Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Mitochondrial cholesterol trafficking: impact on inflammatory mediators

Mitochondrial cholesterol trafficking: impact on inflammatory mediators Volume 3 † Number 1 † March 2010 10.1093/biohorizons/hzq002 Advance Access publication 16 February 2010 ......................................................................................................................................................................................................................................... Research article Mitochondrial cholesterol trafficking: impact on inflammatory mediators Grant English* Vascular Biology Group, Department of Biological and Biomedical Sciences, Glasgow Caledonian University, Cowcaddens Road, Glasgow G4 0BA, UK. * Corresponding author: Division of Cell and Developmental Biology, College of Life Sciences, MSI/WTB/JBC Complex, University of Dundee, Dundee, DD1 5EH, UK. Tel: þ44 (0)1382 385079. Email: g.english@dundee.ac.uk Supervisor: Professor Annette Graham, Vascular Biology Group, Department of Biological and Biomedical Sciences, Glasgow Caledonian University, Cowcaddens Road, Glasgow G4 0BA, UK. ........................................................................................................................................................................................................................................ Macrophage ‘foam cells’ are the hallmark of early, and developing, atherosclerotic lesions. Generation of 27-oxygenated derivatives of cholesterol, one of the most abundant oxysterols in human atheroma, via mitochondrial sterol 27-hydroxylase (CYP27A1), achieves ligand-activation of liver X nuclear receptors (LXR), which marshal cholesterol homeostatic mechanisms leading to cholesterol efflux and nascent high-density lipoprotein generation. The rate-limiting step controlling activity of CYP27A1 is supply of cholesterol from the outer to the inner (cholesterol-poor) mitochondrial membrane, and can be facilitated by steroidogenic acute regulatory protein (StAR). However, LXR activation also exerts indirect control (transrepression) over gene expression of a range of inflammatory mediators, via interference with nuclear factor-kappa B transcription factors, integrating metabolic and inflammatory signalling. Here, we considered the impact of increased cholesterol delivery to CYP27A1 on the expression of inflammatory mediators: Toll-like receptor 3 (Tlr3), Toll-like receptor 6 (Tlr6) and lymphotoxin alpha (Lta). Murine RAW 264.7 macrophages stably transfected with pCMV.5 (empty vector control) and pCMV.5_Stard1 (StAR over-expressing) were challenged for 24 h, in the presence or absence of dibutyryl cAMP (0.3 mM), lipopoly- saccharide (LPS; 0.1 mg/ml), LXR agonist (T0901317; 10 mM) and combinations thereof. Following isolation of RNA and cDNA synthesis, qualitative polymerase chain reaction (PCR) was used to determine the presence and expression of StAR (355 bp) and housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 410 bp), in each cell line. Levels of Stard1, Tlr3, Tlr6 and Lta mRNA were determined by quantitative PCR and expressed as a ratio to Gapdh. Over-expression of StAR significantly altered expression of genes implicated in the innate immune response, increasing Tlr3, Tlr6 and Lta expression under basal conditions, or following the addition of cAMP to increase StAR activity. Addition of LPS decreased intracellular levels of Stard1 mRNA; preliminary evidence of Tlr6 transrepres- sion was also noted in StAR over-expressing cells following this inflammatory challenge. In contrast, induction of Tlr3 was noted in control following addition of LXR agonist, T0901317, suggesting Tlr3 may be a direct LXR target; Lta expression was also enhanced in StAR over-expressing cells in the presence of this agonist. These results should be considered carefully when developing StAR as a possible therapeutic strategy for human metabolic disease. Key words: atherosclerosis, inflammation, macrophage, cholesterol, Liver X receptors (LXRs), steroidogenic acute regulatory protein (StAR). Submitted on 18 September 2009; accepted on 17 December 2009 ........................................................................................................................................................................................................................................ (oxLDL), for instance, is not cleared by the native LDL Introduction receptor but instead recognized as a ‘foreign particle’, inter- Macrophage ‘foam cells’, laden with cholesterol and choles- nalized and esterified via macrophage scavenging receptors. teryl esters derived from the unregulated uptake of differing Removal of cholesterol from macrophage foam cells can be pro-atherogenic lipoproteins, are a hallmark of early and achieved by cholesterol efflux to acceptor apolipoproteins, developing atherosclerotic lesions, influencing both plaque such as apolipoprotein (apo) AI, apoE and high-density lipo- progression and stability. Oxidized low-density lipoprotein protein (HDL); a process mediated via ATP binding cassette ......................................................................................................................................................................................................................................... The Author 2010. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.5), which permits unrestricted non-commercial use, distri- bution, and reproduction in any medium, provided the original work is properly cited. 1 Research article Bioscience Horizons † Volume 3 † Number 1 † March 2010 ......................................................................................................................................................................................................................................... (ABC) transporters such as ABCA1, ABCG1 and ABCG4. an intrinsic ability to regulate intracellular lipid homeosta- Several studies have demonstrated macrophage cholesterol sis (Fig. 1) supporting an anti-atherogenic role for StAR efflux mechanisms and expression of a number of ABC trans- in the vascular system. porters, implicated in the reverse cholesterol transport In addition to the well-defined role of LXRs in modulating pathway, lie under the transcriptional control of liver X macrophage cholesterol homeostasis, it has recently emerged nuclear receptors (LXRa/b). These form heterodimers that LXR activation regulates the expression of inflammatory with 9-cis retinoid X receptors (RXRs) and bind to genes and the innate immune response (Fig. 1). Liver X cognate LXR-responsive elements (LXREs), consisting of nuclear receptors repress the expression of inflammatory imperfect direct hexameric repeat of the core sequence genes downstream of Toll-like receptor 4 (TLR-4), tumour TGACCT separated by four bases, in the promoter regions necrosis factor alpha (TNFa) and interleukin-1b (IL-1b) sig- of target genes. Recent studies have shown that oxygenated nalling, as well as many nuclear factor-kappa B (NF-kB) derivatives of cholesterol, oxysterols, are potent physiologi- target genes, including inducible nitric oxide synthase cal ligands for LXRs, once considered ‘orphan’ nuclear (iNOS), IL-6, cyclooxygenase-1 (COX-1) and IL-1b. The receptors. The products generated by the mitochondrial ability of LXRs to inhibit activation of transcription factors sterol 27-hydroxylase encoded by CYP27A1, in particular such as NF-kB and attenuate inflammatory responses is 27-hydroxycholesterol, have been shown to be the most termed transrepression. The molecular mechanisms funda- abundant enzymatically generated oxysterols in human mental to signal-specific transrepression remain incompletely atheroma which function as endogenous LXR ligands. understood; however, it is clear that activation of LXR can Several lines of evidence support the concept that inhibit inflammatory responses to LPS or cytokines via CYP27A1 may be an important defence mechanism prevent- blockade of NF-kB signalling, at least in certain cell ing macrophage cholesterol accumulation as the expression types. LXREs remain unidentified in the proximal promo- of CYP27A1 is induced in macrophages laden with choles- ters of target genes, suggesting an indirect mechanism of 8 23 terol and a direct correlation exists between macrophage action. In addition to possible competition for transcrip- 27-hydroxycholesterol and cholesteryl ester content. tional coactivators, it is clear that inhibition of the NF-kB Moreover, CYP27A1 colocalizes with macrophages in ather- pathway does not involve inhibition of NF-kB translocation osclerotic plaques, wherein genes which lie under the regu- to the nucleus, NF-kB binding to DNA or degradation of the latory control of LXRs are up-regulated. Crucially, the NF-kB inhibitor, IkB. However, it is suggested that the rate-limiting step governing the activity of CYP27A1 and ability of LXRs to associate with NF-kB and recruit corepres- generation of 27-oxysterols is the supply of cholesterol to sors, such as nuclear receptor corepressor (NCoR), which the enzyme which is situated on the cholesterol-poor inner antagonizes the activities of NF-kB, is fundamental to the 12 21 mitochondrial membrane. Recent studies have shown mechanism of transrepression. that the trafficking of cholesterol from the outer mitochon- Atherosclerotic lesions are proinflammatory in nature, drial membrane to the inner mitochondrial membrane characterized by chronic, unresolved low-grade inflam- across the inter-mitochondrial membrane space can be mation in the arterial wall; a positive risk factor for devel- mediated by steroidogenic acute regulatory protein (StAR). oping atherosclerosis and other cardiovascular diseases. As In steroidogenic tissues, StAR is a critical regulator of the LXRs positively and negatively regulate the expression of a 12 25 synthesis of adrenal and gonadal steroids; however, evi- range of metabolic and inflammatory genes, respectively, dence is emerging that StAR mRNA and protein is unexpect- the ability of these nuclear receptors to integrate metabolic edly expressed in a number of non-steroidogenic cells and and inflammatory signalling makes them an attractive may play a hitherto unsuspected role in vascular tissue. target for intervention in human metabolic diseases such as The presence of StAR in murine macrophages and in the atherosclerosis. In this study, we considered the impact of 2/2 aortic tissues of apoE mice has been identified by Ma enhancing cholesterol transport to CYP27A1, via over- 14 15 et al., and Ning et al. found StAR to be present in expression of StAR in murine RAW264.7 macrophages, on murine b.End3 endothelioma cells. The expression of StAR the expression of genes involved in macrophage inflam- has been identified in human monocytes, THP-1 macro- mation, and demonstrate differential regulation of expression phages and human aortic tissue and it was discovered that of Toll-like receptor 3 (Tlr3), Toll-like receptor 6 (Tlr6) and over-expression of StAR enhances cholesterol efflux to the pro-inflammatory cytokine, Lta. apoAI. Moreover, the over-expression of StAR in human THP-1 macrophages has been shown by Ning et al. to decrease intracellular lipids and limit the secretion of inflam- Materials and Methods matory factors by these macrophages which may be impor- Materials tant within the inflammatory surroundings of the artery wall. Notably, StAR over-expression increases the activity Tissue culture reagents were purchased from Lonza of CYP27A1 to produce regulatory oxysterols which have (Wokingham, UK) and murine RAW 264.7 macrophages ......................................................................................................................................................................................................................................... 