Access the full text.
Sign up today, get DeepDyve free for 14 days.
E.M.EL-Bazza Zeinab, A. Hala, E.D.Z.EL-Fouly Mohie, Y.M.EL-Tablawy Seham (2001)
Inhibitory effect of gamma radiation and Nigella sativa seeds oil on growth, spore germination and toxin production of fungiRadiation Physics and Chemistry, 60
Ramalingam, N. Saraswathy, S. Shanmugapriya, S. Shakthipriyadarshini, S. Sadasivam, M. Shanmugaprakash (2010)
Decolorization of textile dyes by Aspergillus tamarii, mixed fungal culture and Penicillium purpurogenumJournal of Scientific & Industrial Research, 69
H. Kappus (1985)
12 – Lipid Peroxidation: Mechanisms, Analysis, Enzymology and Biological Relevance
J. Pitt, A. Hocking (1987)
Fungi and Food SpoilageFungi and Food Spoilage
E. Nikolaou, I. Agrafioti, M. Stumpf, J. Quinn, I. Stansfield, A. Brown (2009)
Phylogenetic diversity of stress signalling pathways in fungiBMC Evolutionary Biology, 9
Jong Kim, Jiujiang Yu†, N. Mahoney, K. Chan, R. Molyneux, J. Varga, D. Bhatnagar, T. Cleveland, W. Nierman, B. Campbell (2008)
Elucidation of the functional genomics of antioxidant-based inhibition of aflatoxin biosynthesis.International journal of food microbiology, 122 1-2
W. Tsai, J. Lambert, L. Bullerman (1984)
Simplified Method for Microscale Production and Quantification of Aflatoxin in Broth 1.Journal of food protection, 47 7
M. Reverberi, A. Fabbri, S. Zjalić, A. Ricelli, F. Punelli, C. Fanelli (2005)
Antioxidant enzymes stimulation in Aspergillus parasiticus by Lentinula edodes inhibits aflatoxin productionApplied Microbiology and Biotechnology, 69
M. Reverberi, S. Zjalić, A. Ricelli, F. Punelli, E. Camera, C. Fabbri, M. Picardo, C. Fanelli, A. Fabbri (2008)
Modulation of Antioxidant Defense in Aspergillus parasiticus Is Involved in Aflatoxin Biosynthesis: a Role for the ApyapA GeneEukaryotic Cell, 7
H Kappus (1985)
Oxidatice stress
S. Bukallah, M. Rauf, S. Ashraf (2007)
Photocatalytic decoloration of Coomassie Brilliant Blue with titanium oxideDyes and Pigments, 72
(2001)
Cloning: A LaboratoryManual 3 Ed. cold
J. Nabney, B. Nesbitt (1965)
A spectrophotometric method for determining the aflatoxinsAnalyst, 90
Xianchun Jin, Gao-Qiang Liu, Zhenghong Xu, W. Tao (2007)
Decolorization of a dye industry effluent by Aspergillus fumigatus XC6Applied Microbiology and Biotechnology, 74
I. Eichlerová, L. Homolka, L. Lisá, F. Nerud (2006)
The influence of extracellular H2O2 production on decolorization ability in fungiJournal of Basic Microbiology, 46
T. Jayashree, C. Subramanyam (2000)
Oxidative stress as a prerequisite for aflatoxin production by Aspergillus parasiticus.Free radical biology & medicine, 29 10
T. Yoshioka, K. Kawada, T. Shimada, M. Mori (1979)
Lipid peroxidation in maternal and cord blood and protective mechanism against activated-oxygen toxicity in the blood.American journal of obstetrics and gynecology, 135 3
W. Moye-Rowley (2003)
Regulation of the Transcriptional Response to Oxidative Stress in Fungi: Similarities and DifferencesEukaryotic Cell, 2
F. Ferreira, C. Kemmelmeier, C. Arrotéia, C. Costa, C. Mallmann, V. Janeiro, Francine Ferreira, S. Mossini, E. Silva, M. Machinski (2013)
Inhibitory effect of the essential oil of Curcuma longa L. and curcumin on aflatoxin production by Aspergillus flavus Link.Food chemistry, 136 2
I. Yumoto, Teruo Kusano, Tomohiro Shingyo, Y. Nodasaka, H. Matsuyama, H. Okuyama (2001)
Assignment of Pseudomonas sp. strain E-3 to Pseudomonas psychrophila sp. nov., a new facultatively psychrophilic bacteriumExtremophiles, 5
XC Jin, GQ Liu, ZH Xu (2007)
Decolorization of a dye industry effluent by Aspergilus fumigatus XC6Appl Environ Microbiol, 74
MK Refai, NH Aziz, F Far, AA Hassan (1996)
Detection of ochratoxin produced by A. ochraceus in feedstuffs and its control by radiationInt J Appl Rad, 47
S. Camarero, David Ibarra, M. Martínez, Angel Martı́nez (2005)
Lignin-Derived Compounds as Efficient Laccase Mediators for Decolorization of Different Types of Recalcitrant DyesApplied and Environmental Microbiology, 71
N. McNamara, H. Black, N. Beresford, N. Parekh (2003)
Effects of acute gamma irradiation on chemical, physical and biological properties of soilsApplied Soil Ecology, 24
(2003)
Inhibition of aflatoxin biosynthesis by gallic acid
L. Roze, R. Beaudry, N. Keller, John Linz (2004)
Regulation of aflatoxin synthesis by FadA/cAMP/protein kinase A signaling in Aspergillus parasiticusMycopathologia, 158
M. Refai, N. Aziz, F. El-Far, A. Hassan (1996)
Detection of ochratoxin produced by A. ochraceus in feedstuffs and its control by γ radiationApplied Radiation and Isotopes, 47
(2014)
Ann Microbiol
