Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Aflatoxigenic strains of Aspergillus section Flavi isolated from marketed peanuts (Arachis hypogaea) in Algiers (Algeria)

Aflatoxigenic strains of Aspergillus section Flavi isolated from marketed peanuts (Arachis... Ann Microbiol (2013) 63:295–305 DOI 10.1007/s13213-012-0473-0 ORIGINAL ARTICLE Aflatoxigenic strains of Aspergillus section Flavi isolated from marketed peanuts (Arachis hypogaea) in Algiers (Algeria) Nadjet Guezlane-Tebibel & Noureddine Bouras & Salim Mokrane & Tahar Benayad & Florence Mathieu Received: 27 November 2011 /Accepted: 13 April 2012 /Published online: 5 May 2012 Springer-Verlag and the University of Milan 2012 Abstract The present study reports on the natural myco- isolates (20.73 %) synthetized low levels of one or two biota occurring in Chinese peanuts marketed in Algiers, aflatoxins (AFB1 and AFG2). Aflatoxin production was paying special attention to the incidence of Aspergillus also screened on Coconut Agar Medium (CAM), and the section Flavi species that are potential producers of aflatox- results were consistent with the HPLC analysis. Based on ins. The mean value counts of fungi ranged from 155 to the combination of mycotoxins produced, five Aspergillus 577 CFU/g dry matter (DM) and the predominant fungi section Flavi chemotypes were established. Sclerotia pro- were different species of the genus Penicillium (83.81– duction expressed a correlation to aflatoxigenicity. The total 93.85 %) and Aspergillus belonging to section Flavi aflatoxins were detected in four analyzed samples at levels (2.73–73.96 %). Results indicated that 82 isolates (100 %) ranging from 0.71 to 25.50 μg/kg. Furthermore, the ampli- were aflatoxigenic. The Aspergillus section Flavi strains cons corresponding to the ITS1-5.8 S-ITS2 rDNA of six revealed that 65 isolates (79.27 %) were highly aflatoxi- representative strains showed that four strains belonged to genic, producing four kinds of aflatoxins [AFB1 (0.846– Aspergillus flavus, one to A. minisclerotigenes, and one to A. 3.330 μg/g), AFB2 (0.005–0.007 μg/g), AFG1 (0.008– caelatus. The results obtained indicate that there is a possi- 1.595 μg/g), and AFG2 (0.005–0.010 μg/g)], whereas 17 ble risk factor posed by aflatoxins contamination of peanuts marketed in Algiers. N. Guezlane-Tebibel (*) . . Keywords Aflatoxins Aspergillus section Flavi Laboratoire de Microbiologie. Faculté des Sciences Biologiques, Aflatoxigenic, Peanuts (Arachis hypogaea) Algeria Université des Sciences et de la Technologie Houari Boumediene, BP. 32 El Alia 16111, Bab Ezzouar, Algiers, Algeria e-mail: nanatebibe@hotmail.com Introduction N. Bouras S. Mokrane Laboratoire de Biologie des Systèmes Microbiens (LBSM), Mycotoxin contamination of food and feed presents a seri- Ecole Normale Supérieure de Kouba, ous food safety issue on a global scale, causing a high risk B.P. 92, for human and animal health and economic losses. Myco- 16 050 Vieux-Kouba, Algiers, Algeria toxins can be defined as small organic molecules of low T. Benayad solubility in water, non-degradable by living organisms, Laboratoire Central de Police Scientifique, able to provoke acute or chronic intoxication and damage Département de Sécurité Alimentaire et Environnement, to humans and animals after ingestion of contaminated food 1 rue Abdelaziz Khelalfa, Châteauneuf, and feed (Bennett 1987; Bourais and Amine 2006). Most Ben Aknoun, Algiers, Algeria mycotoxins encountered on agricultural products and sub- F. Mathieu ject to European regulations (European Recommendation Université de Toulouse, Laboratoire de Génie Chimique UMR No. 856/2005 of 6 June 2005) are aflatoxins, ochratoxins, 5503 (CNRS/INPT/UPS), ENSAT/INP de Toulouse, patulin, trichothecenes, penicillic acid, and fumonisins 1 avenue de l’Agrobiopôle, (D’Mello and MacDonald 1997). The most potent of the Castanet-Tolosan Cedex, France 296 Ann Microbiol (2013) 63:295–305 four naturally occurring AFs (AFB1, AFB2, AFG1, and microscopic fungi. The aim of this study was to screen and AFG2) is aflatoxin B1 (AFB1), which is listed as a group characterize the strains of Aspergillus section Flavi, based I carcinogen by the International Agency for Research on on a polyphasic approach involving morphological, chemi- Cancer (IARC 1982) because of its demonstrated carcino- cal, and molecular patterns, and to evaluate the rates of genicity to humans (Castegnaro and Wild 1995). Extensive contamination with aflatoxins in peanuts destined for human research has been carried out on the natural occurrence, consumption in Algeria. identification, characterization, biosynthesis, and genetic regulation of aflatoxins (Bennett and Klich 2003; Payne and Brown 1998; Yu et al. 2004). AFB1 is often found in Materials and methods highest concentrations in contaminated food and feed. It is likely to be present in a wide range of food plants or Sample collection animals: cereals (maize, rice, barley, wheat) and their deriv- atives, lentils, sunflower, soybean, fresh fruit or dried, pea- Four different samples of peanuts (all originated from nuts, almonds, walnuts, coconut, pistachio, coffee, cotton China), marketed in four regions of Algiers (Khraissia, seeds, spices (pepper, paprika, ginger), fruit juices, cider, Bab Ezzouar, Bordj El Kiffan, and Kouba), were subjected pastures, food from livestock and poultry, silage and fodder, to mycological analysis. The method of sampling was con- milk and derivatives, meat, etc., causing a loss of nutritional ducted at 4 different points in each evenly mixed 25-kg value. Therefore, the contamination of food with aflatoxi- peanut tank using a previously disinfected probe, consists genic fungi and the production of aflatoxins is a major of 250-g subsamples combined to get 1-kg laboratory sam- concern, which has received worldwide attention due to ples placed in sterile paper bags. Mycological evaluation their deleterious effects on human and animal health as well was done immediately, and all samples were stored at −20 °C as their importance in international food trade (Mishra and for mycotoxin analyses. Das 2003). Approximately 4.5 billion persons living in developing countries are chronically exposed to uncon- Isolation of mycobiota from peanut and culture conditions trolled amounts of the aflatoxins, which result in changes in nutrition and immunity (Williams et al. 2004). The Euro- Total fungal populations were isolated from peanut seed and pean Commission has set the maximum allowable total AFs quantitative enumeration was done using the surface-spread (AFB1, AFB2, AFG1, and AFG2) at 4 μg/kg, AFB1 alone method. Sub-samples (100 g) of each sample were finely at 2 μg/kg in cereals, nuts, and dried fruit ready for sale, and milled and 10 g were homogenized in 90 mL of 0.1 % AFM1 at 0.05 μg/kg in milk. Recent data indicate that peptone dissolved in water for 30 min on an orbital shaker. −2 −4 aflatoxins are produced by 13 species belonging to three Serial decimal dilutions (10 to 10 ) were performed as sections of the genus Aspergillus section Flavi (A. arach- described by Pitt and Hocking (1997), and a 0.1-mL aliquot idicola, A. bombycis, A. flavus, A. parvisclerotigenus, A. of each dilution was inoculated (in triplicates) on the surface minisclerotigenes, A. nomius, A. parasiticus, and A. pseu- of the Dichloran Rose-Bengal Chloramphenicol agar medi- dotamari) Nidulantes (Emericella astellata, E. venezuelen- um (DRBC) (Pitt and Hocking 1997). All Petri dishes were sis,and E. olivicola) Ochraceorosei (A. ochraceoroseus and incubated in darkness for 7 days at 25 °C. One of the three A. rambellii) (Frisvad et al. 2004; Turner et al. 2009; Varga sets of dilutions, averaging between 10–60 colonies per et al. 2009). Among these species, A. flavus, A. parviscler- Petri dish, was selected for counting and mycological anal- otigenus, and A. pseudotamari producing AFB1 and AFB2, ysis. The results were expressed as CFU/g of dry peanut and A. parasiticus and A. nomius developing the four AFs sample (colony-forming units per gram of DM: dry matter) (AFB1, AFB2, AFG1, and AFG2) are the most redoubtable. and isolation frequency (% of samples in which each genera Peanuts are important substrates for the growth and sub- was present). All colonies of Aspergillus section Flavi were sequent aflatoxin production by different members of As- sub-cultured on PDA tubes, incubated in darkness for 7 days pergillus section Flavi: A. flavus, A. parasiticus, A. nomius, at 25 °C then stored at 4 °C for subsequent characterization A. pseudotamarii, A. bombycis, A. arachidicola,and A. and taxonomic identification procedures. minisclerotigenes (Pildain et al. 2008; Sultan and Magan 2010). Soil serves as a reservoir for primary inoculum of A. Morphological characterization of the isolates of Aspergillus flavus and A. parasiticus (Horn and Dorner 1998; Horn et al. section Flavi 1995), and peanut pods are in direct contact with soil pop- ulations of aflatoxigenic fungi. The colonies of Aspergillus section Flavi from each PDA Algeria, importer of peanuts products, and attentive to the tube were sub-cultured at three points on 9-cm-diameter danger of aflatoxinogenic fungi has no information on the Petri dishes containing 20 mL of Czapek-Yeast extract Agar rate of mycotoxic harmful contaminants generated by these (CYA) medium, Malt Extract Agar (MEA) medium, Ann Microbiol (2013) 63:295–305 297 Czapeck-Dox Agar medium, and Aspergillus flavus and A. removed from different points of the colony for each culture, parasiticus Agar (AFPA) medium as reported by Riba et al. weighed and collected into small tubes. A volume of 0.9 mL (2010). Cultures were incubated for 4–7 days, in the dark, at of methanol was added to each tube, and the tubes were left 25 °C and then analyzed for standard morphological criteria stationary for 1 h. Extraction was done after 20 min of (color and colony diameter, head seriation, conidiophore centrifugation at 13,000 rpm for each tube and the extracts and conidia morphology, presence of hülle cells, morpholo- obtained were filtered through a 0.45-μm Millipore filter. gy of cleistothecia and ascospores, presence and size of Extracts were allowedtodry andthenre-suspended in sclerotia, etc.). For micromorphological observations, the 500 μL of chloroform. A volume of 15 μL of each extract isolates from MEA colonies were examined under the mi- was applied on a silica gel G plate (20 × 20 cm, 0.25 mm croscope (×10, ×40, ×100 magnification). Identification was thick, Merck 5721; Darmstadt, Germany), along with 1 μL performed according to the taxonomic keys for the Asper- of the standard of AFs mixture (containing AFB1 and AFG1 gillus genus (Klich 2007; Pitt and Hocking 1997; Raper and at 0.50 μg/mL each and AFB2 and AFG2 at 0.25 μg/mL Fennell 1977). each). The plates were developed in a chloroform-acetone (90:10, v/v) solvent system. After being dried the plates Aflatoxigenic ability of the isolates of Aspergillus section were observed under short (254 nm) and long wavelengths Flavi (365 nm); aflatoxins AFB and AFG appear as four spots in the order of mobility B2>B1 (blue)>G2>G1 (green) with Detection of aflatoxins by fluorescence on Coconut Agar R values 0.62, 0.57, 0.50, and 0.44 for AFB2, AFB1, Medium (CAM) AFG2, and AFG1 respectively. Sample spots were compared with the standards. The detection limit was 0.05 μg/g for all A preliminary screening for the production of AFs, by the AFs. fungal strains, was performed on the basis of emission of blue or green fluorescence after UV light excitation at Detection of aflatoxins by High Performance Liquid 365 nm after growth on Coconut Agar Medium (CAM) Chromatography (HPLC) supplemented with 0.3 % β-cyclodextrin (Davis et al. 1987; Fente et al. 2001). A piece of coconut (100 g) was HPLC was used to confirm the identity of the AFs and to homogenized for 5 min with 300 mL of hot distilled water. quantify them. AFs production by eight strains of Aspergil- The homogenate was filtered through layers of cheesecloth lus section Flavi, differentiated by their cultural characters, and the filtrate was adjusted to pH 7.0 with 2 N NaOH. Agar was determined following the method of Bragulat et al. was added (20 g/L) and the mixture was sterilized by auto- (2001). After 7 days of growth on Czapek yeast extract agar claving at 120 °C for 15 min. The isolates were inoculated (CYA) at 25 °C, three agar plugs (8 mm in diameter) were onto the 60-mm-diameter Petri dish containing 10 mL of removed, with a cork borer, from the inner, middle, and CAM. The cultures of 82 isolates were incubated for 7 days outer areas of each colony. Plugs were weighed and placed in the dark at 25 °C. All the cultures were periodically into Eppendorf tubes containing 1 mL of methanol for 1 h. verified for the appearance of colonies with brilliant The extracts were centrifuged at 13,000 rpm for 10 min and orange-yellow reverse coloration under daylight, and blue the supernatant filtered through a 0.45-μm hydrophilic or green fluorescence under long wavelength (365 nm) UV PVDF filter (Millipore), then recovered in HPLC vials, light after 3, 5, and 7 days and scored as positive or nega- and stored at 4 °C until analysis. The presence of AFs was tive. Fluorescence around colonies indicates the presence of detected by HPLC using a post-column derivatization elec- aflatoxins B and G that develop around the colony fluores- trochemically generated bromine (Kobra cell) and a fluores- cent blue and green, respectively; the appearance of colonies cence detector (Spectra physic 2000) (l0362 nm excitation, with orange-yellow reverse coloration was visible under l0435 nm emission). The HPLC column used was a reverse daylight. A blank consisting of sterilized, non-inoculated phase RP C18 ProntoSil analytical column (250 × 4 mm, CAM medium, incubated under the same conditions, was 3 μm particle size) preceded by a C18 pre-column (Ultrasep used as control. 