Application of Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics

Andrey A. Vodyashkin; Marko George Halim Rizk; Parfait Kezimana; Anatoly A. Kirichuk; Yaroslav M. Stanishevskiy

doi:10.3390/chemengineering5040069

Application of Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics

Vodyashkin, Andrey A.;Rizk, Marko George Halim;Kezimana, Parfait;Kirichuk, Anatoly A.;Stanishevskiy, Yaroslav M. 2021-10-16 00:00:00 chemengineering Review Application of Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics 1 , 1 1 2 Andrey A. Vodyashkin * , Marko George Halim Rizk , Parfait Kezimana , Anatoly A. Kirichuk and Yaroslav M. Stanishevskiy Institute of Biochemical Technology and Nanotechnology, Peoples’ Friendship University of Russia (RUDN University), 6 Miklukho-Maklaya Street, 117198 Moscow, Russia; rizk_m@pfur.ru (M.G.H.R.); kezipar@outlook.com (P.K.); stanishevskiy_yam@pfur.ru (Y.M.S.) Department of Forensic Ecology with the Course of Human Ecology, Peoples’ Friendship University of Russia (RUDN University), 6 Miklukho-Maklaya Street, 117198 Moscow, Russia; kirichuk-aa@rudn.ru * Correspondence: vodyashkin_aa@pfur.ru or av.andrey2013@yandex.ru Abstract: Several metal nanoparticles have been developed for medical application. While all have their beneﬁts, gold nanoparticles (AuNPs) are ideal in cancer therapy and diagnosis as they are chemically inert and minimally toxic. Several studies have shown the potential of AuNPs in the therapeutic ﬁeld, as photosensitizing agents in sonochemical and photothermal therapy and as drug delivery, as well as in diagnostics and theranostics. Although there is a signiﬁcant number of reviews on the application of AuNPs in cancer medicine, there is no comprehensive review on their application both in therapy and diagnostics. Therefore, considering the high number of studies on AuNPs’ applications, this review summarizes data on the application of AuNPs in cancer therapy and diagnostics. In addition, we looked at the inﬂuence of AuNPs’ shape and size on their biological properties. We also present the potential use of hybrid materials based on AuNPs in sonochemical Citation: Vodyashkin, A.A.; Rizk, and photothermal therapy and the possibility of their use in diagnostics. Despite their potential, M.G.H.; Kezimana, P.; Kirichuk, A.A.; the use of AuNPs and derivatives in cancer medicine still has some limitations. In this review, we Stanishevskiy, Y.M. Application of provide an overview of the biological, physicochemical, and legal constraints on using AuNPs in Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics. cancer medicine. ChemEngineering 2021, 5, 69. https://doi.org/10.3390/ Keywords: gold nanoparticles; cancer; diagnosis; therapy; drug delivery; theranostics; hybrid materials chemengineering5040069 Academic Editor: Jacek B. Jasinski 1. Introduction Received: 31 July 2021 Cancer is one of the most global and widespread health problems, as it is the second Accepted: 29 September 2021 leading cause of death globally [1,2]. However, conventional cancer treatments have severe Published: 16 October 2021 drawbacks and often fail to provide satisfactory results [3–10]. After traditional cancer therapy, patients usually take a long time to recover from side effects [10–15]. Moreover, Publisher’s Note: MDPI stays neutral most methods are not highly effective against cancer cells, and cancer chemotherapy with regard to jurisdictional claims in causes disorders in many body organs (heart, kidneys, bladder, nervous system, and published maps and institutional afﬁl- lungs) [16–19]. iations. In recent years, great interest has arisen in applying nanotechnology to diagnose and treat tumor diseases [20,21], mainly because nanotechnology can offer unique methods for the study and control of various biological and medical processes. Therefore, it provides high expectations of creating new techniques with a revolutionary impact on the diagnosis Copyright: © 2021 by the authors. and treatment of cancer [22,23]. Licensee MDPI, Basel, Switzerland. Currently, several varieties of nano-objects of biomedical signiﬁcance are in use, in- This article is an open access article cluding polymer nanoparticles, metal nanoparticles, liposomes, micelles, quantum dots, distributed under the terms and dendrimers, and nanoscale assemblies [24–29]. Among all of them, the use of nanoparticles conditions of the Creative Commons offers more potential in different medical applications [30,31], as shown by their success- Attribution (CC BY) license (https:// ful use as image-enhancing sensors, delivery agents, toxic agents (for example, for the creativecommons.org/licenses/by/ destruction of cancer cells), and diagnostic agents [32,33]. 4.0/). ChemEngineering 2021, 5, 69. https://doi.org/10.3390/chemengineering5040069 https://www.mdpi.com/journal/chemengineering ChemEngineering 2021, 5, 69 2 of 24 In addition, the use of nanoparticles can enhance the effect of various treatments when used in combination with them [34–36]. Moreover, in clinical oncology, there is a new trend of transition from monotherapy towards combination therapy in the presence of valuable nanomaterials [37–39], allowing interactions between different types of treatment and leading to a much more potent therapeutic effect than the separate use of the corresponding monotherapies [40–44]. AuNPs have become promising agents for the therapy and diagnosis of diseases [45,46], as they can passively accumulate and retain in the tumor site because of increased perme- ability and retention (EPR) arising from leaking vascular network and ineffective lymphatic drainage of tumor tissue [47,48]. Further, while many reviews highlight different beneﬁts of AuNPs in cancer medicine, our study presents the recent progress towards the therapeutic and diagnostic application of AuNPs and their derivatives in cancer medicine. However, with the biocompatibility and cytotoxicity of nanoparticles being more or less dependent on their shape and size, we also decided to add an overview of the impact of these two parameters on the applications of AuNPs. Therefore, the present review is divided into seven sections. The impact of the shape and size of AuNPs on their cytotoxicity and biocompatibility is reviewed in Section 2, “Form and Size Dependence on the Biological Properties of Gold Nanoparticles”. The therapeutic application of AuNPs is highlighted in Section 3 Drug Delivery. In the drug delivery section, we review the use of AuNPs in peptide and nucleic acids’ delivery and the potential of hybrid gold-based materials for drug delivery. We continue the review on recent progress in using AuNPs as photosensitizing agents in Section 4. Photothermal therapy and in Section 5. Sonochemical therapy, we also highlight the efﬁcacity of AuNPs in improving these therapeutic methods. In Section 6. Gold Nanoparticles as a Diagnostic Material, we describe the promising developments in the use of AuNPs in diagnosis and theranostics of oncological diseases. Finally, in Section 7. Current Major Restrictions on the Use of Gold Nanoparticles for Medical Purposes, we reviewed the current major restrictions on the use of gold nanoparticles for medical purposes including highlights of the main problems still to be resolved before the widespread use of AuNPs in cancer medicine. For this review, electronic scientiﬁc databases such as PubMed, Science Direct, Web of Science, Scopus, and Medline were used to analyze studies on AuNPs and their application in cancer medicine using keywords such gold nanoparticles, cancer, drug delivery, cancer therapy, cancer treatment, and diagnostics. Data were sorted from 2010 to provide the latest and most current information, but, when there was a need for more clariﬁcation, ulterior data were also used. 2. Form and Size Dependence on the Biological Properties of Gold Nanoparticles The application of gold nanoparticles (AuNPs) in anti-cancer therapy is inﬂuenced by many factors, as reviewed by Singh P. et al., 2018 [49]; among those factors are the preparation methods, the presence of stabilizing agents, surface charge, the presence of hydrophobic/hydrophilic groups on the surface, as well as the size and shape of the AuNPs. Currently, there are several studies on the preparation methods of AuNPs, including those with a modiﬁed surface by particular groups; so, in this review, we will not look at those different ways of preparing AuNPs, but will instead focus exclusively on the application of these gold nanoparticle-based materials products [49,50]. In recent years, studies have shown the impact of both the size and shape of AuNPs on their biological properties, especially their cytotoxicity, and owing to the EPR effect (enhanced permeability and retention effect), nanoparticles smaller than 200 nm can be used (Figure 1). However, particles smaller than 6 nm are quickly excreted by the kidneys, while for those in the region of 10–100 nm, their half-life increases with increasing size [50,51]. ChemEngineering 2021, 5, 69 3 of 24 ChemEngineering 2021, 5, x FOR PEER REVIEW 3 of 25 Figure 1. Owing to the EPR effect (enhanced permeability and retention effect), nanoparticles up Figure 1. Owing to the EPR effect (enhanced permeability and retention effect), nanoparticles up to 2 to 00200 nmnm cancan enter enter andand accum accumulate ulate in th in e the tumtumor or cellscells, , and and cause cause tumo tumor r cell de cell ath death (crea(cr ted eated with with Bio- Render.com). BioRender.com). In addition, studies show that, with inﬂammation, the endothelial lining of the blood In addition, studies show that, with inflammation, the endothelial lining of the blood v vessel essel wa wall ll iis s m mor ore e pe permeable rmeable th than an iin n n normal ormal co conditions, nditions, so so pa particles