A. Gorran, M. Farzaneh, M. Shivazad, M. Rezaeian, A. Ghassempour (2013)
Aflatoxin B1-reduction of Aspergillus flavus by three medicinal plants (Lamiaceae)Food Control, 31
L. Coulibaly, G. Gourène, S. Agathos (2003)
Utilization of fungi for biotreatment of raw wastewatersAfrican Journal of Biotechnology, 2
T. Jayashree, C. Subramanyam (1999)
Antiaflatoxigenic activity of eugenol is due to inhibition of lipid peroxidationLetters in Applied Microbiology, 28
J Sambrook, DW Russel (2001)
Molecular Cloning: A Laboratory Manual 3rd Ed
S. El-Nagerabi, S. Al-Bahry, A. Elshafie, Saud AlHilali (2012)
Effect of Hibiscus sabdariffa extract and Nigella sativa oil on the growth and aflatoxin B1 production of Aspergillus flavus and Aspergillus parasiticus strainsFood Control, 25
C. Bon (2000)
The natural toxins.Biochimie, 82 9-10
Jiaquan Huang, Huifang Jiang, Y.‐Q. Zhou, Y. Lei, Sheng-Yu Wang, B. Liao (2009)
Ethylene inhibited aflatoxin biosynthesis is due to oxidative stress alleviation and related to glutathione redox state changes in Aspergillus flavus.International journal of food microbiology, 130 1
J. Ribeiro, L. Cavaglieri, H. Vital, A. Cristofolini, C. Merkis, A. Astoreca, J. Orlando, M. Carú, A. Dalcero, C. Rosa (2011)
Effect of gamma radiation on Aspergillus flavus and Aspergillus ochraceus ultrastructure and mycotoxin productionRadiation Physics and Chemistry, 80
Ann Microbiol (2014) 64:975–982 DOI 10.1007/s13213-013-0732-8 ORIGINAL ARTICLE Aflatoxin inhibition in Aspergillus flavus for bioremediation purposes Ola M. Gomaa & Salwa Abou El Nour Received: 13 April 2013 /Accepted: 2 October 2013 /Published online: 19 October 2013 Springer-Verlag Berlin Heidelberg and the University of Milan 2013 Abstract Although Aspergilli are known for their efficiency Introduction in bioremediation, some strains produce aflatoxins as second- ary metabolites adding another problem to the already existing Fungi, in general, possess the ability to degrade a wide variety environmental problem. A number of fungal isolates were of toxic environmental compounds; therefore, they are com- tested for their ability to treat laboratory waste water. A single monly used in bioremediation of different xenobiotics (Coulibaly et al. 2003). Fungi are also known to have a great isolate, Aspergillus flavus, was chosen for its ability to treat a mixture of laboratory wastes in 7 days; the long duration ability to adapt to extreme growth conditions, especially in the resulted in the production of aflatoxins. This production was presence of chemical contaminants including high levels of assumed to be the result of fungal exposure to stress. The metals, polychlorinated hydrocarbons, polyaromatic hydro- oxidative stress-related transcription factor (OSTRF) Yap1 carbons, dioxins, biphenyls, nitroaromatics and dyes (Jin was present on the genomic level, suggesting the regulation et al. 2007). Fungi use different modes to remove xenobiotics, of aflatoxin biosynthesis. Although exposure of the fungus to which include external adsorption, intracellular accumulation, 2.5 kGy gamma radiation was effective in aflatoxin and my- enzymatic degradation, or mineralization (Eichlerova et al. celial inhibition, green tea phenolic extract (ca. 70 mg/ml 2006). The interaction of xenobiotics with microbial cells is phenol) was used because it inhibited aflatoxin production considered a type of stress which activates gene expression while fungal mycelial growth was not affected. Aflatoxins resulting in alteration in cell metabolism, proliferation and B1, B2 and G1, G2 were evident in control cultures death. (0.34 μg/g) along with cultures spiked with hydrogen perox- Fungal cells respond to stress via a number of different ide (2.4 μg/g) which was considered the positive oxidant. On mechanisms such as membrane adaptation, intracellular the other hand, aflatoxins were absent completely in cultures changes, extracellular degradation, and/or chelation through supplemented with gallic acid (positive antioxidant) and green enzymatic or non-enzymatic processes (Yumoto et al. 2001); tea phenolic-containing extract. Lipid peroxidation results their response to oxidative stress could also play a key role in followed the same trend. The addition of phenolic green tea governing changes from cell protection to cell death extract inhibited aflatoxin biosynthesis; moreover, it did not (Reverberi et al. 2008). affect the potential of the fungus in bioremediation, or its Reactive oxygen species (ROS) such as superoxide anions, growth. hydrogen peroxide, hydroxyl radicals and lipoperoxides, which are