10 × 4 mm) and the flow rate was 0.5 mL/min. For post- column derivatization, 119 mg potassium bromide and Detection of aflatoxins by Thin-Layer Chromatography 350 μL of nitric acid (4 M) were added to 1 L of the mobile (TLC) phase [20:20:60 (v/v/v) acetonitrile/methanol/ water], as suggested in the Kobra cell instruction manual. The system Thin layer chromatography (TLC) was used as a screening was run isocratically, with a flow rate of 0.5 mL/min; the method to identify the positive samples. The isolates were elution times for AFB1, AFB2, AFG1, and AFG2 were grown in Petri dishes containing (CYA) medium pH 6.7 for 30.2, 24.1, 22.5, and 21.4 min, respectively. The chromato- 7 days at 25 °C. Three agar plugs of the solid medium were grams were analyzed with Class-LC10 software version 1.6 298 Ann Microbiol (2013) 63:295–305 (Shimadzu). The limit of detection was 0.005 μg/kg for vacuum and dissolved in 50 μL of sterile ultra-pure water, AFB1 and AFG1 and 0.02 μg/kg for AFB2 and AFG2. then stored at −20°C until use. The quantification is obtained by measuring the peak area and by comparison with results obtained with standards. PCR reactions Analysis of AFs in peanuts The 5.8 S-ITS region was amplified by PCR using universal primers ITS1 (5′ TCCGTAGGTGAACCTGCGG 3′)and Extraction and purification of AFs from peanut samples ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) (White et al. 1990). PCR reactions were performed with a 50 μL final The extraction of AFs from peanut samples was performed volume, containing 200 ng of DNA template, 5 μL 10× according to the method of official methods of analysis reaction buffer (500 mM KCl, 100 mM Tris–HCl pH 9 and (CAMAG 1997). A quantity of 5.6 g of finely ground 15 mM MgCl ), 1 μL dNTP mixture (10 mM, each one), samples were added to 100 mL methanol into a separating 1 μL of each primer (50 μM), 1.5 μL MgCl (25 mM) and funnel, and mixed for 3 min. The mixture was homogenized 0.5 U of Taq DNA polymerase (MP Biomedicals and Qbio- and extracted with 40 mL sterile distilled water and mixed gene, Illkirch, France). The reaction mixtures were incubat- for 4 min, and then filtered through Whatman paper No. 1. ed in a thermalcycler (Stratagene 96 gradient Robocycler), To the filtrate, 20 mL of NaCl solution (10 %) and 20 mL and the reaction was carried out as follows: 1 step at 94 °C petroleum ether were added. The mixture was shaken for for 4 min, 30 cycles of the following three steps: 45 s at 2 min (the matrix is extracted in petroleum ether). To the 94 °C, 45 s at 55 °C, 50 s at 72 °C; and one final step at aqueous phase, 50 mL dichloromethane was added and 72 °C for 10 min. mixed for 1 min. After separation, the lower phase contain- ing AFs (dichloromethane) was collected. To this phase, 5 g Sequencing and data analysis sodium sulfate was added, and then filtered and evaporated to dryness. The extract was re-suspended in 0.5 mL of PCR products were purified using the JETQUICK PCR HPLC grade methanol, and filtered through a 0.2-μm Min- Purification Spin Kit (MP Biomedicals and Qbiogene) isart cartridge (Sartorius, Gottingen, Germany). The analysis according to the manufacturer’s instructions. Sequencing was performed using the HPLC method (as described of the purified PCR products was made by Millegen, Pro- above). logue Biotech (Labège, Toulouse, France). Nucleotide sequences were identified using the BLAST Determination of the recovery rates of aflatoxins algorithm at NCBI (Zhang et al. 2000). Phylogenetic anal- yses were conducted using the software MEGA version 4.0 The rate of aflatoxin recovery was determined by spiking an package (Tamura et al. 2007), the 5.8 S-ITS region sequen- AFB1-free sample (50 g of finely ground peanut) with an ces were aligned using the multiple-sequence alignment equivalent of 0.5, 5.0, 10, and 20 μg/kg of AFB1, from a program CLUSTAL W (Thompson et al. 1994), Evolution- 10 μg/mL stock solution of AFB1 dissolved in methanol. ary distance matrices were generated as described by Jukes Spiking was carried out in triplicates and a single analysis of and Cantor (1969) and a phylogenetic tree was inferred by a blank sample was also carried out. After allowing the the neighbor-joining method (Saitou and Nei 1987). Tree methanol solvent to evaporate overnight, AFB1 was topologies were evaluated by bootstrap analysis (Felsenstein extracted as described above. The percentage of aflatoxin 1981) based on 1,000 re-samplings of the neighbor-joining recovery (based on the results obtained by AFB1) was dataset. calculated and taken into account for the determination of aflatoxin levels in analyzed samples. Results Molecular characterization Mycological analysis DNA extraction Distribution of fungal genera Six isolates (C1-1, C1-2, C1-3, C3-1, C4-1, C5-1) regarding their ability to produce AFs along with two reference strains The mycological analysis, by plating dilutions of the sus- T T (A. flavus NRRL 3251 and A. parasiticus CBS 100926 ) pension peanut on selective media, allows the detection and were grown on YEA for 48 h, then the DNA extraction was evaluation of fungal genera. The results expressed in per- carried out according to the procedure described in details centages and CFU/g DM of the total mycoflora obtained in −1 −2 −3 by Liu et al. (2000), The DNA pellet is air-dried under dilution 10 as recorded in Table 1. In the 10 and 10 Ann Microbiol (2013) 63:295–305 299 Table 1 Distribution of fungi Sources samples Khraissia Bab Ezzouar Bordj El Kiffan Kouba isolated from peanut samples collected in four regions of Peanut samples C1 C3 C4 C5 Algiers (Algeria) Proteins (%) 25.41 24.67 22.66 23.33 Carbohydrates (%) 18.78 19.03 19.11 18.57 Lipids (%) 45.37 46.67 43.50 48.11 pH 5.09 5.73 5.18 5.64 Humidity (%) 6.10 6.58 5.54 7.32 Total number of fungi (cfu/g DM) 577 155 211 474 Fungi (%) Penicillium spp. 83.81 –– 93.85 Aspergillus section Flavi 10.06 22.88 73.96 2.73 Aspergillus section Nigri 2.23 12.50 – 2.73 Fusarium oxysporum 1.67 –– – Rhizopus spp. 2.23 64.62 26.04 0.69 – Not detected dilutions, the results are not statistically significant. Envi- color, conidia and conidiophore morphology, vesicle seria- ronmental analysis DRBC revealed a diverse mycological tion on MEA medium, presence or absence of sclerotia, and population. The following mycobiota isolated in the seed form of cleistothecia on CZ medium), all isolates belonged samples by using DRBC medium are: Penicillium spp., to the section Flavi. The major morphological characters Aspergillus section Flavi, Aspergillus section Nigri, Rhizo- identified for Aspergillus section Flavi distinction are: gen- pus spp. and Fusarium oxysporum; total number of fungal erally air or flat yellow-green colonies, with conidial heads propagules is between 155 and 577 CFU/g DM. Moreover, in shades; the mycelium formed filaments of irregular size, two samples revealed high contamination levels: C1 Ø(4–6 μm), often with dichotomous branching with acute (577 CFU/g DM) and C5 (474 CFU/g DM). Furthermore, or straight angles; smooth or rough conidiophores, straight the fungal species belonging to the genus Penicillium, are or sinuous, usually branched ending in one or more globular dominant in two samples (C1 and C5), with a rate of 83.81 or spherical vesiculars, spherical more or less elongated, and 93.85 %, respectively; however, no Penicillium isolates radial, varying in size. Around them is a row of phialides were found in other samples (C3 and C4). Moreover, the (uniseriate heads) within which arise spherical or oval wall Aspergillus section Flavi were present in all seeds samples, smooth or rough phialospores (conidia). The phialides are with a frequency of 2.73, 10.06, 22.88, and 73.96 % for C5, sometimes carried by metula (biseriate heads) and cover the C1, C3, and C4 respectively. On the other hand, the popu- whole (radial) or half (hemispherical) vesicle. The sclerotia lation of Aspergillus section Nigri is lower in the substrates; are present or absent and the cleistothecia are triangular or it was observed in samples C1, C3. and C5, with rates of spherical. 2.23, 12.50. and 2.73 %, respectively. However, Fusarium oxysporum was very rare, appearing only in the product C1 Identification of chemotypes in Aspergillus section Flavi at a low frequency (1.67 %). We observed an important presence of Rhizopus species in samples C3 (64.62 %) and Basedonmycotoxinproductionpatterns(AFB1,AFB2, C4 (26.04 %); however, they are less frequent in other AFG1, and AFG2) and the formation of sclerotia and cleis- samples: C1 (2.23 %) and C5 (0.69 %), respectively. tothecia, the 82 strains were classified into five chemotypes (Table 3). Chemotye I was represented by 15 isolates Morphological characterization of Aspergillus section Flavi (18.30 %) producing four AFs (AFB1, AFB2, AFG1, and strains AFG2), sclerotia type L and spherical cleistothecia. Chemo- type II consists of a single isolate (1.22 %), which produced In the present assay, we aimed to identify and characterize four AFs and sclerotia type L; however, the cleistothecia are 82 Aspergillus isolates belonging to section Flavi. Referring absent. Chemotype III was represented by 49 isolates to keys established by Raper and Fennell (1977), Pitt and (59.75 %) that produced four AFs with a mixture of high Hocking (1997), and Cahagnier (1998), our identification production of AFG1 and AFG2, and sclerotia type L; how- was based on standard criteria for strains purified by single- ever, the cleistothecia are absent. Chemotype IV includes 4 spore culture; the morphological characters are summarized isolates (4.88%)thatproduced onlyAFB1and AFG2; in Table 2. On the basis of macro- and micro-morphological sclerotia type L and triangular cleistothecia are present. characters (mainly appearance on CYA medium, colony Finally the chemotype V was represented by 13 isolates 300 Ann Microbiol (2013) 63:295–305 Table 2 Determination of morphological and chemical characterization of 82 of Aspergillus section Flavi Isolated from four peanut samples collected in different regions of Algiers (ALGERIA) a g Morphology Toxigenicity Number Codes of of strains representative c d i i i i Sclerotia Cleistothecia Seriation Conidia Colony Colony Fluorescence AFB1 AFB2 AFG1 AFG2 strain b e h size (mm) color diameter on CAM (mm) 0.80 spherical u/b r/s yg 56 b ++ −/+ +/−−/+ 12 C1-1 0.80 triangular u/b r yg 54 b + –– −/+ 4 C1-2 –– u/b r/s gy 46 – −/+ –– – 2 C1-3 –– u r/s yg 90 – +/− –– – 11 C3-1 0.75 to 0.86 – u r/s yg 60 g/b ++ +/− ++ +/− 49 C4-1 0.90 to 1.0 – u r/s yg 90 g ++++ −/+ + −/+ 1 C5-1 0.70 to 1.0 spherical u r/s yg 46 g ++++ +/− ++ +/− 2 C5-2 0.85 to 1.1 spherical u/b r yg 41 b/g ++++ −/+ + +/− 1 C5-3 Isolates were grown for 4 days at 25 °C, on MEA medium (except sclerotia and cleistothecia were tested on CZ medium), and observed by light microscopy; – absence on CZ medium Size is average of sclerotia in mm, (on CZ medium) u uniseriate; b biseriate; u/b predominantly uniseriate (on MEA medium) r rough; r/s rough or smooth (on MEA medium) yg yellowish green; gy green yellow (on MEA medium) average of 3 colonies in mm (on MEA medium) Isolates were grown for 7 days at 25 °C, on CYA medium, and tested by TLC b blue; g green; g/b green-blue; b/g blue-green ++++ strong signal; ++ medium signal; +/− weak signal; −/+ very weak signal; – not detected C1, C3, C4 and C5 represent the four different regions of Algiers: Khraissia, Bab Ezzouar, Bordj El Kiffan and Kouba, respectively (15.85 %), which were able to produce only AFB1; and no or green fluorescence as shown in Table 2. HPLC analysis sclerotia or cleistothecia were observed. In addition, we showed that among the 82 strains tested, 82 (100 %), 65 observed that among the 82 isolates tested, 65 (79 %) are (79.27 %), 65 (79.27 %), and 69 (84.15 %) were AFB1, able to produce all AFs analyzed (AFB1, AFB2, AFG1, and AFB2, AFG1, and AFG2 producers, respectively, as shown AFG2). in Table 3. Isolates of Aspergillus section Flavi were classi- fied into four groups according to their capacity for produc- Aflatoxin production by isolates of Aspergillus section Flavi ing AFB1 on CYA, which ranged from 0.005 to 3.33 μg/g of medium as reported in Table 4. Four isolates (4.88 %) In this study, the ability for producing AFs (AFB1, AFB2, presented high aflatoxigenic capacity with mean levels of AFG1, and AFG2) was tested for 82 isolates collected from AFB1 ranging from 2.46 to 3.33 μg/g, and 61 (74.39 %) 4 peanut seed samples. Aflatoxin production was screened were moderately aflatoxigeniic (0.70–0.85 μg/g of medium) on Coconut Agar Medium (CAM), and the results revealed as demonstrated by HPLC analysis. Furthermore, we ob- that 69 isolates of Aspergillus section Flavi (84.15 %) were served that four strains (4.88 %) were able to produce small quantities of AFB1 in the 0.065 μg/g range. However, 13 of aflatoxigenic. They produced a blue, green-blue, blue-green, Table 3 Chemotype patterns of Chemotype Mycotoxins Sclerotia Cleistothecia Number of strains Percentage (%) Aspergillus section Flavi strains on Aflatoxins, Sclerotia and AFB1 AFB2 AFG1 AFG2 Cleistothecia producing ability I + + + + + spherical 15 18.30 II +++ + + – 1 1.22 III + + + + + – 49 59.75 IV + –– + + triangular 4 4.88 Percentage of the 82 isolates V+ –– – – – 13 15.85 – Absence Ann Microbiol (2013) 63:295–305 301 Table 4 Occurrence and AFB1-producing ability of 82 strains of Table 6 Contamination rate of four peanut samples collected in Aspergillus section FLAVI isolated from peanut samples different regions of Algiers (Algeria) a a AFB1 (μg/g) Number of strains Percentage (%) Peanut samples Aflatoxins production in peanuts (μg/kg DM) AFB1 AFB2 AFG1 AFG2 Totals 0.005 to 0.01 13 15.85 0.011 to 0.10 4 4.88 C1 (Khraissia) 0.45 0.17 0.19 0.20 1.01 0.11 to 1 61 74.39 C3 (Bab Ezzouar) 20.50 – 4.83 0.17 25.50 1.1 to 3.33 4 4.88 C4 (Bordj El Kiffan) 0.62 0.16 0.57 0.17 1.52 C5 (Kouba) 0.29 – 0.42 – 0.71 The amounts of AFB1 were calculated after 7 days of growth on CYA at 25 °C and analyzed by HPLC Aflatoxin production in 4 samples of peanut, tested by HPLC; DM dry matter 82 isolates (15.85 %) produced AFB1 at very low levels ranging from 0.005 to 0.006 μg/g of medium. – Not detected The results of AF production by each of the representa- Bab Ezzouar region, which far exceeded the regulatory tive strains are summarized in Table 5. The results obtained standards. The AFB2 was present only in two samples with showed that all the tested strains are able to produce AFB1. a value of 0.16–0.17 μg/kg of peanut. The toxins AFG1 and However, two strains (C1-3 and C3-1) are not able to AFG2 are present at variable rates; AFG and AFG were 1 2 produce AFB2, AFG1, and AFG2, and one strain (C1-2) is detected, respectively, in 100 and 75 % of the contaminated not able to produce AFB2 and AFG1. Moreover, the capac- samples. Their concentrations varied from 0.19 to 4.83 μg/kg ity for producing