The Presence of Marine Filamentous Fungi on a Copper-Based Antifouling Paint
The Presence of Marine Filamentous Fungi on a Copper-Based Antifouling Paint
Dobretsov, Sergey;Al-Shibli, Hanaa;Maharachchikumbura, Sajeewa S. N.;Al-Sadi, Abdullah M.
2021-09-07 00:00:00
applied sciences Brief Report The Presence of Marine Filamentous Fungi on a Copper-Based Antifouling Paint 1 , 2 , 3 4 3 Sergey Dobretsov *, Hanaa Al-Shibli , Sajeewa S. N. Maharachchikumbura and Abdullah M. Al-Sadi Department of Marine Science and Fisheries, College of Agricultural and Marine Sciences, Sultan Qaboos University, P.O. Box 34, Al-Khod 123, Oman Centre of Excellence in Marine Biotechnology, Sultan Qaboos University, P.O. Box 50, Al-Khod 123, Oman Department of Crop Sciences, College of Agricultural and Marine Sciences, Sultan Qaboos University, P.O. Box 34, Al-Khod 123, Oman; Alshiblihana@gmail.com (H.A.-S.); alsadi@squ.edu.om (A.M.A.-S.) School of Life Science and Technology, University of Electronic Science and Technology of China, Chengdu 611731, China; sajeewa83@yahoo.com * Correspondence: segey@squ.edu.om; Tel.: +968-2414-3581 Abstract: Marine biofouling is undesirable growth on submerged substances, which causes a major problem for maritime industries. Antifouling paints containing toxic compounds such as copper are used to prevent marine biofouling. However, bacteria and diatoms are usually found in biofilms developed on such paints. In this study, plastic panels painted with a copper-based self-polishing antifouling paint were exposed to biofouling for 6 months in the Marina Bandar Rowdha, Sea of Oman. Clean panels were used as a control substratum. Marine filamentous fungi from protected and unprotected substrate were isolated on a potato dextrose agar. Pure isolates were identified using sequences of the ITS region of rDNA. Six fungal isolates (Alternaria sp., Aspergillus niger, A. terreus, A. tubingensis, Cladosporium halotolerans, and C. omanense) were obtained from the antifouling paint. Citation: Dobretsov, S.; Al-Shibli, H.; Four isolates (Aspergillus pseudodeflectus, C. omanense, and Parengyodontium album) were isolated from Maharachchikumbura, S.S.N.; clean panels and nylon ropes. This is the first evidence of the presence of marine fungi on antifouling Al-Sadi, A.M. The Presence of Marine paints. In comparison with isolates from the unprotected substrate, fungi from the antifouling Filamentous Fungi on a Copper- paint were highly resistant to copper, which suggests that filamentous fungi can grow on marine Based Antifouling Paint. Appl. Sci. antifouling paints. 2021, 11, 8277. https://doi.org/ 10.3390/app11188277 Keywords: marine fungi; copper; antifouling; coating; biofilm; Indian Ocean; Oman Academic Editors: Anna Poli and Valeria Prigione Received: 24 June 2021 1. Introduction Accepted: 20 August 2021 Marine biofouling is defined as the “undesirable accumulation and growth of organ- Published: 7 September 2021 isms on submerged surfaces” [1]. Usually, biofouling organisms are divided by their size onto microfouling and macrofouling. Microfouling is composed of microscopic (<0.5 mm) Publisher’s Note: MDPI stays neutral organisms, mainly bacteria and diatoms [2,3]. Macrofouling, on the other hand, is com- with regard to jurisdictional claims in posed of macroscopic organisms (>0.5 mm) visible by the naked eye, such as barnacles, published maps and institutional affil- mussels, bryozoans, macroalgae and others [4–6]. Microfouling has a significant impact on iations. the recruitment of spores and larvae of algae and invertebrates (reviewed by [4,7]). Marine biofouling causes significant problems for maritime industries [8,9]. It can increase the fuel consumption of ships, clog membranes and pipes, increase corrosion, decrease buoyancy, and destroy nets and cages [10,11]. Countries worldwide spend Copyright: © 2021 by the authors. more than USD 7 billion per year in order to protect from biofouling and deal with is Licensee MDPI, Basel, Switzerland. consequences [9]. This article is an open access article In order to prevent submerged structures like boats and ships from biofouling com- distributed under the terms and panies are using antifouling coatings [9,12]. These antifouling coatings usually contain conditions of the Creative Commons biocides that kill biofouling organisms. Currently, the most effective biocide is copper or Attribution (CC BY) license (https:// cuprous oxide [12]. creativecommons.org/licenses/by/ 4.0/). Appl. Sci. 2021, 11, 8277. https://doi.org/10.3390/app11188277 https://www.mdpi.com/journal/applsci Appl. Sci. 2021, 11, 8277 2 of 9 While antifouling paints are supposed to prevent biofouling, most of them have biofilms on their surfaces [3,13,14]. There is limited information about the biofilm com- position of antifouling paints (see [15,16]). It has been shown that biofilms on antifouling paints consist of diverse species of bacteria and diatoms [17–19]. Up to now, filamentous fungi on antifouling paints have not been observed. Previous studies showed that biocides of antifouling paints and environmental conditions shaped the structure of the microbial communities [20,21]. Marine fungi are an important component of the marine environment [22,23]. While marine filamentous fungi are not very well studied, they are widely distributed and associated with sediments, sand grains, seaweeds, submerged wood, sea animals and plants [24]. Chytidiomycota and Ascomycota are fungal divisions dominated in samples from six European near-shore sites [22]. Forty-six fungal isolates belonging to the genera Cladosporium, Paraphaeosphaeria, Trichoderma, Alternaria, Phoma, and Arthrinium were isolated from marine biofilms developed on different submerged substrata [25]. Chytidiomycetes fungi dominated in marine biofilms developed on glass and plastic substrates [26]. To our knowledge, marine fungi have never been recorded on antifouling paints, especially copper-based ones. However, it was observed using metabarcoding that most of the fungal species in marine periphyton biofilms were not affected by 10 M of copper [27]. Some species of marine filamentous fungi are highly resistant to high concentrations of copper. For example, Penicillium chrysogenum was able to tolerate concentrations of 500 mg L of copper [28]. The main aim of this study was to identify the fungal isolates from biofilms developed on the surface of a cooper-based antifouling paint and demonstrate their copper resistance. 2. Materials and Methods 2.1. Antifouling Paint and Other Substrata A commercial copper self-polishing paint Interspeed BRA640 (International Paint, Gateshead, UK) was used in this study. The antifouling paint contains about 25–50% of cuprous oxide by weight [29]. An average release rate of copper from the paint was 2 1 3.8 g cm day [30]. The paint was manually applied (thickness 125 m) onto plastic fiberglass panels (15 cm 28 cm) cleaned with ethanol (96%, Sigma, Ronkonkoma, NY, USA) in the laboratory. Fiberglass was obtained from a local Omani manufacturer (Al Kaboura, Muscat, Oman). This material was selected because it is used to make boats and it has a high biofouling potential. All coated panels were air-dried for several days at ambient temperature prior to deployment. All substrates (panels and ropes) were cleaned with 96% ethanol before the experiment to eliminate bacteria and fungi. No fungi were found on these substrates prior to the experiment. 