2 Bioscience Horizons † Volume 3 † Number 1 † March 2010 Research article ......................................................................................................................................................................................................................................... Figure 1. Integration of lipid metabolic and inflammatory signalling in macrophages by LXRs. Cholesterol is taken up from both LDL receptors and apoA/ HDL scavenger receptor B1 (SR-BI) and directed to lipid droplets. Cholesterol can also be synthesized de novo in the endoplasmic reticulum from acetate. Acyl-CoA:cholesterol acyltransferase (ACAT) esterifies free cholesterol to the cholesterol esters that represent the predominant components of lipid droplets whereas free cholesterol is produced by the actions of hormone-sensitive lipase. Free cholesterol is bound by StAR, transported to the outer mitochondrial membrane across the inter-membrane space to the inner mitochondrial membrane, where it is converted, via sterol 27-hydroxylase (CYP27A1), to oxyster- ols such as 27-hydroxysterols. The oxysterols act as endogenous ligands for the LXRs and coordinate macrophage cholesterol transportation and regulation of macrophage inflammatory signalling. from American Type Culture Collection (VA, USA); other procedures. Cells were treated with compounds dissolved 0 0 0 sources include: N ,2 -O-dibutyryladenosine 3 ,5 -cyclic in DMSO delivery vehicle (,0.5%, v/v). Cell media were monophosphate sodium salt (dbcAMP) and dimethyl sulph- removed and 1 ml of each treatment condition was added oxide (DMSO) (Sigma-Aldrich, Cambridge, UK), cDNA syn- to the appropriate wells: treatments included challenge thesis kit and lipopolysaccharide (LPS) (BioLine UK, with the major component of the outer membrane of TM London, UK), RNA isolation TRIzol reagents and Gram-negative Escherichia coli 055:B5 cell wall, LPS Absolute Q-PCR Mix (Invitrogen, Paisley, UK), primers/ (0.1 mg/ml); dibutyryl cAMP (dbcAMP; 0.3 mM); the probes (Eurogentec, Belgium) and LXR agonist, T0901317 potent LXRa and LXRb agonist, T0901317 (10 mM), and (Tocris Biosciences, Bristol, UK). combinations thereof. Cyclic AMP is required to activate protein kinase A, which phosphorylates the StAR protein, and is required for the full activity of StAR to be manifested, Macrophage cell lines whereas LPS is a powerful inflammatory stimulant which Murine macrophage cell line, RAW 264.7 [ECACC activates the NF-kB signalling pathway. Cells were incubated 91062702], was maintained in DMEM containing at 378C under 5% CO in humidified air for 24 h before col- UltraGlutamine, supplemented with foetal bovine serum lection of RNA. (FBS; 10%, v/v), HEPES (10 mmol/l), sodium bicarbonate (0.075%, w/v), and penicillin/streptomycin (50 U/ml; Analysis of gene expression 50 mg/ml). Two stably transfected murine RAW 264.7 TM macrophage cell lines were used in this study: one cell line Total RNA was isolated (TRIzol ) from stably transfected was co-transfected with pTK-Hyg (0.5 mg) and pCMV.5 RAW 264.7 macrophage cell lines (above) and reverse tran- (0.5 mg) containing full-length murine Stard1, and the scribed to cDNA using Moloney murine leukemia virus other with the same amount of pTK-Hyg and empty vector reverse transcriptase enzyme (BioLine). To determine the ( pCMV.5), used throughout this study as the ‘control’, so presence and expression of steroidogenic acute regulatory that all macrophage cell lines were subject to the same protein D1 (Stard1; StAR) and the housekeeping gene ......................................................................................................................................................................................................................................... 3 Research article Bioscience Horizons † Volume 3 † Number 1 † March 2010 ......................................................................................................................................................................................................................................... Table 1. Sequences of primers and fluorescent (FAM/TAMRA) probes used to quantify steady-state levels of mRNA encoding murine genes implicated in macrophage inflammatory responses 0 0 0 0 0 0 mRNA GenBank accession number Forward (5 –3 ) Reverse (5 –3 ) Probe (5 –3 ) ........................................................................................................................................................................................................................................ Tlr3 NM_126166.3 GATTCTTCTGGTGTCTTCCACAAA AATGGCTGCAGTCAGCTACGT CAATGCACTGTGAGATAC Tlr6 NM_011604.2 ACCTGGATGTCTCACACAATCG GCCTCAGGCTCGCCATAG TTGCAAAACATCTCTTG Lta NM_010735.1 CCCAATACCCCTTCCATGTG GGTCCTTGAAGTCCCGGATAC CTCTCCTCAGTGCGCAGA Gapdh NM_008084.2 GGCCTCCAAGGAGTAAGAAAC GGGATAGGGCCTCTCTTGCT CTGGACCACCCACCCCAG Stard1 NM_011485.4 GAGGGCAGCTGTAGAGTGTT TTCTCCACTGGCAGCCTGTT AAAGACCCATGTGTGCCGGCC glyceraldehyde 3-phosphate dehydrogenase (Gapdh)ineach cell line, qualitative polymerase chain reactions (PCR) were carried out using exon-spanning primers based on sequences derived from GenBank. Primers were designed to generate a 355 bp amplicon from Stard1 ( forward: 5 -GTTCCTCGCT 0 0 ACGTTCAAGC-3 ; reverse: 5 -GAAACACCTTGCCCACA TCT-3 ) and a 410 bp amplicon from Gapdh (forward: 0 0 0 5 -TGTTCCTACCCCCAATGTGT-3 ; reverse: 5 - TGTGA GGGAGATGCTCAGTG-3 ). Expression of Toll-like receptor 3 (Tlr3), Toll-like receptor 6 (Tlr6), Lta and Stard1 mRNA, relative to internal ‘housekeep- Figure 2. Amplification efficiency curves for the designed real-time ing’ gene, Gapdh, were performed by quantitative (real-time) ‘Taqman’ primers and probes. Serial dilutions of cDNA template were PCR (Q-PCR) using fluorescent probes, and a DNA Engine titrated (0–1200 ng/ml) and ‘Taqman’ Q-PCR ran (Materials and Opticon 2 (MJ Research). PCRs contained 600 ng cDNA tem- Methods) using mouse-specific Gapdh, Tlr3, Tlr6 and Lta primers (1 mM) and probes (1 mM), in triplicate. Amplification efficiencies were determined plate, Absolute Q-PCR Mix, molecular biology grade water, by plotting the average C value against the log initial cDNA concen- t 10 and 100 nM each forward and reverse primer, and probe. tration (ng/ml) and substituting the slope of the curve into the formula: Thermal cycling conditions were 15 min at 958C, 40 cycles of (1/slope) Amplification Efficiency ¼ (10 )– 1. 15 s at 958C and 20 s at 608C, stasis at 508C. Fluorescent 0 0 probes (FAM 5 -reporter; TAMRA 3 -quencher), and oligonu- cleotide primers, were designed using PrimerExpress Software as appropriate; *p , 0.05; **p , 0.01, ***p , 0.001 com- (PE Applied Biosystems, UK) using murine coding sequences pared with the control incubation, or as indicated. available from GenBank; specific sequences are reported in Table 1. The amplification efficiency of each set of primers was determined by linear regression of the log-phase of ampli- Results and discussion fication. Serial dilution of cDNA template was titrated to Atherosclerosis is an inflammatory disease with distinct cyto- 0 – 1200 ng/ml (dilutions made in molecular biology grade kines modulating the disease at different stages of pro- water) and amplified using each primer and probe set with gression. The accumulation of cholesterol and formation of Q-PCR. The C values obtained were plotted against the logar- foam cells in the micro-environment of arterial intimal lesions ithm of the initial concentration of cDNA and the amplification reflects the balance between cholesterol uptake and removal efficiency calculated from the slope using the equation: (1/slope) as well as the impact of different cytokines (both pro- and anti- Amplification Efficiency ¼ (10 )–1 (Fig. 2); 85 – 100% 2DC inflammatory) to which macrophage-derived foam cells are was deemed acceptable. The comparative 2 (cycle exposed. The mitochondrial cholesterol transporter, StAR, threshold) method was employed for quantification of target which plays a key role in steroid hormone production in steroi- gene mRNA, relative to Gapdh mRNA. dogenic cells, has recently been found to be expressed in a number of non-steroidogenic vascular cells, and may play a hitherto unsuspected role in cholesterol homeostasis in vascular Statistical analysis tissues. Moreover, it has emerged that intracellular lipid All values shown are the mean+ SEM for the number of levels, the secretion of inflammatory molecules and induction independent experiments denoted by n in the legends to of apoptosis are decreased and limited in human THP-1 macro- figures. Significant ( p , 0.05) differences were determined phages over-expressing the StAR protein. using repeated-measures analysis of variance (ANOVA) fol- Here, we investigated the role of StAR in regulating macro- lowed by Bonferroni’s post t-test and Dunnett’s post t-test, phage immune responses, demonstrating that over-expression ......................................................................................................................................................................................................................................... 4 Bioscience Horizons † Volume 3 † Number 1 † March 2010 Research article ......................................................................................................................................................................................................................................... Figure 3. Expression of StAR mRNA in murine RAW 264.7 macrophages stably transfected with pCMV.5_Stard1 (StAR over-expression) or pCMV.5 (control), as judged by (A) the generation of a PCR amplicon (355 bp) relative to GAPDH (410 bp) or (B) by Q-PCR (Materials and Methods) expressed as a ratio relative to the housekeeping gene Gapdh, 24 h after treatment with cAMP (0.3 mM), LPS (0.1 mg/ml) and both agents together, and of T0901317 (LXR; 10 mM) in the presence and absence of cAMP (0.3 mM). Values are the mean+ SEM of three independent experiments; **p , 0.01 compared with ‡‡ ‡‡‡ untreated macrophages; p , 0.01 and p , 0.001 for the comparisons indicated. of StAR in murine RAW 264.7 macrophages represses the of StAR expression in the stably transfected StAR over- expression of Toll-like receptor 6 and markedly increases the expressing macrophages and an abrogation of cAMP stimu- expression of TLR-3 and Lta, strongly suggesting a role for lation in control macrophages (Fig. 3B). In particular, LPS StAR in the regulation of the macrophage innate immune treatment markedly decreased StAR expression in StAR over- response. expressing macrophages compared with untreated control cells. Expression of StAR in the former lies predominantly Over-expression of StAR in murine macrophages under control of the pCMV promoter, which is not regulated StARD1 is critical for supplying cholesterol to CYP27A1, by LPS, so it is likely that decreased expression of Stard1, 28 30 and thus the generation of endogenous LXR ligands. The which has a short half-life (3 h), reflects LPS-dependent expression of StAR mRNA in RAW 264.7 macrophages promotion of mRNA degradation, or post-transcriptional was increased, as judged by qualitative PCR (Fig. 3A) and modifications of StAR protein which trigger degradation. Q-PCR (Fig. 3B), following stable transfection with In the presence of the LXR agonist, T0901317, there was a pCMV_Stard1 and compared with the empty vector trend towards an increase in the expression of Stard1 in control. The qualitative and Q-PCR data show in untreated control, but not in StAR over-expressing cells. The apparent cells, as expected, Stard1 was greatly over-expressed in small increase in StAR expression may be attributed to a StAR over-expressing macrophages, relative to mRNA recently identified LXR response element-like (LXRE-like) levels of housekeeping gene which did not change, compared sequence in the murine StAR promoter region, although with empty vector control macrophages; this difference was the mechanisms underlying the reduction of StAR expression sustained in the presence of a cell-permeant cAMP analog, in the StAR over-expressing cells are less obvious. Finally, dibutyryl cAMP. In empty vector control macrophages addition of both LXR agonist and cAMP analog together treated with cAMP, Stard1 mRNA expression was induced, induced a trend towards increased expression of Stard1 in most likely through a cAMP-like response element (CRE) both control and StAR-expressing cells, probably reflecting identified in the murine StAR promoter region. When chal- induction of endogenous expression of this gene in both lenged with the inflammatory molecule LPS, there was a loss cell lines. ......................................................................................................................................................................................................................................... 