rticles o of f 1 10 0 to to 2 200 00 n nm m iin n si size ze ca can n lleave eave th the e b bloodstr loodstre eam am a and nd a accumulate ccumulate i inside nside th the e i interstitial nterstitial tissues. tissues. Moreover, different organs accumulate particles of a particular shape; for example, the Moreover, different organs accumulate particles of a particular shape; for example, preferred localization of irregularly shaped nanoparticles is the spleen and the lungs for rod- the preferred localization of irregularly shaped nanoparticles is the spleen and the lungs shaped particles, but the exact mechanism of this preference is still unknown [52,53]. Finally, for rod-shaped particles, but the exact mechanism of this preference is still unknown the impact of their shape is also closely related to their movement in the bloodstream. [52,53]. Finally, the impact of their shape is also closely related to their movement in the From studies on the effect of size and shape on the biodistribution of AuNPs after bloodstream. intravenous administration, we note the following: From studies on the effect of size and shape on the biodistribution of AuNPs after i(a) ntravThe enous size adand minishape stration str , we ongly note af th fect e fo the llow kinetics ing: of accumulation and excretion of (AuNPs a) The si in ze ﬁltering and sha or pe gans; strongly affect the kinetics of accumulation and excretion of A (b) uNPs Spherical in filteri and ng o star rga-shaped ns; AuNPs showed the same percentage of accumulation, but (others b) Spher localize ical anin d st the ar-liver; shaped AuNPs showed the same percentage of accumulation, b (c) ut oth Only ers lstellate ocalize (or in th star e li -shaped) ver; AuNPs can accumulate in the lungs; (d) Changes in geometry did not improve the passage of the blood–brain barrier. Overall, (c) Only stellate (or star-shaped) AuNPs can accumulate in the lungs; the study is a reliable starting point for the synthesis and functionalization of potential (d) Changes in geometry did not improve the passage of the blood–brain barrier. candidates for theranostic purposes in many research areas [54]. Overall, the study is a reliable starting point for the synthesis and functionalization of potential candidates for theranostic purposes in many research areas [54]. In addition to the accumulation and distribution of gold nanoparticles within the In addition to the accumulation and distribution of gold nanoparticles within the body, their cytotoxicity is assessed depending on their shape and size. Studies show body, their cytotoxicity is assessed depending on their shape and size. Studies show that that cytotoxicity also depends on these parameters. For example, the toxicity tests on cytotoxicity also depends on these parameters. For example, the toxicity tests on three three different forms of chitosan-coated gold nanoparticles (nanospheres, nanostars, and d nanor ifferent ods) forms showed of chi that, tosan even -coated at low gold concentrations, nanoparticles (like nano 8sph M erAu, es, nnanor anosta ods rs, aexhibited nd nano- ro cytotoxicity ds) showed [ 55 th]. at, Mor even eover at lo,w the con IC centra value tions, was like 127.1 8 μM A M u, Au nanfor orod nanospher s exhibited es cyto against tox- HepG2 cells, 81.8 M Au for nanostars, and 22.7 M Au for nanorods, thus showing icity [55]. Moreover, the IC50 value was 127.1 μM Au for nanospheres against HepG2 cells, 8 that 1.8 μ nanor M Au ods for ar ne an the ostmost ars, an cytotoxic, d 22.7 μM followed Au for n by ano nro anostars, ds, thus sh and owi nanospher ng that n es—the anorods least are cytotoxic to HepG2 cells [56]. the most cytotoxic, followed by nanostars, and nanospheres—the least cytotoxic to HepG2 In addition, analysis on cellular uptake of nanoparticles showed that it is also de- cells [56]. pendent on the shape, with a study of the absorption of AuNPs (5 M Au—a non-toxic In addition, analysis on cellular uptake of nanoparticles showed that it is also de- concentration in four types of cancer cells) showing the highest absorption for nanospheres pendent on the shape, with a study of the absorption of AuNPs (5 μM Au—a non-toxic (58.0%), followed by nanorods (52.7%) and nanostars (41.5%). Therefore, not only cyto- concentration in four types of cancer cells) showing the highest absorption for nano- toxicity (nanorods > nanostars > nanospheres), but also the level of cellular absorption spheres (58.0%), followed by nanorods (52.7%) and nanostars (41.5%). Therefore, not only (nanospheres > nanorods > nanostars) depend on the shape of the particles [57]. cytotoxicity (nanorods > nanostars > nanospheres), but also the level of cellular absorption The cytotoxicity of different shapes of AuNPs (rods, stars, and spheres) have also been (nanospheres > nanorods > nanostars) depend on the shape of the particles [57]. analyzed on human cells using in vitro model cells—hFOB 1.19, 143B, MG63, and hTERT- The cytotoxicity of different shapes of AuNPs (rods, stars, and spheres) have also HPNE. The results showed that the IC values were the lowest in 143B cell compared been analyzed on human cells using in vitro model cells—hFOB 1.19, 143B, MG63, and with hFOB 1.19 and MG63 cell lines. AuNPs induced apoptosis in human osteosarcoma in hTERT-HPNE. The results showed that the IC50 values were the lowest in 143B cell ChemEngineering 2021, 5, 69 4 of 24 both 143B and MG63, and AuNPs of all types penetrated the cell membrane and caused ultrastructural changes. AuNPs-nanostars were more cytotoxic to 143B, while hFOB 1.19 cells were more resistant to AuNPs-nanostars (2.5 and 5 g/mL). After exposure to a low concentration of AuNPs-nanostars (0.3 and 0.6 g/mL), hFOB 1.19 and MG63 cells had a similar survival rate. In the MTT test, AuNPs signiﬁcantly reduced the viability of hFOB 1.19, MG63, and 143B cells. The neutral-red uptake analysis (NR analysis) showed that hFOB 1.19 are resistant to the cytotoxic effect of AuNPs-rods at concentrations of 0.3 to 2.5 g/mL, MG63 to AuNPs-rods at the concentration of 0.3 to 0.6 g/mL, and 143B cells to AuNPs-rods at the concentration of 0.3–1.2 g/mL. The AuNPs-spheres were the least cytotoxic compared with the other nanoparticles. MTT tests showed that AuNPs-spheres did not reduce the viability of hFOB1.19 and MG-63 cells. In contrast, the NR assay showed no statistically signiﬁcant effect of AuNPs-spheres on the viability of hFOB1.19, MG63, and 143B cells over the analyzed concentration range. Thus, AuNPs-nanostars were the most cytotoxic, and thus have the highest anti-cancer potential, while AuNPs-spheres have the lowest anti-cancer potential [58]. An analysis of the catalytic activity of AuNPs showed that it is dependent on their size, as Suchomel P. et al. found that decreasing the size causes an increase in the catalytic activity of AuNPs obtained by the reduction of HAuCl with maltose in the presence of Tween 80 [59]. Other properties of AuNPs have also been studied, such as their biological proper- ties based on in vivo and in vitro results. It has been shown that their physicochemical properties can be explained by their hydrodynamic diameter and their zeta potential [60]. However, in an analysis of multidimensional set, no direct relationship between physico- chemical parameters and biological properties was established [61,62], which is most likely because of a large number of parameters that are difﬁcult to take into account and makes it difﬁcult to predict the biological effect of AuNPs in the case of a simultaneous change in several physicochemical properties [63,64]. The results of several studies show that the shape, size, surface charge, and presence of special groups have an impact on the potential and effectivity of AuNPs, so it should be recommended that nano-objects are specially developed for the intended application taking into account all its subtleties, as it would increase the efﬁciency of AuNPs in therapy or diagnosis of the disease. 3. Drug Delivery The ability to customize AuNPs makes it possible to create particles of various core diameters with complete control over size dispersion [65]. Owing to the high surface area to volume ratio, dense loading of ligands with multiple functions involved in therapy, diagnosis, and targeting can be anchored to the surface of AuNPs [66]. There are two main types of anchoring of drugs to the surface of nanoparticles: 1. Conjugation (attachment to the surface of a nanoparticle through linker molecules); 2. Sorption (ﬁxation on the surface due to non-covalent bonds and the developed surface of nanoparticles). Hostetler et al. demonstrated the covalent conjugation of almost 100 molecules with one AuNP with a core diameter of 2 nm [67]. In addition, the delicate surface treatment of AuNPs with different multifunctional monolayers provides ideal functional diversity, making them a versatile platform for drug delivery [68]. The most efﬁcient cellular uptake occurs for particles ranging in size from 25 to 50 nm. In addition, a study on in vivo uptake of AuNPs and their passive accumulation in the tumor showed that the penetration of nanoparticles through the interstitial space of a tumor is highly size-dependent. While the larger AuNPs accumulate near the vasculature, the smaller AuNPs rapidly diffuse from the vasculature and are distributed throughout the tumor matrix [69]. There are two main types of targeted drug delivery: ChemEngineering 2021, 5, 69 5 of 24 1. Passive transfer (delivery is carried out in areas of increased permeability, which cancer cells often have); 2. Active transfer (accumulation in the tumor due to the binding of a speciﬁc ligand and a damage marker). A critical factor in drug delivery is the EPR effect, which occurs because of the extrava- sation of macromolecules or nanoparticles through the tumor ’s blood vessels. Nanoprobe delivery based on the EPR effect is also helpful for tumor imaging agents using ﬂuorescent or radio nuclei in nanoprobes [70]. Several researchers have conﬁrmed that extravasation through EPR does not have a reverse mechanism, so an object penetrating inside is delayed for a long time [45,46]. Cur- rently, there are some mechanisms aimed at improving the EPR effect and the treatment’s effectiveness; one of them is a combination of pharmacological and physical methods of treatment [48,71]. 