2.2. Experiment and Testing Site Three panels covered with the antifouling paint were exposed vertically to biofouling 0 00 0 00 at the depth of 1 m for 6 months in Marina Bandar Rowdha (23,035 07 N 58,036 48 E), Muscat, Oman. As a control, uncoated fiberglass panels were used. Panels were fixed at the desired depth using a nylon rope (RopeNet, Taishan, China) attached to a pontoon. At the end of the rope, a weight was attached to keep the panels in a vertical position. Marina Bandar Rowdha is a semi-enclosed bay for private recreational boats and yachts. It has a relatively high hydrocarbon and heavy metal pollution with one of the high- est concentrations of TBT in Oman’s waters [31]. This marina was selected due to its (very high) biofouling rates and a history of biofouling and antifouling investigations [21,32]. The experiment in the marina was conducted in 2018 between the months of February and September. During the study the seawater temperature varied from 24 to 30 C, pH was about 8.2 and the salinity varied from 37 to 38 ppt. During the experiment, the seawater turbidity was 2–3 NTU (Nephelometric Turbidity Units). Appl. Sci. 2021, 11, 8277 3 of 9 2.3. Isolation of Fungi Biofouled panels (painted and not) and ropes holding panels were collected from the marina in September 2018. At the marina, the ropes and the panels were individually packed into sterile bags and brought on ice to the laboratory. In the laboratory, the panels and ropes were washed several times with sterile distilled water (SDI). Using sterile scissors, the ropes were cut into 1.0 cm pieces. Surfaces of the panels and the ropes were disinfected using 1% sodium hypochlorite solution to eliminate bacteria (NaClO, Zhengzhou Sino Chemical Ltd., Beijing, China). Then, the panels and the ropes were washed three times with SDI. After that, the biofilms were removed from the panels using sterile cotton swabs. Finally, one piece from each rope or an individual swab was placed into a Petri dish containing a 2.5% potato dextrose agar (PDA, Merck, Kenilworth, NJ, USA) prepared using filtered (0.45 m cellulose nitrate filter, Sartorius, Germany) and autoclaved seawater from the marina. As a control, PDA Petri dishes containing autoclaved seawater were used. Visible growth of fungi was checked after incubation at 25 C for up to three weeks. Each individual fungal colony was transferred into a new fresh PDA plate. Pure fungal colonies were stored on PDA slants with 10% glycerol for further genetic identification (see below). 2.4. Identification of Fungi Before the identification, the isolate was grown on PDA. The identification of fila- mentous fungal isolates was done based on sequences of the internal transcribed spacer region (ITS) of the ribosomal DNA [33]. Firstly, 80 g of fungal mycelia were harvested and freeze-dried. Then, its DNA was further extracted [34]. Secondly, the ITS rDNA region was amplified using the primer pairs of ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGT CGTAACAAGG). The PCR program followed the conditions of [35]. MACROGEN, Korea sequenced the PCR products. In order to obtain the ITS rRNA sequence, two complementary sequences for each fungal isolate were aligned using MEGA v.6 [36]. Fungal isolates were identified based on a comparison of the ITS rRNA sequences against the National Center for Biotechnology Information (NCBI) database. Sequences of fungal isolates were deposited in the NCBI GenBank database with accession num- bers MN947598–MN947607. For phylogenetic trees, maximum likelihood analysis with 1000 bootstrap replicates based on ITS sequence data was done using RaxmlGUI v. 1.3 [37]. The final phylogenetic tree was selected by comparing the likelihood scores using the GTR+GAMMA substitution model. 2.5. Copper Resistance of Fungal Isolates In order to prove that fungal isolates are able to grow on antifouling paints, we tested their sensitivity to copper by an agar diffusion technique. Because copper oxide is not soluble in water, copper sulfate (CuSO4, Sigma Aldrich, Ronkonkoma, NY, USA) was used. Firstly, different concentrations (500–0.01 g L ) of copper sulfate in autoclaved seawater were prepared. Secondly, fungal isolates were grown onto 2.5% potato dextrose agar (PDA, Merck, Kenilworth, NJ, USA) for 3 days. PDA was made using autoclaved seawater from the marina. A four mm disc of each fungal isolate was cut and individually placed onto the PDA Petri dish. Thirdly, 10 L of copper sulfate solution was added to a sterile paper disk (diameter 6 mm). As a control, disks with 10 L of seawater were used. The disks were air-dried at room temperature and placed in the middle of a PDA Petri dish two cm away from the isolate. The dishes were incubated at 25 C for 5 days. The experiment was made in triplicate. The presence or absence of an inhibition zone was detected. Finally, the minimal inhibitory concentration of copper (II) sulfate (g cm ) for each fungal isolate was calculated. Appl. Sci. 2021, 11, 8277 4 of 9 3. Results and Discussion 3.1. Biofouling on Different Substrata Biofouling on the antifouling paint was minimal and only biofilms were observed. In opposite, the ropes and unprotected panels were completely covered with macrofouling organisms, dominated by Tunicata and Bryozoa. This supports our previous data about performance of different antifouling paints in Oman waters [21,32]. The 1-year field experiment showed that copper-based antifouling paints have only diatom and bacterial biofouling [21]. A previous experiment with unprotected fiberglass and acrylic panels demonstrated dominance of Bryozoa, barnacles and sponges [38]. The absence of sponges and barnacles in the current study could be due to differences in the substratum chemistry (nylon versus acrylic) and shape (flat plates versus cylindrical ropes). 3.2. Species of Fungi Isolated from Different Substrata In total, six fungal isolates were obtained from the antifouling paint and four were iso- lated from unprotected substrata (Table 1). Based on the phylogenetic analysis, the majority of isolates belonged to Aspergillus and Cladosporium genera (Supplement Figures S1–S4). The genera Aspergillus and Cladosporium are commonly found in the marine environ- ment [39–41]. Additionally, Aspergillus and Cladosporium are associated with marine sponges [42,43]. There is limited information about marine derived filamentous fungi in Oman, but we have been able to isolate Aspergillus terreus from mangrove areas [44]. Cladosporium omanense found in this study (Table 1) was previously isolated from living leaves of Zygophyllum coccineum in Oman [45]. The presence of C. omanense on all inves- tigated substrates could be due to several reasons. It could suggest that this species is very common in Omani waters and can colonize protected and unprotected substrata. Alternatively, it could be due to contamination of our culture by spores of this fungus. This is highly unlikely, as there were no fungi recovered from the control plates with autoclaved seawater. Filamentous fungi belonging to the genera Parengyodontium were isolated from bio- fouled ropes only (Table 1). Parengyodontium album is an environmental saprobic mold and an opportunistic pathogen [46]. This species has been observed on buildings composed of limestone and plaster [47]. Additionally, P. album was found in sediments of polar-boreal White Sea [48]. The presence of this fungus in Oman waters suggests that this species can be found in tropical waters as well. The genera Aspergillus, Cladosporium and Alternaria were found on the copper-based antifouling paint (Table 1). Moreover, A. tubingensis, A. terreus, A. niger and C. halotolerans were found only on the antifouling paint. Alternaria isolates were obtained exclusively from the paint. Previously, the fungi Alternaria were isolated from soft corals [49], sponges [50] and algae [51]. While 18S RNA of fungi belonging to the class Agaricomycetes was detected on an antifouling paint using Illumina amplicon sequencing [52], fungal isolates were obtained from antifouling paints for the first time in this study. Previously, only bacteria and diatoms were detected in biofilms on antifouling paints [3,21]. 