5 Research article Bioscience Horizons † Volume 3 † Number 1 † March 2010 ......................................................................................................................................................................................................................................... Figure 4. Expression of Tlr3 mRNA 24 h after treatment with cAMP (0.3 mM), LPS (0.1 mg/ml) and both agents together, and T0901317 (LXR; 10 mM) in the presence and absence of cAMP (0.3 mM) in control and StAR over-expressing macrophages, determined by Q-PCR (Materials and Methods), expressed as a ratio relative to the housekeeping gene Gapdh. Values are the mean+ SEM of three independent experiments; *p , 0.05 and **p , 0.01 compared with untreated macrophages; p , 0.05, for the comparisons indicated. Changes in gene expression induced by StAR The absence of induction of Tlr3 expression in StAR over- over-expression in murine macrophages expressing cells treated with T0901317 was unexpected, but may be explained by a feedback mechanism wherein over- Toll-like receptor 3 load of the LXR machinery may result in loss of expression TLR-3 is considered to play a crucial role in the recognition of of key targets of this transcription factor, possibly as a result double-stranded viral and retroviral RNA, and in the initiation of competition for co-activator proteins; alternatively, it is and continuation of inflammatory and immune responses. possible that over-activation of LXRs for prolonged Our findings suggest endogenous LXR agonism, mediated periods, in the absence of excess sterols, may exert differing by increased mitochondrial cholesterol trafficking via StAR, results compared with the transient activation required to and LXR synthetic agonist, T0901317, may positively regu- resolve increases in cellular cholesterol concentrations. late Tlr3 mRNA expression in murine macrophages (Fig. 4). Cross-talk between the macrophage Toll-like receptors and Over-expression of StAR under basal conditions was associ- LXR signalling pathways has been demonstrated previously: ated with a trend towards increased expression of Tlr3 Joseph et al. showed synthetic ligand activation of LXRs (3-fold) and addition of the cell-permeant cAMP analog inhibited LPS and cytokine-induced expression of inflamma- (dibutyryl cAMP; [0.3 mM]), required for full activity of the tory genes, such as iNOS and IL-6, by interfering with StAR protein to be manifested, markedly increased NF-kB signalling, whereas other studies have shown that expression of Tlr3 (27-fold; p , 0.05; n ¼ 3; 24 h). activation of TLR-3 or TLR-4 by microbial ligands inhibits Importantly, this induction of Tlr3 mRNA expression was the expression of LXR-dependent cholesterol efflux genes not mediated by cAMP per se, as it was apparent only in through a mechanism involving the IRF3 transcription StAR over-expressing macrophages and not in control cells. factor. Our study suggests that LXR activation may These data suggested Tlr3 expression may be regulated by impact on Tlr3 gene expression, although a detailed func- endogenous oxysterol production, not through a CRE, and tional analysis of the promoter region of Tlr3 is required that Tlr3 may be a direct target for LXRs. This finding was to demonstrate that this occurs directly. also suggested by pharmacological activation of LXR using Clearly, the impact of StAR over-expression in macro- T0901317 in control but not StAR over-expressing macro- phages on expression of Tlr3 is complex and context- phages wherein the expression of Tlr3 mRNA was induced dependent. Overall, the data suggest the expression of by addition of this agonist (12.7-fold; p , 0.01; n ¼ 3; StAR may render macrophages more resistant to dsRNA, 24 h). In the presence of T091317, gene expression levels of enhancing the innate immunological response rather than Tlr3 tended to be higher in both cell lines, compared with diminishing it, thus increasing the capability of the cells to macrophages incubated with the LXR ligand and cAMP. survive infection. This combination of effects suggests that No significant changes in Tlr3 expression were noted follow- the LXR pathway may have evolved as a means to potentiate ing LPS treatment, including no evidence of Tlr3 transrepres- the role of the macrophage in the resolution of inflammation. sion, suggesting that StAR over-expression does not protect The data raise the possibility that LXR/RXR agonists may against inflammatory challenge in this respect. ......................................................................................................................................................................................................................................... 6 Bioscience Horizons † Volume 3 † Number 1 † March 2010 Research article ......................................................................................................................................................................................................................................... Figure 5. Expression of Tlr6 mRNA 24 h after treatment with cAMP (0.3 mM), LPS (0.1 mg/ml) and both agents together, and T0901317 (LXR; 10 mM) in the presence and absence of cAMP (0.3 mM) in control and StAR over-expressing macrophages, determined by Q-PCR (Materials and Methods), expressed as a ratio relative to the housekeeping gene Gapdh. Values are the mean+ SEM of three independent experiments; *p , 0.05 and **p , 0.01 compared with ‡‡ ‡‡‡ untreated macrophages; p , 0.01 and p , 0.001 for the comparisons indicated. be used to enhance innate immunity in contexts of extensive StAR has previously been shown to repress lipid accumu- tissue damage, or in response to highly virulent bacterial and lation in macrophages, and to repress inflammatory viral pathogens which may otherwise induce macrophage responses and apoptosis in these cells. Our results chal- apoptosis as a means to subvert host immune defence. lenge this role of StAR as incomplete in conception: StAR over-expression enhances the expression of Tlr6 under Toll-like receptor 6 basal conditions, and only limits the expression of Tlr6 in Toll-like receptor 6 (TLR-6) is fundamental to the macro- the face of an inflammatory challenge. Both pro- and anti- phage innate immune response by specifying and enhancing inflammatory processes may occur simultaneously in the the diacyl lipopeptide pathogen-associated molecular StAR over-expressing murine macrophages treated with pattern sensitivity of TLR-2 and through heterodimerization LPS and cAMP. LPS induces the expression of inflammatory contributing to its signalling capabilities. Under basal con- molecules through TLR-4 ligation and activation of NF-kB ditions, gene expression of Tlr6 was induced over 8.5-fold transcription factors, whereas cAMP not only enhances the ( p , 0.01; n ¼ 3; 24 h) in StAR over-expressing cells, com- activity of StAR via PKA-dependent phosphorylation, but pared with control macrophages (Fig. 5). These levels of also interferes with activation of the NF-kB signalling Tlr6 mRNA were sustained in the presence of cAMP in pathway in some cell types. It is possible that these StAR over-expressing macrophages ( p , 0.001; n ¼ 3; complex cellular processes may antagonize one another 24 h); in contrast, treatment with cAMP significantly ( p , and thus the expression of the NF-kB target gene, Tlr6,is 0.05) decreased gene expression of Tlr6 in control cells. repressed. We also cannot eliminate the possibility that Addition of the LXR agonist T0901317 induced a significant other signalling molecules in the Tlr-4 signalling cascade decline in Tlr6 expression in StAR over-expressing macro- may be down-regulated in response to adverse LPS challenge phages, compared with control cells, mirroring the result or by LXR activation, therefore sequestering NF-kBinan observed with Tlr3 (Fig. 4) and discussed above, although inactive conformation in the cytoplasm and preventing the in this case, the effect was partially reversed by the addition induction of Tlr6 mRNA expression. of cAMP. This may indicate a differential sensitivity to acti- vation/desensitization of the LXR machinery (above), or Lymphotoxin alpha perhaps that endogenous LXR ligands may have alternative cellular functions. Finally, when cells were challenged with Lta is a pro-inflammatory cytokine associated with increased LPS, levels of Tlr6 were clearly reduced in StAR over- cardiovascular risk. In monocytes, Lta induces the terminal expressing cells when compared with either the basal con- differentiation and the synthesis of G-CSF, and in dition or the empty vector control ( p , 0.01). Again, this B-lymphocytes, Lta functions as a mitogen. In neutrophils, suspected transrepression was observed in the presence or Lta induces the production of reactive oxygen species, in absence of cAMP. Repression of induction of inflammatory addition to its role as a chemoattractant, increasing phagocy- molecules by LPS has also been observed with the LXR ago- tosis, and also cell adhesion to the endothelium. Our data nists T0901317 and GW3965 in murine macrophages. suggest expression of the Lta gene was induced by StAR over- ......................................................................................................................................................................................................................................... 