3.1. Peptide Delivery Given the potential of peptides as drugs, nanoparticles of different sizes from 1 to 100 nm have been used to deliver peptides into cells to improve their therapeutic effect. Pérez-Ortiz M. et al. showed that AuNPs synthesized by reducing HAuCl with sodium citrate could serve as a basis for creating a glucagon-like peptide from conjugates, which can be used as a drug. This method helps increase the peptide half-life and drug stability. They found that the complex of nanoparticles and peptides had no effect on the integrity of tight junctions and had no adverse impact on the metabolic activity (viability) of intestinal epithelial cells after 2 and 20 months. Their study also showed that the modiﬁcation with polyethylene glycol improves biocompatibility with biological barriers and increases the efﬁciency of the conjugate absorption, which indicates that AuNPs are highly promising for delivering peptide drugs [72]. Other researchers have also shown the potential of AuNPs in peptide delivery, as they synthesized AuNPs by reduction with tannin and sodium citrate, after which they functionalized PEG together with peptides PFV (CALNNPFVYLI) or R8 (CALRRRRRRRR) [73]. Data on cellular uptake at 4 C show that nanoparticles enter cells through energy- dependent endocytosis, which has been studied on nanoparticles of 10 to 100 nm in size [74]. In addition, nanoparticles with peptides can inhibit macropinocytosis by blocking the sodium–proton exchange. Most nanoparticles with peptides are absorbed by cells in the pathways of clathrin-mediated endocytosis and micropinocytosis, and it was revealed that they had increased cellular uptake in comparison with conventional nanoparticles, which should undoubtedly be used in the design of various delivery systems for the treatment of multiple diseases [75–77]. Kapur A. et al. used the complexes of peptides with gold nanoparticles and nanorods for direct translocation across the plasma membrane [78], showing that those peptides could help avoid the limitations currently encountered during the delivery of nano-objects into tumor cells. In addition, the complex of AuNPs and peptides can also be used as a biosensor inside the cell, thanks to the high electronic contrast provided by AuNPs [79,80]. 3.2. Nucleic Acid Delivery Another class of compounds that are promising in treating various diseases, includ- ing cancer diseases, is nucleic acids. To attach oligonucleotides to gold nanoparticles, covalent functionalization with thiol-modiﬁed oligonucleotides is used [81,82]. A layer of nucleic acids on the surface of gold nanoparticles inhibits the action of nucleases, and thus preserves the payload. The non-covalent interaction of nucleic acids and gold nanoparti- cles is used to deliver unmodiﬁed nucleic acids useful for gene therapy [83,84]. For the successful application of this method, it is important to consider several factors, such as carrier/nucleotide size, surface charge, and surface hydrophobicity [85]. Kunoh T. et al. showed in their green biosynthesis of AuNPs using Leptothrix cells (iron-oxidizing bacteria) that nucleic acids bind to ready-made gold nanoparticles and ChemEngineering 2021, 5, 69 6 of 24 participate in the formation of nanoparticles, acting as a reducing agent and a coating agent [86]. Furthermore, they showed that ﬁne-grained spherical AuNPs could be formed owing to the oxidation of the guanine fragment without the need for any reducing agents or physical modiﬁcations, which makes this material very promising for medical applica- tions [87,88]. AuNPs can also be obtained by reduction with chitosan combined with siRNA STAT3 0 0 on its surface (sense sequence: 5 AAAUGAAGGUGGUGGAGAAUU3 ; antisense sequence: 0 0 5 UUCUCCACCACCUUCAUUUUU3 ) and imatinib for one hour [87]. Intratumoral delivery of siRNA STAT3 and imatinib with AuNPs showed a decrease in tumor weight by 45% and in intramuscular load by 30% [88]. In vitro studies have demonstrated that co-delivery of the two drugs (siRNA STAT3 and imatinib) signiﬁcantly reduces cell viability compared with siRNA STAT3 or imatinib alone. In the absence of a nucleotide portion, there was no effect on tumors. Therefore, the created complex hybrid material shows high efﬁciency in suppressing melanoma cancer [89]. Several researchers have developed AuNPs by reducing sodium citrate and function- alizing them through thiol modiﬁcations at the 5 -end of anti-221 nucleotides, miR-221 inhibitor, and AS1411 aptamer, a guanine-rich oligonucleotide that can form stable G- quadruplex structures for speciﬁc targeting of nucleolin, which is overexpressed on the surface of leukemic cells [90–92]. Such AuNPs were modiﬁed with PEG and loaded with doxorubicin. This hybrid material counteracts miR-221/p-glycoprotein-dependent mul- tidrug resistance in leukemia and sensitizes primary blasts in leukemic patients with a chemoresistant relapse to doxorubicin [93–96]. This method for oligonucleotide drug delivery in combination with doxorubicin is a unique antileukemic strategy that induces apoptosis of cancer cells and leads to the restoration of the expression of tumor suppressors p27kip1 and p15ink4b, as well as to a miR-221-mediated decrease in the expression of P-glycoprotein [97]. In a recent study, Saravanakumar K. et al. used AuNPs of 50 nm in size and spher- ical and hexagonal shape, obtained by incubation with the protein extract of the fungi Trichoderma harzianum. They modiﬁed them using the APT aptamer (AS1411). Cytotoxicity analysis showed that the modiﬁcation with APT aptamer increased cytotoxicity in lung cancer and human brain tumor cell lines compared with normal cells NIH3T3 because of a lower expression of nucleolin in the plasma membrane of normal cells NIH3T3 and higher expression of nucleolin in cancer cells. In addition, the crude protein content of Trichoderma was also associated with the toxicity of AuNPs to malignant cells. In addition, their results show that, during the action of AuNPs on cells, an excessive amount of ROS is released, causing damage to the nucleus and cell death and that fungal crude protein- coated gold nanoparticles functionalized with aptamer (APT-FE-AuNPs) bind to nucleolin in the plasma membrane of cancer cells and trigger apoptosis and necrosis (Figure 2) [98]. AuNPs have also been used in combination with biopolymers, capable of being incorporated into the human body and metabolized to deliver nucleic acids. A recent study shows the process of assembling a hybrid material based on AuNPs by reducing HAuCl4 in the presence of chitosan, which acts as a capping agent, thus obtaining chitosan-coated AuNPs of 20 nm on average. Those nanoparticles were used to deliver siRNA. The results show that, in addition to the high stability of the obtained particles in biological systems, there is increased efﬁciency in releasing the therapeutic agent and high absorption by cells owing to endocytosis. Cytotoxicity relative to lung epithelial cells H1299-eGFP, as well as suppression of biomarker signals, indicated a high efﬁciency of siRNA delivery using the developed system (Figure 3) [99]. ChemEngineering 2021, 5, x FOR PEER REVIEW 7 of 25 ChemEngineering 2021, 5, 69 7 of 24 ChemEngineering 2021, 5, x FOR PEER REVIEW 7 of 25 Figure 2. Schematic illustration of nucleolin targeted delivery of APT-FE-AuNPs to improve cyto- toxicity in cancer cells [98]. AuNPs have also been used in combination with biopolymers, capable of being in- corporated into the human body and metabolized to deliver nucleic acids. A recent study shows the process of assembling a hybrid material based on AuNPs by reducing HAuCl4 in the presence of chitosan, which acts as a capping agent, thus obtaining chitosan-coated AuNPs of 20 nm on average. Those nanoparticles were used to deliver siRNA. The results show that, in addition to the high stability of the obtained particles in biological systems, there is increased efficiency in releasing the therapeutic agent and high absorption by cells owing to endocytosis. Cytotoxicity relative to lung epithelial cells H1299-eGFP, as well as suppre Figure 2. ssSchematic ion of bioillustration marker sign of a nucleolin ls, indica tar ted geted a hi delivery gh efficof iency APTo -FE-AuNPs f siRNA dto eli impr very ove usi cytotox- ng the Figure 2. Schematic illustration of nucleolin targeted delivery of APT-FE-AuNPs to improve cyto- d icity tev oxici el in o ty pe cancer in d c sy ancells st cer em ( c[ el 98 ls Fi ]. [gure 98]. 3) [99]. AuNPs have also been used in combination with biopolymers, capable of being in- corporated into the human body and metabolized to deliver nucleic acids. A recent study shows the process of assembling a hybrid material based on AuNPs by reducing HAuCl4 in the presence of chitosan, which acts as a capping agent, thus obtaining chitosan-coated AuNPs of 20 nm on average. Those nanoparticles were used to deliver siRNA. The results show that, in addition to the high stability of the obtained particles in biological systems, there is increased efficiency in releasing the therapeutic agent and high absorption by cells owing to endocytosis. Cytotoxicity relative to lung epithelial cells H1299-eGFP, as well as suppression of biomarker signals, indicated a high efficiency of siRNA delivery using the developed system (Figure 3) [99]. Fig Figure ure 3 3. . S Schematic chematic r rep epr res esentation entation of of t the he chitosan-coated chitosan-coated AuNPs AuNPs for for siRNA siRNA delivery delivery [[9 99 9]. ]. 