; Anderson et al. 1966; Quarles 1983; Mor- no inflammatory reaction 5 days after injection. In the ton 1988). This supports tylosin having low toxicity to case of tylosin oral administration, slight intestinal epi- animals. thelial cell atrophy was observed in only one sample, but We confirmed the side effects of tylosin on the various this was also not significant. In addition, it was con- flounder tissues, and there was a slight inflammatory firmed that slight renal tubule vacuolization and renal Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 15 of 18 Fig. 14 Histopathological results of trunk kidney, intestine, liver, and stomach 10 day after tylosin oral administration tubule atrophy occurred in some individuals in the 10 degree of kidney damage depends on the type and dose mg/kg and 40 mg/kg groups. The proximal renal tubules of the antibiotic. Antibiotic glomerulonephritis or renal are the first sites that contact the toxin after it has been tubular lesions in fish have been reported in several spe- filtered by the glomeruli, so damage from toxic sub- cies (Augusto et al. 1996; Reimschuessel and Williams stances can easily occur (Solez 1984). Therefore, the kid- 1995; Reimschuessel et al. 1996). However, in most of ney can be a target tissue for antibiotic toxicity, and the the experimental groups, there was no difference Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 16 of 18 Fig. 15 Histopathological results of trunk kidney, intestine, liver, and stomach 20 day after tylosin oral administration compared to the control group, the symptoms were study, it was found that proper administration of tylosin mild, and the toxicity was considered to be low because to olive flounder infected with S. parauberis SPOF18J3 it did not have a significant effect on the fish. was I.M. or oral administration of 10 mg/kg, and these data can be applied directly to aquaculture sites. In Conclusion addition, histopathological analysis, serological analysis, In this study, we applied tylosin to treat olive flounder and LD verification confirmed that the toxicity of tylo- streptococcal disease for the first time. Through this sin to olive flounder was extremely low. Therefore, it is Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 17 of 18 Table 4 Summary of histopathological results after tylosin I.M. considered appropriate to treat olive flounder infected Days post injection with S. parauberis with tylosin. In addition, pharmacoki- Groups 1 day 2 days 5 days 10 days 20 Notes netic analysis of tylosin on olive flounder is needed, and days these results may be used as basic data for the evalua- 10 Mild renal Inflammatory Inflammatory Mild fatty tions required upon request to obtain approval for tylo- mg/kg tubule response in response in liver and vacuolization muscles muscles liver sin use as fishery antibiotics in Korea. Mild renal Mild renal atrophy in tubule tubule most Acknowledgements vacuolization vacuolization samples including The work was supported by a Grant from the National Institute of Fisheries 40 Mild renal Mild renal Inflammatory Inflammatory the control Science, Republic of Korea (R2020060) and “Smart Aquaculture Research mg/kg tubule tubule response in response group Center” funded by the Ministry of Oceans and Fisheries, Korea. vacuolization vacuolization muscles in muscles Renal tubule Mild renal atrophy tubule Authors’ contributions vacuolization MSJ and SDH designed and conducted the experiment and wrote the paper. These authors contributed equally to this work. KMC and YJK participated in the fish sampling and data analysis. JYH, MGK, JMJ, and JSS participated in the data analysis. JHL prepared the ingredients. HCL designed the experiment. CIP supervised the study. All authors discussed and approved the final manuscript. Funding The study was supported by National Institute of Fisheries Science, Republic of Korea (Grant no. R2020060). Availability of data and materials Please contact author for data requests. Ethics approval and consent to participate All experimental protocols followed the guidelines of the Institutional Animal Care and Use Committee of the Gyeongsang National University. Table 5 Summary of histopathological results after tylosin oral Consent for publication administration Not applicable Days post administration Competing interests Groups 1 2 days 5 days 10 20 Notes The authors declare that they have no competing interests. day days days 10 Intestinal Mild fatty liver and Author details mg/kg epithelial liver atrophy in Institute of Marine Industry, College of Marine Science, Gyeongsang cell most samples National University, 455, Tongyeong 650-160, Republic of Korea. Aquatic atrophy including the Animal Disease Control Center, National Institute of Fisheries Science (NIFS), control group 216 Gijanghaean-ro, Gijang-eup, Gijang-gun, Busan 46083, Republic of Korea. 