AFs was ranged from 0.005 to 3.330 μg/g for AFG1 and from 0.17 to 0.20 μg/kg for AFG2. AFB1 is the CYA (for AFB1), 0.005 to 0.007 μg/g CYA (for AFB2), most potent of the four naturally occurring AFs. It should be 0.008 to 1.715 μg/g CYA for (AFG1), and 0.005 to noted that these substrates are contaminated with AFB1 and 1.057 μg/g CYA (for AFG2). AFG1 toxins that are carcinogenic. Aflatoxin content in sample peanuts Molecular characterization of the Aspergillus section Flavi isolates The different amounts of the sum of aflatoxins detected in each sample of peanuts are summarized in Table 6. The Identification of the six chosen isolates (C1-1, C1-2, C1-3, aflatoxin production suggests that the four substrates were C3-1, C4-1, and C5-1) was based on the 5.8 S-ITS region. contaminated in varying doses depending on their nature. Thus, a set of primers (ITS1 and ITS4) was used to amplify The incidence of contamination was 100 % with concen- the rDNA region, which includes the two-non-coding ITS1 trations ranging from 0.71 to 25.50 μg/kg. The AFB1, the and ITS2 segments and the 5.8 rRNA gene. The results major toxic form, was detected in all four samples examined showed that the size of all the amplified PCR products (100 %) with levels ranging from 0.29 to 20.50 μg/kg; the including those belonging to reference strains (A. flavus highest rate (20.50 μg/kg) was found in the sample from the T T NRRL 3251 and A. parasiticus CBS 100926 ) were esti- Table 5 Production of Aflatoxins (AFB1, AFB2, AFG1, and AFG2) mated to be 590 bp. by representative strains of Aspergillus section Flavi Our BLAST data showed that the isolates C1-1, C3-1 C4- 1, and C5-1 were related to A. flavus isolate NRRL 4998 Codes of representative strain Aflatoxins production of strains (μg/g CYA) with a similarity ranging between 100 and 99 %, whereas the isolate C1-3 matched A. caelatus strain NRRL 25528 AFB1 AFB2 AFG1 AFG2 Totals with a 100 % similarity. However, the isolate C1-2 was more closely related to A. minisclerotigenes CBS 117635 . C1-1 0.846 0.005 0.008 0.005 0.859 C1-2 0.065 –– 0.005 0.066 C1-3 0.005 –– – 0.005 Discussion C3-1 0.006 –– – 0.006 C4-1 0.684 0.007 1.715 1.057 2.287 Peanuts, being a popular food product, have a high number C5-1 2.460 0.005 0.091 0.005 2.555 of uses. Peanuts contain a class of fatty acids called mono- C5-2 3.330 0.007 0.277 0.010 3.624 unsaturated fats. Monounsaturated fats are part of the Med- C5-3 2.566 0.005 0.103 0.008 2.682 iterranean diet and are known to decrease risk of Isolates were grown for 7 days at 25 °C, on CYA medium, and tested cardiovascular disease. Unfortunately, in Algiers, these by HPLC products face a number of abiotic factors such as high 302 Ann Microbiol (2013) 63:295–305 humidity, and a temperature conducive to the growth of Alternaria spp., Aspergillus spp., Fusarium spp., and Penicil- fungi, when sold in grocery stores or markets whether lium spp., take place when the moisture content of their stocked in open cases or in plastic packaging. Penicillium substrata is higher than 13 % for cereals and beans, and higher spp., Aspergillus spp. (especially those belonging to section than 5–7 % for peanuts and oil products. In our investigation, Flavi), Fusarium spp. and Rhizopus spp. were the major we note that section Flavi colonized virtually all varieties fungal species most commonly isolated from our sample analyzed despite the acidic pH of the samples. They also peanuts. Hanlin (1969) indicated that Penicillium was the tolerated low humidity. Penicillium spp. and Aspergillus spp. most common genus isolated from Spanish peanut shells. have long been considered mainly as storage fungi; our results The level in seeds was lower, but in both shells and seeds demonstrate that they contaminate the seeds of peanuts. In there were more Penicillium spp. The soil, plants, and comparison to previously published results by the authors organic wastes are usually primary habitats of fungi. Fur- cited above, our investigated samples showed a fungal con- thermore, the high frequency of Penicillium spp., Fusarium tamination whatever their physical and chemical environment. spp., and Aspergillus spp. in soil samples have already been The screening of fungi isolated for aflatoxin production described (Klich 1998). These molds in the form of fila- revealed that 82 Aspergillus section Flavi isolates (100 %) ments or conidia are present in almost all environments: were aflatoxigenic. Our isolates are able to synthesize one, soil, the atmosphere, and water. Weather phenomena (atmo- two, three, or all four AFs. The biosynthesis of aflatoxins, spheric turbulence, rain), human activities (particularly like all secondary metabolites, is strongly dependent on earthworks), and animals, especially insects, are secondary growth conditions such as substrate composition (Luchese factors influencing the dispersal of conidia (Cole and and Harrigan 1993) or physical factors like pH, water activ- Kendrick 1981). However, the isolates of Aspergillus sec- ity, temperature, or modified atmosphere (Ellis et al. 1993; tion Flavi were present in all seed samples analyzed. Pea- Molina and Gianuzzi 2002). Differences in this expression nuts are often invaded before harvest by Aspergillus flavus can also be detected within the same species. Indeed, all and A. parasiticus, fungi which produce the carcinogenic isolates of the same species do not have all the enzyme aflatoxins (Horn et al. 2001); Pitt et al. (1993) have already systems required for the production of mycotoxins (Nicholson reported that A. flavus was the dominant fungi isolated from et al. 2003). Thus, the progress of the chemotaxonomy has peanut samples. Furthermore, A. parasiticus was the fungi shown that, for the same species, substance profiles are dif- isolated the most from inside of dry pods, detected in 80 % ferent when the fungus is sampled on the natural substrate or of the samples. Soil is a reservoir for species of section Flavi from a culture in Petri dishes (Reboux 2006). The new Euro- (A. flavus strains, A. parasiticus, A. caelatus, and A. tam- pean standards on aflatoxin levels allowed for peanuts, en- arii), species of section Nigri, and A. terreus; densities of hanced by particularly stringent standards for sampling, these fungi in soil vary greatly among fields and may require effective control techniques. There are approximately influence the severity of peanut infection (Horn 2006). 75 % similarity of the results between the coconut agar meth- The same author also reported that soil is a reservoir for od and HPLC. Similar results were obtained by Giorni et al. Aspergillus flavus and A. parasiticus, fungi that commonly (2007) who found that 73 % of Aspergillus section Flavi colonize peanut seeds and produce aflatoxins. Aspergillus strains isolated from maize showed fluorescence when inocu- flavus and A. parasiticus are the major producers of aflatox- lated on coconut agar medium and 70 % of the strains were in, as they can colonize virtually all raw materials especially positive when tested by HPLC. Our strains were classified cereals and vegetable oilseeds provided the temperature is into five different chemotypes, based on patterns of mycotox- above 15 °C, and if possible between 30 °C and 40 °C, and in, sclerotia, and cleistothecia production. We observed that all are the ultimate harmful mold in hot and wet climates the AFs producers have yellow-green colonies producing (Berthier and Valla 1998). The currently available data large sclerotia and sometimes the cleistothecia; 69 aflatoxi- indicate that four fungal species identified from peanut genic strains (84.15 %) are able to produce sclerotia (chemo- seeds were always inevitably present in the atmosphere types I, II, III, and IV). The genetic diversity within A. flavus (Cole and Kendrick 1981) and in the field, and persist on populations has been widely studied in relation to their poten- the dried seeds for a long time: Aspergillus flavus, A. niger, tial aflatoxigenicity and morphological variant L- and A. parasiticus, and Fusarium spp. This means that during S-strains. Within A. flavus and other Aspergillus species storage the atmospheric humidity on the premises must capable of aflatoxin production, considerable diversity is remain equal to that of the stored product and if possible found. Kozakiewicz (1989) reported that production of scle- less than or equal to 70 % (Berthier and Valla 1998). The rotia is a rare characteristic of A. flavus strains only, and in relative humidity and the pH measured in our samples agreement with Klich (2007), the presence of sclerotia does ranged from 5.54 to 7.32 % and from 5.09 to 5.73, respec- not seem to be related to aflatoxin production, but the presence tively (Table 1). Zehrer (1996) indicated that infestations by of small sclerotia appears to be correlated with high aflatoxin fungi, some of which are known from crop protection such as production. Several researchers have tried to establish a Ann Microbiol (2013) 63:295–305 303 correlation between sclerotia production ability and aflatox- different aflatoxins, AFB1 is known to be the most signifi- igenicity, but published data are contradictory. Some of cant in terms of animal and human health risk. This toxin clinical A. flavus isolates could have aflatoxin- and sclerotia- was present in all contaminated samples, at amounts ranging producing abilities, but not necessarily all aflatoxigenic A. from 0.29 to 20.50 μg/kg. Because peanuts are used for flavus isolates are capable of producing sclerotia (Dehghan food, strict regulatory limits for the amount of aflatoxin in et al. 2008). peanut products have been established. For raw peanuts Many studies refer to a positive correlation between entering the EU, the level must be<4 μg/kg total aflatoxins high aflatoxin production and presence of small sclerotia and have not more than 2 μg/kg B1 (European Commission (Chang et al. 2001;Cotty 1989, 1997; Novas and Cabral 2006). Usually, pre-harvest aflatoxin contamination occurs 2002; Pildain et al. 2004). Inconsistency of results may under conditions of nutrient and drought stress during the arise from the fact that fungal growth conditions have not later stages of the growing season (Blankenship et al. 1984; been standardized and several culture media have been Dorner and Cole 2002; Hill and Lacey 1983). Their high used for this purpose. In agreement with Cotty (1989), S- frequency in peanut samples in the China or Argentina type strains usually produce high levels of aflatoxins and regions is likely due to the very hot and dry summer con- numerous sclerotia smaller than 400 μm in diameter. How- ditions. The presence of Aspergillus section Flavi in peanuts ever, the morphological characters can vary: for instance, has previously been reported in China, Japan, South Africa, sclerotia which are characteristic of some species are not the U.S., Argentina and Paraguay (Okano et al. 2008). Other always present in all isolates of the same species, and their authors report that these species have been detected in soils production can vary among cultures of the same isolate. of Arizona, Thailand, and West Africa (Vaamonde et al. Among our eight isolates of Aspergillus section Flavi,we 2003); Sultan and Magan (2010) demonstrated the suscep- could only detect the L-morphology, since four produced tibility of Egyptian peanut to colonization with Aspergillus sclerotia bigger than 400 μm under the tested conditions. section Flavi, especially A. flavus isolates. The present study Giorni et al. (2007) and Razzaghi-Abyaneh et al. (2006) demonstrated the susceptibility of peanuts to colonization report no correlation between sclerotial production/size with Aspergillus section Flavi, especially A. flavus isolates. and aflatoxigenicity, similar to the case of one of our The multiple sequences alignment established by the strains, a high producer that does not produce sclerotia; program CLUSTAL W showed that 4 isolates (C1-1, C3- or even an inverse correlation, with L-type strains being 1 C4-1, and C5-1) are identical to several aflatoxinogenic the most aflatoxigenic (Abbas et al. 2005). type strains. They formed a distinct group, cluster I, con- We could not establish a correlation between sclerotia sisting of A. flavus that showed high similarities (99–100 %) presence size and toxigenicity. In our case, three isolates using the 5.8 S-ITS region; the similarity was equal to which are L-type strains were the most toxigenic. Peanuts 100 % with A. flavus isolate NRRL 4998 [EF661566], are important substrates for the growth and subsequent while the isolate C5-1 has 99 % similarity with the strain aflatoxin production by different species of Aspergillus sec- A. flavus isolate NRRL 4998 [EF661566]. The four strains tion Flavi: A. flavus, A. parasiticus, A. nomius, A. pseudo- (C1-1, C 3–1, C4-1, and C5-1) generally producers of AFB1 tamarii,and A. bombycis (Sultan and Magan 2010). or the four AFs (AFB1, AFB2, AFG1, and AFG2) seem to Recently, additional new aflatoxin-producing species have be related mainly to the species A. flavus. Bayman and Cotty been isolated from peanuts in Argentina (A. arachidicola (1993), Egel et al. (1994), and Geiser et al. (2000) reported and A. minisclerotigenes; Pildain et al. 2008). Generally, the that isolates of A. flavus are genetically very diverse. Al- fungal species can infect peanuts both pre-and post-harvest though it is generally accepted that A. flavus produces only (Barros et al. 2003; Cotty 1997). As with fungi in general, AFB, production of AFG has also been reported in the Aspergillus taxonomy is complex and ever evolving. The literature (Gabal et al. 1994; Giorni et al. 2007). We ob- genus is easily identified by its characteristic conidiophores, served significant differences in the sequences of C1-2 and but species identification and differentiation is complex, for C1-3 isolates. However, our sequence data show clearly that it is traditionally based on a range of macro- and micro- these two species are genetically different. The C1-2 isolate morphological features. Furthermore, all these morphologi- produces aflatoxins AFB1 and AFG2 forming cluster II and cal criteria have to be determined under standardized labo- has 98 % similarity with A. minisclerotigenes isolate CBS ratory conditions by trained mycologists, in order to obtain 117635 [EF409239]. The C1-3 strain synthesizes aflatoxin an accurate identification. Many authors reported that the B1, constitutes cluster III, and had 100 % similarity with A. percentage of highly aflatoxigenic isolates was stronger caelatus NRRL 25528 [AF004930]. Through these results, among A. flavus from groundnuts than A. flavus from wheat, we can conclude that our strains were distributed in the maize, or animal feedstuffs. clade of the Aspergillus section Flavi. Furthermore, the mycotoxin analyses indicated that afla- The results we obtained allowed us to identify in our toxins were present in 100 % of the samples. Among the peanuts as three different species of Aspergillus section 304 Ann Microbiol (2013) 63:295–305 Bayman P, Cotty PJ (1993) Genetic diversity in Aspergillus flavus: Flavi involved in the mycotoxin biosynthesis. These are association with aflatoxin production and morphology. Can J Bot Aspergillus flavus, A. minisclerotigenes,and A. caelatus. 