3.3. Copper Resistance of Fungal Isolates In order to prove that fungal isolates are able to grow on antifouling paints, their sensitivity to different copper concentrations is tested in laboratory experiments (Table 2). Due to low solubility of CuO, CuSO was used in this experiment. Previous studies suggest that CuSO is more toxic compare to CuO [53]. Thus, the isolates are more resistant to CuO than is reported in Table 2. Generally, isolates from antifouling paint can tolerate higher concentrations of copper. Five out of six isolates from the antifouling paint can 2 1 tolerate an average daily release rate of copper 3.8 g cm day [30] from the tested paint (Table 2). The highest copper resistance was observed for Aspergillus terreus. This fungus can tolerate 2% of CuCl in a polyvinyl chloride coating in a laboratory experiment [54] and can be used to remove heavy metals from water [54]. In opposite, fungal isolates from unprotected substrata had low tolerance to copper (Table 2). This suggests that isolates Appl. Sci. 2021, 11, x FOR PEER REVIEW 4 of 9 Appl. Sci. 2021, 11, x FOR PEER REVIEW 4 of 9 Appl. Sci. 2021, 11, x FOR PEER REVIEW 4 of 9 Appl. Sci. 2021, 11, x FOR PEER REVIEW 4 of 9 Appl. Sci. 2021, 11, x FOR PEER REVIEW 4 of 9 Biofouling on the antifouling paint was minimal and only biofilms were observed. In Biofouling on the antifouling paint was minimal and only biofilms were observed. In opposite, the ropes and unprotected panels were completely covered with macrofouling Biofouling on the antifouling paint was minimal and only biofilms were observed. In opposite, the ropes and unprotected panels were completely covered with macrofouling Biofouling on the antifouling paint was minimal and only biofilms were observed. In organ Bi ism ofouli s, dng omon the a inated b ny tif Tunic ouling pai ata and nt wa Bryozo s minima a. Th l and is sup only portb s ou iofilms r pr were evious observe data ab dout . In opposite, the ropes and unprotected panels were completely covered with macrofouling organisms, dominated by Tunicata and Bryozoa. This supports our previous data about opposite, the ropes and unprotected panels were completely covered with macrofouling opposite, the ropes a performance of different antifouling nd unprotected pa paints in nels were co Oman mplet wate ers [2 ly cov 1,3 e2 red wit ]. The 1- h ma year fie crofou ld lin ex- g organisms, dominated by Tunicata and Bryozoa. This supports our previous data about organ performanc isms, d e o of different antifouling minated by Tunicata and paints in Bryozo Om a. Th ani wat s sup ep rs [2 orts ou 1,32r p ]. The 1- reviou ye s da ar fie ta ab ld out ex- organ periment showed tha isms, dominated b t copper-ba y Tunicatsed a a andn Bryozo tifoulina. Th g paints ha is suppve only dia orts our prev tom a iousn da d ba ta ab cteria outl performance of different antifouling paints in Oman waters [21,32]. The 1-year field ex- performanc periment showed tha e of different antifouling t copper-based a paints in ntifoulin Om g pa an ints ha waters [2 ve only dia 1,32]. The 1- tom a ye nar fie d bacteria ld ex-l performanc biofouling [21 e of different antifouling ]. A previous experiment paints in with unprotected fiberglass a Oman waters [21,32]. The 1- nd aye crylic pa ar field nel ex- s periment showed that copper-based antifouling paints have only diatom and bacterial biofouling [21]. A previous experiment with unprotected fiberglass and acrylic panels periment showed that copper-based antifouling paints have only diatom and bacterial periment showed tha demonstrated dominatnce copper-ba of Bryozo sed a a, bn atifoulin rnacles g pa and sp ints ha onges ve only dia [38]. The ab tom a sence o nd ba f spcteria onges l biofouling [21]. A previous experiment with unprotected fiberglass and acrylic panels demonstrated dominance of Bryozoa, barnacles and sponges [38]. The absence of sponges biofouling [21]. A previous experiment with unprotected fiberglass and acrylic panels biofouling [21]. A previous experiment with unprotected fiberglass and acrylic panels dem and b oa nst rnr acle ated s in dom the c ina unce rrent of Br stud yozo y co a, uld ba be du rnacle e to di s and fferences i sponges [3 n8 the sub ]. The ab stra senc tum e o chemi f spong stry es and barnacles in the current study could be due to differences in the substratum chemistry demonstrated dominance of Bryozoa, barnacles and sponges [38]. The absence of sponges dem (nylon onst ve rrs atus ed acr dom yliin c) aand nce s of Br hapyozo e (fla a, t plates versus c barnacles and sp ylindric onges a[l ropes). 38]. The absence of sponges and barnacles in the current study could be due to differences in the substratum chemistry (nylon versus acrylic) and shape (flat plates versus cylindrical ropes). and barnacles in the current study could be due to differences in the substratum chemistry and barnacles in the current study could be due to differences in the substratum chemistry (nylon versus acrylic) and shape (flat plates versus cylindrical ropes). (nylon versus acrylic) and shape (flat plates versus cylindrical ropes). 3.2. Species of Fungi Isolated from Different Substrata (nylon versus acrylic) and shape (flat plates versus cylindrical ropes). 3.2. Species of Fungi Isolated from Different Substrata 3.2. Species of Fungi Isolated from Different Substrata In total, six fungal isolates were obtained from the antifouling paint and four were 3.2. Species of Fungi Isolated from Different Substrata In total, six fungal isolates were obtained from the antifouling paint and four were 3.2. Species of Fungi Isolated from Different Substrata isolated from unprotected substrata (Table 1). Based on the phylogenetic analysis, the ma- In total, six fungal isolates were obtained from the antifouling paint and four were isolated from unprotected substrata (Table 1). Based on the phylogenetic analysis, the ma- In total, six fungal isolates were obtained from the antifouling paint and four were In total, six fungal isolates were obtained from the antifouling paint and four were jority of isolates belonged to Aspergillus and Cladosporium genera (Supplement Figures S1– isolated from unprotected substrata (Table 1). Based on the phylogenetic analysis, the ma- jority of isolates belonged to Aspergillus and Cladosporium genera (Supplement Figures S1– isolated from unprotected substrata (Table 1). Based on the phylogenetic analysis, the ma- isolated S4). The from genera unprotected substrata (T Aspergillus and Cladospor able 1) ium . B are a com sed on m the phylogen only found in t etic an he mar alysis, t ine environ he ma- - jority of isolates belonged to Aspergillus and Cladosporium genera (Supplement Figures S1– S4). The genera Aspergillus and Cladosporium are commonly found in the marine environ- jority of isolates belonged to Aspergillus and Cladosporium genera (Supplement Figures S1– jority o ment [f39– isolates be 41]. Addi longed tiona tlly, o