formed from unsaturated fatty acids, can be pro- . . Keywords Aspergillus flavus Bioremediation Aflatoxin duced during different cellular metabolic activities. ROS can . . inhibition Oxidative stress Antioxidant be overproduced after exposure to oxidative stress (Kappus 1985), which has been shown to stimulate aflatoxin produc- tion in Aspergillus parasiticus (Reverberi et al. 2005). Afla- toxins are highly oxygenated polyketide secondary metabo- O. M. Gomaa (*) S. A. El Nour lites produced by some Aspergillus strains (Jayashree and Microbiology Department, National Center for Radiation Research Subramanyam 2000); they are hepato-carcinogenic, and even and Technology (NCRRT), Atomic energy Authority, low concentrations may have significant effect on food and 3 Ahmad El Zomor St, P.O. Box 29, Nasr City, Cairo, Egypt agricultural commodities (Kim et al. 2008). The mechanism e-mail: ola_gomaa@hotmail.com 976 Ann Microbiol (2014) 64:975–982 regulating the oxidative stress response in fungi is classified 72 °C for 10 min and the mixture was held at 4 °C until into two types: the nuclear localization control and the activity analysis. The amplicons were seperated by electrophoresis regulation via protein phosphorylation (Moye-Rowley 2003). on a 2 % agarose gel according to Sambrook and Russel There are different ways to control aflatoxin production, for (2001). example, the use of natural antioxidants has been shown to inhibit aflatoxin synthesis in Aspergillus flavus (Kim et al. Aflatoxin inhibition 2008), gamma radiation was used to kill the fungus prior to aflatoxin synthesis (El-Bazza et al 2001), and even by manip- Some compounds were used to inhibit or enhance aflatoxin ulating the signaling process (Roze et al 2004). Since there is a inhibition, 0.1, 0.25 and 0.5 M gallic acid were added to relation between oxidative stress and aflatoxin production, cultures on the day of inoculation. About 5 g of green tea and since some xenobiotics are known to exert an oxidative (obtained from China) was added to 50 ml of hot water and stress-like effect on fungi, the use of an antioxidant was was left to simmer; the infused tea extract was collected by presumed to inhibit aflatoxin biosynthesis. Therefore, the filtering through Mira cloth and stored at 4 °C. The phenol aim of the present work is to study the inhibition of aflatoxin content was assayed using the Folin-Ciocalteau method biosynthesis prior to the use of a fungal isolate in biological (Waterhouse 2006). A volume of 100 μl of Folin-ciocalteau treatment of liquid laboratory waste. reagent was added to 20 μl of sample and 1,580 μlof distilled water and mixed. About 300 μlof 20 % Na CO was added to 2 3 the reaction mixture and was allowed to stand for 30 min at Materials and methods 40 °C in water bath. Absorbance was read at 765 nm against blank (same mixture without the sample). A calibration curve Microorganism, culture conditions and detection of the Yap1 of gallic acid was used as reference. Hydrogen peroxide was gene added directly after inoculation (0.02, 0.04 and 0.06 % v/v). Control cultures were inoculated with A. flavus and incubated Six Aspergillus sp. and three Penicillium sp. isolates were as previously described. obtained from the microbiology department at the National Center for Radiation Research and Technology (NCRRT), Gamma radiation Cairo, Egypt, to test their potential use for treatment of labo- ratory liquid waste. The waste mainly contained glacial acetic Five ml of A. flavus spore suspension was put into separate acid, methanol and Coomassie Brilliant Blue G-250 (CBB) test tubes and used for gamma radiation experiments. Gamma dye. The fungi were grown in 50 ml liquid Czapeck's Dox irradiation of the spore suspensions was performed in tripli- media in 100 ml Erlenmeyer flasks; the liquid waste was cate at the cobalt source located at NCRRT, Cairo, Egypt. The added the following day (to prevent fungal growth inhibition) test tubes containing the spore suspension were subjected to and cultures were left to incubate at 30 °C at 150 rpm. The the following doses: 1, 2 and 2.5 kGy at a dose rate of culture showing a decolorized medium was considered for 3.08 kGy/h. Spore suspensions were inoculated into further use. The chosen isolate was identified microscopically Czapeck's Dox liquid medium in separate Erlenmeyer flasks as Aspergillus flavus through its conidi (Pitt and Hocking and were left to incubate at 30 °C at 150 rpm for 7 days. The 1985); it was grown and maintained on Czapeck's Dox agar aflatoxin extraction and assay is described later. medium. Spore