71:23–34 Seventy-six isolates (92.69 %) were A. flavus, all being Bennett JW (1987) Mycotoxins, mycotoxicoses, mycotoxicology. aflatoxin producers; of the 76 A. flavus isolates positive Mycopathologia 100:3–5 Bennett JW, Klich M (2003) Mycotoxins. Clin Microbiol Rev 16:497– forAFs,65 (79.26%)wereabletosynthetizeall AFs (AFB1, AFB2, AFG1, and AFG2), 4 isolates (4.87 %) were Berthier J, Valla G (1998) Moisissures - mycotoxines et aliments: du A. minisclerotigenes producers of two aflatoxins (AFB1 and risque à la prévention. Rev Med Vet 149:479–492 AFG2), and 2 isolates (2.44 %) identified as A. caelatus or A. Blankenship PD, Cole RJ, Sanders TH, Hill RA (1984) Effect of geocarposphere temperature on preharvest colonization of pseudocaelatus, producers of one aflatoxin (AFB1) as dem- drought stressed peanut by Aspergillus flavus and subsequent onstrated by HPLC analysis. It is well known that some aflatoxin contamination. Mycopathologia 85:69–74 species of this Aspergillus section are considered the most Bourais I, Amine A (2006) Aflatoxines toxiques redoutables dans nos significant mycotoxigenic fungi (Moss 1996). aliments. Les techniques de laboratoire. No. 0/2006. p. 4–8 Bragulat MR, Abarca ML, Cabanes FJ (2001) An easy screening However, in Algeria, little research has been done on the method for fungi producing ochratoxin A in pure culture. Int J occurrence of mycotoxigenic fungi, species identification, Food Microbiol 71:139–144 and mycotoxin evaluation. Although the number of samples Cahagnier B (1998) Moisissures des aliments peu hydratés. Lavoisier analyzed was limited, for the first time the results obtained Tec & Doc, Paris CAMAG (1997). Determination of aflatoxins B1, B2, G1 and G2 in in this study have provided information about the presence foodstuffs. CAMAG, Application notes, BIBLIOGRAPHY SER- and distribution of mycotoxigenic fungi in peanuts marketed VICE (CBS). Thin-layer chromatography. 79, p. 10 in Algeria and their ability to produce different aflatoxins. Castegnaro M, Wild CP (1995) IARC activities in mycotoxin research. The maximum permissible aflatoxin level in Algeria is In Nat Toxins 3:327–331 Chang PK, Bennett JW, Cotty PJ (2001) Association of aflatoxin 4 μg/kg, and in our results one of the contaminated samples biosynthesis and sclerotial development in Aspergillus parasiti- exceeded this value (25.50 μg/kg), indicating the need for cus. Mycopathologia 153:41–48 constant monitoring of peanuts, because the population con- Cole G, Kendrick B (1981) Biology of conidial fungi. Academic, sumes this commodity in large amounts, and the aflatoxins London Cotty PJ (1989) Virulence and cultural characteristics of two Aspergil- could pose a real problem in Algeria. lus flavus strains pathogenic on cotton. Phytopathology 79:808– These aflatoxigenic isolates infect many of our food crops such as peanuts, which are used in many culinary Cotty PJ (1997) Aflatoxin-producing potential of communities of preparations in Algeria and may contain high levels of Aspergillus section Flavi from cotton producing areas in the United States. Mycol Res 101:698–704 aflatoxins if not controlled. Constant vigilance must be Davis ND, Iyer SK, Diener UL (1987) Improved method of screening maintained in different food products particularly in the nuts for aflatoxin with a coconut agar medium. Appl Environ Micro- (pistachios, peanuts, almonds, hazelnuts, etc.) given the biol 53:1593–1595 frequency and levels of contamination encountered. In gen- Dehghan P, Zaini F, Mahmoudi M, Jebali A, Kordbacheh P, Rezaei S (2008) Aflatoxin and sclerotia production in clinical isolates of eral, good management of the agricultural environment may Aspergillus flavus group. Iranian J Publ Health 37:41–50 offer a way to reduce mycotoxins and the toxigenic fungal D’Mello JPF, McDonald AMC (1997) Mycotoxins. Anim Feed Sci contamination in peanuts pre-harvest, because the pods are Technol 69:155–166 exposed to different environmental conditions during their Dorner JW, Cole RJ (2002) Effect of application of nontoxigenic strain of Aspergillus flavus and A. parasiticus on subsequent aflatoxin formation until harvest (Gonçalez et al. 2008). More inves- contamination of peanut in storage. J Stored Prod Res 38:329–339 tigations on levels of aflatoxins and other mycotoxins in Egel DS, Cotty PJ, Ellias KS (1994) Relationships among isolates of different food products are necessary to provide more infor- Aspergillus sect. Flavi that vary in aflatoxin production. Phytopa- mation on the exposure of the Algerian population to these thology 84:906–912 Ellis WO, Smith PJ, Simpson BK, Khanizadeh S, Oldham JH (1993) dangerous toxins. Control of growth and aflatoxin production of Aspergillus flavus under modified atmosphere packaging conditions. Food Micro- biol 10:9–21 European Commission (2006) Final report of a mission carried out in China, in order to assess the felicities and measures in place for References the control of aflatoxin contamination in peanuts intended for export into the UE. Report DG (SANCO)/8126/2006 Abbas HK, Weaver MA, Zablotowicz RM, Horn BW, Shier WT European Union (UE) (2005) Commission Regulation (EC) N°. 856/ (2005) Relationships between aflatoxin production and sclerotia 2005. Official Journal of the European Union 48 (6 June 2005), 3–8 formation among isolates of Aspergillus Section Flavi from the Felsentein J (1981) Evolutionary trees from DNA sequences: a maxi- Mississippi Delta. Eur J Plant Pathol 112:283–287 mum likelihood approach. J Mol Evol 17:368–376 Barros G, Torres A, Palacio G, Chulze S (2003) Aspergillus species Fente CA, Ordaz JJ, Vazquez BI, Franco CM, Cepeda A (2001) New from section Flavi isolated from soil at planting and harvest time additive for culture media for rapid identification of aflatoxin- in peanut-growing regions of Argentina. J Sci Food Agric producing Aspergillus strains. Appl Environ Microbiol 67:4858– 83:1303–1307 4862 Ann Microbiol (2013) 63:295–305 305 Frisvad JC, Samson RA, Smedsgaard J (2004) Emericella astellata,a Payne GA, Brown MP (1998) Genetics and Physiology of aflatoxin new producer of aflatoxin B1, B2 and sterigmatocystin. Lett Appl biosynthesis. Annu Rev Phytopath 36:329–362 Microbiol 38:440–445 Pildain MB, Vaamonde G, Cabral D (2004) Analysis of population Gabal MA, Hegazi SA, Hassanin N (1994) Aflatoxin production by structure of Aspergillus flavus from peanut based on vegetative Aspergillus flavus field isolates. Vet Hum Toxicol 36:519–521 compatibility, geographic origin, mycotoxin and sclerotia produc- Geiser DM, Dorner JW, Horn BW, Taylor JW (2000) The phyloge- tion. Int J Food Microbiol 93:31–40 netics of mycotoxin and sclerotium production in Aspergillus Pildain MB, Frisvad JC, Vaamonde G, Cabral D, Varga J, Samson RA flavus and Aspergillus oryzea. Fungal Genet Biol 31:169–179 (2008) Two novel aflatoxin producing Aspergillus species from Giorni P, Magan N, Pietri A, Bertuzzi T, Battilani P (2007) Studies of Argentinean peanuts. Int J Sysyt Evol Microbiol 58:725–735 Aspergillus section Flavi isolated from maize in northen Italy. Int Pitt JI, Hocking AD (1997) Fungi and food Spoilage, 2nd edn. Blackie, J Food Microbiol 113:330–338 London Goncalez E, Nogueira JH, Fonseca H, Felicio JD, Pino FA, Correa B Pitt JI, Hocking AD, Bhudhasamai K, Miscamble BF, Wheeler KA, (2008) Mycobiota and mycotoxins in Brazilian peanut kernels Tanboon-Ek P (1993) The normal mycoflora of commodities from from sowing to harvest. Int J Food Microbiol 123:184–190 Thailand. 1. Nuts and oilseeds. Int J Food Microbiol 20:211–226 Hanlin RT (1969) Fungi in developing peanut fruits. Mycopath Mycol Raper KB, Fennell DI (1977) The genus Aspergillus. Krieger, Malabar Appl 38:93–100 Razzaghi-Abyaneh M, Shams-Ghahf Arokhi M, Allameh A, Kazeroon- Hill RA, Lacey J (1983) Factors determining the microflora of stored Shiri A, Ranjbar-Bahadori S, Mirzahoseini H, Rezaee MB (2006) A barley grain. Ann App Biol 102:467–483 survey on distribution of Aspergillus section Flavi in corn field soils Horn BW (2006) Relationship between soil densities of Aspergillus in Iran: Population patterns based on aflatoxins, cyclopiazonic acid species and colonization of wounded peanut seeds. Can J Micro- and sclerotia production. Mycopathologia 161:183–192 biol 52:951–960 Reboux G (2006) Mycotoxines: effets sur la santé et interactions avec Horn BW, Dorner JW (1998) Soil populations of Aspergillus species d’autres composants organiques. Rev Fr Allergol 46:208–212 from section Flavi along a transect through peanut-growing Riba A, Bouras N, Mokrane S, Mathieu F, Lebrihi A, Sabaou N (2010) regions of the United States. Mycologia 90:767–776 Aspergillus section Flavi and aflatoxins in Algerian wheat and Horn BW, Greene RL, Dorner JW (1995) Effect of corn and peanut derived products. Food Chem Toxicol 48:2772–2777 cultivation on soil populations of Aspergillus flavus and A. parasiticus Saitou N, Nei M (1987) The neighbor-joining method: a new method in southwestern Georgia. Appl Environ Microbiol 61:2472–2475 for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425 Horn BW, Greene RL, Sorensen RB, Blankenship PD, Dorner JW Sultan Y, Magan N (2010) Mycotoxigenic fungi in peanuts from different (2001) Conidial movement of nontoxigenic Aspergillus flavus geographic regions of Egypt. Mycotoxin Res 26:133–140 and Aspergillus parasiticus in peanut fields following application Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular to soil. Mycopathologia 151:81–92 Evolutionary Genetics Analysis (MEGA) software version 4.0. IARC (1982) The evaluation of the carcinogenic risk of chemical to Mol Biol Evol 24:1596–1599 humans, IARC Monograph Supplement, vol 4, 4th edn. Interna- Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improv- tional Agency for Research on Cancer, Lyon ing the sensitivity of progressive multiple sequence alignment Jukes TH, Cantor CR (1969) Evolution of Protein Molecules. In: through sequence weighting, position-specific gap penalties and Murno HN (ed). Academic, New York, pp 21–132 weight matrix choice. Nucleic Acids Res 22:4673–80 Klich MA (1998) Soil fungi of some low-altitude desert cotton fields Turner NW, Subrahmanyam S, Piletsky SA (2009) Analytical methods and ability of their extracts to inhibit Aspergillus flavus. Mycopa- for determination of mycotoxins: a review. Anal Chim Acta thologia 142:97–100 632:168–180 Klich MA (2007) Environmental and developmental factors influenc- Vaamonde G, Patriarca A, Fernandez Pinto V, Comerio R, Degrossi C ing aflatoxin production by Aspergillus flavus and Aspergillus (2003) Variability of aflatoxin and cyclopiazonic acid production parasiticus. Mycoscience 48:71–80 by Aspergillus section Flavi from different substrates in Argen- Kozakiewicz Z (1989) Aspergillus species on stored products. Myco- tina. Int J Food Microbiol 88:79–84 logical Papers, vol 161. CAB International, Wallingford Varga J, Frisvad JC, Samson RA (2009) A reappraisal of fungi pro- Liu D, Coloe S, Baird R, Pedersen J (2000) Rapid Mini-Preparation of ducing aflatoxins. World Mycotoxin J 2:263–277 Fungal DNA for PCR. J Clin Microbiol 38:471 White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct Luchese RH, Harrigan WF (1993) Biosynthesis of aflatoxin – the role sequencing of fungal ribosomal RNA genes for phylogenetics. In: of nutritional factors. J Appl Bacteriol 74:5–14 Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR Proto- Mishra HN, Das C (2003) A review on biological control and metab- cols: a guide to methods and Applications. Academic, San Diego, olism of aflatoxin. Crit Rev Food Sci Nutr 43:245–264 pp 315–322 Molina M, Gianuzzi L (2002) Modelling of aflatoxin production by Williams JH, Phillips TD, Jolly PE, Stiles JK, Jolly CM, Aggarwal D Aspergillus parasiticus in a solid medium at different temperatures, (2004) Human aflatoxicosis in developing countries: a review of pH and propionic acid concentrations. Food Res Int 35:585–594 toxicology, exposure, potential health consequences, and inter- Moss MO (1996) Mode of formation of ochratoxin A. Food Addit ventions. Am J Clin Nutr 80:1106–1122 Contam 135:5–9 Yu J, Bathnagar D, Cleveland TE (2004) Completed sequence of Nicholson P, Chandler E, Simpson DR, Thomsett M, WILSON A aflatoxin pathway gene cluster in Aspergillus parasiticus. FEBS (2003) Molecular methods for species and chemotype detection Lett 564:126–130 of toxigenic fungi. Asp App Bio 68:11–20 Zehrer W (1996) Promotion de la Protection Intégrée des Cultures et Novas MV, Cabral D (2002) Association of mycotoxin and sclerotia des Denrées Stockées à Madagascar. Recueil des exposés lors du production with compatibility groups in Aspergillus flavus from Symposium tenu à Toliara du 7 au 11 Octobre 1996. Service de la peanut in Argentina. Plant Dis 86:215–219 Surveillance Phytosanitaire du Territoire National Direction de la Okano K, Tomita T, Kumeda Y, Matsumaru K, Ichinoe M (2008) Aflatoxin Protection des Végétaux. BP 1042 – Nanisana. 101 Antananarivo. B and G contamination in imported peanuts [Arachis hypogaea]and Madagascar Aspergillus section Flavi of the causing fungi. Mycotoxins. AGRIS Zhang Z, Schwartz S, Wagner L, Miller W (2000) A greedy algorithm Categories. Food Contamin Toxicol 58:107–114 for aligning DNA sequences. J Comput Biol 7:203–14 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

Aflatoxigenic strains of Aspergillus section Flavi isolated from marketed peanuts (Arachis hypogaea) in Algiers (Algeria)

Download PDF
11 pages

Loading next page...