7 Research article Bioscience Horizons † Volume 3 † Number 1 † March 2010 ......................................................................................................................................................................................................................................... Figure 6. Expression of Lta mRNA 24 h after treatment with cAMP (0.3 mM), LPS (0.1 mg/ml) and both agents together, and T0901317 (LXR; 10 mM) in the presence and absence of cAMP (0.3 mM) in control and StAR over-expressing macrophages, determined by Q-PCR (Materials and Methods), expressed as a ratio relative to the housekeeping gene Gapdh. Values are the mean+ SEM of three independent experiments; **p , 0.01 compared with untreated ‡ ‡‡‡ macrophages; p , 0.05 and p , 0.001 for the comparisons indicated. expression compared with control cells (Fig. 6). The expression are due to its established function in mitochon- expression of Lta was induced 12.2-fold ( p , 0.05; n ¼ 3; drial cholesterol transport. This study gives us a new 24 h) in StAR over-expressing macrophages under basal con- insight into the physiological and pathological roles of vascu- ditions, compared with control cells. Addition of cAMP, lar StAR protein, revealing some of the positive and negative which induces endogenous expression and activation of effects of this protein in lipid metabolism and inflammation. StAR (Fig. 3), also increased levels of Lta in control macro- It also highlights some deleterious aspects of LXR agonism, phages. Addition of the exogenous LXR agonist also tended raising some important questions as to the utility of LXR to increase Lta levels in control cells, and this effect was agonists in human metabolic diseases such as atherosclerosis. enhanced and proved significant in StAR over-expressing cells ( p , 0.001) in the presence or absence of cAMP, an Acknowledgements effect markedly distinct from the responses observed in Figs 4 and 5.Lta is not an established LXR target, and detailed I gratefully acknowledge the support, advice and supervision analysis of the promoter region of this gene is clearly war- provided by Prof. Annette Graham throughout this project. ranted. Lta expression was further increased 4.29-fold in the Sincere thanks are also due to Dr Janice Taylor, Dr Faye presence of both LPS and cAMP in StAR over-expressing Borthwick and Hossein Elbadawy for technical help and dis- cells ( p , 0.001; n ¼ 3; 24 h). Thus, these data suggest that cussions, and Amanda Gibbon and Asma Riaz for providing over-expression of StAR (and indeed pharmacological acti- RNA samples. vation of LXR) in vascular tissues may exert both positive and negative effects: in this case, inducing the expression of Funding a cytokine which may exacerbate arterial inflammation. This research project was funded by the Department of Biological and Biomedical Sciences, Glasgow Caledonian Conclusions University. The data support a role for StAR in the regulation of macro- phage innate immunological responses and highlight the Author biography pleiotropic effects of mitochondrial cholesterol trafficking in regulating TLR-3, TLR-6, Lta and steroidogenic acute Grant graduated from Glasgow Caledonian University in regulatory protein D1 itself. Overall, we demonstrated that 2009 with a First Class Honours degree in Pharmacology. StAR induces Tlr3 and Lta gene expression, but inhibits He was also awarded the Institute of Biology top Bioscience Tlr6 gene expression in murine macrophages, the latter Student 2009 and the Ian Packer Memorial award for the only when subject to an inflammatory challenge. best Honours Research Project, upon which this article is Importantly, some of the paradoxical and unexpected based. After completing a Biochemical Society Vacation results of this study reveal that the effects of StAR over- Scholarship in 2008, Grant developed a particular interest in expression appear highly context-dependent; it is also cell signalling and trafficking. He is keen to utilise the tools unclear whether all of the observed effects of StAR over- of cell biology, protein chemistry and molecular biology to ......................................................................................................................................................................................................................................... 8 Bioscience Horizons † Volume 3 † Number 1 † March 2010 Research article ......................................................................................................................................................................................................................................... 17. Ning Y, Bai Q, Lu H et al. (2008) Overexpression of mitochondrial cholesterol understand how signal transduction controls normal cellular delivery protein, StAR, decreases intracellular lipids and inflammatory factors processes, the mechanisms of signal sorting, and integration secretion in macrophages. Atherosclerosis 13: 1–7. between different signaling pathways; how these controls are 18. Hall EA, Ren S, Hylemon PB et al. (2005) Detection of the steroidogenic acute altered in disease, and how this information can be exploited regulatory protein, StAR, in human liver cells. Biochim Biophys Acta 1733: in the design and development of novel therapeutic agents. 111–119. Grant is currently doing a four-year Wellcome Trust PhD in 19. Pascual G, Glass CK (2006) Nuclear receptors versus inflammation: mechan- Cellular and Molecular Biology at the University of Dundee. isms of transrepression. Trends Endocrinol Metab 17: 321–327. 20. Bensinger SJ, Tontonoz P (2008) Integration of metabolism and inflam- mation by lipid-activated nuclear receptors. Nature 454: 470–477. 21. Rizzo G, Fiorucci S (2006) PPARs and other nuclear receptors in inflam- mation. Curr Opin Pharmacol 6: 421–427. References 22. Joseph SB, Castrillo A, Laffitte BA et al. (2003) Reciprocal regulation of inflam- 1. Hahn C, Schwartz MA (2009) Mechanotransduction in vascular physiology mation and lipid metabolism by liver X receptors. Nat Med 9: 213–219. and atherogenesis. Nat Rev Mol Cell Biol 10: 53–62. 23. Zelcer N, Tontonoz P (2006) Liver X receptors as integrators of metabolic 2. Hansson KG, Robertson AKL, So¨ derberg-Naucle´r C (2006) Inflammation and and inflammatory signalling. J Clin Invest 116: 607–614. atherosclerosis. Annu Rev Pathol 1: 297–329. 24. Jongstra-Bilen J, Haidari M, Zhu SN et al. (2006) Low-grade chronic inflam- 3. Oram JF, Heinecke JW (2005) ATP-binding cassette transporter A1: a cell mation in regions of the normal mouse arterial intima predisposed to ather- cholesterol exporter that protects against cardiovascular disease. Physiol osclerosis. J Exp Med 203: 2073–2083. Rev 85: 1243–1372. 25. Patel MB, Oza NA, Anand IS et al. (2008) Liver X receptor: a novel therapeutic 4. Venkateswaran A, Lafitte BA, Joseph SB et al. (2000) Control of cellular target. Indian J Pharm Sci 70: 135–144. cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc Natl 26. Libby P (2002) Inflammation in atherosclerosis. Nature 420: 688–674. Acad Sci USA 97: 12097–12102. 27. Kawakami M, Kuroki M (1993) Roles of cytokines and growth factors in ather- 5. Zelcer N, Tontonoz P (2006) Liver X receptors as integrators of metabolic ogenesis. Nippon Rinsho 51: 2010–2015. and inflammatory signaling. J Clin Invest 116: 607–614. 28. Stocco DM (2001) Tracking the role of a star in the sky of a new millennium. 6. Repa JJ, Mangelsdorf DJ (2002) The liver X receptor gene team: potential Mol Endocrinol 15: 1245–1254. new players in atherosclerosis. Nat Med 8: 1243–1248. 29. Christenson LK, Osborne TF, McAllister JM et al. (2001) Conditional response 7. Fu X, Menke G, Chen Y et al. (2001) 27-hydroxycholesterol is an endogenous of the human steroidogenic acute regulatory protein gene promoter to ligand for liver X receptor in cholesterol-loaded cells. J Biol Chem 276: sterol regulatory element binding protein-1a . Endocrinology 142: 128–36. 38378–38387. 30. Hales KH, Diemer T, Ginde S et al. (2000) Diametric effects of bacterial endo- 8. Llaverias G, Lacasa D, Vazquez-Carrera M et al. (2005) Cholesterol regulation toxin lipopolysaccharide on adrenal and Leydig cell steroidogenic acute of genes involved in sterol trafficking in human THP-1 macrophages. Mol Cell regulatory protein. Endocrinology 141: 4000–4012. Biochem 273: 185–191. 31. Cummins CL, Volle DH, Zhang Y et al. (2006) Liver X receptors regulate 9. Westman J, Kallin B, Bjorkhem I et al. (1998) Sterol 27-hydroxylase and adrenal cholesterol balance. J Clin Invest 116: 1902–1912. apoAI/phospholipids-mediated efflux of cholesterol from cholesterol-laden 32. Fukuda K, Watanabe T, Tokisue T (2008) Modulation of double-stranded RNA macrophages: evidence for an inverse relation between the two mechan- recognition by the N-terminal histidine-rich region of the human Toll-like isms. Arterioscler Thromb Vasc Biol 18: 554–561. receptor 3. J Biol Chem 283: 22787–22794. 10. Shanahan CM, Carpenter KLH, Cary NRB (2001) A potential role for sterol 33. Arakane F, King SR, Kallen CB et al. (1997) Phosphorylation of steroidogeniac 27-hydroxylase in atherogenesis. Atherosclerosis 154: 269–276. acute regulatory protein (StAR) modulates its steroidogenic activity. J Biol 11. Verschuren L, de Vries-van der Weij J, Zadelaar S et al. (2009) LXR agonist sup- Chem 272: 32656–32662. presses atherosclerotic lesion growth and promotes lesion regression in 34. Castrillo A, Joseph SB, Vaidya SA (2003) Crosstalk between LXR and Toll-like apoE*3Leiden mice: time course and mechanisms. JLipid Res 50: 301–311. receptor signalling mediates bacterial and viral antagonism of cholesterol 12. Pandak WM, Ren S, Marques D et al. (2002) Transport of cholesterol into metabolism. Mol Cell 12: 805–816. mitochondria is rate-limiting for bile acid synthesis via the alternative 35. Valledor AF (2005) The innate immune response under the control of the pathway in primary rat hepatocytes. J Biol Chem 277: 48158–48164. LXR pathway. Immunobiology 210: 127–132. 13. Christenson LK, Strauss JF (2000) Steroidogenic acute regulatory protein 36. Nakao Y, Funami K, Kikkawa S et al. (2005) Surface-expressed TLR6 partici- (StAR) and the intramitochondrial translocation of cholesterol. Biochim pates in the recognition of diacylated lipopeptide and peptidoglycan in Biophys Acta 1529: 175–187. human cells. J Immunol 174: 1566–1573. 14. Ma Y, Ren S, Pandak WM et al. (2007) The effects of inflammatory cytokines 37. Terasaka N, Hiroshima A, Ariga A et al. (2005) Liver X receptor agonists on steroidogenic acute regulatory protein expression in macrophages. inhibit tissue factor expression in macrophages. FEBS J 272: 1546–1556. Inflamm Res 56: 495–501. 38. Naoum JJ, Chai H, Lin PH et al. (2006) Lymphotoxin-alpha and cardiovascular 15. Ning Y, Chen S, Li X et al. (2006) Cholesterol, LDL and 25-hydroxycholesterol disease: clinical association and pathogenic mechanisms. Med Sci Monit 12: regulate expression of the steroidogenic acute regulatory protein in micro- 121–124. vascular endothelial cell line (bEnd.3). Biochem Biophys Res Commun 342: 1249–1256. 39. Trinchieri G (1992) Effects of TNF and lymphotoxin on the hematopoietic system. Immun Series 56: 289–313. 16. Borthwick F, Taylor JM, Graham A (2007) Expression of STARD1 and STARD4 subfamilies of lipid binding proteins during macrophage differentiation and 40. Kunkel SL (1991) The role of TNF in diverse pathologic processes. Biotherapy methyl-b-cyclodextrin cholesterol depletion. J Clin Lipidol 22: 734–742. 3: 135–141. ........................................................................................................................................................................................................................................ ......................................................................................................................................................................................................................................... http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Bioscience Horizons Oxford University Press

Mitochondrial cholesterol trafficking: impact on inflammatory mediators

English, Grant
Bioscience Horizons , Volume 3 (1) – Mar 16, 2010
Download PDF
9 pages

Loading next page...
 
/lp/oxford-university-press/mitochondrial-cholesterol-trafficking-impact-on-inflammatory-mediators-j6N3b2gk8a

References (37)

Publisher
Oxford University Press
Copyright
© Published by Oxford University Press.