suspension was prepared by collecting spores using 1 % Tween 80; count was ca. 6x10 . Inoculation was Extraction of aflatoxin from liquid medium done by adding 0.5 ml from spore suspension under sterile conditions. The fungal isolate was grown on Czapeck's Dox The inoculated flasks of 7-day old cultures were autoclaved at medium. DNA extraction took place using Genomic DNA 121 °C for 30 s to facilitate aflatoxin extraction and to kill extraction kit (Fermentas, EU). Detection of the genes conidia (Tsai et al. 1984). Aflatoxins were extracted (from encoding Yap1 was performed using the following primers: mycelium and filtrate) by chloroform (AOAC 2000); the AF-yap1F:5'-TCACACCAGTTCCTCTCATC, chloroform phase containing the aflatoxins was filtered AFyap1R:5'GCGGAACTTCTCCATAGATT (Reverberi through filter paper over anhydrous sodium sulphate and et al. 2008). evaporated to 1 ml using a rotary vacuum evaporator. Amplification was conducted in an Eppendorf Mastercycler Thermal Cycler with the following program: Purification and detection of aflatoxin initial denaturation at 94 °C for 1 min 30 seconds; this was followed by 40 cycles consisting of denaturing at 95 °C for The extracted aflatoxin was further purified by adding hexane 35 s, annealing at 55 °C for 55 s, and extension at 72 °C for and anhydrous diethyl ether; the mixture was spotted on Silica 1 min. The reaction was completed by a final extension at gel-G chromatogram plates by thin layer chromatography Ann Microbiol (2014) 64:975–982 977 (TLC) using pre-coated glass plates (20x20 cm) with a thin Coomassie Brilliant Blue dye (CBB) was added and the flasks layer (0.25 mm) of silica gel GF .Aliquots of 40 μlof the were incubated at 30 °C and 150 rpm until visually the blue sample extract and 40 μl of aflatoxins (B ,B ,G , and G2) color was absent. Samples were withdrawn from each flask 1 2 1 standards (10 μl/ml in chloroform) were separately spotted and by-products were extracted as follows: the culture filtrate onto the TLC plates. The spotted plates were developed in was extracted by adding an equal volume of ethyl acetate, the chromatographic jars using chloroform:acetone (9:1 v/v) as a extract was dried over anhydrous magnesium sulfate. The running solvent. After the solvent front had advanced 13- dried residue was re-dissolved in HPLC grade methanol and 15 cm above the origin of the spots, the chromatoplates were used to detect residual dye and formed by-prodcuts by means removed, dried and examined under a UV lamp at a wave- of HPLC (Agilent 1100 Series Waldborn, Germany) using a length of 362 nm in a dark chamber. Aflatoxins in the positive UV-Vis diode array detection, elution was at 30 °C with a flow samples were identified by visually comparing their R and rate of 0.7 ml/min using acetonitrile to phosphate buffer fluorescence with that of standards (AOAC 2000). (pH 7) ratio of 75:25. Detection was at 265 nm. Spectrometric determination of aflatoxin Results One ml of each chloroform sample extract was spotted onto a 0.5 mm thick silica gel GF plate (Nabney and Nesbitt Screeningofsomefungal isolatesusedinbioremediation 1965). The plate was developed in chloroform:acetone (9:1 v/v). The fluorescence bands with R identical to the About nine isolates were used to study their potential use in standards were scraped off, eluted with cold methanol bioremediation of laboratrory liquid waste containing metha- (10 ml), filtered and estimated using ATI Unicam, 5600 series nol, glacial acetic acid and CBB dye. Only two of the nine UV-VIS Spectrophotometer. Aflatoxins B and B were esti- isolates grew on Czapeck's agar plates and formed a clear zone 1 2 mated as aflatoxin B at 360 nm and aflatoxins G and G as in plates amended with the colored liquid waste; both isolates 1 2 aflatoxin G at 362 nm according to the formula: belonged to Aspergillus sp. (Table 1). The one with the widest decolorizing zone and growth, identified microscopically as A M 10 10 Aspergillus flavus, was used in the upcoming experiments. μgaflatoxins=g ¼ E 1 25 The primary gene involved in oxidative stress regulation is Yap1 coding one of the oxidative stress-related transcription Where: factors (OSTRFs) that play a key role in aflatoxin biosynthesis. A Absorbance at 360 or at 362 nm M Molecular weight (for B B =312, for G G =328) 1 2 1 2 E Extraction coefficient (for B B =21.800, for G 1 2 1 Table 1 Isolation, preliminary identification, growth and bioremediating G =17.700) ability of some Egyptian isolates Source of Preliminary *Radius of Decolorization Mycelial isolation identification decolorization