 
/lp/springer-journals/aflatoxigenic-strains-of-aspergillus-section-flavi-isolated-from-rINbuP2aeG

References (65)

Publisher
Springer Journals
Copyright
Copyright © 2012 by Springer-Verlag and the University of Milan
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Fungus Genetics; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/s13213-012-0473-0
Publisher site
See Article on Publisher Site

Abstract

Ann Microbiol (2013) 63:295–305 DOI 10.1007/s13213-012-0473-0 ORIGINAL ARTICLE Aflatoxigenic strains of Aspergillus section Flavi isolated from marketed peanuts (Arachis hypogaea) in Algiers (Algeria) Nadjet Guezlane-Tebibel & Noureddine Bouras & Salim Mokrane & Tahar Benayad & Florence Mathieu Received: 27 November 2011 /Accepted: 13 April 2012 /Published online: 5 May 2012 Springer-Verlag and the University of Milan 2012 Abstract The present study reports on the natural myco- isolates (20.73 %) synthetized low levels of one or two biota occurring in Chinese peanuts marketed in Algiers, aflatoxins (AFB1 and AFG2). Aflatoxin production was paying special attention to the incidence of Aspergillus also screened on Coconut Agar Medium (CAM), and the section Flavi species that are potential producers of aflatox- results were consistent with the HPLC analysis. Based on ins. The mean value counts of fungi ranged from 155 to the combination of mycotoxins produced, five Aspergillus 577 CFU/g dry matter (DM) and the predominant fungi section Flavi chemotypes were established. Sclerotia pro- were different species of the genus Penicillium (83.81– duction expressed a correlation to aflatoxigenicity. The total 93.85 %) and Aspergillus belonging to section Flavi aflatoxins were detected in four analyzed samples at levels (2.73–73.96 %). Results indicated that 82 isolates (100 %) ranging from 0.71 to 25.50 μg/kg. Furthermore, the ampli- were aflatoxigenic. The Aspergillus section Flavi strains cons corresponding to the ITS1-5.8 S-ITS2 rDNA of six revealed that 65 isolates (79.27 %) were highly aflatoxi- representative strains showed that four strains belonged to genic, producing four kinds of aflatoxins [AFB1 (0.846– Aspergillus flavus, one to A. minisclerotigenes, and one to A. 3.330 μg/g), AFB2 (0.005–0.007 μg/g), AFG1 (0.008– caelatus. The results obtained indicate that there is a possi- 1.595 μg/g), and AFG2 (0.005–0.010 μg/g)], whereas 17 ble risk factor posed by aflatoxins contamination of peanuts marketed in Algiers. N. Guezlane-Tebibel (*) . . Keywords Aflatoxins Aspergillus section Flavi Laboratoire de Microbiologie. Faculté des Sciences Biologiques, Aflatoxigenic, Peanuts (Arachis hypogaea) Algeria Université des Sciences et de la Technologie Houari Boumediene, BP. 32 El Alia 16111, Bab Ezzouar, Algiers, Algeria e-mail: nanatebibe@hotmail.com Introduction N. Bouras S. Mokrane Laboratoire de Biologie des Systèmes Microbiens (LBSM), Mycotoxin contamination of food and feed presents a seri- Ecole Normale Supérieure de Kouba, ous food safety issue on a global scale, causing a high risk B.P. 92, for human and animal health and economic losses. Myco- 16 050 Vieux-Kouba, Algiers, Algeria toxins can be defined as small organic molecules of low T. Benayad solubility in water, non-degradable by living organisms, Laboratoire Central de Police Scientifique, able to provoke acute or chronic intoxication and damage Département de Sécurité Alimentaire et Environnement, to humans and animals after ingestion of contaminated food 1 rue Abdelaziz Khelalfa, Châteauneuf, and feed (Bennett 1987; Bourais and Amine 2006). Most Ben Aknoun, Algiers, Algeria mycotoxins encountered on agricultural products and sub- F. Mathieu ject to European regulations (European Recommendation Université de Toulouse, Laboratoire de Génie Chimique UMR No. 856/2005 of 6 June 2005) are aflatoxins, ochratoxins, 5503 (CNRS/INPT/UPS), ENSAT/INP de Toulouse, patulin, trichothecenes, penicillic acid, and fumonisins 1 avenue de l’Agrobiopôle, (D’Mello and MacDonald 1997). The most potent of the Castanet-Tolosan Cedex, France 296 Ann Microbiol (2013) 63:295–305 four naturally occurring AFs (AFB1, AFB2, AFG1, and microscopic fungi. The aim of this study was to screen and AFG2) is aflatoxin B1 (AFB1), which is listed as a group characterize the strains of Aspergillus section Flavi, based I carcinogen by the International Agency for Research on on a polyphasic approach involving morphological, chemi- Cancer (IARC 1982) because of its demonstrated carcino- cal, and molecular patterns, and to evaluate the rates of genicity to humans (Castegnaro and Wild 1995). Extensive contamination with aflatoxins in peanuts destined for human research has been carried out on the natural occurrence, consumption in Algeria. identification, characterization, biosynthesis, and genetic regulation of aflatoxins (Bennett and Klich 2003; Payne and Brown 1998; Yu et al. 2004). AFB1 is often found in Materials and methods highest concentrations in contaminated food and feed. It is likely to be present in a wide range of food plants or Sample collection animals: cereals (maize, rice, barley, wheat) and their deriv- atives, lentils, sunflower, soybean, fresh fruit or dried, pea- Four different samples of peanuts (all originated from nuts, almonds, walnuts, coconut, pistachio, coffee, cotton China), marketed in four regions of Algiers (Khraissia, seeds, spices (pepper, paprika, ginger), fruit juices, cider, Bab Ezzouar, Bordj El Kiffan, and Kouba), were subjected pastures, food from livestock and poultry, silage and fodder, to mycological analysis. The method of sampling was con- milk and derivatives, meat, etc., causing a loss of nutritional ducted at 4 different points in each evenly mixed 25-kg value. Therefore, the contamination of food with aflatoxi- peanut tank using a previously disinfected probe, consists genic fungi and the production of aflatoxins is a major of 250-g subsamples combined to get 1-kg laboratory sam- concern, which has received worldwide attention due to ples placed in sterile paper bags. Mycological evaluation their deleterious effects on human and animal health as well was done immediately, and all samples were stored at −20 °C as their importance in international food trade (Mishra and for mycotoxin analyses. Das 2003). Approximately 4.5 billion persons living in developing countries are chronically exposed to uncon- Isolation of mycobiota from peanut and culture conditions trolled amounts of the aflatoxins, which result in changes in nutrition and immunity (Williams et al. 2004). The Euro- Total fungal populations were isolated from peanut seed and pean Commission has set the maximum allowable total AFs quantitative enumeration was done using the surface-spread (AFB1, AFB2, AFG1, and AFG2) at 4 μg/kg, AFB1 alone method. Sub-samples (100 g) of each sample were finely at 2 μg/kg in cereals, nuts, and dried fruit ready for sale, and milled and 10 g were homogenized in 90 mL of 0.1 % AFM1 at 0.05 μg/kg in milk. Recent data indicate that peptone dissolved in water for 30 min on an orbital shaker. −2 −4 aflatoxins are produced by 13 species belonging to three Serial decimal dilutions (10 to 10 ) were performed as sections of the genus Aspergillus section Flavi (A. arach- described by Pitt and Hocking (1997), and a 0.1-mL aliquot idicola, A. bombycis, A. flavus, A. parvisclerotigenus, A. of each dilution was inoculated (in triplicates) on the surface minisclerotigenes, A. nomius, A. parasiticus, and A. pseu- of the Dichloran Rose-Bengal Chloramphenicol agar medi- dotamari) Nidulantes (Emericella astellata, E. venezuelen- um (DRBC) (Pitt and Hocking 1997). All Petri dishes were sis,and E. olivicola) Ochraceorosei (A. ochraceoroseus and incubated in darkness for 7 days at 25 °C. One of the three A. rambellii) (Frisvad et al. 2004; Turner et al. 2009; Varga sets of dilutions, averaging between 10–60 colonies per et al. 2009). Among these species, A. flavus, A. parviscler- Petri dish, was selected for counting and mycological anal- otigenus, and A. pseudotamari producing AFB1 and AFB2, ysis. The results were expressed as CFU/g of dry peanut and A. parasiticus and A. nomius developing the four AFs sample (colony-forming units per gram of DM: dry matter) (AFB1, AFB2, AFG1, and AFG2) are the most redoubtable. and isolation frequency (% of samples in which each genera Peanuts are important substrates for the growth and sub- was present). All colonies of Aspergillus section Flavi were sequent aflatoxin production by different members of As- sub-cultured on PDA tubes, incubated in darkness for 7 days pergillus section Flavi: A. flavus, A. parasiticus, A. nomius, at 25 °C then stored at 4 °C for subsequent characterization A. pseudotamarii, A. bombycis, A. arachidicola,and A. and taxonomic identification procedures. minisclerotigenes (Pildain et al. 2008; Sultan and Magan 2010). Soil serves as a reservoir for primary inoculum of A. Morphological characterization of the isolates of Aspergillus flavus and A. parasiticus (Horn and Dorner 1998; Horn et al. section Flavi 1995), and peanut pods are in direct contact with soil pop- ulations of aflatoxigenic fungi. The colonies of Aspergillus section Flavi from each PDA Algeria, importer of peanuts products, and attentive to the tube were sub-cultured at three points on 9-cm-diameter danger of aflatoxinogenic fungi has no information on the Petri dishes containing 20 mL of Czapek-Yeast extract Agar rate of mycotoxic harmful contaminants generated by these (CYA) medium, Malt Extract Agar (MEA) medium, Ann Microbiol (2013) 63:295–305 297 Czapeck-Dox Agar medium, and Aspergillus flavus and A. removed from different points of the colony for each culture, parasiticus Agar (AFPA) medium as reported by Riba et al. weighed and collected into small tubes. A volume of 0.9 mL (2010). Cultures were incubated for 4–7 days, in the dark, at of methanol was added to each tube, and the tubes were left 25 °C and then analyzed for standard morphological criteria stationary for 1 h. Extraction was done after 20 min of (color and colony diameter, head seriation, conidiophore centrifugation at 13,000 rpm for each tube and the extracts and conidia morphology, presence of hülle cells, morpholo- obtained were filtered through a 0.45-μm Millipore filter. gy of cleistothecia and ascospores, presence and size of Extracts were allowedtodry andthenre-suspended in sclerotia, etc.). For micromorphological observations, the 500 μL of chloroform. A volume of 15 μL of each extract isolates from MEA colonies were examined under the mi- was applied on a silica gel G plate (20 × 20 cm, 0.25 mm croscope (×10, ×40, ×100 magnification). Identification was thick, Merck 5721; Darmstadt, Germany), along with 1 μL performed according to the taxonomic keys for the Asper- of the standard of AFs mixture (containing AFB1 and AFG1 gillus genus (Klich 2007; Pitt and Hocking 1997; Raper and at 0.50 μg/mL each and AFB2 and AFG2 at 0.25 μg/mL Fennell 1977). each). The plates were developed in a chloroform-acetone (90:10, v/v) solvent system. After being dried the plates Aflatoxigenic ability of the isolates of Aspergillus section were observed under short (254 nm) and long wavelengths Flavi (365 nm); aflatoxins AFB and AFG appear as four spots in the order of mobility B2>B1 (blue)>G2>G1 (green) with Detection of aflatoxins by fluorescence on Coconut Agar R values 0.62, 0.57, 0.50, and 0.44 for AFB2, AFB1, Medium (CAM) AFG2, and AFG1 respectively. Sample spots were compared with the standards. The detection limit was 0.05 μg/g for all A preliminary screening for the production of AFs, by the AFs. fungal strains, was performed on the basis of emission of blue or green fluorescence after UV light excitation at Detection of aflatoxins by High Performance Liquid 365 nm after growth on Coconut Agar Medium (CAM) Chromatography (HPLC) supplemented with 0.3 % β-cyclodextrin (Davis et al. 1987; Fente et al. 2001). A piece of coconut (100 g) was HPLC was used to confirm the identity of the AFs and to homogenized for 5 min with 300 mL of hot distilled water. quantify them. AFs production by eight strains of Aspergil- The homogenate was filtered through layers of cheesecloth lus section Flavi, differentiated by their cultural characters, and the filtrate was adjusted to pH 7.0 with 2 N NaOH. Agar was determined following the method of Bragulat et al. was added (20 g/L) and the mixture was sterilized by auto- (2001). After 7 days of growth on Czapek yeast extract agar claving at 120 °C for 15 min. The isolates were inoculated (CYA) at 25 °C, three agar plugs (8 mm in diameter) were onto the 60-mm-diameter Petri dish containing 10 mL of removed, with a cork borer, from the inner, middle, and CAM. The cultures of 82 isolates were incubated for 7 days outer areas of each colony. Plugs were weighed and placed in the dark at 25 °C. All the cultures were periodically into Eppendorf tubes containing 1 mL of methanol for 1 h. verified for the appearance of colonies with brilliant The extracts were centrifuged at 13,000 rpm for 10 min and orange-yellow reverse coloration under daylight, and blue the supernatant filtered through a 0.45-μm hydrophilic or green fluorescence under long wavelength (365 nm) UV PVDF filter (Millipore), then recovered in HPLC vials, light after 3, 5, and 7 days and scored as positive or nega- and stored at 4 °C until analysis. The presence of AFs was tive. Fluorescence around colonies indicates the presence of detected by HPLC using a post-column derivatization elec- aflatoxins B and G that develop around the colony fluores- trochemically generated bromine (Kobra cell) and a fluores- cent blue and green, respectively; the appearance of colonies cence detector (Spectra physic 2000) (l0362 nm excitation, with orange-yellow reverse coloration was visible under l0435 nm emission). The HPLC column used was a reverse daylight. A blank consisting of sterilized, non-inoculated phase RP C18 ProntoSil analytical column (250 × 4 mm, CAM medium, incubated under the same conditions, was 3 μm particle size) preceded by a C18 pre-column (Ultrasep used as control. 