Asp Asperg ergillus illus and and Clados Clados pori porium um gener are as a (Supplement Figure sociated with ma s S1– rine S4). The genera Aspergillus and Cladosporium are commonly found in the marine environ- S4). The ment [39– gene 41]. Addi ra Aspeti rgona illuslly, and Asperg Clados illus por and ium are Clados comporium monly are as found in t soci hat e mar ed wit ineh environ marine - S4). The sponges [4 gene 2,4ra 3].Asp There is li ergillus and mite d Clados inform porat ium ion about are com marine monly foun deriv d ed in t fih laement marious fung ne environ i in - ment [39–41]. Additionally, Aspergillus and Cladosporium are associated with marine sponges [42,43]. There is limited information about marine derived filamentous fungi in ment [39–41]. Additionally, Aspergillus and Cladosporium are associated with marine ment [ Oman, b 39– ut41 w ]. Addi e haveti b ona eenlly, abAsperg le to is illus olat and e Aspergillus terreus Cladosporium are as from m soci angrov ated wit e ar heas m a[r4i4]. ne sponges [42,43]. There is limited information about marine derived filamentous fungi in Oman, but we have been able to isolate Aspergillus terreus from mangrove areas [44]. sponges [42,43]. There is limited information about marine derived filamentous fungi in sponges [42,43]. There is limited information about marine derived filamentous fungi in Cladosporium omanense found in this study (Table 1) was previously isolated from living Oman, but we have been able to isolate Aspergillus terreus from mangrove areas [44]. Cladosporium omanense found in this study (Table 1) was previously isolated from living Oman, but we have been able to isolate Aspergillus terreus from mangrove areas [44]. Oman, but we have been able to isolate Aspergillus terreus from mangrove areas [44]. Cladosporium omanense leaves of Zygophyllum co fou ccineum nd in t in Oman [45]. The pr his study (Table 1) wa esence of s previo Cus . oly i manense solated fr on aom living ll investi- leaves of Zygophyllum coccineum in Oman [45]. The presence of C. omanense on all investi- Cladosporium omanense found in this study (Table 1) was previously isolated from living Cladosporium omanense gated substrates could be fou d nu d in t e to seve his st ral ud reason y (Tab s. le It co 1) wa uld s previ suggest t ously i hat this solated fr species om living is very leaves of Zygophyllum coccineum in Oman [45]. The presence of C. omanense on all investi- gated substrates could be due to several reasons. It could suggest that this species is very leaves of Zygophyllum coccineum in Oman [45]. The presence of C. omanense on all investi- leave comm s of on in Om Zygophyllum co ani wateccineum rs and c in Oman [45]. The pr an colonize protected and unp esence of C r.o o tect manense ed sub on stra at ll invest a. Alter- i- gated substrates could be due to several reasons. It could suggest that this species is very ga com ted substrates coul mon in Omani w d be ater d s and c ue to seve an col ral onize p reason rs. ot It co ected and unp uld suggest t roth ect at this ed sub species strata. is Alt very er- ga nat ted substrates coul ively, it could be d d be ue t d o cont ue toaminat several ioreason n of our c s. It co ultu uld re by spores suggest thof t at this his fspecies ungus. This is very is common in Omani waters and can colonize protected and unprotected substrata. Alter- Appl. Sci. 2021, 11, 8277 5 of 9 natively, it could be due to contamination of our culture by spores of this fungus. This is common in Omani waters and can colonize protected and unprotected substrata. Alter- com highly mou n in Om nlikely, as there were ani waters and c no fungi recovered an colonize protect froe m d and unp the control pl rotect ae tes d sub with autocl strata. Alt ave ed r- natively, it could be due to contamination of our culture by spores of this fungus. This is highly unlikely, as there were no fungi recovered from the control plates with autoclaved natively, it could be due to contamination of our culture by spores of this fungus. This is natively, it could be due to contamination of our culture by spores of this fungus. This is seawater. highly unlikely, as there were no fungi recovered from the control plates with autoclaved seawater. highly unlikely, as there were no fungi recovered from the control plates with autoclaved highly unlikely, as there were no fungi recovered from the control plates with autoclaved seawater. seawater. Table 1. The list of fungal isolates from panels painted with the antifouling paint and not painted (control) panels and from the copper-based antifouling paint are adapted to high copper concentrations and seawater. Table 1. The list of fungal isolates from panels painted with the antifouling paint and not painted (control) panels and ropes. Table 1. The list of fungal i could solates gr from ow and pan play els painted an important with ther antifouling paint and n ole in biofilms. ot painted (control) panels and ropes. Table 1. The list of fungal isolates from panels painted with the antifouling paint and not painted (control) panels and Table 1 ropes. . The list of fungal isolates from panels painted with the antifouling paint and not painted (control) panels and ropes. Species Substrate No GenBank Accession Number Picture Table 1. The list of fungal isolates from panels painted with the antifouling paint and not painted (control) panels and ropes. ropes. Species Substrate No GenBank Accession Number Picture Species Substrate No GenBank Accession Number Picture Species Substrate No GenBank Accession Number Picture Spec Speciesies Substr Substrateate No No GenB GenBankank AcAccessioncession Num Numberber Picture Picture Aspergillus tubingensis Antifouling paint H1 MN947598 Aspergillus tubingensis Antifouling paint H1 MN947598 Aspergillus tubingensis Antifouling paint H1 MN947598 Aspergillus tubingensis Antifouling paint H1 MN947598 Asperg Asperillus tubing gillus tubingensis ensis AntiAntifouling fouling paipaint nt H1 H1 MN9 MN947598 47598 Aspergillus terreus Antifouling paint H2 MN947599 Aspergillus terreus Antifouling paint H2 MN947599 Aspergillus terreus Antifouling paint H2 MN947599 Asperg Asperillus terreus gillus terreus AntiAntifouling fouling paipaint nt H2 H2 MN9 MN947599 47599 Aspergillus terreus Antifouling paint H2 MN947599 Alternaria sp. Antifouling paint H3 MN947600 Alternaria sp. Antifouling paint H3 MN947600 Alterna Alternaria ria sp. sp. AntiAntifouling fouling paipaint nt H3 H3 MN9 MN947600 47600 Alternaria sp. Antifouling paint H3 MN947600 Alternaria sp. Antifouling paint H3 MN947600 Aspergillus niger Antifouling paint H4 MN947601 Aspergillus niger Antifouling paint H4 MN947601 Aspergillus niger Antifouling paint H4 MN947601 Aspergillus niger Antifouling paint H4 MN947601 Appl.Asperg Sci. 2021 illus nig , 11, x FO eR P r EER RE Anti VIEW fo uling paint H4 MN947601 5 of 9 Aspergillus niger Antifouling paint H4 MN947601 Appl. Sci. 2021, 11, x FOR PEER REVIEW 5 of 9 Appl. Sci. 2021, 11, x FOR PEER REVIEW 5 of 9 Appl. Sci. 2021, 11, x FOR PEER REVIEW 5 of 9 Appl. Sci. 2021, 11, x FOR PEER REVIEW 5 of 9 Cladosporium halotoler- Cladosporiu Cladosporium m halotoler- halotolerans AntiAntifouling fouling paipaint nt H6 H6 MN9 MN947602 47602 Antifouling paint H6 MN947602 Cladosporiu ans m halotoler- Cladosporiu ans m halotoler- Antifouling paint H6 MN947602 Cladosporium halotoler- ans Antifouling paint H6 MN947602 Antifouling paint H6 MN947602 Cladosporium omanense Antifouling paint H7 MN947603 ans ans Cladosporium