Subject
Research articles
eISSN
1754-7431
DOI
10.1093/biohorizons/hzq002
Publisher site
See Article on Publisher Site

Abstract

Volume 3 † Number 1 † March 2010 10.1093/biohorizons/hzq002 Advance Access publication 16 February 2010 ......................................................................................................................................................................................................................................... Research article Mitochondrial cholesterol trafficking: impact on inflammatory mediators Grant English* Vascular Biology Group, Department of Biological and Biomedical Sciences, Glasgow Caledonian University, Cowcaddens Road, Glasgow G4 0BA, UK. * Corresponding author: Division of Cell and Developmental Biology, College of Life Sciences, MSI/WTB/JBC Complex, University of Dundee, Dundee, DD1 5EH, UK. Tel: þ44 (0)1382 385079. Email: g.english@dundee.ac.uk Supervisor: Professor Annette Graham, Vascular Biology Group, Department of Biological and Biomedical Sciences, Glasgow Caledonian University, Cowcaddens Road, Glasgow G4 0BA, UK. ........................................................................................................................................................................................................................................ Macrophage ‘foam cells’ are the hallmark of early, and developing, atherosclerotic lesions. Generation of 27-oxygenated derivatives of cholesterol, one of the most abundant oxysterols in human atheroma, via mitochondrial sterol 27-hydroxylase (CYP27A1), achieves ligand-activation of liver X nuclear receptors (LXR), which marshal cholesterol homeostatic mechanisms leading to cholesterol efflux and nascent high-density lipoprotein generation. The rate-limiting step controlling activity of CYP27A1 is supply of cholesterol from the outer to the inner (cholesterol-poor) mitochondrial membrane, and can be facilitated by steroidogenic acute regulatory protein (StAR). However, LXR activation also exerts indirect control (transrepression) over gene expression of a range of inflammatory mediators, via interference with nuclear factor-kappa B transcription factors, integrating metabolic and inflammatory signalling. Here, we considered the impact of increased cholesterol delivery to CYP27A1 on the expression of inflammatory mediators: Toll-like receptor 3 (Tlr3), Toll-like receptor 6 (Tlr6) and lymphotoxin alpha (Lta). Murine RAW 264.7 macrophages stably transfected with pCMV.5 (empty vector control) and pCMV.5_Stard1 (StAR over-expressing) were challenged for 24 h, in the presence or absence of dibutyryl cAMP (0.3 mM), lipopoly- saccharide (LPS; 0.1 mg/ml), LXR agonist (T0901317; 10 mM) and combinations thereof. Following isolation of RNA and cDNA synthesis, qualitative polymerase chain reaction (PCR) was used to determine the presence and expression of StAR (355 bp) and housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 410 bp), in each cell line. Levels of Stard1, Tlr3, Tlr6 and Lta mRNA were determined by quantitative PCR and expressed as a ratio to Gapdh. Over-expression of StAR significantly altered expression of genes implicated in the innate immune response, increasing Tlr3, Tlr6 and Lta expression under basal conditions, or following the addition of cAMP to increase StAR activity. Addition of LPS decreased intracellular levels of Stard1 mRNA; preliminary evidence of Tlr6 transrepres- sion was also noted in StAR over-expressing cells following this inflammatory challenge. In contrast, induction of Tlr3 was noted in control following addition of LXR agonist, T0901317, suggesting Tlr3 may be a direct LXR target; Lta expression was also enhanced in StAR over-expressing cells in the presence of this agonist. These results should be considered carefully when developing StAR as a possible therapeutic strategy for human metabolic disease. Key words: atherosclerosis, inflammation, macrophage, cholesterol, Liver X receptors (LXRs), steroidogenic acute regulatory protein (StAR). Submitted on 18 September 2009; accepted on 17 December 2009 ........................................................................................................................................................................................................................................ (oxLDL), for instance, is not cleared by the native LDL Introduction receptor but instead recognized as a ‘foreign particle’, inter- Macrophage ‘foam cells’, laden with cholesterol and choles- nalized and esterified via macrophage scavenging receptors. teryl esters derived from the unregulated uptake of differing Removal of cholesterol from macrophage foam cells can be pro-atherogenic lipoproteins, are a hallmark of early and achieved by cholesterol efflux to acceptor apolipoproteins, developing atherosclerotic lesions, influencing both plaque such as apolipoprotein (apo) AI, apoE and high-density lipo- progression and stability. Oxidized low-density lipoprotein protein (HDL); a process mediated via ATP binding cassette ......................................................................................................................................................................................................................................... The Author 2010. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.5), which permits unrestricted non-commercial use, distri- bution, and reproduction in any medium, provided the original work is properly cited. 1 Research article Bioscience Horizons † Volume 3 † Number 1 † March 2010 ......................................................................................................................................................................................................................................... (ABC) transporters such as ABCA1, ABCG1 and ABCG4. an intrinsic ability to regulate intracellular lipid homeosta- Several studies have demonstrated macrophage cholesterol sis (Fig. 1) supporting an anti-atherogenic role for StAR efflux mechanisms and expression of a number of ABC trans- in the vascular system. porters, implicated in the reverse cholesterol transport In addition to the well-defined role of LXRs in modulating pathway, lie under the transcriptional control of liver X macrophage cholesterol homeostasis, it has recently emerged nuclear receptors (LXRa/b). These form heterodimers that LXR activation regulates the expression of inflammatory with 9-cis retinoid X receptors (RXRs) and bind to genes and the innate immune response (Fig. 1). Liver X cognate LXR-responsive elements (LXREs), consisting of nuclear receptors repress the expression of inflammatory imperfect direct hexameric repeat of the core sequence genes downstream of Toll-like receptor 4 (TLR-4), tumour TGACCT separated by four bases, in the promoter regions necrosis factor alpha (TNFa) and interleukin-1b (IL-1b) sig- of target genes. Recent studies have shown that oxygenated nalling, as well as many nuclear factor-kappa B (NF-kB) derivatives of cholesterol, oxysterols, are potent physiologi- target genes, including inducible nitric oxide synthase cal ligands for LXRs, once considered ‘orphan’ nuclear (iNOS), IL-6, cyclooxygenase-1 (COX-1) and IL-1b. The receptors. The products generated by the mitochondrial ability of LXRs to inhibit activation of transcription factors sterol 27-hydroxylase encoded by CYP27A1, in particular such as NF-kB and attenuate inflammatory responses is 27-hydroxycholesterol, have been shown to be the most termed transrepression. The molecular mechanisms funda- abundant enzymatically generated oxysterols in human mental to signal-specific transrepression remain incompletely atheroma which function as endogenous LXR ligands. understood; however, it is clear that activation of LXR can Several lines of evidence support the concept that inhibit inflammatory responses to LPS or cytokines via CYP27A1 may be an important defence mechanism prevent- blockade of NF-kB signalling, at least in certain cell ing macrophage cholesterol accumulation as the expression types. LXREs remain unidentified in the proximal promo- of CYP27A1 is induced in macrophages laden with choles- ters of target genes, suggesting an indirect mechanism of 8 23 terol and a direct correlation exists between macrophage action. In addition to possible competition for transcrip- 27-hydroxycholesterol and cholesteryl ester content. tional coactivators, it is clear that inhibition of the NF-kB Moreover, CYP27A1 colocalizes with macrophages in ather- pathway does not involve inhibition of NF-kB translocation osclerotic plaques, wherein genes which lie under the regu- to the nucleus, NF-kB binding to DNA or degradation of the latory control of LXRs are up-regulated. Crucially, the NF-kB inhibitor, IkB. However, it is suggested that the rate-limiting step governing the activity of CYP27A1 and ability of LXRs to associate with NF-kB and recruit corepres- generation of 27-oxysterols is the supply of cholesterol to sors, such as nuclear receptor corepressor (NCoR), which the enzyme which is situated on the cholesterol-poor inner antagonizes the activities of NF-kB, is fundamental to the 12 21 mitochondrial membrane. Recent studies have shown mechanism of transrepression. that the trafficking of cholesterol from the outer mitochon- Atherosclerotic lesions are proinflammatory in nature, drial membrane to the inner mitochondrial membrane characterized by chronic, unresolved low-grade inflam- across the inter-mitochondrial membrane space can be mation in the arterial wall; a positive risk factor for devel- mediated by steroidogenic acute regulatory protein (StAR). oping atherosclerosis and other cardiovascular diseases. As In steroidogenic tissues, StAR is a critical regulator of the LXRs positively and negatively regulate the expression of a 12 25 synthesis of adrenal and gonadal steroids; however, evi- range of metabolic and inflammatory genes, respectively, dence is emerging that StAR mRNA and protein is unexpect- the ability of these nuclear receptors to integrate metabolic edly expressed in a number of non-steroidogenic cells and and inflammatory signalling makes them an attractive may play a hitherto unsuspected role in vascular tissue. target for intervention in human metabolic diseases such as The presence of StAR in murine macrophages and in the atherosclerosis. In this study, we considered the impact of 2/2 aortic tissues of apoE mice has been identified by Ma enhancing cholesterol transport to CYP27A1, via over- 14 15 et al., and Ning et al. found StAR to be present in expression of StAR in murine RAW264.7 macrophages, on murine b.End3 endothelioma cells. The expression of StAR the expression of genes involved in macrophage inflam- has been identified in human monocytes, THP-1 macro- mation, and demonstrate differential regulation of expression phages and human aortic tissue and it was discovered that of Toll-like receptor 3 (Tlr3), Toll-like receptor 6 (Tlr6) and over-expression of StAR enhances cholesterol efflux to the pro-inflammatory cytokine, Lta. apoAI. Moreover, the over-expression of StAR in human THP-1 macrophages has been shown by Ning et al. to decrease intracellular lipids and limit the secretion of inflam- Materials and Methods matory factors by these macrophages which may be impor- Materials tant within the inflammatory surroundings of the artery wall. Notably, StAR over-expression increases the activity Tissue culture reagents were purchased from Lonza of CYP27A1 to produce regulatory oxysterols which have (Wokingham, UK) and murine RAW 264.7 macrophages ......................................................................................................................................................................................................................................... 