10 × 4 mm) and the flow rate was 0.5 mL/min. For post- column derivatization, 119 mg potassium bromide and Detection of aflatoxins by Thin-Layer Chromatography 350 μL of nitric acid (4 M) were added to 1 L of the mobile (TLC) phase [20:20:60 (v/v/v) acetonitrile/methanol/ water], as suggested in the Kobra cell instruction manual. The system Thin layer chromatography (TLC) was used as a screening was run isocratically, with a flow rate of 0.5 mL/min; the method to identify the positive samples. The isolates were elution times for AFB1, AFB2, AFG1, and AFG2 were grown in Petri dishes containing (CYA) medium pH 6.7 for 30.2, 24.1, 22.5, and 21.4 min, respectively. The chromato- 7 days at 25 °C. Three agar plugs of the solid medium were grams were analyzed with Class-LC10 software version 1.6 298 Ann Microbiol (2013) 63:295–305 (Shimadzu). The limit of detection was 0.005 μg/kg for vacuum and dissolved in 50 μL of sterile ultra-pure water, AFB1 and AFG1 and 0.02 μg/kg for AFB2 and AFG2. then stored at −20°C until use. The quantification is obtained by measuring the peak area and by comparison with results obtained with standards. PCR reactions Analysis of AFs in peanuts The 5.8 S-ITS region was amplified by PCR using universal primers ITS1 (5′ TCCGTAGGTGAACCTGCGG 3′)and Extraction and purification of AFs from peanut samples ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) (White et al. 1990). PCR reactions were performed with a 50 μL final The extraction of AFs from peanut samples was performed volume, containing 200 ng of DNA template, 5 μL 10× according to the method of official methods of analysis reaction buffer (500 mM KCl, 100 mM Tris–HCl pH 9 and (CAMAG 1997). A quantity of 5.6 g of finely ground 15 mM MgCl ), 1 μL dNTP mixture (10 mM, each one), samples were added to 100 mL methanol into a separating 1 μL of each primer (50 μM), 1.5 μL MgCl (25 mM) and funnel, and mixed for 3 min. The mixture was homogenized 0.5 U of Taq DNA polymerase (MP Biomedicals and Qbio- and extracted with 40 mL sterile distilled water and mixed gene, Illkirch, France). The reaction mixtures were incubat- for 4 min, and then filtered through Whatman paper No. 1. ed in a thermalcycler (Stratagene 96 gradient Robocycler), To the filtrate, 20 mL of NaCl solution (10 %) and 20 mL and the reaction was carried out as follows: 1 step at 94 °C petroleum ether were added. The mixture was shaken for for 4 min, 30 cycles of the following three steps: 45 s at 2 min (the matrix is extracted in petroleum ether). To the 94 °C, 45 s at 55 °C, 50 s at 72 °C; and one final step at aqueous phase, 50 mL dichloromethane was added and 72 °C for 10 min. mixed for 1 min. After separation, the lower phase contain- ing AFs (dichloromethane) was collected. To this phase, 5 g Sequencing and data analysis sodium sulfate was added, and then filtered and evaporated to dryness. The extract was re-suspended in 0.5 mL of PCR products were purified using the JETQUICK PCR HPLC grade methanol, and filtered through a 0.2-μm Min- Purification Spin Kit (MP Biomedicals and Qbiogene) isart cartridge (Sartorius, Gottingen, Germany). The analysis according to the manufacturer’s instructions. Sequencing was performed using the HPLC method (as described of the purified PCR products was made by Millegen, Pro- above). logue Biotech (Labège, Toulouse, France). Nucleotide sequences were identified using the BLAST Determination of the recovery rates of aflatoxins algorithm at NCBI (Zhang et al. 2000). Phylogenetic anal- yses were conducted using the software MEGA version 4.0 The rate of aflatoxin recovery was determined by spiking an package (Tamura et al. 2007), the 5.8 S-ITS region sequen- AFB1-free sample (50 g of finely ground peanut) with an ces were aligned using the multiple-sequence alignment equivalent of 0.5, 5.0, 10, and 20 μg/kg of AFB1, from a program CLUSTAL W (Thompson et al. 1994), Evolution- 10 μg/mL stock solution of AFB1 dissolved in methanol. ary distance matrices were generated as described by Jukes Spiking was carried out in triplicates and a single analysis of and Cantor (1969) and a phylogenetic tree was inferred by a blank sample was also carried out. After allowing the the neighbor-joining method (Saitou and Nei 1987). Tree methanol solvent to evaporate overnight, AFB1 was topologies were evaluated by bootstrap analysis (Felsenstein extracted as described above. The percentage of aflatoxin 1981) based on 1,000 re-samplings of the neighbor-joining recovery (based on the results obtained by AFB1) was dataset. calculated and taken into account for the determination of aflatoxin levels in analyzed samples. Results Molecular characterization Mycological analysis DNA extraction Distribution of fungal genera Six isolates (C1-1, C1-2, C1-3, C3-1, C4-1, C5-1) regarding their ability to produce AFs along with two reference strains The mycological analysis, by plating dilutions of the sus- T T (A. flavus NRRL 3251 and A. parasiticus CBS 100926 ) pension peanut on selective media, allows the detection and were grown on YEA for 48 h, then the DNA extraction was evaluation of fungal genera. The results expressed in per- carried out according to the procedure described in details centages and CFU/g DM of the total mycoflora obtained in −1 −2 −3 by Liu et al. (2000), The DNA pellet is air-dried under dilution 10 as recorded in Table 1. In the 10 and 10 Ann Microbiol (2013) 63:295–305 299 Table 1 Distribution of fungi Sources samples Khraissia Bab Ezzouar Bordj El Kiffan Kouba isolated from peanut samples collected in four regions of Peanut samples C1 C3 C4 C5 Algiers (Algeria) Proteins (%) 25.41 24.67 22.66 23.33 Carbohydrates (%) 18.78 19.03 19.11 18.57 Lipids (%) 45.37 46.67 43.50 48.11 pH 5.09 5.73 5.18 5.64 Humidity (%) 6.10 6.58 5.54 7.32 Total number of fungi (cfu/g DM) 577 155 211 474 Fungi (%) Penicillium spp. 83.81 –– 93.85 Aspergillus section Flavi 10.06 22.88 73.96 2.73 Aspergillus section Nigri 2.23 12.50 – 2.73 Fusarium oxysporum 1.67 –– – Rhizopus spp. 2.23 64.62 26.04 0.69 – Not detected dilutions, the results are not statistically significant. Envi- color, conidia and conidiophore morphology, vesicle seria- ronmental analysis DRBC revealed a diverse mycological tion on MEA medium, presence or absence of sclerotia, and population. The following mycobiota isolated in the seed form of cleistothecia on CZ medium), all isolates belonged samples by using DRBC medium are: Penicillium spp., to the section Flavi. The major morphological characters Aspergillus section Flavi, Aspergillus section Nigri, Rhizo- identified for Aspergillus section Flavi distinction are: gen- pus spp. and Fusarium oxysporum; total number of fungal erally air or flat yellow-green colonies, with conidial heads propagules is between 155 and 577 CFU/g DM. Moreover, in shades; the mycelium formed filaments of irregular size, two samples revealed high contamination levels: C1 Ø(4–6 μm), often with dichotomous branching with acute (577 CFU/g DM) and C5 (474 CFU/g DM). Furthermore, or straight angles; smooth or rough conidiophores, straight the fungal species belonging to the genus Penicillium, are or sinuous, usually branched ending in one or more globular dominant in two samples (C1 and C5), with a rate of 83.81 or spherical vesiculars, spherical more or less elongated, and 93.85 %, respectively; however, no Penicillium isolates radial, varying in size. Around them is a row of phialides were found in other samples (C3 and C4). Moreover, the (uniseriate heads) within which arise spherical or oval wall Aspergillus section Flavi were present in all seeds samples, smooth or rough phialospores (conidia). The phialides are with a frequency of 2.73, 10.06, 22.88, and 73.96 % for C5, sometimes carried by metula (biseriate heads) and cover the C1, C3, and C4 respectively. On the other hand, the popu- whole (radial) or half (hemispherical) vesicle. The sclerotia lation of Aspergillus section Nigri is lower in the substrates; are present or absent and the cleistothecia are triangular or it was observed in samples C1, C3. and C5, with rates of spherical. 2.23, 12.50. and 2.73 %, respectively. However, Fusarium oxysporum was very rare, appearing only in the product C1 Identification of chemotypes in Aspergillus section Flavi at a low frequency (1.67 %). We observed an important presence of Rhizopus species in samples C3 (64.62 %) and Basedonmycotoxinproductionpatterns(AFB1,AFB2, C4 (26.04 %); however, they are less frequent in other AFG1, and AFG2) and the formation of sclerotia and cleis- samples: C1 (2.23 %) and C5 (0.69 %), respectively. tothecia, the 82 strains were classified into five chemotypes (Table 3). Chemotye I was represented by 15 isolates Morphological characterization of Aspergillus section Flavi (18.30 %) producing four AFs (AFB1, AFB2, AFG1, and strains AFG2), sclerotia type L and spherical cleistothecia. Chemo- type II consists of a single isolate (1.22 %), which produced In the present assay, we aimed to identify and characterize four AFs and sclerotia type L; however, the cleistothecia are 82 Aspergillus isolates belonging to section Flavi. Referring absent. Chemotype III was represented by 49 isolates to keys established by Raper and Fennell (1977), Pitt and (59.75 %) that produced four AFs with a mixture of high Hocking (1997), and Cahagnier (1998), our identification production of AFG1 and AFG2, and sclerotia type L; how- was based on standard criteria for strains purified by single- ever, the cleistothecia are absent. Chemotype IV includes 4 spore culture; the morphological characters are summarized isolates (4.88%)thatproduced onlyAFB1and AFG2; in Table 2. On the basis of macro- and micro-morphological sclerotia type L and triangular cleistothecia are present. characters (mainly appearance on CYA medium, colony Finally the chemotype V was represented by 13 isolates 300 Ann Microbiol (2013) 63:295–305 Table 2 Determination of morphological and chemical characterization of 82 of Aspergillus section Flavi Isolated from four peanut samples collected in different regions of Algiers (ALGERIA) a g Morphology Toxigenicity Number Codes of of strains representative c d i i i i Sclerotia Cleistothecia Seriation Conidia Colony Colony Fluorescence AFB1 AFB2 AFG1 AFG2 strain b e h size (mm) color diameter on CAM (mm) 0.80 spherical u/b r/s yg 56 b ++ −/+ +/−−/+ 12 C1-1 0.80 triangular u/b r yg 54 b + –– −/+ 4 C1-2 –– u/b r/s gy 46 – −/+ –– – 2 C1-3 –– u r/s yg 90 – +/− –– – 11 C3-1 0.75 to 0.86 – u r/s yg 60 g/b ++ +/− ++ +/− 49 C4-1 0.90 to 1.0 – u r/s yg 90 g ++++ −/+ + −/+ 1 C5-1 0.70 to 1.0 spherical u r/s yg 46 g ++++ +/− ++ +/− 2 C5-2 0.85 to 1.1 spherical u/b r yg 41 b/g ++++ −/+ + +/− 1 C5-3 Isolates were grown for 4 days at 25 °C, on MEA medium (except sclerotia and cleistothecia were tested on CZ medium), and observed by light microscopy; – absence on CZ medium Size is average of sclerotia in mm, (on CZ medium) u uniseriate; b biseriate; u/b predominantly uniseriate (on MEA medium) r rough; r/s rough or smooth (on MEA medium) yg yellowish green; gy green yellow (on MEA medium) average of 3 colonies in mm (on MEA medium) Isolates were grown for 7 days at 25 °C, on CYA medium, and tested by TLC b blue; g green; g/b green-blue; b/g blue-green ++++ strong signal; ++ medium signal; +/− weak signal; −/+ very weak signal; – not detected C1, C3, C4 and C5 represent the four different regions of Algiers: Khraissia, Bab Ezzouar, Bordj El Kiffan and Kouba, respectively (15.85 %), which were able to produce only AFB1; and no or green fluorescence as shown in Table 2. HPLC analysis sclerotia or cleistothecia were observed. In addition, we showed that among the 82 strains tested, 82 (100 %), 65 observed that among the 82 isolates tested, 65 (79 %) are (79.27 %), 65 (79.27 %), and 69 (84.15 %) were AFB1, able to produce all AFs analyzed (AFB1, AFB2, AFG1, and AFB2, AFG1, and AFG2 producers, respectively, as shown AFG2). in Table 3. Isolates of Aspergillus section Flavi were classi- fied into four groups according to their capacity for produc- Aflatoxin production by isolates of Aspergillus section Flavi ing AFB1 on CYA, which ranged from 0.005 to 3.33 μg/g of medium as reported in Table 4. Four isolates (4.88 %) In this study, the ability for producing AFs (AFB1, AFB2, presented high aflatoxigenic capacity with mean levels of AFG1, and AFG2) was tested for 82 isolates collected from AFB1 ranging from 2.46 to 3.33 μg/g, and 61 (74.39 %) 4 peanut seed samples. Aflatoxin production was screened were moderately aflatoxigeniic (0.70–0.85 μg/g of medium) on Coconut Agar Medium (CAM), and the results revealed as demonstrated by HPLC analysis. Furthermore, we ob- that 69 isolates of Aspergillus section Flavi (84.15 %) were served that four strains (4.88 %) were able to produce small quantities of AFB1 in the 0.065 μg/g range. However, 13 of aflatoxigenic. They produced a blue, green-blue, blue-green, Table 3 Chemotype patterns of Chemotype Mycotoxins Sclerotia Cleistothecia Number of strains Percentage (%) Aspergillus section Flavi strains on Aflatoxins, Sclerotia and AFB1 AFB2 AFG1 AFG2 Cleistothecia producing ability I + + + + + spherical 15 18.30 II +++ + + – 1 1.22 III + + + + + – 49 59.75 IV + –– + + triangular 4 4.88 Percentage of the 82 isolates V+ –– – – – 13 15.85 – Absence Ann Microbiol (2013) 63:295–305 301 Table 4 Occurrence and AFB1-producing ability of 82 strains of Table 6 Contamination rate of four peanut samples collected in Aspergillus section FLAVI isolated from peanut samples different regions of Algiers (Algeria) a a AFB1 (μg/g) Number of strains Percentage (%) Peanut samples Aflatoxins production in peanuts (μg/kg DM) AFB1 AFB2 AFG1 AFG2 Totals 0.005 to 0.01 13 15.85 0.011 to 0.10 4 4.88 C1 (Khraissia) 0.45 0.17 0.19 0.20 1.01 0.11 to 1 61 74.39 C3 (Bab Ezzouar) 20.50 – 4.83 0.17 25.50 1.1 to 3.33 4 4.88 C4 (Bordj El Kiffan) 0.62 0.16 0.57 0.17 1.52 C5 (Kouba) 0.29 – 0.42 – 0.71 The amounts of AFB1 were calculated after 7 days of growth on CYA at 25 °C and analyzed by HPLC Aflatoxin production in 4 samples of peanut, tested by HPLC; DM dry matter 82 isolates (15.85 %) produced AFB1 at very low levels ranging from 0.005 to 0.006 μg/g of medium. – Not detected The results of AF production by each of the representa- Bab Ezzouar region, which far exceeded the regulatory tive strains are summarized in Table 5. The results obtained standards. The AFB2 was present only in two samples with showed that all the tested strains are able to produce AFB1. a value of 0.16–0.17 μg/kg of peanut. The toxins AFG1 and However, two strains (C1-3 and C3-1) are not able to AFG2 are present at variable rates; AFG and AFG were 1 2 produce AFB2, AFG1, and AFG2, and one strain (C1-2) is detected, respectively, in 100 and 75 % of the contaminated not