3.3. Hybrid Gold-Based Materials for Drug Delivery Recently, hybrid materials based on AuNPs have become more promising for anti- cancer drug delivery, as an example of the complex of AuNPs with gallauseite nanotubes. This complex is prepared with biological methods, giving it a tremendous advantage for biomedical purposes [100–103]. Several methods can be used to attach AuNPs to a drug-using particular group, such as a pH-sensitive linker. Such a type of attachment of the drug to AuNPs allows the intracellular release of the drug from the nanoparticle to be triggered when they enter the acidic organelles (Figure 4) [104]. AuNPs, developed through a modiﬁcation with polyethylene glycol and conjugated with doxorubicin using a hydrazine linker, were used Figure 3. Schematic representation of the chitosan-coated AuNPs for siRNA delivery [99]. to release a model drug (doxorubicin). The drug release was found to be dependent on ChemEngineering 2021, 5, 69 8 of 24 ChemEngineering 2021, 5, x FOR PEER the REV pH IEW of the medium, as at pH 7.4, after incubation for 48 h, only 20% of the drug9was of 25 released, and at pH 5, more than 80% was released. Figure 4. (A) Schematic illustration of doxorubicin (DOX)-tethered responsive gold nanoparticles Figure 4. (A) Schematic illustration of doxorubicin (DOX)-tethered responsive gold nanoparticles and (B) their cooperation between enhanced doxorubicin cellular entry and a responsive intracellu- and (B) their cooperation between enhanced doxorubicin cellular entry and a responsive intracellular lar release of doxorubicin into the cells to overcome drug resistance [104]. release of doxorubicin into the cells to overcome drug resistance [104]. 4. Photothermal Therapy The attachment of doxorubicin to the surface of AuNPs protects it from P-gp efﬂux, thus increasing the retention of doxorubicin in cells [105,106], and that combined with Photothermal therapy (PTT) is one of the non-surgical methods based on the use of high drug loading capacity and effective drug release under pH control combined with the particular photosensitizing substances, which selectively accumulate in pathologic cells advantage of multimodal visualization inside cells show the high potential of this delivery and increase their sensitivity to light. Photothermal therapy has several advantages over system in medicine [107]. Furthermore, drug delivery systems, by binding cytotoxic drugs other methods, for example, high efficiency in the treatment of skin cancer, the absence of to the surface of AuNPs through an acid–labile bond, have demonstrated their potential to complicated procedures in preparation for treatment, and the possibility of using it in inhibit the growth of cancer cells (for instance, MCF-7/ADR) owing to the high efﬁciency of hard-to-reach places [123]. cellular uptake through endocytosis and subsequent acid-dependent release in cells [108]. Usually, PTT is carried out in two stages (Figure 5): the introduction of a photosensi- Our literature analysis also showed another hybrid system—a complex of AuNPs tizer drug into the tumor area (or vein) and its accumulation in cancer cells, after which with dendrimer G5-FD conjugated with doxorubicin [109–111]. Further, it has been demon- the tumor area is irradiated with a laser with a specific wavelength [124]. strated that such a complex has a therapeutic effect and provides targeted inhibition of FAR-expressing cancer cells [112,113]. AuNPs (20–25 nm) modiﬁed with PEG and carboxylated dendrimer PAMAM G4 have also been used to deliver doxorubicin [114]. While nanoparticles have shown high stability over a wide pH range [115,116], Wang F. et al. in their work established a relationship between drug release at different pH, with more than 50% of doxorubicin released in an acidic medium (pH 4), thus suggesting a high efﬁciency against cancer cells [104]. Apart from doxorubicin, the drug delivery ability of AuNP-based hybrid materials was tested by loading it with the model drug, curcumin; it was found that, at pH 5.5, about ChemEngineering 2021, 5, 69 9 of 24 95% of curcumin was released within 48 h, and at pH 7.4, only 10% was released. Thus, conﬁrming that hybrid nanoparticles have a pH-dependent drug delivery process and are more efﬁcient in the acidic medium [117–121]. Drug release from nanosystems is controlled; ﬁrst, it enters the cytoplasm, accumulates in the lysosomes, and then, after 24 h, the drug is released from the lysosomes going into the cell nucleus [45]. Thus, the new multifunctional nanosystem based on AuNPs may provide a unique platform for intracellularly releasing an anti-cancer drug at tumor sites. AuNPs coated with a platinum layer and modiﬁed with the cRGD peptide of various sizes were loaded with doxorubicin. Yang Q. et al. showed in their in vivo experiments the effectiveness of the complex AuNPs-DOX comparison with free doxorubicin [122]. The antitumor properties of the complex were additionally conﬁrmed by immunohistochemi- cal/immunoﬂuorescence analysis of tumor tissues during various treatments. Furthermore, the complex showed high absorption in the near-infrared range, which was used for pho- tothermal therapy and showed a high degree of inhibition of MDA-MB-231 tumor with a low level of laser radiation (1.5 W/cm for 5 min) and a low dose of medication. This complex has combined therapeutic functions, including an antioxidant effect on injuries caused by oxidative stress. It may be an ideal candidate for maximizing the results of chemothermal therapy, compensating for their adverse effects [122]. 4. Photothermal Therapy Photothermal therapy (PTT) is one of the non-surgical methods based on the use of particular photosensitizing substances, which selectively accumulate in pathologic cells and increase their sensitivity to light. Photothermal therapy has several advantages over other methods, for example, high efﬁciency in the treatment of skin cancer, the absence of complicated procedures in preparation for treatment, and the possibility of using it in hard-to-reach places [123]. ChemEngineering 2021, 5, x FOR PEER REVIEW 10 of 25 Usually, PTT is carried out in two stages (Figure 5): the introduction of a photosensi- tizer drug into the tumor area (or vein) and its accumulation in cancer cells, after which the tumor area is irradiated with a laser with a speciﬁc wavelength [124]. Figure 5. Schematic illustration of PTT on skin cancer (created with BioRender.com). Figure 5. Schematic illustration of PTT on skin cancer (created with BioRender.com). AuNPs actively absorb radiation in the near-infrared range owing to the relative AuNPs actively absorb radiation in the near-infrared range owing to the relative transparency of the human body and its large surface area, and these properties are transparency of the human body and its large surface area, and these properties are the the reason for the use of AuNPs in PTT [125,126]. Upon absorption of light energy, the reason for the use of AuNPs in PTT [125,126]. Upon absorption of light energy, the pho- photosensitizer excites the surrounding oxygen molecules into the singlet state, destroying tosensitizer excites the surrounding oxygen molecules into the singlet state, destroying cells by oxidation. Thus, for AuNPs, there is intense heating of cells, followed by their cells by oxidation. Thus, for AuNPs, there is intense heating of cells, followed by their death. The depth of light penetration increases as its spectrum shifts to the red region, death. The depth of light penetration increases as its spectrum shifts to the red region, so so the development of photosensitizers based on metal NPs, including AuNPs, activated the development of photosensitizers based on metal NPs, including AuNPs, activated by by infrared radiation, should increase the depth of the photodynamic effect by several infrared radiation, should increase the depth of the photodynamic effect by several times times [127,128]. [127,128]. An ideal candidate for a photothermal therapy role requires several conditions [129–133]: An ideal candidate for a photothermal therapy role requires several conditions [129– (i) nanoparticles of suitable size and uniform shape; 133]: (ii) possessing a good dispersibility in aqueous solutions; (i) nanoparticles of suitable size and uniform shape; (ii) possessing a good dispersibility in aqueous solutions; (iii) respond to near-infrared light in range (650–950 nm) to prevent damage to surround- ing healthy tissue, to ensure sufficient photothermal efficiency, and to ensure enough penetration depth; (iv) sufficiently photostable to allow adequate diffusion time to reach tumors before los- ing their light sensitivity; (v) exhibit low or no cytotoxicity in living systems. Gold is already used as a therapeutic method in nanomedicine, with colloidal gold, covalently linked to adenovirus vectors, used to selectively target cancer and induce hy- perthermia by near-infrared (NIR) laser radiation. Moreover, gold nanoparticles have sev- eral advantages that make them suitable for photothermal cancer treatments [134,135]: (1) The ability to focus on the local region of the tumor while minimizing non-specific distribution; (2) They can be activated through near-infrared (NIR) laser light, creating the ability to penetrate deep into biological tissues; (3) They can be modulated to create multifaceted drug delivery systems and cancer photothermal therapy. Several studies have proposed a unique hybrid material based on AuNPs and black phosphorus. Black phosphorus (BP), a new type of