2 Bioscience Horizons † Volume 3 † Number 1 † March 2010 Research article ......................................................................................................................................................................................................................................... Figure 1. Integration of lipid metabolic and inflammatory signalling in macrophages by LXRs. Cholesterol is taken up from both LDL receptors and apoA/ HDL scavenger receptor B1 (SR-BI) and directed to lipid droplets. Cholesterol can also be synthesized de novo in the endoplasmic reticulum from acetate. Acyl-CoA:cholesterol acyltransferase (ACAT) esterifies free cholesterol to the cholesterol esters that represent the predominant components of lipid droplets whereas free cholesterol is produced by the actions of hormone-sensitive lipase. Free cholesterol is bound by StAR, transported to the outer mitochondrial membrane across the inter-membrane space to the inner mitochondrial membrane, where it is converted, via sterol 27-hydroxylase (CYP27A1), to oxyster- ols such as 27-hydroxysterols. The oxysterols act as endogenous ligands for the LXRs and coordinate macrophage cholesterol transportation and regulation of macrophage inflammatory signalling. from American Type Culture Collection (VA, USA); other procedures. Cells were treated with compounds dissolved 0 0 0 sources include: N ,2 -O-dibutyryladenosine 3 ,5 -cyclic in DMSO delivery vehicle (,0.5%, v/v). Cell media were monophosphate sodium salt (dbcAMP) and dimethyl sulph- removed and 1 ml of each treatment condition was added oxide (DMSO) (Sigma-Aldrich, Cambridge, UK), cDNA syn- to the appropriate wells: treatments included challenge thesis kit and lipopolysaccharide (LPS) (BioLine UK, with the major component of the outer membrane of TM London, UK), RNA isolation TRIzol reagents and Gram-negative Escherichia coli 055:B5 cell wall, LPS Absolute Q-PCR Mix (Invitrogen, Paisley, UK), primers/ (0.1 mg/ml); dibutyryl cAMP (dbcAMP; 0.3 mM); the probes (Eurogentec, Belgium) and LXR agonist, T0901317 potent LXRa and LXRb agonist, T0901317 (10 mM), and (Tocris Biosciences, Bristol, UK). combinations thereof. Cyclic AMP is required to activate protein kinase A, which phosphorylates the StAR protein, and is required for the full activity of StAR to be manifested, Macrophage cell lines whereas LPS is a powerful inflammatory stimulant which Murine macrophage cell line, RAW 264.7 [ECACC activates the NF-kB signalling pathway. Cells were incubated 91062702], was maintained in DMEM containing at 378C under 5% CO in humidified air for 24 h before col- UltraGlutamine, supplemented with foetal bovine serum lection of RNA. (FBS; 10%, v/v), HEPES (10 mmol/l), sodium bicarbonate (0.075%, w/v), and penicillin/streptomycin (50 U/ml; Analysis of gene expression 50 mg/ml). Two stably transfected murine RAW 264.7 TM macrophage cell lines were used in this study: one cell line Total RNA was isolated (TRIzol ) from stably transfected was co-transfected with pTK-Hyg (0.5 mg) and pCMV.5 RAW 264.7 macrophage cell lines (above) and reverse tran- (0.5 mg) containing full-length murine Stard1, and the scribed to cDNA using Moloney murine leukemia virus other with the same amount of pTK-Hyg and empty vector reverse transcriptase enzyme (BioLine). To determine the ( pCMV.5), used throughout this study as the ‘control’, so presence and expression of steroidogenic acute regulatory that all macrophage cell lines were subject to the same protein D1 (Stard1; StAR) and the housekeeping gene ......................................................................................................................................................................................................................................... 3 Research article Bioscience Horizons † Volume 3 † Number 1 † March 2010 ......................................................................................................................................................................................................................................... Table 1. Sequences of primers and fluorescent (FAM/TAMRA) probes used to quantify steady-state levels of mRNA encoding murine genes implicated in macrophage inflammatory responses 0 0 0 0 0 0 mRNA GenBank accession number Forward (5 –3 ) Reverse (5 –3 ) Probe (5 –3 ) ........................................................................................................................................................................................................................................ Tlr3 NM_126166.3 GATTCTTCTGGTGTCTTCCACAAA AATGGCTGCAGTCAGCTACGT CAATGCACTGTGAGATAC Tlr6 NM_011604.2 ACCTGGATGTCTCACACAATCG GCCTCAGGCTCGCCATAG TTGCAAAACATCTCTTG Lta NM_010735.1 CCCAATACCCCTTCCATGTG GGTCCTTGAAGTCCCGGATAC CTCTCCTCAGTGCGCAGA Gapdh NM_008084.2 GGCCTCCAAGGAGTAAGAAAC GGGATAGGGCCTCTCTTGCT CTGGACCACCCACCCCAG Stard1 NM_011485.4 GAGGGCAGCTGTAGAGTGTT TTCTCCACTGGCAGCCTGTT AAAGACCCATGTGTGCCGGCC glyceraldehyde 3-phosphate dehydrogenase (Gapdh)ineach cell line, qualitative polymerase chain reactions (PCR) were carried out using exon-spanning primers based on sequences derived from GenBank. Primers were designed to generate a 355 bp amplicon from Stard1 ( forward: 5 -GTTCCTCGCT 0 0 ACGTTCAAGC-3 ; reverse: 5 -GAAACACCTTGCCCACA TCT-3 ) and a 410 bp amplicon from Gapdh (forward: 0 0 0 5 -TGTTCCTACCCCCAATGTGT-3 ; reverse: 5 - TGTGA GGGAGATGCTCAGTG-3 ). Expression of Toll-like receptor 3 (Tlr3), Toll-like receptor 6 (Tlr6), Lta and Stard1 mRNA, relative to internal ‘housekeep- Figure 2. Amplification efficiency curves for the designed real-time ing’ gene, Gapdh, were performed by quantitative (real-time) ‘Taqman’ primers and probes. Serial dilutions of cDNA template were PCR (Q-PCR) using fluorescent probes, and a DNA Engine titrated (0–1200 ng/ml) and ‘Taqman’ Q-PCR ran (Materials and Opticon 2 (MJ Research). PCRs contained 600 ng cDNA tem- Methods) using mouse-specific Gapdh, Tlr3, Tlr6 and Lta primers (1 mM) and probes (1 mM), in triplicate. Amplification efficiencies were determined plate, Absolute Q-PCR Mix, molecular biology grade water, by plotting the average C value against the log initial cDNA concen- t 10 and 100 nM each forward and reverse primer, and probe. tration (ng/ml) and substituting the slope of the curve into the formula: Thermal cycling conditions were 15 min at 958C, 40 cycles of (1/slope) Amplification Efficiency ¼ (10 )– 1. 15 s at 958C and 20 s at 608C, stasis at 508C. Fluorescent 0 0 probes (FAM 5 -reporter; TAMRA 3 -quencher), and oligonu- cleotide primers, were designed using PrimerExpress Software as appropriate; *p , 0.05; **p , 0.01, ***p , 0.001 com- (PE Applied Biosystems, UK) using murine coding sequences pared with the control incubation, or as indicated. available from GenBank; specific sequences are reported in Table 1. The amplification efficiency of each set of primers was determined by linear regression of the log-phase of ampli- Results and discussion fication. Serial dilution of cDNA template was titrated to Atherosclerosis is an inflammatory disease with distinct cyto- 0 – 1200 ng/ml (dilutions made in molecular biology grade kines modulating the disease at different stages of pro- water) and amplified using each primer and probe set with gression. The accumulation of cholesterol and formation of Q-PCR. The C values obtained were plotted against the logar- foam cells in the micro-environment of arterial intimal lesions ithm of the initial concentration of cDNA and the amplification reflects the balance between cholesterol uptake and removal efficiency calculated from the slope using the equation: (1/slope) as well as the impact of different cytokines (both pro- and anti- Amplification Efficiency ¼ (10 )–1 (Fig. 2); 85 – 100% 2DC inflammatory) to which macrophage-derived foam cells are was deemed acceptable. The comparative 2 (cycle exposed. The mitochondrial cholesterol transporter, StAR, threshold) method was employed for quantification of target which plays a key role in steroid hormone production in steroi- gene mRNA, relative to Gapdh mRNA. dogenic cells, has recently been found to be expressed in a number of non-steroidogenic vascular cells, and may play a hitherto unsuspected role in cholesterol homeostasis in vascular Statistical analysis tissues. Moreover, it has emerged that intracellular lipid All values shown are the mean+ SEM for the number of levels, the secretion of inflammatory molecules and induction independent experiments denoted by n in the legends to of apoptosis are decreased and limited in human THP-1 macro- figures. Significant ( p , 0.05) differences were determined phages over-expressing the StAR protein. using repeated-measures analysis of variance (ANOVA) fol- Here, we investigated the role of StAR in regulating macro- lowed by Bonferroni’s post t-test and Dunnett’s post t-test, phage immune responses, demonstrating that over-expression ......................................................................................................................................................................................................................................... 4 Bioscience Horizons † Volume 3 † Number 1 † March 2010 Research article ......................................................................................................................................................................................................................................... Figure 3. Expression of StAR mRNA in murine RAW 264.7 macrophages stably transfected with pCMV.5_Stard1 (StAR over-expression) or pCMV.5 (control), as judged by (A) the generation of a PCR amplicon (355 bp) relative to GAPDH (410 bp) or (B) by Q-PCR (Materials and Methods) expressed as a ratio relative to the housekeeping gene Gapdh, 24 h after treatment with cAMP (0.3 mM), LPS (0.1 mg/ml) and both agents together, and of T0901317 (LXR; 10 mM) in the presence and absence of cAMP (0.3 mM). Values are the mean+ SEM of three independent experiments; **p , 0.01 compared with ‡‡ ‡‡‡ untreated macrophages; p , 0.01 and p , 0.001 for the comparisons indicated. of StAR in murine RAW 264.7 macrophages represses the of StAR expression in the stably transfected StAR over- expression of Toll-like receptor 6 and markedly increases the expressing macrophages and an abrogation of cAMP stimu- expression of TLR-3 and Lta, strongly suggesting a role for lation in control macrophages (Fig. 3B). In particular, LPS StAR in the regulation of the macrophage innate immune treatment markedly decreased StAR expression in StAR over- response. expressing macrophages compared with untreated control cells. Expression of StAR in the former lies predominantly Over-expression of StAR in murine macrophages under control of the pCMV promoter, which is not regulated StARD1 is critical for supplying cholesterol to CYP27A1, by LPS, so it is likely that decreased expression of Stard1, 28 30 and thus the generation of endogenous LXR ligands. The which has a short half-life (3 h), reflects LPS-dependent expression of StAR mRNA in RAW 264.7 macrophages promotion of mRNA degradation, or post-transcriptional was increased, as judged by qualitative PCR (Fig. 3A) and modifications of StAR protein which trigger degradation. Q-PCR (Fig. 3B), following stable transfection with In the presence of the LXR agonist, T0901317, there was a pCMV_Stard1 and compared with the empty vector trend towards an increase in the expression of Stard1 in control. The qualitative and Q-PCR data show in untreated control, but not in StAR over-expressing cells. The apparent cells, as expected, Stard1 was greatly over-expressed in small increase in StAR expression may be attributed to a StAR over-expressing macrophages, relative to mRNA recently identified LXR response element-like (LXRE-like) levels of housekeeping gene which did not change, compared sequence in the murine StAR promoter region, although with empty vector control macrophages; this difference was the mechanisms underlying the reduction of StAR expression sustained in the presence of a cell-permeant cAMP analog, in the StAR over-expressing cells are less obvious. Finally, dibutyryl cAMP. In empty vector control macrophages addition of both LXR agonist and cAMP analog together treated with cAMP, Stard1 mRNA expression was induced, induced a trend towards increased expression of Stard1 in most likely through a cAMP-like response element (CRE) both control and StAR-expressing cells, probably reflecting identified in the murine StAR promoter region. When chal- induction of endogenous expression of this gene in both lenged with the inflammatory molecule LPS, there was a loss cell lines. ......................................................................................................................................................................................................................................... 