able to produce AFB2 and AFG1. Moreover, the capac- samples. Their concentrations varied from 0.19 to 4.83 μg/kg ity for producing AFs was ranged from 0.005 to 3.330 μg/g for AFG1 and from 0.17 to 0.20 μg/kg for AFG2. AFB1 is the CYA (for AFB1), 0.005 to 0.007 μg/g CYA (for AFB2), most potent of the four naturally occurring AFs. It should be 0.008 to 1.715 μg/g CYA for (AFG1), and 0.005 to noted that these substrates are contaminated with AFB1 and 1.057 μg/g CYA (for AFG2). AFG1 toxins that are carcinogenic. Aflatoxin content in sample peanuts Molecular characterization of the Aspergillus section Flavi isolates The different amounts of the sum of aflatoxins detected in each sample of peanuts are summarized in Table 6. The Identification of the six chosen isolates (C1-1, C1-2, C1-3, aflatoxin production suggests that the four substrates were C3-1, C4-1, and C5-1) was based on the 5.8 S-ITS region. contaminated in varying doses depending on their nature. Thus, a set of primers (ITS1 and ITS4) was used to amplify The incidence of contamination was 100 % with concen- the rDNA region, which includes the two-non-coding ITS1 trations ranging from 0.71 to 25.50 μg/kg. The AFB1, the and ITS2 segments and the 5.8 rRNA gene. The results major toxic form, was detected in all four samples examined showed that the size of all the amplified PCR products (100 %) with levels ranging from 0.29 to 20.50 μg/kg; the including those belonging to reference strains (A. flavus highest rate (20.50 μg/kg) was found in the sample from the T T NRRL 3251 and A. parasiticus CBS 100926 ) were esti- Table 5 Production of Aflatoxins (AFB1, AFB2, AFG1, and AFG2) mated to be 590 bp. by representative strains of Aspergillus section Flavi Our BLAST data showed that the isolates C1-1, C3-1 C4- 1, and C5-1 were related to A. flavus isolate NRRL 4998 Codes of representative strain Aflatoxins production of strains (μg/g CYA) with a similarity ranging between 100 and 99 %, whereas the isolate C1-3 matched A. caelatus strain NRRL 25528 AFB1 AFB2 AFG1 AFG2 Totals with a 100 % similarity. However, the isolate C1-2 was more closely related to A. minisclerotigenes CBS 117635 . C1-1 0.846 0.005 0.008 0.005 0.859 C1-2 0.065 –– 0.005 0.066 C1-3 0.005 –– – 0.005 Discussion C3-1 0.006 –– – 0.006 C4-1 0.684 0.007 1.715 1.057 2.287 Peanuts, being a popular food product, have a high number C5-1 2.460 0.005 0.091 0.005 2.555 of uses. Peanuts contain a class of fatty acids called mono- C5-2 3.330 0.007 0.277 0.010 3.624 unsaturated fats. Monounsaturated fats are part of the Med- C5-3 2.566 0.005 0.103 0.008 2.682 iterranean diet and are known to decrease risk of Isolates were grown for 7 days at 25 °C, on CYA medium, and tested cardiovascular disease. Unfortunately, in Algiers, these by HPLC products face a number of abiotic factors such as high 302 Ann Microbiol (2013) 63:295–305 humidity, and a temperature conducive to the growth of Alternaria spp., Aspergillus spp., Fusarium spp., and Penicil- fungi, when sold in grocery stores or markets whether lium spp., take place when the moisture content of their stocked in open cases or in plastic packaging. Penicillium substrata is higher than 13 % for cereals and beans, and higher spp., Aspergillus spp. (especially those belonging to section than 5–7 % for peanuts and oil products. In our investigation, Flavi), Fusarium spp. and Rhizopus spp. were the major we note that section Flavi colonized virtually all varieties fungal species most commonly isolated from our sample analyzed despite the acidic pH of the samples. They also peanuts. Hanlin (1969) indicated that Penicillium was the tolerated low humidity. Penicillium spp. and Aspergillus spp. most common genus isolated from Spanish peanut shells. have long been considered mainly as storage fungi; our results The level in seeds was lower, but in both shells and seeds demonstrate that they contaminate the seeds of peanuts. In there were more Penicillium spp. The soil, plants, and comparison to previously published results by the authors organic wastes are usually primary habitats of fungi. Fur- cited above, our investigated samples showed a fungal con- thermore, the high frequency of Penicillium spp., Fusarium tamination whatever their physical and chemical environment. spp., and Aspergillus spp. in soil samples have already been The screening of fungi isolated for aflatoxin production described (Klich 1998). These molds in the form of fila- revealed that 82 Aspergillus section Flavi isolates (100 %) ments or conidia are present in almost all environments: were aflatoxigenic. Our isolates are able to synthesize one, soil, the atmosphere, and water. Weather phenomena (atmo- two, three, or all four AFs. The biosynthesis of aflatoxins, spheric turbulence, rain), human activities (particularly like all secondary metabolites, is strongly dependent on earthworks), and animals, especially insects, are secondary growth conditions such as substrate composition (Luchese factors influencing the dispersal of conidia (Cole and and Harrigan 1993) or physical factors like pH, water activ- Kendrick 1981). However, the isolates of Aspergillus sec- ity, temperature, or modified atmosphere (Ellis et al. 1993; tion Flavi were present in all seed samples analyzed. Pea- Molina and Gianuzzi 2002). Differences in this expression nuts are often invaded before harvest by Aspergillus flavus can also be detected within the same species. Indeed, all and A. parasiticus, fungi which produce the carcinogenic isolates of the same species do not have all the enzyme aflatoxins (Horn et al. 2001); Pitt et al. (1993) have already systems required for the production of mycotoxins (Nicholson reported that A. flavus was the dominant fungi isolated from et al. 2003). Thus, the progress of the chemotaxonomy has peanut samples. Furthermore, A. parasiticus was the fungi shown that, for the same species, substance profiles are dif- isolated the most from inside of dry pods, detected in 80 % ferent when the fungus is sampled on the natural substrate or of the samples. Soil is a reservoir for species of section Flavi from a culture in Petri dishes (Reboux 2006). The new Euro- (A. flavus strains, A. parasiticus, A. caelatus, and A. tam- pean standards on aflatoxin levels allowed for peanuts, en- arii), species of section Nigri, and A. terreus; densities of hanced by particularly stringent standards for sampling, these fungi in soil vary greatly among fields and may require effective control techniques. There are approximately influence the severity of peanut infection (Horn 2006). 75 % similarity of the results between the coconut agar meth- The same author also reported that soil is a reservoir for od and HPLC. Similar results were obtained by Giorni et al. Aspergillus flavus and A. parasiticus, fungi that commonly (2007) who found that 73 % of Aspergillus section Flavi colonize peanut seeds and produce aflatoxins. Aspergillus strains isolated from maize showed fluorescence when inocu- flavus and A. parasiticus are the major producers of aflatox- lated on coconut agar medium and 70 % of the strains were in, as they can colonize virtually all raw materials especially positive when tested by HPLC. Our strains were classified cereals and vegetable oilseeds provided the temperature is into five different chemotypes, based on patterns of mycotox- above 15 °C, and if possible between 30 °C and 40 °C, and in, sclerotia, and cleistothecia production. We observed that all are the ultimate harmful mold in hot and wet climates the AFs producers have yellow-green colonies producing (Berthier and Valla 1998). The currently available data large sclerotia and sometimes the cleistothecia; 69 aflatoxi- indicate that four fungal species identified from peanut genic strains (84.15 %) are able to produce sclerotia (chemo- seeds were always inevitably present in the atmosphere types I, II, III, and IV). The genetic diversity within A. flavus (Cole and Kendrick 1981) and in the field, and persist on populations has been widely studied in relation to their poten- the dried seeds for a long time: Aspergillus flavus, A. niger, tial aflatoxigenicity and morphological variant L- and A. parasiticus, and Fusarium spp. This means that during S-strains. Within A. flavus and other Aspergillus species storage the atmospheric humidity on the premises must capable of aflatoxin production, considerable diversity is remain equal to that of the stored product and if possible found. Kozakiewicz (1989) reported that production of scle- less than or equal to 70 % (Berthier and Valla 1998). The rotia is a rare characteristic of A. flavus strains only, and in relative humidity and the pH measured in our samples agreement with Klich (2007), the presence of sclerotia does ranged from 5.54 to 7.32 % and from 5.09 to 5.73, respec- not seem to be related to aflatoxin production, but the presence tively (Table 1). Zehrer (1996) indicated that infestations by of small sclerotia appears to be correlated with high aflatoxin fungi, some of which are known from crop protection such as production. Several researchers have tried to establish a Ann Microbiol (2013) 63:295–305 303 correlation between sclerotia production ability and aflatox- different aflatoxins, AFB1 is known to be the most signifi- igenicity, but published data are contradictory. Some of cant in terms of animal and human health risk. This toxin clinical A. flavus isolates could have aflatoxin- and sclerotia- was present in all contaminated samples, at amounts ranging producing abilities, but not necessarily all aflatoxigenic A. from 0.29 to 20.50 μg/kg. Because peanuts are used for flavus isolates are capable of producing sclerotia (Dehghan food, strict regulatory limits for the amount of aflatoxin in et al. 2008). peanut products have been established. For raw peanuts Many studies refer to a positive correlation between entering the EU, the level must be<4 μg/kg total aflatoxins high aflatoxin production and presence of small sclerotia and have not more than 2 μg/kg B1 (European Commission (Chang et al. 2001;Cotty 1989, 1997; Novas and Cabral 2006). Usually, pre-harvest aflatoxin contamination occurs 2002; Pildain et al. 2004). Inconsistency of results may under conditions of nutrient and drought stress during the arise from the fact that fungal growth conditions have not later stages of the growing season (Blankenship et al. 1984; been standardized and several culture media have been Dorner and Cole 2002; Hill and Lacey 1983). Their high used for this purpose. In agreement with Cotty (1989), S- frequency in peanut samples in the China or Argentina type strains usually produce high levels of aflatoxins and regions is likely due to the very hot and dry summer con- numerous sclerotia smaller than 400 μm in diameter. How- ditions. The presence of Aspergillus section Flavi in peanuts ever, the morphological characters can vary: for instance, has previously been reported in China, Japan, South Africa, sclerotia which are characteristic of some species are not the U.S., Argentina and Paraguay (Okano et al. 2008). Other always present in all isolates of the same species, and their authors report that these species have been detected in soils production can vary among cultures of the same isolate. of Arizona, Thailand, and West Africa (Vaamonde et al. Among our eight isolates of Aspergillus section Flavi,we 2003); Sultan and Magan (2010) demonstrated the suscep- could only detect the L-morphology, since four produced tibility of Egyptian peanut to colonization with Aspergillus sclerotia bigger than 400 μm under the tested conditions. section Flavi, especially A. flavus isolates. The present study Giorni et al. (2007) and Razzaghi-Abyaneh et al. (2006) demonstrated the susceptibility of peanuts to colonization report no correlation between sclerotial production/size with Aspergillus section Flavi, especially A. flavus isolates. and aflatoxigenicity, similar to the case of one of our The multiple sequences alignment established by the strains, a high producer that does not produce sclerotia; program CLUSTAL W showed that 4 isolates (C1-1, C3- or even an inverse correlation, with L-type strains being 1 C4-1, and C5-1) are identical to several aflatoxinogenic the most aflatoxigenic (Abbas et al. 2005). type strains. They formed a distinct group, cluster I, con- We could not establish a correlation between sclerotia sisting of A. flavus that showed high similarities (99–100 %) presence size and toxigenicity. In our case, three isolates using the 5.8 S-ITS region; the similarity was equal to which are L-type strains were the most toxigenic. Peanuts 100 % with A. flavus isolate NRRL 4998 [EF661566], are important substrates for the growth and subsequent while the isolate C5-1 has 99 % similarity with the strain aflatoxin production by different species of Aspergillus sec- A. flavus isolate NRRL 4998 [EF661566]. The four strains tion Flavi: A. flavus, A. parasiticus, A. nomius, A. pseudo- (C1-1, C 3–1, C4-1, and C5-1) generally producers of AFB1 tamarii,and A. bombycis (Sultan and Magan 2010). or the four AFs (AFB1, AFB2, AFG1, and AFG2) seem to Recently, additional new aflatoxin-producing species have be related mainly to the species A. flavus. Bayman and Cotty been isolated from peanuts in Argentina (A. arachidicola (1993), Egel et al. (1994), and Geiser et al. (2000) reported and A. minisclerotigenes; Pildain et al. 2008). Generally, the that isolates of A. flavus are genetically very diverse. Al- fungal species can infect peanuts both pre-and post-harvest though it is generally accepted that A. flavus produces only (Barros et al. 2003; Cotty 1997). As with fungi in general, AFB, production of AFG has also been reported in the Aspergillus taxonomy is complex and ever evolving. The literature (Gabal et al. 1994; Giorni et al. 2007). We ob- genus is easily identified by its characteristic conidiophores, served significant differences in the sequences of C1-2 and but species identification and differentiation is complex, for C1-3 isolates. However, our sequence data show clearly that it is traditionally based on a range of macro- and micro- these two species are genetically different. The C1-2 isolate morphological features. Furthermore, all these morphologi- produces aflatoxins AFB1 and AFG2 forming cluster II and cal criteria have to be determined under standardized labo- has 98 % similarity with A. minisclerotigenes isolate CBS ratory conditions by trained mycologists, in order to obtain 117635 [EF409239]. The C1-3 strain synthesizes aflatoxin an accurate identification. Many authors reported that the B1, constitutes cluster III, and had 100 % similarity with A. percentage of highly aflatoxigenic isolates was stronger caelatus NRRL 25528 [AF004930]. Through these results, among A. flavus from groundnuts than A. flavus from wheat, we can conclude that our strains were distributed in the maize, or animal feedstuffs. clade of the Aspergillus section Flavi. Furthermore, the mycotoxin analyses indicated that afla- The results we obtained allowed us to identify in our toxins were present in 100 % of the samples. Among the peanuts as three different species of Aspergillus section 304 Ann Microbiol (2013) 63:295–305 Bayman P, Cotty PJ (1993) Genetic diversity in Aspergillus flavus: Flavi involved in the mycotoxin biosynthesis. These are association with aflatoxin production and morphology. Can J Bot Aspergillus flavus, A. minisclerotigenes,and A. caelatus. 