two-dimensional nanomaterial, has received serious attention in recent years thanks to its excellent properties and enormous potential in various chemical, physical, and biological fields [136,137]. The hybrid material is obtained by sonicating black phosphorus suspension, mixing it in boiling water with a HAuCl4 solution for 2 min. Finally, the solution is centrifuged to obtain gold nanoparticles in black phosphorus (BP-AuNPs). To assess the potential of BP-AuNPs, both in vivo and in vitro experiments showed encouraging results, with BP-AuNPs for 4 h inducing a more severe photothermal damage and 75% of cancer cells being destroyed after incubation with 30 μg/mL. Furthermore, the in vivo experiment with 4T1 mammary tumors in mice showed that photothermal treatment of tumors with BP-AuNPs provides high therapeutic ChemEngineering 2021, 5, 69 10 of 24 (iii) respond to near-infrared light in range (650–950 nm) to prevent damage to surround- ing healthy tissue, to ensure sufﬁcient photothermal efﬁciency, and to ensure enough penetration depth; (iv) sufﬁciently photostable to allow adequate diffusion time to reach tumors before losing their light sensitivity; (v) exhibit low or no cytotoxicity in living systems. Gold is already used as a therapeutic method in nanomedicine, with colloidal gold, covalently linked to adenovirus vectors, used to selectively target cancer and induce hyperthermia by near-infrared (NIR) laser radiation. Moreover, gold nanoparticles have several advantages that make them suitable for photothermal cancer treatments [134,135]: (1) The ability to focus on the local region of the tumor while minimizing non-speciﬁc distribution; (2) They can be activated through near-infrared (NIR) laser light, creating the ability to penetrate deep into biological tissues; (3) They can be modulated to create multifaceted drug delivery systems and cancer photothermal therapy. Several studies have proposed a unique hybrid material based on AuNPs and black phosphorus. Black phosphorus (BP), a new type of two-dimensional nanomaterial, has received serious attention in recent years thanks to its excellent properties and enormous potential in various chemical, physical, and biological ﬁelds [136,137]. The hybrid material is obtained by sonicating black phosphorus suspension, mixing it in boiling water with a HAuCl solution for 2 min. Finally, the solution is centrifuged to obtain gold nanoparticles in black phosphorus (BP-AuNPs). To assess the potential of BP-AuNPs, both in vivo and in vitro experiments showed encouraging results, with BP-AuNPs for 4 h inducing a more severe photothermal damage and 75% of cancer cells being destroyed after incubation with 30 g/mL. Furthermore, the in vivo experiment with 4T1 mammary tumors in mice showed that photothermal treatment of tumors with BP-AuNPs provides high therapeutic efﬁcacy without obvious neoplasms. Thus, the BP-AuNPs have an excellent photothermal effect and high antitumor activity, indicating their promising biomedicine potential [138]. AuNPs can also be used to increase the sensitivity of tumor cells to hyperthermia treatment, as proven by the work of Moradi S. et al. They analyzed the viability of Y79 cells 48 h after 0.5–11 min hyperthermia with and without AuNPs using MTT analysis and found that the percentage of cell viability was 50% after hyperthermia with AuNPs for 4.5 min; to achieve a similar effect without nanoparticles, it took 9 min. Thus, proving that AuNPs help increase tumor cells’ sensitivity to hyperthermia treatment [139]. Another latest advancement in the hyperthermal treatment of tumor diseases was Fe O nanoparticles coated with gold and silver shells. Colloidal solutions of magnetite 3 4 nanoparticles coated with gold and silver with 10–20 nm had a cytotoxic effect on HCT116 cells. Concentrations of 400 g/mL and 600 g/mL of the Fe O core with a shell of AuNPs 3 4 led to a decrease in the viability by about 40% and 55%, respectively [140]. 5. Sonochemical Therapy In recent years, scientists have widely explored various approaches in cancer therapy based on the action of ultrasound waves on the tumor [141]. There are a few studies on the use of ultrasound techniques in cancer control [142,143]. The therapeutic effect of ultrasound is based on its interaction with tissues, causing some biological effects [142]. There are three main methods of ultrasound therapy for tumor diseases (Table 1): high intensity focused ultrasound (HIFU), low-intensity ultrasound (LIU), and sonody- namic therapy (SDT) [144–147]. The biological effects of ultrasound are mainly caused by heat, mechanical stress, and cavitation (Figure 6) [148]. Inertial cavitation is consid- ered a more promising method of using ultrasound therapy as it does not cause thermal effects [149–151]. ChemEngineering 2021, 5, x FOR PEER REVIEW 11 of 25 efficacy without obvious neoplasms. Thus, the BP-AuNPs have an excellent photothermal effect and high antitumor activity, indicating their promising biomedicine potential [138]. AuNPs can also be used to increase the sensitivity of tumor cells to hyperthermia treatment, as proven by the work of Moradi S. et al. They analyzed the viability of Y79 ChemEngineering 2021, 5, 69 11 of 24 cells 48 h after 0.5–11 min hyperthermia with and without AuNPs using MTT analysis and found that the percentage of cell viability was 50% after hyperthermia with AuNPs for 4.5 min; to achieve a similar effect without nanoparticles, it took 9 min. Thus, proving that A Table uNPs 1. Main help methods increase of tum ultrasound or cells’therapy sensitiv for ity to cancer hy .perthermia treatment [139]. Another latest advancement in the hyperthermal treatment of tumor diseases was Ultrasound Therapy Fe3O4 nanoparticles coated with gold and silver shells. Colloidal solutions of magnetite Type of Therapy Intensity, W/cm Frequency Effect Features nanoparticles coated with gold and silver with 10–20 nm had a cytotoxic effect on HCT116 cells. Concentrations of 400 μg/mL and 600 μg/mL of the Fe3O4 core with a shell of AuNPs High intensity focused local overheating of the tissue with a 100–20,000 0.25–10 MHz heat to destroy cells ultrasound (HIFU) led to a decrease in the viability by about 40% and 55%, re temperatur spectively [ e fr1 om 40]60 . to 85 C increased the activity of 5. Sonochemical Therapy chemotherapeutic molecules in cancer therapy; used for direct action on cells In recent years, scientists have widely explored various approaches in cancer therapy slight heating, and their components (sonoporation); based on the action of ultrasound waves on the tumor [141]. There are a few studies on Low-intensity 0.1–5 1 Hz–100 kHz improved it has been used for the delivery or ultrasound (LIU) the use of ultrasound techniques in cancer control [142,143]. The therapeutic effect of ul- permeability transfection of genes and for trasound is based on its interaction with tissues, causing some biological effects [142]. accelerating tissue heating, as well as There are three main methods of ultrasound thera for py its foanti-vascular r tumor disea effect ses on (Ta the ble 1): neovascular network of the tumor high intensity focused ultrasound (HIFU), low-intensity ultrasound (LIU), and sono- dynamic therapy (SDT) [144–147]. The biological effects of ultrasound are mainly caused free radical nature the combined effect on the tumor of Sonodynamic by heat, mechanical stress, and ca associated vitation ( with Figure the 6) [148]. In ultrasound ertial caviand tatio chemical n is considered 1–10 0.5–2 MHz therapy (SDT) cavitation effects of non-medicinal compounds that a more promising method of using ultrasound therapy as it does not cause thermal effects ultrasound enhance the therapeutic effect [149–151]. Figure 6. Schematic illustration of sonochemical therapy (created with BioRender.com). Figure 6. Schematic illustration of sonochemical therapy (created with BioRender.com). The main application of nanoparticles in ultrasound therapy for cancer is reduced Table 1. Main methods of ultrasound therapy for cancer. to the formation of bubbles on their rough surface, which causes evaporation in the environment and, ther Ult eby rasou , vapor nd Tcavities herapy (Figure 7). The method of sonodynamic therapy seems to be very attractive because, owing to the high penetrating ability of ultrasound (up Type of Therapy Intensity, W/cm Frequency Effect Features to tens of centimeters, depending on the frequency), it allows acting on intensely localized tumors that are inaccessible for photodynamic therapy [152,153]. High intensity fo- heat to destroy local overheating of the tissue with Sonodynamic therapy uses the synergistic effect of a non-toxic and selective agent cused ultrasound 100–20,000 0.25–10 MHz cells a temperature from 60 to 85 C (sensitizer). AuNPs can have tremendous therapeutic effects, together with SDT, through (HIFU) biocompatibility, selectivity, and biodistribution [142]. An example of ultrasound therapy increased the activity of chemo- and AuNPs is the recovery after anti-cancer therapy involving active forms of oxygen- ROS. Victor et al. demonstrated that nanoparticles and ther therapeutic apeutic mo pulsed lecules ultrasound in cancer reduce the content of pro-inﬂammatory cytokines in tissues [154]. During the inﬂammatory slight heating, im- therapy; used for direct action on Low-intensity ul- phase of the healing process, ultrasound can activate immune cells to migrate to the injury 0.1–5 1 Hz–100 kHz proved permeabil- cells and their components (sono- trasound (LIU) site [155,156]. At the same time, gold compounds can suppress the expression of NF-B ity poration); it has been used for the and other inﬂammatory responses [157]. AuNPs can play a positive role after therapy with delivery or transfection of genes ROS