omanense Antifouling paint H7 MN947603 Cladosporium omanense Antifouling paint H7 MN947603 Cladosporium omanense Antifouling paint H7 MN947603 Cladosporium omanense Cladosporium omanense AntiAntifouling fouling paipaint nt H7 H7 MN9 MN947603 47603 Aspergillus pseudodeflec- Not painted panel H90 MN947605 Aspergillus pseudodeflec- Not painted panel tus (control) Aspergillus pseudodeflec- Not painted panel H90 MN947605 tus (control) Aspergillus pseudodeflec- Not painted panel H90 MN947605 Not painted panel Asperg Aspergillus illus p tus pseudodeflectus s eudodeflec- Not pa (control) inted panel H90 MN9 H90 MN94760547605 tus (control) (control) H90 MN947605 tus (control) Not painted panel Cladosporium omanense H89 MN947604 Not painted panel (control) Cladosporium omanense Not painted panel H89 MN947604 Not painted panel (control) Cladosporium omanense Cladosporium omanense Not painted panel H89 MN9 H89 MN94760447604 (control) Cladosporium omanense Not pa (control) inted panel H89 MN947604 (control) Cladosporium omanense H89 MN947604 (control) Cladosporium omanense Ropes H91 MN947606 Cladosporium omanense Ropes H91 MN947606 Cladosporium omanense Ropes H91 MN947606 Cladosporium omanense Ropes H91 MN947606 Cladosporium omanense Ropes H91 MN947606 Cladosporium omanense Ropes H91 MN947606 Parengyo Parengyodontium dontium album album Ropes H92 Ropes H92 MN9 MN94760747607 Parengyodontium album Ropes H92 MN947607 Parengyodontium album Ropes H92 MN947607 Parengyodontium album Ropes H92 MN947607 Parengyodontium album Ropes H92 MN947607 Filamentous fungi belonging to the genera Parengyodontium were isolated from bio- Filamentous fungi belonging to the genera Parengyodontium were isolated from bio- fouled ropes only (Table 1). Parengyodontium album is an environmental saprobic mold Filamentous fungi belonging to the genera Parengyodontium were isolated from bio- fouled ropes only (Table 1). Parengyodontium album is an environmental saprobic mold Filamentous fungi belonging to the genera Parengyodontium were isolated from bio- and an opportunistic pathogen [46]. This species has been observed on buildings com- fouled ropes only (Table 1). Parengyodontium album is an environmental saprobic mold Filamentous fungi belonging to the genera Parengyodontium were isolated from bio- and an opportunistic pathogen [46]. This species has been observed on buildings com- fouled ropes only (Table 1). Parengyodontium album is an environmental saprobic mold posed of limestone and plaster [47]. Additionally, P. album was found in sediments of po- and an opportunistic pathogen [46]. This species has been observed on buildings com- fouled ropes only (Table 1). Parengyodontium album is an environmental saprobic mold posed of limestone and plaster [47]. Additionally, P. album was found in sediments of po- and an opportunistic pathogen [46]. This species has been observed on buildings com- lar-boreal White Sea [48]. The presence of this fungus in Oman waters suggests that this posed of limestone and plaster [47]. Additionally, P. album was found in sediments of po- and an opportunistic pathogen [46]. This species has been observed on buildings com- lar-boreal White Sea [48]. The presence of this fungus in Oman waters suggests that this posed of limestone and plaster [47]. Additionally, P. album was found in sediments of po- species can be found in tropical waters as well. lar-boreal White Sea [48]. The presence of this fungus in Oman waters suggests that this posed of limestone and plaster [47]. Additionally, P. album was found in sediments of po- species can be found in tropical waters as well. lar-boreal White Sea [48]. The presence of this fungus in Oman waters suggests that this The genera Aspergillus, Cladosporium and Alternaria were found on the copper-based species can be found in tropical waters as well. lar-boreal White Sea [48]. The presence of this fungus in Oman waters suggests that this The genera Aspergillus, Cladosporium and Alternaria were found on the copper-based species can be found in tropical waters as well. antifouling paint (Table 1). Moreover, A. tubingensis, A. terreus, A. niger and C. halotolerans The genera Aspergillus, Cladosporium and Alternaria were found on the copper-based species can be found in tropical waters as well. antifouling paint (Table 1). Moreover, A. tubingensis, A. terreus, A. niger and C. halotolerans The genera Aspergillus, Cladosporium and Alternaria were found on the copper-based were found only on the antifouling paint. Alternaria isolates were obtained exclusively antifouling paint (Table 1). Moreover, A. tubingensis, A. terreus, A. niger and C. halotolerans The genera Aspergillus, Cladosporium and Alternaria were found on the copper-based were found only on the antifouling paint. Alternaria isolates were obtained exclusively antifouling paint (Table 1). Moreover, A. tubingensis, A. terreus, A. niger and C. halotolerans from the paint. Previously, the fungi Alternaria were isolated from soft corals [49], sponges were found only on the antifouling paint. Alternaria isolates were obtained exclusively antifouling paint (Table 1). Moreover, A. tubingensis, A. terreus, A. niger and C. halotolerans from the paint. Previously, the fungi Alternaria were isolated from soft corals [49], sponges were found only on the antifouling paint. Alternaria isolates were obtained exclusively [50] and algae [51]. While 18S RNA of fungi belonging to the class Agaricomycetes was from the paint. Previously, the fungi Alternaria were isolated from soft corals [49], sponges were found only on the antifouling paint. Alternaria isolates were obtained exclusively [50] and algae [51]. While 18S RNA of fungi belonging to the class Agaricomycetes was from the paint. Previously, the fungi Alternaria were isolated from soft corals [49], sponges detected on an antifouling paint using Illumina amplicon sequencing [52], fungal isolates [50] and algae [51]. While 18S RNA of fungi belonging to the class Agaricomycetes was from the paint. Previously, the fungi Alternaria were isolated from soft corals [49], sponges detected on an antifouling paint using Illumina amplicon sequencing [52], fungal isolates [50] and algae [51]. While 18S RNA of fungi belonging to the class Agaricomycetes was were obtained from antifouling paints for the first time in this study. Previously, only detected on an antifouling paint using Illumina amplicon sequencing [52], fungal isolates [50] and algae [51]. While 18S RNA of fungi belonging to the class Agaricomycetes was were obtained from antifouling paints for the first time in this study. Previously, only detected on an antifouling paint using Illumina amplicon sequencing [52], fungal isolates bacteria and diatoms were detected in biofilms on antifouling paints [3,21]. were obtained from antifouling paints for the first time in this study. Previously, only detected on an antifouling paint using Illumina amplicon sequencing [52], fungal isolates bacteria and diatoms were detected in biofilms on antifouling paints [3,21]. were obtained from antifouling paints for the first time in this study. Previously, only bacteria and diatoms were detected in biofilms on antifouling paints [3,21]. were obtained from antifouling paints for the first time in this study. Previously, only bacteria and diatoms were detected in biofilms on antifouling paints [3,21]. 3.3. Copper Resistance of Fungal Isolates bacteria and diatoms were detected in biofilms on antifouling paints [3,21]. 