of colored growth Fungal growth and lipid peroxidation of colored lab waste water (g/100 ml) waste in culture water (cm) broth The fungal biomass obtained at the end of the incubation period was washed with distilled water three times and dried in an Leaves Aspergillus sp. 0 - 0 oven at 70 °C for 24 h. Dry biomass was determined as dry Penicillium sp. 0 - 0 weight per volume. Lipid peroxidation was calculated as the Aspergillus sp. 1.2 ++ 3.1 concentration of malondialehyde (MDA) (the end product of Aspergillus sp. 0 - - lipid peroxidation) for A. flavus grown in gallic acid, phenolic- Vegetable Aspergillus sp. 4.5 +++ 5.8 containing green tea extract, and hydrogen peroxide and were Soil penicillium sp. 0 - - compared to those obtained from control cultures. Lipid perox- Penicillium sp. 0 - - idation was determined as thiobarbituric acid reactive substance Aspergillus sp. 0 - + (TBARS) according to Yoshika et al. (1979). Thedatarecorded Aspergillus sp. 0 - - are the mean values for triplicate separate experiments. *qualitative assay on solid agar media. Bioremediation potential of A. flavus For decolorization of colored waste water, - indicates no decolorization and + indicates decolorization, comparisons were based on preliminary Cultivation was performed as previously described; after in- visual observation. oculation, about 10 % of lab liquid waste containing 2 % of All data are the mean values of triplicate readings. 978 Ann Microbiol (2014) 64:975–982 Fig. 1 Appearance of the gene similar to those produced by aflatoxin standard, while gallic Yap1 in Aspergillus flavus as Yap1 acid and phenolic green tea extract, and exposure to gamma compared to 1 kb molecular radiation resulted in absolute absence of bands (Fig. 3). marker (M) Fungal growth and lipid peroxidation The fungal biomass did not show significant changes by the addition of aflatoxin inducers or inhibitors. Lipid peroxidation decreased 13- and 12-fold in gallic acid and phenolic green tea extract amended cultures, respectively. On the other hand, cultures amended with hydrogen peroxide Figure 1 shows the presence of a fragment representing the showed about 2.5-fold increase, as compared to control cultures (Fig. 4). Yap1 gene at about 700 bp. Bioremeidation The inhibition of aflatoxin Aspergillus flavus grown in the presence of phenolic green tea The use of different gamma radiation doses affected the afla- toxin production proportionally, aflatoxins were inhibited as extract and colored liquid waste showed decolorization after 7 days; the obtained HPLC chromatogram after the decolori- the gamma radiation doses increased. A complete inhibition was detected at 2.5 kGy (Fig. 2). Other compounds were zation showed seven peaks at retention times: 2.828, 4.179, added to the culture medium to study their effect on aflatoxin 4.742, 4.964, 5.204, 5.646 and 6.202 min with areas of 20.12, 33.16, 11.69, 9.75, 18.46, 3.81 and 2.98 % (Fig. 5-a) as biosynthesis. The addition of both 0.5 M gallic acid and green tea phenolic-containing extract (70 mg/ml) resulted in com- compared to five peaks detected after decolorization using A. flavus alone, the retention times were: 2.937, plete block for aflatoxin production, while the addition of hydrogen peroxide induced a sevenfold increase in aflatoxin 3.569, 4.252, 5.527 and 6.181 min with an area of 19.73, 7.65. 53. 34, 8.17 and 11.09 %, respectively (Fig. 5-b). On the production which reached 2.4 μg/g, as compared to 0.34 μg/g in control cultures. The detection of aflatoxin on TLC plates other hand, the HPLC chromatogram before decolorization showed a single peak at 2.65 min with an area of 84.51 % shows the presence of clear bands in control cultures and hydrogen peroxide amended cultures, those bands were (Fig. 5-c). 0.4 3 Fig. 2 Aflatoxin production in A. flavus cultures exposed to 0.35 2.5 different doses of gamma 0.3 radiation (i) and cultures amended 0.25 with different concentrations of 1.5 hydrogen peroxide (ii), gallic acid 0.2 ii (iii) as compared to 1 0.15 cultures amended with 0.5 0.1 green tea phenol-containing extract (iv) 0.05 0 0.01 0.02 0.03 0.04 0.05 0.06 0.07 0 0.5 1 1.5 2 2.5 3 Hydrogen peroxide (% v/v) Gamma Radiation (kGy) 0.4 0.4 0.35 0.35 iii iv 0.3 0.3 0.25 0.25 0.2 0.2 0.15 0.15 0.1 0.1 0.05 0.05 0 0.1 0.2 0.3 0.4 0.5 0.6 Control Phenol extract Gallic acid (M) Aflatoxin (ug/g) Aflatoxin (ug/g) Aflatoxin (ug/g) Aflatoxin (ug/g) Ann Microbiol (2014) 64:975–982 979 waste water containing CBB dye. Dyes are considered a type of cell wall stress which activates compensatory changes in the architecture of