participation, because, in combination with pulsed ultrasound, they reduce the effect and for accelerating tissue heating, of reactive oxidative forms on damaged tissues, thereby reducing the structural damage caused by this effect. Beik et al. compared the pine-sensitizing effect of nanographene oxide and AuNPs. They noted that the ultrasound-induced heating of AuNPs was much higher than that of nanographene, which, in combination with vectors that can direct the nanoparticle to the tumor (for example, folic acid and peptide vectors), are promising for targeted sonodynamic therapy [158]. ChemEngineering 2021, 5, x FOR PEER REVIEW 12 of 25 as well as for its anti-vascular effect on the neovascular network of the tumor free radical nature the combined effect on the tumor Sonodynamic associated with the of ultrasound and chemical non- 1–10 0.5–2 MHz therapy (SDT) cavitation effects of medicinal compounds that enhance ultrasound the therapeutic effect The main application of nanoparticles in ultrasound therapy for cancer is reduced to the formation of bubbles on their rough surface, which causes evaporation in the environ- ment and, thereby, vapor cavities (Figure 7). The method of sonodynamic therapy seems to be very attractive because, owing to the high penetrating ability of ultrasound (up to ChemEngineering 2021, 5, 69 12 of 24 tens of centimeters, depending on the frequency), it allows acting on intensely localized tumors that are inaccessible for photodynamic therapy [152,153]. Figure 7. Schematic illustration of the cavitation effect in the eukaryotic cell, with a demonstration of Figure 7. Schematic illustration of the cavitation effect in the eukaryotic cell, with a demonstration ROS secretion and cell membrane rupture (created with BioRender.com). of ROS secretion and cell membrane rupture (created with BioRender.com). 6. Gold Nanoparticles as a Diagnostic Material Sonodynamic therapy uses the synergistic effect of a non-toxic and selective agent One of the promising areas of application of gold nanoparticles is the diagnosis (sensitizer). AuNPs can have tremendous therapeutic effects, together with SDT, through and theranostics of oncological diseases. Furthermore, AuNPs are a practical choice for biocompatibility, selectivity, and biodistribution [142]. An example of ultrasound therapy biosensors and bioimaging applications because of their unique light absorption and and AuNPs is the recovery after anti-cancer therapy involving active forms of oxygen- scattering properties. In addition, the electrochemical response of AuNPs can be used as a ROS. Victor et al. demonstrated that nanoparticles and therapeutic pulsed ultrasound re- detection signal [159]. duce the content of pro-inflammatory cytokines in tissues [154]. During the inflammatory Raman imaging, the technique that uses non-emitting electromagnetic waves (near-IR phase of the healing process, ultrasound can activate immune cells to migrate to the injury spectrum) to obtain a chemical composition from the Raman spectrum of a sample [159], site [155,156]. At the same time, gold compounds can suppress the expression of NF-κB is used to assess the chemical composition of cells and tissues in the body and, therefore, and other inflammatory responses [157]. AuNPs can play a positive role after therapy with is used to track any change in the chemical structure due to tumor formation. AuNPs ROS participation, because, in combination with pulsed ultrasound, they reduce the effect are used to diagnose cancer owing to their surface-enhanced Raman scattering (SERS) effect [160,161]. They can also be used for rapid intracellular Raman imaging, increasing the sensitivity and selectivity of the method and monitoring changes in cell morphology during toxic-induced cell death [162]. While Raman imaging methods are already successfully used in cancer diagno- sis [163–166], Raman imaging diagnostics using AuNPs allow noticing speciﬁc differences related to speciﬁc components, reﬂecting different levels of nucleic acids, proteins, and lipids in cancers and normal serum [167]. For example, in a study with people with various oral cavity diseases, AuNPs allowed obtaining high-quality SERS-spectra of oral squamous cell carcinoma (OSCC) proteins, thus showing their efﬁciency in the diagnostics of OSCC. Thus, the Raman imaging method with AuNPs allows accurately determining the chemical composition of tissues and, therefore, diagnosing diseases and their localization with a high degree of probability. However, the methods’ sensitivity and effectiveness still depend on many factors, such as stage of the disease, localization of the disease, and the use or absence of additional agents. Moreover, AuNPs used in combination with graphene oxide can be the next generation of nanotherapeutics, with the SERS signal from graphene oxide wrapped gold nanoparticles ChemEngineering 2021, 5, 69 13 of 24 being used for intracellular Raman imaging in cancer cells, while an anti-cancer drug, attached to the nanoparticle, is being delivered into the cells [168]. Photoacoustic imaging (PAI), a biomedical analysis technique that provides practical information about the molecular characteristics of tissue, is a newly developed hybrid method of biomedical imaging for monitoring tumor angiogenesis and detecting skin melanoma, as well as monitoring and diagnosing other various neoplasms. Gold nanopar- ticles of different shapes are used in PAI, a method based on the absorption of waves and the subsequent generation of ultrasonic signals. Gold nanoparticles have great potential for use as biocompatible contrast agents, as reviewed in the work of Li W. and Chen, X. They suggest that the potential of AuNPs is due to their inherent and geometrically induced optical properties [169]. Moreover, as AuNPs are responsive to acidic environments, they can be used as imaging agents. Furthermore, they have a cancer-speciﬁc accumulation at the cellular level, and can thus provide an ampliﬁed signal for imaging cancer cells [170]. Another critical step is diagnosing metastasis, and biocompatible gold nanoparticles can be used as a contrast agent in diagnosing lymph-node-related diseases and metastasis, as they usually spread through the lymphatic system [171]. Dark-ﬁeld microscopy, the type of microscopy in which the image contrast is increased by registering only the light scattered by the studied sample, provides a unique opportunity to research living and unstained biological samples in detail. Gold is one of the best markers for dark-ﬁeld microscopy, which, combined with the properties of nanoparticles, can be a unique system for diagnosing tumor markers and a detailed study of tumor cells. Gold nanoparticles can be used as non-bleaching markers in dark-ﬁeld microscopy. They are also used to analyze carbohydrate–protein interaction, correlated with biological processes, such as cancer metastasis, in a method based on a single plasmonic nanoparticle by conventional dark ﬁeld microscopy [172]. Qian W. et al. showed that peptide conjugated AuNPs could be delivered to the cytoplasmic or nuclear region of a cell and used as light scattering contrast agents, thus enabling to track the complete cycle of cancer cells from birth to division [173]. Moreover, AuNPs have been used as an internal reference to reduce the deviations and ﬂuctuations from the dark-ﬁeld microscopy technique and improve the precision of the acquired data through post-data analysis [174]. Computed tomography (CT), the non-destructive layer-by-layer examination of the internal structure of tissue using X-ray radiation, is used for cell imaging. However, a more accurate image is obtained by injecting a contrast agent intravenously in the diagnosis of tumor diseases. Cao Y. et al. showed that gold nanoparticles could be used as a nanoscale contrast agent, as they used their dendrimer-entrapped AuNPs for targeted CT imaging of hepatocellular carcinoma (HCC), and their ﬂow cytometry results revealed that dendrimer-entrapped gold nanoparticles modiﬁed with lactobionic acid could speciﬁcally target HepG2 cells [175]. Furthermore, an in vivo cell tracking method using gold nanoparticles was developed and tested using a melanoma-speciﬁc T-cell receptor labeled with AuNPs. The AuNPs-labeled T-cells were injected intravenously into mice and, with CT imaging, they were able to study the distribution, migration, and kinetics of T- cells [176]. Apart from CT, other molecular imaging techniques used in cancer diagnostics, such as magnetic resonance imaging (MRI), have also beneﬁted from the development of targeted contrast agents, such as gold nanoparticles, which enables targeted imaging via site-speciﬁc accumulation of nanoparticles in the cells of interest [177,178]. In addition to the traditional diagnostic methods, various diagnostic and theranostics systems based on gold nanoparticles are currently being created, like a highly sensitive method for amplifying an enzyme signal using gold nanoparticles to detect a speciﬁc antigen in human serum. In addition, a smartphone application was developed for quick analysis of the results within 15 min, displaying them on the smartphone screen [179]. In addition, AuNPs are also used as carriers of the biorecognition of antibody aKLK3 and HRP-streptavidin/biotinylated poly-A-ssDNA sequences for the speciﬁc and sensitive analysis of KLK3, an important marker for the diagnosis of prostate cancer [180–182]. ChemEngineering 2021, 5, 69 14 of 24 A DNA biosensor based on a hybrid material consisting of graphene oxide and gold nanoparticles (Figure 8) was developed. It uses a sandwich hybridization assay by immo- bilizing a DNA probe on gold nanoparticles and capturing target DNA biomarkers [183]. The device is based on electrochemical DNA interactions, and its signal is measured by amperometric detection [184,185]. Using amperometric detection, breast cancer biomarkers were obtained with a sensitivity of 378 nA/nM and 219 nA/nM for the target ERBB2 and CD24, respectively, which is several times higher than the target content of these ChemEngineering 2021, 5, x FOR PEER REVIEW 15 of 25 compounds in the tumor [186]. Figure 8. Schematic illustration of a DNA sensor showing the hybrid material consisting of graphene Figure 8. Schematic illustration of a DNA sensor showing the hybrid material consisting of graphene oxide and gold nanoparticles and the hybridization of target DNA [183]. oxide and gold nanoparticles and the hybridization of target DNA [183]. 