3.3. Copper Resistance of Fungal Isolates 3.3. Copper Resistance of Fungal Isolates In order to prove that fungal isolates are able to grow on antifouling paints, their 3.3. Copper Resistance of Fungal Isolates In order to prove that fungal isolates are able to grow on antifouling paints, their sensit 3.3. Co ivit pper Re y to dif sistance ferent of Fu copn pg er concent al Isolates rations is tested in laboratory experiments (Table 2). In order to prove that fungal isolates are able to grow on antifouling paints, their sensitivity to different copper concentrations is tested in laboratory experiments (Table 2). In order to prove that fungal isolates are able to grow on antifouling paints, their Due to low solubility of CuO, CuSO4 was used in this experiment. Previous studies sug- sensitivity to different copper concentrations is tested in laboratory experiments (Table 2). In order to prove that fungal isolates are able to grow on antifouling paints, their Due to low solubility of CuO, CuSO4 was used in this experiment. Previous studies sug- sensitivity to different copper concentrations is tested in laboratory experiments (Table 2). gest that CuSO4 is more toxic compare to CuO [53]. Thus, the isolates are more resistant Due to low solubility of CuO, CuSO4 was used in this experiment. Previous studies sug- sensitivity to different copper concentrations is tested in laboratory experiments (Table 2). gest that CuSO4 is more toxic compare to CuO [53]. Thus, the isolates are more resistant Due to low solubility of CuO, CuSO4 was used in this experiment. Previous studies sug- to CuO than is reported in Table 2. Generally, isolates from antifouling paint can tolerate gest that CuSO4 is more toxic compare to CuO [53]. Thus, the isolates are more resistant Due to low solubility of CuO, CuSO4 was used in this experiment. Previous studies sug- to CuO than is reported in Table 2. Generally, isolates from antifouling paint can tolerate gest that CuSO4 is more toxic compare to CuO [53]. Thus, the isolates are more resistant higher concentrations of copper. Five out of six isolates from the antifouling paint can to CuO than is reported in Table 2. Generally, isolates from antifouling paint can tolerate gest that CuSO4 is more toxic compare to CuO [53]. Thus, the isolates are more resistant higher concentrations of copper. Five out of six isolates from the antifouling paint can to CuO than is reported in Table 2. Generally, isolates from antifouling paint can tolerate −2 −1 tolerate an average daily release rate of copper 3.8 μg cm day [30] from the tested paint higher concentrations of copper. Five out of six isolates from the antifouling paint can to CuO than is reported in Table 2. Generally, isolates from antifouling paint can tolerate −2 −1 tolerate an average daily release rate of copper 3.8 μg cm day [30] from the tested paint higher concentrations of copper. Five out of six isolates from the antifouling paint can −2 −1 (Table 2). The highest copper resistance was observed for Aspergillus terreus. This fungus tolerate an average daily release rate of copper 3.8 μg cm day [30] from the tested paint higher concentrations of copper. Five out of six isolates from the antifouling paint can −2 −1 (Table 2). The highest copper resistance was observed for Aspergillus terreus. This fungus tolerate an average daily release rate of copper 3.8 μg cm day [30] from the tested paint can tolerate 2% of CuCl2 in a polyvinyl chloride coating in −2 a l−a 1 boratory experiment [54] (Table 2). The highest copper resistance was observed for Aspergillus terreus. This fungus tolerate an average daily release rate of copper 3.8 μg cm day [30] from the tested paint can tolerate 2% of CuCl2 in a polyvinyl chloride coating in a laboratory experiment [54] (Table 2). The highest copper resistance was observed for Aspergillus terreus. This fungus and can be used to remove heavy metals from water [54]. In opposite, fungal isolates from can tolerate 2% of CuCl2 in a polyvinyl chloride coating in a laboratory experiment [54] (Table 2). The highest copper resistance was observed for Aspergillus terreus. This fungus and can be used to remove heavy metals from water [54]. In opposite, fungal isolates from can tolerate 2% of CuCl2 in a polyvinyl chloride coating in a laboratory experiment [54] unprotected substrata had low tolerance to copper (Table 2). This suggests that isolates and can be used to remove heavy metals from water [54]. In opposite, fungal isolates from can tolerate 2% of CuCl2 in a polyvinyl chloride coating in a laboratory experiment [54] unprotected substrata had low tolerance to copper (Table 2). This suggests that isolates and can be used to remove heavy metals from water [54]. In opposite, fungal isolates from unprotected substrata had low tolerance to copper (Table 2). This suggests that isolates and can be used to remove heavy metals from water [54]. In opposite, fungal isolates from unprotected substrata had low tolerance to copper (Table 2). This suggests that isolates unprotected substrata had low tolerance to copper (Table 2). This suggests that isolates Appl. Sci. 2021, 11, 8277 6 of 9 Table 2. The minimal inhibitory concentration of copper (II) sulfate (g cm ) for fungal isolates from panels painted with the antifouling paint, not painted (control), and ropes. Highlighted values 2 1 exceed an average release rate of copper from the paint (3.8 g cm day [30]). Minimal Inhibitory Species Substrate Concentration Aspergillus tubingensis Antifouling paint 4.3 Aspergillus terreus Antifouling paint 5.2 Alternaria sp. Antifouling paint 3.9 Aspergillus niger Antifouling paint 4.3 Cladosporium halotolerans Antifouling paint 3.9 Cladosporium omanense Antifouling paint 1.3 Aspergillus pseudodeflectus Control 0.17 Cladosporium omanense Control 0.87 Cladosporium omanense Ropes 1.3 Parengyodontium album Ropes 1.3 3.4. Importance of This Study Our finding has very important implications for antifouling industries. Firstly, it demonstrates that some fungal species can live on antifouling paints and tolerate relatively high copper concentrations. Compared to the isolates from unprotected substrata (ropes and panels), fungi from the antifouling paint were highly resistant to copper. Previous stud- ies suggested copper resistance of some fungal species that bind copper to cell walls [55,56]. Additionally, fungi can produce copper-binding proteins and chelating compounds in response to elevated concentrations of copper [55]. Secondly, the role of fungal species on antifouling paints requires further investigations. It is possible to propose that filamentous fungi can degrade organic matrix of the paint, composed of vinyl or acrylic resin or silicone polymers, which in turn can affect release of the biocide and the life span of the antifouling paint. It has been shown that filamentous fungi can deteriorate synthetic paints [57,58]. Additionally, filamentous fungi can degrade biocides of antifouling paints, such as Irgarol 1051 [59] and TBT [60]. In opposite, some marine fungal species produce antimicrobial and antifouling compounds (see review [61]). Presence of these strains on paints could be beneficial and enhance their antifouling properties. Finally, more research is needed to understand if marine fungi can be found on other antifouling paints exposed to biofouling in different seas and investigate possible mechanisms whereby fungi transform these paints. Additionally, it is important to investigate the role of marine fungi on antifouling paints and possible mechanisms of their resistance. Supplementary Materials: The following are available online at https://www.mdpi.com/article/10 .3390/app11188277/s1, Figure S1: Phylogram generated from maximum likelihood analysis based on ITS sequence data of analyzed Alternaria species. Isolates derived from this study are in red. The tree is rooted to A. alternantherae (CBS124392), Figure S2: Phylogram generated from maximum likelihood analysis based on ITS sequence data of analyzed Aspergillus species. Isolates derived from this study are in red. The tree is rooted to Penicillium herquei (CBS 336.48), Figure S3: Phylogram generated from maximum likelihood analysis based on ITS sequence data of analyzed Cladosporium species. Isolates derived from this study are in red, Figure S4: The tree is rooted to Cercospora beticola (CBS 116456), Phylogram generated from maximum likelihood analysis based on ITS sequence data of analyzed Parengyodontium species. Isolates derived from this study are in red. The tree is rooted to Purpureocillium lilacinum (CBS 284.36). Author Contributions: Conceptualization, S.D. and A.M.A.