the microbial cell wall, through the cell wall stress signaling pathway, which is related to other types of stress such as osmotic stress and oxidative stress (Nikolaou et al. 2009). Several studies have correlated oxidative stress as a trigger for aflatoxin production and suggested that it is a prerequisite (Huang et al. 2009). When cells are exposed to oxidative stress, reactive oxygen species (ROS) act as a sec- ond messenger, therefore, triggering a series of metabolic 1 2 3 4 5 6 events, such as the aflatoxin biosynthesis (Reverberi et al. 2008). In yeast, oxidative stress-related transcription factors (OSRTFs) were activated by different oxidative stimuli such Fig. 3 Aflatoxin bands as they appear on silica gel plates. Chromoplates were visualized with UV lamp at 362 nm. The bands represent aflatoxin as peroxides, diamides and free radical generators as well as standard (1), control A. flavus culture (2), 0.5 M gallic acid amended antioxidant addition (Moye-Rowley 2003), a particular culture (3), phenolic-containing green tea extract amended culture (4), OSTRF is Yap1 which is a nuclear factor localized in the 0.06 % v/v hydrogen peroxide amended culture (5) and A. flavus culture cytoplasm and is considered to play a key role in aflatoxin exposed to 2.5 kGy gamma radiation (6) biosynthesis, probably by regulating the antioxidant enzymes and maintaining the oxidant/antioxidant balance (Reverberi Discussion et al. 2008). The Yap1 gene was detected in A. flavus under study, suggesting a high possibility for manipulating the afla- toxin synthesis. The liquid laboratory waste produced at the end of protein electrophoresis is usually collected in containers and stored A very common way for aflatoxin inhibition is the use of for a considerably long time before it is dealt with. The main gamma radiation. There are two effects for gamma radiation, component of the waste water is the CBB dye, and although the indirect effect, which involves the formation of ROS, and this dye belongs to the triarylmethane class which is consid- the direct effect on DNA, which leads to killing of the micro- ered recalcitrant, few research have focused on its removal; for bial cells (McNamara et al. 2003). Gamma radiation indeed example, Bukallah et al. (2007) used UV radiation and titani- was proposed to be efficient in eliminating toxigenic fungi um oxide as an advanced oxidative process. Aspergillus ta- prior to the formation of mycotoxins (Refai et al. 1996). mari, a mixed fungal culture and Penicillium purpurogenum El-Bazza et al. (2001) argued that gamma radiation prevented were also used to decolorize CBB as a biological removal fungal growth, thus preventing aflatoxin formation. On the method (Ramalingam et al. 2010). Many toxic strains of other hand, A. flavus exposed to low doses of gamma radia- tion increased aflatoxin production through increasing ROS Aspergillus are known to produce aflatoxins after long incu- bation periods. Unfortunately, some of these toxic producing (Ribeiro et al. 2011). For that reason, it is logical to use gamma strains are ones with high bioremediation capabilities, when radiation when it makes no difference if the microbe is living they are exposed to xenobiotic stress for a long period; they or not, but in the case of bioremediation, the viability and are prone to producing aflatoxins, which was the case when A. growth of the microbe are required. From that standpoint, and flavus under study was used in the bioremediation of lab since we need the fungus viable and in full growth, natural Fig. 4 Dry mycelial weight and lipid peroxidation of cultures supplemented with 0.5 M gallic acid and 70 mg/ml phenolic green 50 tea extract as compared to those for control and 0.06 % v/v hydrogen peroxide spiked cultures Control Gallic acid Phenolic extract Hydrogen peroxide Control Gallic acid Phenolic extract Hydrogen peroxide Dry weight (g/100 ml) MDA(Picomole/g wet mycelia) 980 Ann Microbiol (2014) 64:975–982 Fig. 5 HPLC chromatograms representing liquid waste treated with A. flavus and phenol-containing extract (a), A. flavus (b) as compared to liquid waste prior to treatment (c) antioxidants were hypothesized to intervene with aflatoxin was reported to inhibit aflatoxin production by Cary et al. production. In the present study, the addition of green tea (2003) as well. Caffeic acid, also a phenolic compound, was phenolic-containing extract, a natural antioxidant, resulted in reported to inhibit aflatoxin production (Kim et al. 2008). 