7. Current Major Restrictions on the Use of Gold Nanoparticles for Medical Purposes One of the most challenging tumor diseases to diagnose is brain cancer, but now, diagnostic 7.1. Toxicitand y: Safe theranostic ty Test systems based on gold nanoparticles are being actively created, as reviewed by Meola A. et al. [187]. Currently, there are several standard methods for assessing the toxicity/safety of na- noparticles in vitro. In addition, researchers have developed recommendations for deter- mining the toxicity of various nanoparticles [188]. However, these techniques are individ- ual for each type of nanoparticle and cannot be applied to more complex or hybrid mate- rials. This leads to uncertain and unpredictable results for real objects, leading to a lack of therapeutic/diagnostic action or being more detrimental to the body. As mentioned in the section on the effect of shape and size on the biological proper- ties of nanoparticles, there are a considerable number of factors affecting the toxicity of nanoparticles (size, shape, surface charge, and capping agents), and this complicates the possibility of developing an appropriate method for determining toxicity. In addition, it was reported that the toxicity does not depend only on the type of nanoparticles, but also on the target. For different tumor cells, the effect of gold nanoparticles occurs at different ChemEngineering 2021, 5, 69 15 of 24 In conclusion, AuNPs possess a unique structure that can be actively used both as a carrier of test systems and as a signal source for the diagnosis of tumor markers and an excellent contrast agent for various diagnostic methods currently used. 7. Current Major Restrictions on the Use of Gold Nanoparticles for Medical Purposes 7.1. Toxicity: Safety Test Currently, there are several standard methods for assessing the toxicity/safety of nanoparticles in vitro. In addition, researchers have developed recommendations for determining the toxicity of various nanoparticles [188]. However, these techniques are individual for each type of nanoparticle and cannot be applied to more complex or hybrid materials. This leads to uncertain and unpredictable results for real objects, leading to a lack of therapeutic/diagnostic action or being more detrimental to the body. As mentioned in the section on the effect of shape and size on the biological properties of nanoparticles, there are a considerable number of factors affecting the toxicity of nanopar- ticles (size, shape, surface charge, and capping agents), and this complicates the possibility of developing an appropriate method for determining toxicity. In addition, it was reported that the toxicity does not depend only on the type of nanoparticles, but also on the target. For different tumor cells, the effect of gold nanoparticles occurs at different concentrations. In this regard, it can be concluded that it is necessary to create several universal procedures (similar to GLP) that allow assessing the safety of nanoparticles in each speciﬁc case, which will be used for all similar objects around the world (personalized) [188–190]. 7.2. Adsorption from Physiological Media Size, developed surface, shape, and charge contribute to the adsorption of the protein on the surface of nanoparticles. Consequently, this leads to a change in physicochemical parameters and, thereby, worsens the therapeutic properties. Therefore, the development of new agents that would modify the surface could help realistically evaluate the properties of nanoparticles by their physicochemical properties [191]. In addition, several delivery methods that consider the formation of the corona protein and allow it to be used for various purposes are being developed [192,193]. 7.3. Pharmacodynamics: Pharmacokinetics Even though studies on gold nanoparticles are very relevant, there have still not been comprehensive studies on their kinetics, clearance, and biodistribution inside the organism. The lack of studies on the pharmacokinetics of gold nanoparticles inside the human body limits the possibility of the massive use of gold nanoparticles in treating tumor diseases. Analysis of these parameters is complicated by the difﬁculty of determining nanoparticles’ distribution in the organism, as experiments in vivo and in vitro do not give a complete picture of the biodistribution of nanoparticles within the organism. It is important to note that gold nanoparticles are a convenient object for studying inside the organism, compared with other nano-objects, owing to surface plasma resonance and a high extinction coefﬁcient [194]. 7.4. Low Efﬁciency Wilhelm S. et al. studied the nanoparticles’ delivery to tumors and found that, on average, only 0.7% of nanoparticles reach the cancer cells, and only in exceptional cases, nanoparticles reach the tumors in more than 5%. Furthermore, when nanoparticles are injected, the mononuclear phagocytic system (MPS) and the renal clearance pathway absorb most of the nanoparticles, drastically reducing the effectiveness and harming the MPS organs [195]. 7.5. Lack of Clinical Trials There are currently few clinical trials using gold nanoparticles (around 15 studies in https://clinicaltrials.gov (accessed on 5 September 2021 )), which do not yet allow ChemEngineering 2021, 5, 69 16 of 24 comprehensive research on various factors and indicators (clearance, biodistribution, and protein sorption), and thus limit the use of nanoparticles in medical practice. The onset of clinical trials could expand and clarify the therapeutic and diagnostic potential of nanoparticles. Still, they should be carried out after comprehensive safety and toxicity tests of these nanoparticles [196]. 8. Conclusions Cancer remains the most common cause of death currently. Hence, there is a need to develop new and improved cancer treatment and diagnosis, which requires new and modern approaches, and AuNPs can become one of these new approaches. Although there have been several scientiﬁc studies on NPs’ application in cancer medicine, studies on AuNPs’ use in cancer therapy and diagnostics are emerging. Therefore, in this review, we analyzed available data on the applications of AuNPs in oncotherapy and cancer diagnos- tics. Studies have shown that, while shape, size, and charge have a considerable impact on the properties of AuNPs, no direct correlation was found between those parameters and the effectiveness of AuNPs’ use in therapy. Moreover, for each type of tumor disease, a per- sonalized approach is required to establish the optimal physical and chemical parameters of AuNPs that will ensure maximum efﬁciency and safety. In therapy, AuNPs can effectively be used as delivery systems for various molecules, including high-molecular compounds. They can also be used as auxiliary agents for sonochemistry and sensitizers for photodynamic therapy. Thanks to their physicochemical properties, they are a very promising sensitizer for these therapeutic methods, which are most relevant for treating skin cancer, as they are highly effective and safe. In addition, AuNPs play a special role in the diagnosis and theranostics of tumor diseases, with several methods already developed for the diagnosis of diseases successfully using AuNPs as auxiliary agents and sensitizers. AuNPs and their hybrid materials derivatives are very promising components that will soon help in the early diagnosis of tumor markers. Although the beneﬁts of AuNPs in cancer medicine are visible, there remain several constraints that need to be studied, analyzed, and solved before any large-scale use of gold nanoparticles in the therapy and diagnosis of cancer, along with traditional drugs. Author Contributions: Methodology, A.A.V.; writing—original draft preparation, A.A.V. and P.K.; writing—review and editing, M.G.H.R., A.A.K. and Y.M.S. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Acknowledgments: This paper was supported by the RUDN University Strategic Academic Leader- ship Program. Conﬂicts of Interest: The authors declare no conﬂict of interest. References 1. World Health Organization. WHO Report on Cancer: Setting Priorities, Investing Wisely and Providing Care for All; World Health Organization: Geneva, Switzerland, 2020; ISBN 9789240001299. 2. Abdel-Qadir, H.; Austin, P.C.; Lee, D.S.; Amir, E.; Tu, J.V.; Thavendiranathan, P.; Fung, K.; Anderson, G.M. A Population-Based Study of Cardiovascular Mortality Following Early-Stage Breast Cancer. JAMA Cardiol. 2017, 2, 88–93. [CrossRef] [PubMed] 3. Sud, A.; Kinnersley, B.; Houlston, R.S. Genome-Wide Association Studies of Cancer: Current Insights and Future Perspectives. Nat. Rev. Cancer 2017, 17, 692–704. [CrossRef] [PubMed] 4. Global Burden of Disease Cancer Collaboration Global, Regional, and National Cancer Incidence, Mortality, Years of Life Lost, Years Lived with Disability, and Disability-Adjusted Life-Years for 29 Cancer Groups, 1990 to 2016: A Systematic Analysis for the Global Burden of Disease Study. JAMA Oncol. 