40 Renal Department of Fisheries Science, Aquatic Life Medicine, Pukyong National mg/kg tubular University, Busan, Korea. vacuolization Received: 6 April 2020 Accepted: 13 July 2020 References Anderson RC, Harris PN, Lee CC, Maze N, Small RM, Worth HM. The toxicology and pharmacology of tylosin, an antibiotic, and some salts of tylosin. Unpublished report No. VAR.100/c/9 from Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, IN, USA. Submitted to WHO by Elanco Animal Health, Division of Eli Lilly and Company, Indianapolis, IN, USA. 1966. Anderson RC, Worth HM. The acute toxicity of tylosin phosphate. Unpublished study No. 893/TACUTE/AM from Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, IN, USA. Submitted to WHO by Elanco Animal Health, Division of Eli Lilly and Company, Indianapolis, IN, USA. 1961. Augusto J, Smith B, Smith S, Robertson J, Reimschuessel R. Gentamicin-induced nephrotoxicity and nephroneogenesis in Oreochromis nilotica, a tilapian fish. Dis. Aquat. Org. 1996;26(1):49–58. Table 6 The cumulative mortality rate of acute toxicity study in Baggot JD. Some aspects of clinical pharmacokinetics in veterinary medicine: principles of pharmacokinetics. J. Vet. Pharmacol. Ther. 1978;1:111–8. olive flounder by tylosin I.M. Corcoran JW, Huber ML, Huber FM. Relationship of ribosomal binding and Group 350 mg/ 400 mg/ 450 mg/ 500 mg/ antibacterial properties of tylosin-type antibiotics. J. Antibiot. 1977;30(11): kg kg kg kg 1012–4. Finney DJ. Probit analysis. 3rd ed. Cambridge: Cambridge University Press; 1971. Cumulative mortality 0 (0/10) 30 (3/10) 50 (5/10) 60 (6/10) Gingerich DA, Baggot JD, Kowalski JJ. Tylosin antimicrobial activity and (%) pharmacokinetics in cows. Can. Vet. J. 1997;18(4):96–100. Joo et al. Fisheries and Aquatic Sciences (2020) 23:20 Page 18 of 18 Huang XJ, Choi YK, Im HS, Yarimaga O, Yoon E, Kim HS. Aspartate aminotransferase (AST/GOT) and alanine aminotransferase (ALT/GPT) detection techniques. Sensors. 2006;6(7):756–82. Jee BY, Shin KW, Lee DW, Kim YJ, Lee MK. Monitoring of the mortalities and medications in the inland farms of olive flounder, Paralichthys olivaceus,in South Korea. J. Fish Pathol. 2014;27(1):77–83. Joint FAO/WHO Expert Committee on Food Additives (JECFA). Toxicological evaluation of certain veterinary drug residues in food: Tylosin. 2009. Katz SE, Bardy MS. Antibiotic residues in food and their significance. Food Biotechnol. 2000;14(3):147–71. Kim JW, Cho MY, Jee BY, Park MA, Kim NY. Administration and use of aquaculture drugs in Korea. J. Fish Pathol. 2014;17(1):67–75. Kim JW, Lee HN, Jee BY, Woo SH, Kim YJ, Lee MK. Monitoring of the mortalities in the aquaculture farms of South Korea. J. Fish Pathol. 2012;25(3):271–7. Kowalski C, Roliński Z, Zań R, Wawron W. Pharmacokinetics of tylosin in broiler chickens. Pol. J. Vet. Sci. 2002;5:127–30. Lewicki J. Tylosin. A review of pharmacokinetics, residues in food animals and analytic methods. Available at the website of FAO at: ftp://ftp.fao.org/ag/agn/ food/tylosin_2006.pdf (Accessed 10 August 2008). 2006. Marsteller T, Winkelman N, Gebhart C, Armbruster G, Weldon W, Muller PR, Weatherford PJ, Symanowski J. Efficacy of intramuscular tylosin for the treatment and control of porcine proliferative enteropathy caused by Lawsonia intracellularis. Vet. Ther. 2001;3(1):5–7. Mata AI, Gibello A, Casamayor A, Blanco MM, Domínguez L, Fernández- Garayzábal JF. Multiplex PCR assay for detection of bacterial pathogens associated with warm-water Streptococcosis in fish. Appl. Environ. Microbiol. 2004;70:3183–7. Mishra A, Nam GH, Gim JA, Lee HE, Jo A, Kim HS. Current challenges of Streptococcus infection and effective molecular, cellular, and environmental control methods in aquaculture. Mol. Cells. 2018;41:495–505. Morton DM. Tylan products. Expert report on toxicological documentation. Unpublished report from Lilly research Laboratories, Eli Lilly and Company, Greenfield, IN, USA. Submitted to WHO by Elanco Animal Health, Division of Eli Lilly and Company, Indianapolis, IN, USA, 1988. NIFS. Investigation of safety and efficacy of fishery antibiotics customized by fish species. 2019. Final report. Prats C, El Korchi G, Francech R, Arboix M, Perez B. Disposition kinetics of tylosin administered intravenously and intramuscularly to pigs. Res. Vet. Sci. 2002;73: 141–4. rd Prescott JF, Baggot JD. Antimicrobial therapy in veterinary medicine. 3 edn. Iowa State University Press, Ames, IA, USA. 1988. Quarles JP. Acute comparative intravenous toxicity testing of tylosin, desmycosin and macrocin in the ICR mouse. Unpublished studies Nos M-V-46-83, M-V- 45-83 and M-V-44-83 from the Toxicology Division, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, IN, USA. Submitted to WHO by Elanco Animal Health, Division of Eli Lilly and Company, Indianapolis, IN, USA. 1983. Reimschuessel R, Chamie SJ, Kinnel M. Evaluation of gentamicin-induced nephrotoxicosis in toadfish. J. Am. Vet. Med. Assoc. 1996;209(1):137–9. Reimschuessel R, Williams D. Development of new nephrons in adult kidneys following gentamicin-induced nephrotoxicity. Ren. Fail. 1995;17(2):101–96. Shim JD, Hwang SD, Jang SY, Kim TW, Jeong JM. Monitoring of the mortalities in oliver flounder (Paralichthys olivaceus) farms of Korea. J. Fish Pathol. 2019; 32(1):029–35. Smith P, Hiney MP, Samuelsen OB. Bacterial resistance to antimicrobial agents used in fish farming: a critical evaluation of method and meaning. Annu. Rev. Fish Dis. 1994;4:273–313. Solez K. The pathology and pathogenesis of human “acute tubular necrosis”,In Solez, K. and Whelton, A. Acute renal failure: correlations between morphology and function. Marcel Dekker, Inc., New York. 1984; pp.17-42. Widmer AF. New development in diagnosis and treatment of infection in orthopaedic implants. Clin. Infect. Dis. 2001;33:S94–106. Ziv G, Sulman FG. Serum and milk concentrations of spectinomycin and tylosin in cows and ewes. Am. J. Vet. Res. 1973;34:329–33. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Journal

Fisheries and Aquatic SciencesSpringer Journals

Published: Aug 10, 2020

There are no references for this article.