5 Research article Bioscience Horizons † Volume 3 † Number 1 † March 2010 ......................................................................................................................................................................................................................................... Figure 4. Expression of Tlr3 mRNA 24 h after treatment with cAMP (0.3 mM), LPS (0.1 mg/ml) and both agents together, and T0901317 (LXR; 10 mM) in the presence and absence of cAMP (0.3 mM) in control and StAR over-expressing macrophages, determined by Q-PCR (Materials and Methods), expressed as a ratio relative to the housekeeping gene Gapdh. Values are the mean+ SEM of three independent experiments; *p , 0.05 and **p , 0.01 compared with untreated macrophages; p , 0.05, for the comparisons indicated. Changes in gene expression induced by StAR The absence of induction of Tlr3 expression in StAR over- over-expression in murine macrophages expressing cells treated with T0901317 was unexpected, but may be explained by a feedback mechanism wherein over- Toll-like receptor 3 load of the LXR machinery may result in loss of expression TLR-3 is considered to play a crucial role in the recognition of of key targets of this transcription factor, possibly as a result double-stranded viral and retroviral RNA, and in the initiation of competition for co-activator proteins; alternatively, it is and continuation of inflammatory and immune responses. possible that over-activation of LXRs for prolonged Our findings suggest endogenous LXR agonism, mediated periods, in the absence of excess sterols, may exert differing by increased mitochondrial cholesterol trafficking via StAR, results compared with the transient activation required to and LXR synthetic agonist, T0901317, may positively regu- resolve increases in cellular cholesterol concentrations. late Tlr3 mRNA expression in murine macrophages (Fig. 4). Cross-talk between the macrophage Toll-like receptors and Over-expression of StAR under basal conditions was associ- LXR signalling pathways has been demonstrated previously: ated with a trend towards increased expression of Tlr3 Joseph et al. showed synthetic ligand activation of LXRs (3-fold) and addition of the cell-permeant cAMP analog inhibited LPS and cytokine-induced expression of inflamma- (dibutyryl cAMP; [0.3 mM]), required for full activity of the tory genes, such as iNOS and IL-6, by interfering with StAR protein to be manifested, markedly increased NF-kB signalling, whereas other studies have shown that expression of Tlr3 (27-fold; p , 0.05; n ¼ 3; 24 h). activation of TLR-3 or TLR-4 by microbial ligands inhibits Importantly, this induction of Tlr3 mRNA expression was the expression of LXR-dependent cholesterol efflux genes not mediated by cAMP per se, as it was apparent only in through a mechanism involving the IRF3 transcription StAR over-expressing macrophages and not in control cells. factor. Our study suggests that LXR activation may These data suggested Tlr3 expression may be regulated by impact on Tlr3 gene expression, although a detailed func- endogenous oxysterol production, not through a CRE, and tional analysis of the promoter region of Tlr3 is required that Tlr3 may be a direct target for LXRs. This finding was to demonstrate that this occurs directly. also suggested by pharmacological activation of LXR using Clearly, the impact of StAR over-expression in macro- T0901317 in control but not StAR over-expressing macro- phages on expression of Tlr3 is complex and context- phages wherein the expression of Tlr3 mRNA was induced dependent. Overall, the data suggest the expression of by addition of this agonist (12.7-fold; p , 0.01; n ¼ 3; StAR may render macrophages more resistant to dsRNA, 24 h). In the presence of T091317, gene expression levels of enhancing the innate immunological response rather than Tlr3 tended to be higher in both cell lines, compared with diminishing it, thus increasing the capability of the cells to macrophages incubated with the LXR ligand and cAMP. survive infection. This combination of effects suggests that No significant changes in Tlr3 expression were noted follow- the LXR pathway may have evolved as a means to potentiate ing LPS treatment, including no evidence of Tlr3 transrepres- the role of the macrophage in the resolution of inflammation. sion, suggesting that StAR over-expression does not protect The data raise the possibility that LXR/RXR agonists may against inflammatory challenge in this respect. ......................................................................................................................................................................................................................................... 6 Bioscience Horizons † Volume 3 † Number 1 † March 2010 Research article ......................................................................................................................................................................................................................................... Figure 5. Expression of Tlr6 mRNA 24 h after treatment with cAMP (0.3 mM), LPS (0.1 mg/ml) and both agents together, and T0901317 (LXR; 10 mM) in the presence and absence of cAMP (0.3 mM) in control and StAR over-expressing macrophages, determined by Q-PCR (Materials and Methods), expressed as a ratio relative to the housekeeping gene Gapdh. Values are the mean+ SEM of three independent experiments; *p , 0.05 and **p , 0.01 compared with ‡‡ ‡‡‡ untreated macrophages; p , 0.01 and p , 0.001 for the comparisons indicated. be used to enhance innate immunity in contexts of extensive StAR has previously been shown to repress lipid accumu- tissue damage, or in response to highly virulent bacterial and lation in macrophages, and to repress inflammatory viral pathogens which may otherwise induce macrophage responses and apoptosis in these cells. Our results chal- apoptosis as a means to subvert host immune defence. lenge this role of StAR as incomplete in conception: StAR over-expression enhances the expression of Tlr6 under Toll-like receptor 6 basal conditions, and only limits the expression of Tlr6 in Toll-like receptor 6 (TLR-6) is fundamental to the macro- the face of an inflammatory challenge. Both pro- and anti- phage innate immune response by specifying and enhancing inflammatory processes may occur simultaneously in the the diacyl lipopeptide pathogen-associated molecular StAR over-expressing murine macrophages treated with pattern sensitivity of TLR-2 and through heterodimerization LPS and cAMP. LPS induces the expression of inflammatory contributing to its signalling capabilities. Under basal con- molecules through TLR-4 ligation and activation of NF-kB ditions, gene expression of Tlr6 was induced over 8.5-fold transcription factors, whereas cAMP not only enhances the ( p , 0.01; n ¼ 3; 24 h) in StAR over-expressing cells, com- activity of StAR via PKA-dependent phosphorylation, but pared with control macrophages (Fig. 5). These levels of also interferes with activation of the NF-kB signalling Tlr6 mRNA were sustained in the presence of cAMP in pathway in some cell types. It is possible that these StAR over-expressing macrophages ( p , 0.001; n ¼ 3; complex cellular processes may antagonize one another 24 h); in contrast, treatment with cAMP significantly ( p , and thus the expression of the NF-kB target gene, Tlr6,is 0.05) decreased gene expression of Tlr6 in control cells. repressed. We also cannot eliminate the possibility that Addition of the LXR agonist T0901317 induced a significant other signalling molecules in the Tlr-4 signalling cascade decline in Tlr6 expression in StAR over-expressing macro- may be down-regulated in response to adverse LPS challenge phages, compared with control cells, mirroring the result or by LXR activation, therefore sequestering NF-kBinan observed with Tlr3 (Fig. 4) and discussed above, although inactive conformation in the cytoplasm and preventing the in this case, the effect was partially reversed by the addition induction of Tlr6 mRNA expression. of cAMP. This may indicate a differential sensitivity to acti- vation/desensitization of the LXR machinery (above), or Lymphotoxin alpha perhaps that endogenous LXR ligands may have alternative cellular functions. Finally, when cells were challenged with Lta is a pro-inflammatory cytokine associated with increased LPS, levels of Tlr6 were clearly reduced in StAR over- cardiovascular risk. In monocytes, Lta induces the terminal expressing cells when compared with either the basal con- differentiation and the synthesis of G-CSF, and in dition or the empty vector control ( p , 0.01). Again, this B-lymphocytes, Lta functions as a mitogen. In neutrophils, suspected transrepression was observed in the presence or Lta induces the production of reactive oxygen species, in absence of cAMP. Repression of induction of inflammatory addition to its role as a chemoattractant, increasing phagocy- molecules by LPS has also been observed with the LXR ago- tosis, and also cell adhesion to the endothelium. Our data nists T0901317 and GW3965 in murine macrophages. suggest expression of the Lta gene was induced by StAR over- ......................................................................................................................................................................................................................................... 