100 % inhibition of aflatoxin. Gallic acid was used as a Other natural substances such as Hibiscus sabdariffa extract positive indicator for the antioxidative effect of phenols; it and Nigella sativa oil (El-Negerabi et al. 2012), curcumin Ann Microbiol (2014) 64:975–982 981 (Ferreira et al 2013), and medicinal plant extracts (Gorran References et al. 2013) were used to inhibit aflatoxin production in A. flavus, but none resulted in 100 % inhibition as the results AOAC (2000) Natural toxins. In:Trucksess MW(Ed.) Official Methods obtained in our study. The anti-aflatoxigenic activity of natural of Anlaysis of AOAC International, AOAC International. Gaithersburg, Maryland ,USA, p 2-37 antioxidants is probably connected to their ability to counter- Bukallah SB, Rauf MA, Ashraf SS (2007) Photocatalytic decoloration of act fungal oxidative stress responses up-stream of the aflatox- Coomasie Brilliant Blue with titanium oxide. Dyes Pigments 72: in biosynthetic gene cluster (Kim et al. 2008). To confirm that 353–356 ROS formation is the trigger for aflatoxin biosynthesis, hy- Camarero S, Ibarra D, Marinez MJ, Martinex AT (2005) Lignin-derived compounds as efficient laccase mediators for decolorization of differ- drogen peroxide, a potent oxidant, was added. The results ent types of recalcitrant dyes. Appl Environ Microbiol 71:1775–1784 show that natural antioxidants could block the aflatoxin pro- Cary JW, Harris PY, Molyneux RJ, Mahoney NE (2003) Inhibition of duction pathway thus preventing ROS formation, while hy- aflatoxin biosynthesis by gallic acid. Proceedings of the 16th Annual drogen peroxide increased the aflatoxin production. Hydrogen Aflatoxin Elimination Workshop, October 13-15, 2003, Savannah, Georgia. p. 40 peroxide generates highly reactive hydroxyl radicals which Coulibaly L, Gourene G, Agathos NS (2003) Utilization of fungi for initiates lipoperoxides in the membrane lipids thus resulting in biotreatment of raw wastewaters. Afr J Biotechnol 2:620–630 lipid peroxidation when antioxidant enzymes are exceeded by Eichlerova I, Homolka L, Lisa L, Nerud F (2006) The influence of ROS and lose their scavenging capacity (Reverberi et al. extracellular H O production on decolorization ability in fungi. J 2 2 Basic Microbiol 46:449–455 2008). Oxidative stress is considered a prerequisite in the El-Bazza ZEM, Farrag HA, El-Fouly MEDZ, El-Tablway SYEM (2001) biosynthesis process as reported by Jayashree and Inhibitory effect of gamma radiation and Nigella sativa seeds oil on Subramanyan (2000) in their comparative study between toxic growth, spore germination and toxin production of fungi. Rad Phys and non-toxic Aspergillus strains. Other reports corroborate Chem 60:181–189 El-Negerabi SAF, Al-Bahry SN, El-Shafie AE, AlHilali S (2012) Effect the involvement of free radicals and lipid peroxidation in of Hibiscus sabdariffa extract and Nigella sativa oil on the growth aflatoxin production (Jayashree and Subramanyan 1999; and aflatoxin B production of Aspergillus flavus and Aspergillus Huang et al. 2009). To confirm that the inhibition of aflatoxin parasiticus strains. Food Control 25:59–63 production by green tea phenol extract did not affect the Ferreira FD, Kemmelmeier C, Arroteia CC, da Costa CL, Mallmann CA, Janeiro V, Ferreira FMD, Mossini SAG, Silva EL, Machinski M Jr bioremediating ability of the fungus, HPLC chromatograms (2013) Inhibitory effect of the essential oil of Curcuma longa L. and were obtained before and after bioremediation of A. flavus curcumin on aflatoxin production by Aspergillus flavus.FoodChem and A. flavus incubated with green tea phenol extract. The 136:789–793 obtained results confirm that biodegradation took place; Gorran A, Farzaneh M, Shivazad M, Rezaeian M, Ghassempour A (2013) Aflatoxin B1-reduction of Aspergillus flavus by three me- hence, the appearance of several peaks which represent the dicinal plants (Lamiaceae). Food Control 31:218–223 degraded by-products in comparison to a single peak which Huang JQ, Jiang HF, Zhou YQ, Lei Y, Wang SY, Liao BS (2009) represents the dye before bioremediation took place. As a Ethylene inhibited aflatoxin biosynthesis is due to oxidative stress matter of fact, the addition of phenolic compounds increase alleviation and related to glutathione redox state changes in Aspergillus flavus. Int J Food Microbiol 130:17–21 the bioremediation capabilities of some fungi, natural phenols Jayashree T, Subramanyam C (1999) Antiaflatoxigenic activity of euge- acted as a mediator and enhanced the decolorization of recal- nol is due to inhibition of lipid peroxidation. Lett Appl Microbiol 28: citrant dyes (Camarero et al. 2005), which might explain the 