-S.; methodology, S.D. and A.M.A.-S.; formal analysis, H.A.-S., S.D. and S.S.N.M.; investigation, H.A.-S. and S.S.N.M.; writing—original draft preparation, S.D. and A.M.A.-S.; writing—review and editing, S.D., A.M.A.-S., H.A.-S. and S.S.N.M.; supervision, S.D. and A.M.A.-S.; project administration, S.D. and A.M.A.-S.; funding acquisition, S.D. and A.M.A.-S. All authors have read and agreed to the published version of the manuscript. Appl. Sci. 2021, 11, 8277 7 of 9 Funding: This research was funded by the TRC grant RC/AGR/FISH/16/01, Omantel grant EG/SQU- OT/20/01, SQU internal grant IG/AGR/FISH/18/01 and the grant EG/AGR/CROP/16/01. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: Sequences of fungal isolates can be found in the NCBI GenBank database with accession numbers MN947598–MN947607. Acknowledgments: S.D. acknowledged financial support by the TRC grant RC/AGR/FISH/16/01 and SQU internal grant IG/AGR/FISH/18/01. A.M.A. research was supported by the grant EG/AGR/CROP/16/01 and RC/AGR/FISH/16/01. Conflicts of Interest: The authors declare no conflict of interest. References 1. Wahl, M. Marine epibiosis. I. Fouling and antifouling: Some basic aspects. Mar. Ecol. Prog. Ser. 1989, 58, 175–189. [CrossRef] 2. Dobretsov, S.; Dahms, H.-U.; Qian, P.-Y. Inhibition of biofouling by marine microorganisms and their metabolites. Biofouling 2006, 22, 43–54. [CrossRef] [PubMed] 3. Salta, M.; Wharton, J.A.; Blache, Y.; Stokes, K.R.; Briand, J.-F. Marine biofilms on artificial surfaces: Structure and dynamics. Environ. Microbiol. 2013, 15, 2879–2893. [CrossRef] [PubMed] 4. Hadfield, M.G. Biofilms and marine invertebrate larvae: What bacteria produce that larvae use to choose settlement sites. Annu. Rev. Mar. Sci. 2011, 3, 453–470. [CrossRef] 5. Venkatesan, R.; Murthy, P.S. Macrofouling control in power plants. In Marine and Industrial Biofouling; Flemming, H.C., Murthy, P.S., Venkatesan, R., Cooksey, K., Eds.; Springer Series on Biofilms; Springer: Berlin/Heidelberg, Germany, 2009; Volume 4, pp. 1–27. 6. Wieczorek, S.K.; Todd, C.D. Inhibition and facilitation of settlement of epifaunal marine invertebrate larvae by microbial biofilm cues. Biofouling 1998, 12, 81–118. [CrossRef] 7. Dobretsov, S.; Rittschof, D. Love at first taste: Induction of larval settlement by marine microbes. Int. J. Mol. Sci. 2020, 21, 731. [CrossRef] 8. Schultz, M.P.; Bendick, J.A.; Holm, E.R.; Hertel, W.M. Economic impact of biofouling on a naval surface ship. Biofouling 2011, 27, 87–98. [CrossRef] 9. Yebra, D.M.; Kiil, S.; Dam-Johansen, K. Antifouling technology—Past, present and future steps towards efficient and environmen- tally friendly antifouling coatings. Prog. Org. Coat. 2004, 50, 75–104. [CrossRef] 10. Bott, T.R. Biofouling control in cooling water. Int. J. Chem. Eng. 2009, 2009. [CrossRef] 11. Jones, G. The battle against marine biofouling: A historical review. In Advances in Marine Antifouling Coatings and Technologies; Hellio, C., Yebra, D., Eds.; Woodhead publishing series in metals and surface engineering; CRC Press: Boca Ration, FL, USA, 2009; pp. 19–45. 12. Maréchal, J.-P.; Hellio, C. Challenges for the development of new non-toxic antifouling solutions. Int. J. Mol. Sci. 2009, 10, 4623–4637. [CrossRef] 13. Dempsey, M.J. Colonisation of antifouling paints by marine bacteria. Bot. Mar. 2009, 24, 185–192. [CrossRef] 14. Thomas, T.E.; Robinson, M.G. The role of bacteria in the metal tolerance of the fouling diatom Amphora coffeaeformis Ag. J. Exp. Mar. Biol. Ecol. 1987, 107, 291–297. [CrossRef] 15. Yang, J.-L.; Li, Y.-F.; Liang, X.; Guo, X.-P.; Ding, D.W.; Zhang, D.; Zhou, S.; Bao, W.-Y.; Bellou, N.; Dobretsov, S. Silver nanoparticles impact biofilm communities and mussel settlement. Sci. Rep. 2016, 6, 37406. [CrossRef] 16. Yang, J.-L.; Li, Y.-F.; Guo, X.-P.; Liang, X.; Xu, Y.-F.; Ding, D.-W.; Bao, W.-Y.; Dobretsov, S. The effect of carbon nanotubes and titanium dioxide incorporated in PDMS on biofilm community composition and subsequent mussel plantigrade settlement. Biofouling 2016, 32, 763–777. [CrossRef] 17. Chen, C.-L.; Maki, J.S.; Rittschof, D.; Teo, S.L.-M. Early marine bacterial biofilm on a copper-based antifouling paint. Int. Biodeterior. Biodegrad. 2013, 83, 71–76. [CrossRef] 18. Pelletier, É.; Bonnet, C.; Lemarchand, K. Biofouling growth in cold estuarine waters and evaluation of some chitosan and copper anti-fouling paints. Int. J. Mol. Sci. 2009, 10, 3209–3223. [CrossRef] 19. Winfield, M.O.; Downer, A.; Longyer, J.; Dale, M.; Barker, G.L.A. Comparative study of biofilm formation on biocidal antifouling and fouling-release coatings using next-generation DNA sequencing. Biofouling 2018, 34, 464–477. [CrossRef] 20. Briand, J.-F.; Djeridi, I.; Jamet, D.; Cope, S.; Bressy, C.; Molmeret, M.; Le Berre, B.; Rimet, F.; Bouchez, A.; Blache, Y. Pioneer marine biofilms on artificial surfaces including antifouling coatings immersed in two contrasting French Mediterranean coast sites. Biofouling 2012, 28, 453–463. [CrossRef] [PubMed] 21. Muthukrishnan, T.; Abed, R.M.M.; Dobretsov, S.; Kidd, B.; Finnie, A.A. Long-term microfouling on commercial biocidal fouling control coatings. Biofouling 2014, 30, 1155–1164. [CrossRef] Appl. Sci. 2021, 11, 8277 8 of 9 22. Richards, T.A.; Leonard, G.; Mahé, F.; del Campo, J.; Romac, S.; Jones, M.D.M.; Maguire, F.; Dunthorn, M.; De Vargas, C.; Massana, R.; et al. Molecular diversity and distribution of marine fungi across 130 European environmental samples. Proc. R. Soc. B Biol. Sci. 2015, 282, 20152243. [CrossRef] [PubMed] 23. Tisthammer, K.H.; Cobian, G.M.; Amend, A.S. Global biogeography of marine fungi is shaped by the environment. Fung. Ecol. 2016, 19, 39–46. [CrossRef] 24. Overy, P.D.; Rämä, T.; Oosterhuis, R.; Walker, K.A.; Pang, K.-L. The neglected marine fungi, sensu stricto, and their isolation for natural products’ discovery. Mar. Drug. 2019, 17, 42. [CrossRef] [PubMed] 25. Miao, L.; Qian, P.-Y. Antagonistic antimicrobial activity of marine fungi and bacteria isolated from marine biofilm and seawaters of Hong Kong. Aquat. Microb. Ecol. 2005, 38, 231–238. [CrossRef] 26. Kirstein, I.V.; Wichels, A.; Krohne, G.; Gerdts, G. Mature biofilm communities on synthetic polymers in seawater-specific or general? Mar. Environ. Res. 2018, 142, 147–154. [CrossRef] [PubMed] 27. Corcoll, N.; Yang, J.; Backhaus, T.; Zhang, X.; Eriksson, K.M. Copper affects composition and functioning of microbial communities in marine biofilms at environmentally relevant concentrations. Front. Microb. 