7 Research article Bioscience Horizons † Volume 3 † Number 1 † March 2010 ......................................................................................................................................................................................................................................... Figure 6. Expression of Lta mRNA 24 h after treatment with cAMP (0.3 mM), LPS (0.1 mg/ml) and both agents together, and T0901317 (LXR; 10 mM) in the presence and absence of cAMP (0.3 mM) in control and StAR over-expressing macrophages, determined by Q-PCR (Materials and Methods), expressed as a ratio relative to the housekeeping gene Gapdh. Values are the mean+ SEM of three independent experiments; **p , 0.01 compared with untreated ‡ ‡‡‡ macrophages; p , 0.05 and p , 0.001 for the comparisons indicated. expression compared with control cells (Fig. 6). The expression are due to its established function in mitochon- expression of Lta was induced 12.2-fold ( p , 0.05; n ¼ 3; drial cholesterol transport. This study gives us a new 24 h) in StAR over-expressing macrophages under basal con- insight into the physiological and pathological roles of vascu- ditions, compared with control cells. Addition of cAMP, lar StAR protein, revealing some of the positive and negative which induces endogenous expression and activation of effects of this protein in lipid metabolism and inflammation. StAR (Fig. 3), also increased levels of Lta in control macro- It also highlights some deleterious aspects of LXR agonism, phages. Addition of the exogenous LXR agonist also tended raising some important questions as to the utility of LXR to increase Lta levels in control cells, and this effect was agonists in human metabolic diseases such as atherosclerosis. enhanced and proved significant in StAR over-expressing cells ( p , 0.001) in the presence or absence of cAMP, an Acknowledgements effect markedly distinct from the responses observed in Figs 4 and 5.Lta is not an established LXR target, and detailed I gratefully acknowledge the support, advice and supervision analysis of the promoter region of this gene is clearly war- provided by Prof. Annette Graham throughout this project. ranted. Lta expression was further increased 4.29-fold in the Sincere thanks are also due to Dr Janice Taylor, Dr Faye presence of both LPS and cAMP in StAR over-expressing Borthwick and Hossein Elbadawy for technical help and dis- cells ( p , 0.001; n ¼ 3; 24 h). Thus, these data suggest that cussions, and Amanda Gibbon and Asma Riaz for providing over-expression of StAR (and indeed pharmacological acti- RNA samples. vation of LXR) in vascular tissues may exert both positive and negative effects: in this case, inducing the expression of Funding a cytokine which may exacerbate arterial inflammation. This research project was funded by the Department of Biological and Biomedical Sciences, Glasgow Caledonian Conclusions University. The data support a role for StAR in the regulation of macro- phage innate immunological responses and highlight the Author biography pleiotropic effects of mitochondrial cholesterol trafficking in regulating TLR-3, TLR-6, Lta and steroidogenic acute Grant graduated from Glasgow Caledonian University in regulatory protein D1 itself. Overall, we demonstrated that 2009 with a First Class Honours degree in Pharmacology. StAR induces Tlr3 and Lta gene expression, but inhibits He was also awarded the Institute of Biology top Bioscience Tlr6 gene expression in murine macrophages, the latter Student 2009 and the Ian Packer Memorial award for the only when subject to an inflammatory challenge. best Honours Research Project, upon which this article is Importantly, some of the paradoxical and unexpected based. After completing a Biochemical Society Vacation results of this study reveal that the effects of StAR over- Scholarship in 2008, Grant developed a particular interest in expression appear highly context-dependent; it is also cell signalling and trafficking. He is keen to utilise the tools unclear whether all of the observed effects of StAR over- of cell biology, protein chemistry and molecular biology to ......................................................................................................................................................................................................................................... 8 Bioscience Horizons † Volume 3 † Number 1 † March 2010 Research article ......................................................................................................................................................................................................................................... 17. Ning Y, Bai Q, Lu H et al. (2008) Overexpression of mitochondrial cholesterol understand how signal transduction controls normal cellular delivery protein, StAR, decreases intracellular lipids and inflammatory factors processes, the mechanisms of signal sorting, and integration secretion in macrophages. Atherosclerosis 13: 1–7. between different signaling pathways; how these controls are 18. Hall EA, Ren S, Hylemon PB et al. (2005) Detection of the steroidogenic acute altered in disease, and how this information can be exploited regulatory protein, StAR, in human liver cells. Biochim Biophys Acta 1733: in the design and development of novel therapeutic agents. 111–119. Grant is currently doing a four-year Wellcome Trust PhD in 19. Pascual G, Glass CK (2006) Nuclear receptors versus inflammation: mechan- Cellular and Molecular Biology at the University of Dundee. isms of transrepression. Trends Endocrinol Metab 17: 321–327. 20. Bensinger SJ, Tontonoz P (2008) Integration of metabolism and inflam- mation by lipid-activated nuclear receptors. Nature 454: 470–477. 21. Rizzo G, Fiorucci S (2006) PPARs and other nuclear receptors in inflam- mation. Curr Opin Pharmacol 6: 421–427. References 22. Joseph SB, Castrillo A, Laffitte BA et al. (2003) Reciprocal regulation of inflam- 1. Hahn C, Schwartz MA (2009) Mechanotransduction in vascular physiology mation and lipid metabolism by liver X receptors. Nat Med 9: 213–219. and atherogenesis. Nat Rev Mol Cell Biol 10: 53–62. 23. Zelcer N, Tontonoz P (2006) Liver X receptors as integrators of metabolic 2. Hansson KG, Robertson AKL, So¨ derberg-Naucle´r C (2006) Inflammation and and inflammatory signalling. J Clin Invest 116: 607–614. atherosclerosis. Annu Rev Pathol 1: 297–329. 24. Jongstra-Bilen J, Haidari M, Zhu SN et al. (2006) Low-grade chronic inflam- 3. Oram JF, Heinecke JW (2005) ATP-binding cassette transporter A1: a cell mation in regions of the normal mouse arterial intima predisposed to ather- cholesterol exporter that protects against cardiovascular disease. Physiol osclerosis. J Exp Med 203: 2073–2083. Rev 85: 1243–1372. 25. Patel MB, Oza NA, Anand IS et al. (2008) Liver X receptor: a novel therapeutic 4. Venkateswaran A, Lafitte BA, Joseph SB et al. (2000) Control of cellular target. Indian J Pharm Sci 70: 135–144. cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc Natl 26. Libby P (2002) Inflammation in atherosclerosis. Nature 420: 688–674. Acad Sci USA 97: 12097–12102. 27. Kawakami M, Kuroki M (1993) Roles of cytokines and growth factors in ather- 5. Zelcer N, Tontonoz P (2006) Liver X receptors as integrators of metabolic ogenesis. Nippon Rinsho 51: 2010–2015. and inflammatory signaling. J Clin Invest 116: 607–614. 28. Stocco DM (2001) Tracking the role of a star in the sky of a new millennium. 6. Repa JJ, Mangelsdorf DJ (2002) The liver X receptor gene team: potential Mol Endocrinol 15: 1245–1254. new players in atherosclerosis. Nat Med 8: 1243–1248. 29. Christenson LK, Osborne TF, McAllister JM et al. (2001) Conditional response 7. Fu X, Menke G, Chen Y et al. (2001) 27-hydroxycholesterol is an endogenous of the human steroidogenic acute regulatory protein gene promoter to ligand for liver X receptor in cholesterol-loaded cells. J Biol Chem 276: sterol regulatory element binding protein-1a . Endocrinology 142: 128–36. 38378–38387. 30. Hales KH, Diemer T, Ginde S et al. (2000) Diametric effects of bacterial endo- 8. Llaverias G, Lacasa D, Vazquez-Carrera M et al. (2005) Cholesterol regulation toxin lipopolysaccharide on adrenal and Leydig cell steroidogenic acute of genes involved in sterol trafficking in human THP-1 macrophages. Mol Cell regulatory protein. Endocrinology 141: 4000–4012. Biochem 273: 185–191. 31. Cummins CL, Volle DH, Zhang Y et al. (2006) Liver X receptors regulate 9. Westman J, Kallin B, Bjorkhem I et al. (1998) Sterol 27-hydroxylase and adrenal cholesterol balance. J Clin Invest 116: 1902–1912. apoAI/phospholipids-mediated efflux of cholesterol from cholesterol-laden 32. Fukuda K, Watanabe T, Tokisue T (2008) Modulation of double-stranded RNA macrophages: evidence for an inverse relation between the two mechan- recognition by the N-terminal histidine-rich region of the human Toll-like isms. Arterioscler Thromb Vasc Biol 18: 554–561. receptor 3. J Biol Chem 283: 22787–22794. 10. Shanahan CM, Carpenter KLH, Cary NRB (2001) A potential role for sterol 33. Arakane F, King SR, Kallen CB et al. (1997) Phosphorylation of steroidogeniac 27-hydroxylase in atherogenesis. Atherosclerosis 154: 269–276. acute regulatory protein (StAR) modulates its steroidogenic activity. J Biol 11. Verschuren L, de Vries-van der Weij J, Zadelaar S et al. (2009) LXR agonist sup- Chem 272: 32656–32662. presses atherosclerotic lesion growth and promotes lesion regression in 34. Castrillo A, Joseph SB, Vaidya SA (2003) Crosstalk between LXR and Toll-like apoE*3Leiden mice: time course and mechanisms. JLipid Res 50: 301–311. receptor signalling mediates bacterial and viral antagonism of cholesterol 12. Pandak WM, Ren S, Marques D et al. (2002) Transport of cholesterol into metabolism. Mol Cell 12: 805–816. mitochondria is rate-limiting for bile acid synthesis via the alternative 35. Valledor AF (2005) The innate immune response under the control of the pathway in primary rat hepatocytes. J Biol Chem 277: 48158–48164. LXR pathway. Immunobiology 210: 127–132. 13. Christenson LK, Strauss JF (2000) Steroidogenic acute regulatory protein 36. Nakao Y, Funami K, Kikkawa S et al. (2005) Surface-expressed TLR6 partici- (StAR) and the intramitochondrial translocation of cholesterol. Biochim pates in the recognition of diacylated lipopeptide and peptidoglycan in Biophys Acta 1529: 175–187. human cells. J Immunol 174: 1566–1573. 14. Ma Y, Ren S, Pandak WM et al. (2007) The effects of inflammatory cytokines 37. Terasaka N, Hiroshima A, Ariga A et al. (2005) Liver X receptor agonists on steroidogenic acute regulatory protein expression in macrophages. inhibit tissue factor expression in macrophages. FEBS J 272: 1546–1556. Inflamm Res 56: 495–501. 38. Naoum JJ, Chai H, Lin PH et al. (2006) Lymphotoxin-alpha and cardiovascular 15. Ning Y, Chen S, Li X et al. (2006) Cholesterol, LDL and 25-hydroxycholesterol disease: clinical association and pathogenic mechanisms. Med Sci Monit 12: regulate expression of the steroidogenic acute regulatory protein in micro- 121–124. vascular endothelial cell line (bEnd.3). Biochem Biophys Res Commun 342: 1249–1256. 39. Trinchieri G (1992) Effects of TNF and lymphotoxin on the hematopoietic system. Immun Series 56: 289–313. 16. Borthwick F, Taylor JM, Graham A (2007) Expression of STARD1 and STARD4 subfamilies of lipid binding proteins during macrophage differentiation and 40. Kunkel SL (1991) The role of TNF in diverse pathologic processes. Biotherapy methyl-b-cyclodextrin cholesterol depletion. J Clin Lipidol 22: 734–742. 3: 135–141. ........................................................................................................................................................................................................................................ .........................................................................................................................................................................................................................................

Journal

Bioscience Horizons – Oxford University Press

Published: Mar 16, 2010

Keywords: atherosclerosis inflammation macrophage cholesterol Liver X receptors (LXRs) steroidogenic acute regulatory protein (StAR)

There are no references for this article.