179–183 appearance of seven peaks in the presence of green tea phenol Jayashree T, Subramanyam C (2000) Oxidative stress as a prerequisite for aflatoxin production by Aspergills parasiticus. Free Radic Biol Med extract as compared to five in its absence. Therefore, it is safe 29:981–985 to say that the presence of more peaks in the chromatograms Jin XC, Liu GQ, Xu ZH (2007) Decolorization of a dye industry effluent of decolorized waste in the presence of phenolic green tea by Aspergilus fumigatus XC6. Appl Environ Microbiol 74:239–243 extract is attributed to the natural phenolic content, and this in Kappus H (1985) Lipid peroxidation: Mechanism, Analysis, Enzymology and Biological Relevance. In: Sies H (ed) Oxidatice return have aided in the biodegradation process. Further work stress. Academic Press, London, UK is suggested to explore the exact enzymatic pathway of deg- Kim JH, Yu J, Mahoney N, Chan KL, Molyneux RJ, Varga J, Bhatnagar radation to enhance the process. D, Cleveland TE, Nierman WC, Campbell BC (2008) Elucidation of In conclusion, the use of fungi in bioremediation is consid- the functional genomics of antioxidant-based inhibition of aflatoxin biosynthesis. Int J Food Microbiol 122:49–60 ered very efficient and cost effective, yet some fungi belong to McNamara NP, Black HIJ, Beresford NA, Parkeh N (2003) Effects of toxigenic strains and have the ability to produce afla- acute gamma radiation on chemical, physical and biological prop- toxin, thus posing a serious problem. The process of erties of soils. Appl Soil Ecol 24:117–132 aflatoxin biosynthesis and production through the addi- Moye-Rowley WS (2003) Regulation of transcriptional response to oxida- tive stress in fungi: similarities and differences. Euc Cell 2:381–389 tion of natural antioxidant supplements is considered an Nabney J, Nesbitt BF (1965) A spectrophotometric method for determin- effective and cheap method of 100 % aflatoxin inhibi- ing the aflatoxins. Analyst 90:155–160 tion; this characteristic could be applied not only in the Nikolaou E, Agrafioti I, Stumpf M, Quinn J, Stansfield I, Brown AJP bioremediation field, but also in other fields like food (2009) Phylogenetic diversity of stress signalling pathways in fungi. preservation and post-harvest storage. BMC EvolBiol9:44–62 982 Ann Microbiol (2014) 64:975–982 Pitt JI, Hocking AD (1985) Fungi and Food Spoilage. Academic Press, radiation on Aspergillus flavus and Aspergillus ochraceus ultra- Sydney, Australia structure and mycotoxin production. Rad Phys Chem 80:658–663 Ramalingam NS, Shanmugapriya S, Shakthipriyadarshini S, Sadasivam Roze LV, Beaudry RM, Keller NP, Linz JE (2004) Regulation of aflatoxin S, Shanmugaprakash M (2010) Decolorization of textile dyes by synthesis by FadA/cAMP/protein kinase A signaling in Aspergillus Aspergillus tamari, mixed fungal culture and Penicillium parasiticus. Mycopathologia 158:219–232 purpurogenum. J Sci Ind Res 69:151–153 Sambrook J, Russel DW (2001) Molecular Cloning: A Laboratory Manual rd Refai MK, Aziz NH, El Far F, Hassan AA (1996) Detection of ochratoxin 3 Ed. cold Spring Harbor Laboratory Press, Cold Spring Harbor produced by A. ochraceus in feedstuffs and its control by radiation. Tsai WJ, Lambert JD, Bullerman LB (1984) Simplified method for Int J Appl Rad 47:617–621 microscale production and quantification of aflatoxin in broth. J Reverberi M, Fabbri AA, Zjalic S, Ricelli A, Punelli F, Fanelli C (2005) Food Prot 47:526–529 Antioxidant enzymes stimulation in Aspergillus parasiticus by Waterhouse A (2006) http://waterhouse.ucdavis.edu/phenol/folinmicro.htm Lentinula edodes inhibits aflatoxin production. Appl Microbiol Yoshika T, Kawada K, Shimada T, Mori M (1979) Lipid peroxidation in Biotechnol 69:207–215 maternal and cord blood and protective mechanism against Reverberi M, Zjalic S, Ricelli A, Punelli F, Camera E, Fabbri C, Picardo activated-oxygen toxicity in the blood. Am J Obstet Gynecol 135: M, Fanelli C, Fabbri AA (2008) Modulation of antioxidant defense 372–376 in Aspergillus parasiticus is involved in aflatoxin biosynthesis: a Yumoto I, Kusano T, Shingyo T, Nodasaka Y, Matasuyama H, Okuyama role for the ApyapA Gene. Euc Cell 7:988–1000 H (2001) Assignment of Pseudomonas sp. strain E-3 to Ribeiro J, Cavaglieri L, Vital H, Cristofolini A, Merkis C, Astoreca A, Pseudomonas psychrophila sp. nov. a new facultatively psychro- Orlando J, Caru M, Dalcero A, Rosa CAR (2011) Effect of gamma philic bacterium. Extremo 5:343–349
Annals of Microbiology – Springer Journals
Published: Oct 19, 2013
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.