2019, 9, 3248. [CrossRef] 28. Lotlikar, N.; Damare, S.; Meena, R.M.; Jayachandran, S. Variable protein expression in marine-derived filamentous fungus Penicillium chrysogenum in response to varying copper concentrations and salinity. Metallomics 2020, 12, 1083–1093. [CrossRef] [PubMed] 29. Interspeed BRA640 Red Safety Sheet. Available online: http://datasheets1.international-coatings.com/msds/BRA640_USA_ eng_B4.pdf (accessed on 22 July 2020). 30. Valkirs, A.O.; Seligman, P.F.; Haslbeck, E.; Caso, J.S. Measurement of copper release rates from antifouling paint under laboratory and in situ conditions: Implications for loading estimation to marine water bodies. Mar. Poll. Bull. 2003, 46, 763–779. [CrossRef] 31. Jupp, B.P.; Fowler, S.W.; Dobretsov, S.; van der Wiele, H.; Al-Ghafri, A. Assessment of heavy metal and petroleum hydrocarbon contamination in the Sultanate of Oman with emphasis on harbours, marinas, terminals and ports. Mar. Pollut. Bull. 2017, 121, 260–273. [CrossRef] 32. Muthukrishnan, T.; Dobretsov, S.; De Stefano, M.; Abed, R.M.M.; Kidd, B.; Finnie, A.A. Diatom communities on commercial biocidal fouling control coatings after one year of immersion in the marine environment. Mar. Environ. Res. 2017, 129, 102–112. [CrossRef] 33. Al-Sadi, A.M.; Al-Mazroui, S.S.; Phillips, A.J.L. Evaluation of culture-based techniques and 454 pyrosequencing for the analysis of fungal diversity in potting media and organic fertilizers. J. Appl. Microb. 2015, 119, 500–509. [CrossRef] 34. Al-Sadi, A.M.; Al-Ghaithi, A.G.; Al-Balushi, Z.M.; Al-Jabri, A.H. Analysis of diversity in Pythium aphanidermatum populations from a single greenhouse reveals phenotypic and genotypic changes over 2006 to 2011. Plant Dis. 2012, 96, 852–858. [CrossRef] 35. White, T.J.; Bruns, T.D.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. 36. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [CrossRef] 37. Silvestro, D.; Michalak, I. RaxmlGUI: A graphical front-end for RAxML. Org. Divers. Evol. 2012, 12, 335–337. [CrossRef] 38. Dobretsov, S. Biofouling on artificial substrata in Muscat waters. J. Agric. Mar. Sci. JAMS 2015, 20, 24–29. [CrossRef] 39. Chung, D.; Kim, H.; Choi, H.S. Fungi in salterns. J. Microbiol. Seoul Korea 2019, 57, 717–724. [CrossRef] 40. Corinaldesi, C.; Barone, G.; Marcellini, F.; Dell’Anno, A.; Danovaro, R. Marine microbial-derived molecules and their potential use in cosmeceutical and cosmetic products. Mar. Drugs 2017, 15, 118. [CrossRef] 41. Lee, Y.M.; Kim, M.J.; Li, H.; Zhang, P.; Bao, B.; Lee, K.J.; Jung, J.H. Marine-derived Aspergillus species as a source of bioactive secondary metabolites. Mar. Biotechnol. 2013, 15, 499–519. [CrossRef] 42. Paulino, G.V.B.; Félix, C.R.; Landell, M.F. Diversity of filamentous fungi associated with coral and sponges in coastal reefs of northeast Brazil. J. Basic Microbiol. 2019, 60, 103–111. [CrossRef] 43. Wang, G.; Li, Q.; Zhu, P. Phylogenetic diversity of culturable fungi associated with the Hawaiian sponges Suberites zeteki and Gelliodes fibrosa. Antonie Van Leeuwenhoek 2008, 93, 163–174. [CrossRef] [PubMed] 44. Al-Shibli, H.; Dobretsov, S.; Al-Nabhani, A.; Maharachchikumbura, S.S.N.; Rethinasamy, V.; Al-Sadi, A.M. Aspergillus terreus obtained from mangrove exhibits antagonistic activities against Pythium aphanidermatum-induced damping-off of cucumber. PeerJ 2019, 7, e7884. [CrossRef] 45. Halo, B.A.; Maharachchikumbura, S.S.N.; Al-Yahyai, R.A.; Al-Sadi, A.M. Cladosporium omanense, a new endophytic species from Zygophyllum coccineum in Oman. Phytotaxa 2019, 388, 145–154. [CrossRef] 46. Tsang, C.-C.; Chan, J.F.W.; Pong, W.-M.; Chen, J.H.K.; Ngan, A.H.Y.; Cheung, M.; Lai, C.K.C.; Tsang, D.N.C.; Lau, S.K.P.; Woo, P.C.Y. Cutaneous hyalohyphomycosis due to Parengyodontium album gen. et comb. nov. Med. Mycol. 2016, 54, 699–713. [CrossRef] 47. Ponizovskaya, V.B.; Rebrikova, N.L.; Kachalkin, A.V.; Antropova, A.B.; Bilanenko, E.N.; Mokeeva, V.L. Micromycetes as colonizers of mineral building materials in historic monuments and museums. Fungal Biol. 2019, 123, 290–306. [CrossRef] 48. Khusnullina, A.I.; Bilanenko, E.N.; Kurakov, A.V. Microscopic fungi of White Sea sediments. Contemp. Probl. Ecol. 2018, 11, 503–513. [CrossRef] Appl. Sci. 2021, 11, 8277 9 of 9 49. Zhao, D.-L.; Cao, F.; Wang, C.-Y.; Yang, L.-J.; Shi, T.; Wang, K.-L.; Shao, C.-L.; Wang, C.-Y. Alternatone A, an unusual perylenequinone-related compound from a soft-coral-derived strain of the fungus Alternaria alternata. J. Nat. Prod. 2019, 82, 3201–3204. [CrossRef] 50. Chen, Y.; Chen, R.; Xu, J.; Tian, Y.; Xu, J.; Liu, Y. Two new altenusin/thiazole hybrids and a new benzothiazole derivative from the marine sponge-derived fungus Alternaria sp. SCSIOS02F49. Molecules 2018, 23, 2844. [CrossRef] 51. Shi, Z.-Z.; Fang, S.-T.; Miao, F.-P.; Ji, N.-Y. Two new tricycloalternarene esters from an alga-epiphytic isolate of Alternaria alternata. Nat. Prod. Res. 2018, 32, 2523–2528. [CrossRef] 52. Dobretsov, S.; Abed, R.M.M.; Muthukrishnan, T.; Sathe, P.; Al-Naamani, L.; Queste, B.Q.; Piontkovski, S. Living on the edge: Biofilms developing in oscillating environmental conditions. Biofouling 2018, 34, 1064–1077. [CrossRef] 53. Rotini, A.; Tornambè, A.; Cossi, R.; Iamunno, F.; Benvenuto, G.; Berducci, M.T.; Maggi, C.; Thaller, M.C.; Cicero, A.M.; Manfra, L.; et al. Salinity-based toxicity of CuO nanoparticles, CuO-bulk and Cu ion to Vibrio anguillarum. Front. Microbiol. 2017, 8, 2076. [CrossRef] 54. Nasrallah, D.A.; Morsi, M.A.; El-Sayed, F.; Metwally, R.A. Structural, optical and electrical properties of copper chloride filled polyvinyl chloride/polystyrene blend and its antifungal properties against Aspergillus avenaceus and Aspergillus terreus. Compos. Commun. 2020, 22. [CrossRef] 55. Dias, M.A.; Lacerda, I.C.A.; Pimentel, P.F.; De Castro, H.F.; Rosa, C.A. Removal of heavy metals by an Aspergillus terreus strain immobilized in a polyurethane matrix. Lett. Appl. Microb. 2002, 34, 46–50. [CrossRef] 56. Cervantes, C.; Gutierrez-Corona, F. Copper resistance mechanisms in bacteria and fungi. FEMS Microbiol. Rev. 1994, 14, 121–137. [CrossRef] 57. Cappitelli, F.; Vicini, S.; Piaggio, P.; Abbruscato, P.; Princi, E.; Casadevall, A.; Nosanchuk, J.D.; Zanardini, E. Investigation of fungal deterioration of synthetic paint binders using vibrational spectroscopic techniques. Macromol. Biosci. 2005, 5, 49–57. [CrossRef] 58. Saad, D.S.; Kinsey, G.C.; Kim, S.; Gaylarde, C.C. Extraction of genomic DNA from filamentous fungi in biofilms on water-based paint coatings; 12th International Biodeterioration and Biodegradation Symposium (Biosorption and Bioremediation III). Int. Biodeterior. Biodegrad. 2004, 54, 99–103. [CrossRef] 59. Ogawa, N.; Okamura, H.; Hirai, H.; Nishida, T. Degradation of the antifouling compound Irgarol 1051 by manganese peroxidase from the white rot fungus Phanerochaete chrysosporium. Chemosphere 2004, 55, 487–491. [CrossRef] 60. Bernat, P.; Długonski, ´ J. Acceleration of tributyltin chloride (TBT) degradation in liquid cultures of the filamentous fungus Cunninghamella elegans. Chemosphere 2006, 62, 3–8. [CrossRef] 61. Liu, L.L.; Wu, C.-H.; Qian, P.Y. Marine natural products as antifouling molecules—A mini-review (2014–2020). Biofouling 2020, 36, 1210–1226.
http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png
Applied Sciences
Multidisciplinary Digital Publishing Institute
http://www.deepdyve.com/lp/multidisciplinary-digital-publishing-institute/the-presence-of-marine-filamentous-fungi-on-a-copper-based-antifouling-0mZAIOkM0l