71:23–34 Seventy-six isolates (92.69 %) were A. flavus, all being Bennett JW (1987) Mycotoxins, mycotoxicoses, mycotoxicology. aflatoxin producers; of the 76 A. flavus isolates positive Mycopathologia 100:3–5 Bennett JW, Klich M (2003) Mycotoxins. Clin Microbiol Rev 16:497– forAFs,65 (79.26%)wereabletosynthetizeall AFs (AFB1, AFB2, AFG1, and AFG2), 4 isolates (4.87 %) were Berthier J, Valla G (1998) Moisissures - mycotoxines et aliments: du A. minisclerotigenes producers of two aflatoxins (AFB1 and risque à la prévention. Rev Med Vet 149:479–492 AFG2), and 2 isolates (2.44 %) identified as A. caelatus or A. Blankenship PD, Cole RJ, Sanders TH, Hill RA (1984) Effect of geocarposphere temperature on preharvest colonization of pseudocaelatus, producers of one aflatoxin (AFB1) as dem- drought stressed peanut by Aspergillus flavus and subsequent onstrated by HPLC analysis. It is well known that some aflatoxin contamination. Mycopathologia 85:69–74 species of this Aspergillus section are considered the most Bourais I, Amine A (2006) Aflatoxines toxiques redoutables dans nos significant mycotoxigenic fungi (Moss 1996). aliments. Les techniques de laboratoire. No. 0/2006. p. 4–8 Bragulat MR, Abarca ML, Cabanes FJ (2001) An easy screening However, in Algeria, little research has been done on the method for fungi producing ochratoxin A in pure culture. Int J occurrence of mycotoxigenic fungi, species identification, Food Microbiol 71:139–144 and mycotoxin evaluation. Although the number of samples Cahagnier B (1998) Moisissures des aliments peu hydratés. Lavoisier analyzed was limited, for the first time the results obtained Tec & Doc, Paris CAMAG (1997). Determination of aflatoxins B1, B2, G1 and G2 in in this study have provided information about the presence foodstuffs. CAMAG, Application notes, BIBLIOGRAPHY SER- and distribution of mycotoxigenic fungi in peanuts marketed VICE (CBS). Thin-layer chromatography. 79, p. 10 in Algeria and their ability to produce different aflatoxins. Castegnaro M, Wild CP (1995) IARC activities in mycotoxin research. The maximum permissible aflatoxin level in Algeria is In Nat Toxins 3:327–331 Chang PK, Bennett JW, Cotty PJ (2001) Association of aflatoxin 4 μg/kg, and in our results one of the contaminated samples biosynthesis and sclerotial development in Aspergillus parasiti- exceeded this value (25.50 μg/kg), indicating the need for cus. Mycopathologia 153:41–48 constant monitoring of peanuts, because the population con- Cole G, Kendrick B (1981) Biology of conidial fungi. Academic, sumes this commodity in large amounts, and the aflatoxins London Cotty PJ (1989) Virulence and cultural characteristics of two Aspergil- could pose a real problem in Algeria. lus flavus strains pathogenic on cotton. Phytopathology 79:808– These aflatoxigenic isolates infect many of our food crops such as peanuts, which are used in many culinary Cotty PJ (1997) Aflatoxin-producing potential of communities of preparations in Algeria and may contain high levels of Aspergillus section Flavi from cotton producing areas in the United States. Mycol Res 101:698–704 aflatoxins if not controlled. Constant vigilance must be Davis ND, Iyer SK, Diener UL (1987) Improved method of screening maintained in different food products particularly in the nuts for aflatoxin with a coconut agar medium. Appl Environ Micro- (pistachios, peanuts, almonds, hazelnuts, etc.) given the biol 53:1593–1595 frequency and levels of contamination encountered. In gen- Dehghan P, Zaini F, Mahmoudi M, Jebali A, Kordbacheh P, Rezaei S (2008) Aflatoxin and sclerotia production in clinical isolates of eral, good management of the agricultural environment may Aspergillus flavus group. Iranian J Publ Health 37:41–50 offer a way to reduce mycotoxins and the toxigenic fungal D’Mello JPF, McDonald AMC (1997) Mycotoxins. Anim Feed Sci contamination in peanuts pre-harvest, because the pods are Technol 69:155–166 exposed to different environmental conditions during their Dorner JW, Cole RJ (2002) Effect of application of nontoxigenic strain of Aspergillus flavus and A. parasiticus on subsequent aflatoxin formation until harvest (Gonçalez et al. 2008). More inves- contamination of peanut in storage. J Stored Prod Res 38:329–339 tigations on levels of aflatoxins and other mycotoxins in Egel DS, Cotty PJ, Ellias KS (1994) Relationships among isolates of different food products are necessary to provide more infor- Aspergillus sect. Flavi that vary in aflatoxin production. Phytopa- mation on the exposure of the Algerian population to these thology 84:906–912 Ellis WO, Smith PJ, Simpson BK, Khanizadeh S, Oldham JH (1993) dangerous toxins. Control of growth and aflatoxin production of Aspergillus flavus under modified atmosphere packaging conditions. Food Micro- biol 10:9–21 European Commission (2006) Final report of a mission carried out in China, in order to assess the felicities and measures in place for References the control of aflatoxin contamination in peanuts intended for export into the UE. Report DG (SANCO)/8126/2006 Abbas HK, Weaver MA, Zablotowicz RM, Horn BW, Shier WT European Union (UE) (2005) Commission Regulation (EC) N°. 856/ (2005) Relationships between aflatoxin production and sclerotia 2005. Official Journal of the European Union 48 (6 June 2005), 3–8 formation among isolates of Aspergillus Section Flavi from the Felsentein J (1981) Evolutionary trees from DNA sequences: a maxi- Mississippi Delta. Eur J Plant Pathol 112:283–287 mum likelihood approach. J Mol Evol 17:368–376 Barros G, Torres A, Palacio G, Chulze S (2003) Aspergillus species Fente CA, Ordaz JJ, Vazquez BI, Franco CM, Cepeda A (2001) New from section Flavi isolated from soil at planting and harvest time additive for culture media for rapid identification of aflatoxin- in peanut-growing regions of Argentina. J Sci Food Agric producing Aspergillus strains. Appl Environ Microbiol 67:4858– 83:1303–1307 4862 Ann Microbiol (2013) 63:295–305 305 Frisvad JC, Samson RA, Smedsgaard J (2004) Emericella astellata,a Payne GA, Brown MP (1998) Genetics and Physiology of aflatoxin new producer of aflatoxin B1, B2 and sterigmatocystin. Lett Appl biosynthesis. Annu Rev Phytopath 36:329–362 Microbiol 38:440–445 Pildain MB, Vaamonde G, Cabral D (2004) Analysis of population Gabal MA, Hegazi SA, Hassanin N (1994) Aflatoxin production by structure of Aspergillus flavus from peanut based on vegetative Aspergillus flavus field isolates. Vet Hum Toxicol 36:519–521 compatibility, geographic origin, mycotoxin and sclerotia produc- Geiser DM, Dorner JW, Horn BW, Taylor JW (2000) The phyloge- tion. Int J Food Microbiol 93:31–40 netics of mycotoxin and sclerotium production in Aspergillus Pildain MB, Frisvad JC, Vaamonde G, Cabral D, Varga J, Samson RA flavus and Aspergillus oryzea. Fungal Genet Biol 31:169–179 (2008) Two novel aflatoxin producing Aspergillus species from Giorni P, Magan N, Pietri A, Bertuzzi T, Battilani P (2007) Studies of Argentinean peanuts. Int J Sysyt Evol Microbiol 58:725–735 Aspergillus section Flavi isolated from maize in northen Italy. Int Pitt JI, Hocking AD (1997) Fungi and food Spoilage, 2nd edn. Blackie, J Food Microbiol 113:330–338 London Goncalez E, Nogueira JH, Fonseca H, Felicio JD, Pino FA, Correa B Pitt JI, Hocking AD, Bhudhasamai K, Miscamble BF, Wheeler KA, (2008) Mycobiota and mycotoxins in Brazilian peanut kernels Tanboon-Ek P (1993) The normal mycoflora of commodities from from sowing to harvest. Int J Food Microbiol 123:184–190 Thailand. 1. Nuts and oilseeds. Int J Food Microbiol 20:211–226 Hanlin RT (1969) Fungi in developing peanut fruits. Mycopath Mycol Raper KB, Fennell DI (1977) The genus Aspergillus. Krieger, Malabar Appl 38:93–100 Razzaghi-Abyaneh M, Shams-Ghahf Arokhi M, Allameh A, Kazeroon- Hill RA, Lacey J (1983) Factors determining the microflora of stored Shiri A, Ranjbar-Bahadori S, Mirzahoseini H, Rezaee MB (2006) A barley grain. Ann App Biol 102:467–483 survey on distribution of Aspergillus section Flavi in corn field soils Horn BW (2006) Relationship between soil densities of Aspergillus in Iran: Population patterns based on aflatoxins, cyclopiazonic acid species and colonization of wounded peanut seeds. Can J Micro- and sclerotia production. Mycopathologia 161:183–192 biol 52:951–960 Reboux G (2006) Mycotoxines: effets sur la santé et interactions avec Horn BW, Dorner JW (1998) Soil populations of Aspergillus species d’autres composants organiques. Rev Fr Allergol 46:208–212 from section Flavi along a transect through peanut-growing Riba A, Bouras N, Mokrane S, Mathieu F, Lebrihi A, Sabaou N (2010) regions of the United States. Mycologia 90:767–776 Aspergillus section Flavi and aflatoxins in Algerian wheat and Horn BW, Greene RL, Dorner JW (1995) Effect of corn and peanut derived products. Food Chem Toxicol 48:2772–2777 cultivation on soil populations of Aspergillus flavus and A. parasiticus Saitou N, Nei M (1987) The neighbor-joining method: a new method in southwestern Georgia. Appl Environ Microbiol 61:2472–2475 for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425 Horn BW, Greene RL, Sorensen RB, Blankenship PD, Dorner JW Sultan Y, Magan N (2010) Mycotoxigenic fungi in peanuts from different (2001) Conidial movement of nontoxigenic Aspergillus flavus geographic regions of Egypt. Mycotoxin Res 26:133–140 and Aspergillus parasiticus in peanut fields following application Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular to soil. Mycopathologia 151:81–92 Evolutionary Genetics Analysis (MEGA) software version 4.0. IARC (1982) The evaluation of the carcinogenic risk of chemical to Mol Biol Evol 24:1596–1599 humans, IARC Monograph Supplement, vol 4, 4th edn. Interna- Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improv- tional Agency for Research on Cancer, Lyon ing the sensitivity of progressive multiple sequence alignment Jukes TH, Cantor CR (1969) Evolution of Protein Molecules. In: through sequence weighting, position-specific gap penalties and Murno HN (ed). Academic, New York, pp 21–132 weight matrix choice. Nucleic Acids Res 22:4673–80 Klich MA (1998) Soil fungi of some low-altitude desert cotton fields Turner NW, Subrahmanyam S, Piletsky SA (2009) Analytical methods and ability of their extracts to inhibit Aspergillus flavus. Mycopa- for determination of mycotoxins: a review. Anal Chim Acta thologia 142:97–100 632:168–180 Klich MA (2007) Environmental and developmental factors influenc- Vaamonde G, Patriarca A, Fernandez Pinto V, Comerio R, Degrossi C ing aflatoxin production by Aspergillus flavus and Aspergillus (2003) Variability of aflatoxin and cyclopiazonic acid production parasiticus. Mycoscience 48:71–80 by Aspergillus section Flavi from different substrates in Argen- Kozakiewicz Z (1989) Aspergillus species on stored products. Myco- tina. Int J Food Microbiol 88:79–84 logical Papers, vol 161. CAB International, Wallingford Varga J, Frisvad JC, Samson RA (2009) A reappraisal of fungi pro- Liu D, Coloe S, Baird R, Pedersen J (2000) Rapid Mini-Preparation of ducing aflatoxins. World Mycotoxin J 2:263–277 Fungal DNA for PCR. J Clin Microbiol 38:471 White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct Luchese RH, Harrigan WF (1993) Biosynthesis of aflatoxin – the role sequencing of fungal ribosomal RNA genes for phylogenetics. In: of nutritional factors. J Appl Bacteriol 74:5–14 Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR Proto- Mishra HN, Das C (2003) A review on biological control and metab- cols: a guide to methods and Applications. Academic, San Diego, olism of aflatoxin. Crit Rev Food Sci Nutr 43:245–264 pp 315–322 Molina M, Gianuzzi L (2002) Modelling of aflatoxin production by Williams JH, Phillips TD, Jolly PE, Stiles JK, Jolly CM, Aggarwal D Aspergillus parasiticus in a solid medium at different temperatures, (2004) Human aflatoxicosis in developing countries: a review of pH and propionic acid concentrations. Food Res Int 35:585–594 toxicology, exposure, potential health consequences, and inter- Moss MO (1996) Mode of formation of ochratoxin A. Food Addit ventions. Am J Clin Nutr 80:1106–1122 Contam 135:5–9 Yu J, Bathnagar D, Cleveland TE (2004) Completed sequence of Nicholson P, Chandler E, Simpson DR, Thomsett M, WILSON A aflatoxin pathway gene cluster in Aspergillus parasiticus. FEBS (2003) Molecular methods for species and chemotype detection Lett 564:126–130 of toxigenic fungi. Asp App Bio 68:11–20 Zehrer W (1996) Promotion de la Protection Intégrée des Cultures et Novas MV, Cabral D (2002) Association of mycotoxin and sclerotia des Denrées Stockées à Madagascar. Recueil des exposés lors du production with compatibility groups in Aspergillus flavus from Symposium tenu à Toliara du 7 au 11 Octobre 1996. Service de la peanut in Argentina. Plant Dis 86:215–219 Surveillance Phytosanitaire du Territoire National Direction de la Okano K, Tomita T, Kumeda Y, Matsumaru K, Ichinoe M (2008) Aflatoxin Protection des Végétaux. BP 1042 – Nanisana. 101 Antananarivo. B and G contamination in imported peanuts [Arachis hypogaea]and Madagascar Aspergillus section Flavi of the causing fungi. Mycotoxins. AGRIS Zhang Z, Schwartz S, Wagner L, Miller W (2000) A greedy algorithm Categories. Food Contamin Toxicol 58:107–114 for aligning DNA sequences. J Comput Biol 7:203–14

Journal

Annals of Microbiology – Springer Journals

Published: May 5, 2012

There are no references for this article.