2018, 4, 1553–1568. [CrossRef] ChemEngineering 2021, 5, 69 17 of 24 5. Cibula, D.; Pötter, R.; Planchamp, F.; Avall-Lundqvist, E.; Fischerova, D.; Haie-Meder, C.; Köhler, C.; Landoni, F.; Lax, S.; Linde- gaard, J.C.; et al. The European Society of Gynaecological Oncology/European Society for Radiotherapy and Oncology/European Society of Pathology Guidelines for the Management of Patients with Cervical Cancer. Virchows Arch. 2018, 472, 919–936. [CrossRef] 6. Tu, H.; Wen, C.P.; Tsai, S.P.; Chow, W.-H.; Wen, C.; Ye, Y.; Zhao, H.; Tsai, M.K.; Huang, M.; Dinney, C.P.; et al. Cancer Risk Associated with Chronic Diseases and Disease Markers: Prospective Cohort Study. BMJ 2018, 360, k134. [CrossRef] 7. Palesh, O.; Scheiber, C.; Kesler, S.; Mustian, K.; Koopman, C.; Schapira, L. Management of Side Effects during and Post-Treatment in Breast Cancer Survivors. Breast J. 2018, 24, 167–175. [CrossRef] 8. Zaorsky, N.G.; Churilla, T.M.; Egleston, B.L.; Fisher, S.G.; Ridge, J.A.; Horwitz, E.M.; Meyer, J.E. Causes of Death among Cancer Patients. Ann. Oncol. 2017, 28, 400–407. [CrossRef] 9. Yarchoan, R.; Uldrick, T.S. HIV-Associated Cancers and Related Diseases. N. Engl. J. Med. 2018, 378, 1029–1041. [CrossRef] 10. Tocut, M.; Brenner, R.; Zandman-Goddard, G. Autoimmune Phenomena and Disease in Cancer Patients Treated with Immune Checkpoint Inhibitors. Autoimmun. Rev. 2018, 17, 610–616. [CrossRef] 11. Delaunay, M.; Cadranel, J.; Lusque, A.; Meyer, N.; Gounant, V.; Moro-Sibilot, D.; Michot, J.-M.; Raimbourg, J.; Girard, N.; Guisier, F.; et al. Immune-Checkpoint Inhibitors Associated with Interstitial Lung Disease in Cancer Patients. Eur. Respir. J. 2017, 50, 1700050. [CrossRef] 12. Curigliano, G.; Lenihan, D.; Fradley, M.; Ganatra, S.; Barac, A.; Blaes, A.; Herrmann, J.; Porter, C.; Lyon, A.R.; Lancellotti, P.; et al. Management of Cardiac Disease in Cancer Patients throughout Oncological Treatment: ESMO Consensus Recommendations. Ann. Oncol. 2020, 31, 171–190. [CrossRef] [PubMed] 13. Pearman, T.P.; Beaumont, J.L.; Mroczek, D.; O’Connor, M.; Cella, D. Validity and Usefulness of a Single-Item Measure of Patient-Reported Bother from Side Effects of Cancer Therapy. Cancer 2018, 124, 991–997. [CrossRef] 14. Pearce, A.; Haas, M.; Viney, R.; Pearson, S.-A.; Haywood, P.; Brown, C.; Ward, R. Incidence and Severity of Self-Reported Chemotherapy Side Effects in Routine Care: A Prospective Cohort Study. PLoS ONE 2017, 12, e0184360. [CrossRef] 15. Demaria, M.; O’Leary, M.N.; Chang, J.; Shao, L.; Liu, S.; Alimirah, F.; Koenig, K.; Le, C.; Mitin, N.; Deal, A.M.; et al. Cellular Senescence Promotes Adverse Effects of Chemotherapy and Cancer Relapse. Cancer Discov. 2017, 7, 165–176. [CrossRef] 16. Ariza-Garcia, A.; Lozano-Lozano, M.; Galiano-Castillo, N.; Postigo-Martin, P.; Arroyo-Morales, M.; Cantarero-Villanueva, I. A Web-Based Exercise System (e-CuidateChemo) to Counter the Side Effects of Chemotherapy in Patients with Breast Cancer: Randomized Controlled Trial. J. Med. Internet Res. 2019, 21, e14418. [CrossRef] 17. Carlson, L.E.; Subnis, U.B.; Piedalue, K.-A.L.; Vallerand, J.; Speca, M.; Lupichuk, S.; Tang, P.; Faris, P.; Wolever, R.Q. The ONE-MIND Study: Rationale and Protocol for Assessing the Effects of ONlinE MINDfulness-Based Cancer Recovery for the Prevention of Fatigue and Other Common Side Effects during Chemotherapy. Eur. J. Cancer Care 2019, 28, e13074. [CrossRef] 18. Gegechkori, N.; Haines, L.; Lin, J.J. Long-Term and Latent Side Effects of Speciﬁc Cancer Types. Med. Clin. N. Am. 2017, 101, 1053–1073. [CrossRef] [PubMed] 19. McGowan, J.V.; Chung, R.; Maulik, A.; Piotrowska, I.; Walker, J.M.; Yellon, D.M. Anthracycline Chemotherapy and Cardiotoxicity. Cardiovasc. Drugs Ther. 2017, 31, 63–75. [CrossRef] 20. Mostafavi, E.; Soltantabar, P.; Webster, T.J. Nanotechnology and picotechnology. In Biomaterials in Translational Medicine; Elsevier: Amsterdam, The Netherlands, 2019; pp. 191–212. ISBN 9780128134771. 21. Chen, S.; Li, R.; Li, X.; Xie, J. Electrospinning: An Enabling Nanotechnology Platform for Drug Delivery and Regenerative Medicine. Adv. Drug Deliv. Rev. 2018, 132, 188–213. [CrossRef] [PubMed] 22. Abadeer, N.S.; Murphy, C.J. Recent Progress in Cancer Thermal Therapy Using Gold Nanoparticles. J. Phys. Chem. C Nanomater. Interfaces 2016, 120, 4691–4716. [CrossRef] 23. Song, W.; Anselmo, A.C.; Huang, L. Nanotechnology Intervention of the Microbiome for Cancer Therapy. Nat. Nanotechnol. 2019, 14, 1093–1103. [CrossRef] [PubMed] 24. Riaz, M.K.; Riaz, M.A.; Zhang, X.; Lin, C.; Wong, K.H.; Chen, X.; Zhang, G.; Lu, A.; Yang, Z. Surface Functionalization and Targeting Strategies of Liposomes in Solid Tumor Therapy: A Review. Int. J. Mol. Sci. 2018, 19, 195. [CrossRef] [PubMed] 25. Wang, Z.; Deng, X.; Ding, J.; Zhou, W.; Zheng, X.; Tang, G. Mechanisms of Drug Release in pH-Sensitive Micelles for Tumour Targeted Drug Delivery System: A Review. Int. J. Pharm. 2018, 535, 253–260. [CrossRef] [PubMed] 26. Tao, W.; Ji, X.; Xu, X.; Islam, M.A.; Li, Z.; Chen, S.; Saw, P.E.; Zhang, H.; Bharwani, Z.; Guo, Z.; et al. Antimonene Quantum Dots: Synthesis and Application as near-Infrared Photothermal Agents for Effective Cancer Therapy. Angew. Chem. Weinh. Bergstr. Ger. 2017, 129, 12058–12062. [CrossRef] 27. Palmerston Mendes, L.; Pan, J.; Torchilin, V.P. Dendrimers as Nanocarriers for Nucleic Acid and Drug Delivery in Cancer Therapy. Molecules 2017, 22, 1401. [CrossRef] 28. Jia, Q.; Ge, J.; Liu, W.; Zheng, X.; Wang, M.; Zhang, H.; Wang, P. Biocompatible Iron Phthalocyanine-Albumin Assemblies as Photoacoustic and Thermal Theranostics in Living Mice. ACS Appl. Mater. Interfaces 2017, 9, 21124–21132. [CrossRef] 29. Wang, P.; Zhang, L.; Zheng, W.; Cong, L.; Guo, Z.; Xie, Y.; Wang, L.; Tang, R.; Feng, Q.; Hamada, Y.; et al. Thermo-Triggered Release of CRISPR-Cas9 System by Lipid-Encapsulated Gold Nanoparticles for Tumor Therapy. Angew. Chem. Int. Ed. Engl. 2018, 57, 1491–1496. [CrossRef] 30. Daraee, H.; Eatemadi, A.; Abbasi, E.; Fekri Aval, S.; Kouhi, M.; Akbarzadeh, A. Application of Gold Nanoparticles in Biomedical and Drug Delivery. Artif. Cells Nanomed. Biotechnol. 2016, 44, 410–422. [CrossRef] ChemEngineering 2021, 5, 69 18 of 24 31. Cai, Y.; Liang, P.; Tang, Q.; Yang, X.; Si, W.; Huang, W.; Zhang, Q.; Dong, X. Diketopyrrolopyrrole-Triphenylamine Organic Nanoparticles as Multifunctional Reagents for Photoacoustic Imaging-Guided Photodynamic/Photothermal Synergistic Tumor Therapy. ACS Nano 2017, 11, 1054–1063. [CrossRef] 32. Aghebati-Maleki, A.; Dolati, S.; Ahmadi, M.; Baghbanzhadeh, A.; Asadi, M.; Fotouhi, A.; Youseﬁ, M.; Aghebati-Maleki, L. Nanoparticles and Cancer Therapy: Perspectives for Application of Nanoparticles in the Treatment of Cancers. J. Cell. Physiol. 2020, 235, 1962–1972. [CrossRef] 33. Xuan, M.; Shao, J.; Zhao, J.; Li, Q.; Dai, L.; Li, J. Magnetic Mesoporous Silica Nanoparticles Cloaked by Red Blood Cell Membranes: Applications in Cancer Therapy. Angew. Chem. Int. Ed. Engl. 2018, 57, 6049–6053. [CrossRef] [PubMed] 34. Mishra, H.; Mishra, P.K.; Ekielski, A.; Jaggi, M.; Iqbal, Z.; Talegaonkar, S. Melanoma Treatment: From Conventional to Nanotech- nology. J. Cancer Res. Clin. Oncol. 2018, 144, 2283–2302. [CrossRef] [PubMed] 35. Candido, N.M.; de Melo, M.T.; Franchi, L.P.; Primo, F.L.; Tedesco, A.C.; Rahal, P.; Calmon, M.F. Combining Photodynamic Therapy and Chemotherapy: Improving Breast Cancer Treatment with Nanotechnology. J. Biomed. Nanotechnol. 2018, 14, 994–1008. [CrossRef] [PubMed] 36. Janicka, M.; Gubernator, J. Use of Nanotechnology for Improved Pharmacokinetics and Activity of Immunogenic Cell Death Inducers Used in Cancer Chemotherapy. Expert Opin. Drug Deliv. 2017, 14, 1059–1075. [CrossRef] 37. Zhao, C.-Y.; Cheng, R.; Yang, Z.; Tian, Z.-M. Nanotechnology for Cancer Therapy Based on Chemotherapy. Molecules 2018, 23, 826. [CrossRef] 38. Falagan-Lotsch, P.; Grzincic, E.M.; Murphy, C.J. New Advances in Nanotechnology-Based Diagnosis and Therapeutics for Breast Cancer: An Assessment of Active-Targeting Inorganic Nanoplatforms. Bioconjug. Chem. 2017, 28, 135–152. [CrossRef] 39. Matos, A.I.; Carreira, B.; Peres, C.; Moura, L.I.F.; Conniot, J.; Fourniols, T.; Scomparin, A.; Martínez-Barriocanal, Á.; Arango, D.; Conde, J.P.; et al. Nanotechnology Is an Important Strategy for Combinational Innovative Chemo-Immunotherapies against Colorectal Cancer. J. Control. Release 2019, 307, 108–138. [CrossRef] 40. Pillai, G. Nanotechnology toward treating cancer. In Applications of Targeted Nano Drugs and Delivery Systems; Elsevier: Amsterdam, The Netherlands, 2019; pp. 221–256. ISBN 9780128140291. 41. Sielaff, C.M.; Mousa, S.A. Status and Future Directions in the Management of Pancreatic Cancer: Potential Impact of Nanotech- nology. J. Cancer Res. Clin. Oncol. 2018, 144, 1205–1217. [CrossRef] 42. Song, G.; Cheng, L.; Chao, Y.; Yang, K.; Liu, Z. Emerging Nanotechnology and Advanced Materials for Cancer Radiation Therapy. Adv. Mater. 2017, 29, 1604894. [CrossRef] 43. Deng, H.; Zhang, Z. The Application of Nanotechnology in Immune Checkpoint Blockade for Cancer Treatment. J. Control. Release 2018, 290, 28–45. [CrossRef] 44. Cryer, A.M.; Thorley, A.J. Nanotechnology in the Diagnosis and Treatment of Lung Cancer. Pharmacol. Ther. 2019, 198, 189–205. [CrossRef] [PubMed] 45. Yang, X.; Yang, M.; Pang, B.; Vara, M.; Xia, Y. Gold Nanomaterials at Work in Biomedicine. Chem. Rev. 2015, 115, 10410–10488. [CrossRef] [PubMed] 46. Dreaden, E.C.; Alkilany, A.M.; Huang, X.; Murphy, C.J.; El-Sayed, M.A. The Golden Age: Gold Nanoparticles for Biomedicine. Chem. Soc. Rev. 2012, 41, 2740–2779. [CrossRef] [PubMed] 47. Beik, J.; Khateri, M.; Khosravi, Z.; Kamrava, S.K.; Kooranifar, S.; Ghaznavi, H.; Shakeri-Zadeh, A. Gold Nanoparticles in Combinatorial Cancer Therapy Strategies. Coord. Chem. Rev. 2019, 387, 299–324. [CrossRef] 48. Maeda, H.; Wu, J.; Sawa, T.; Matsumura, Y.; Hori, K. Tumor Vascular Permeability and the EPR Effect in Macromolecular Therapeutics: A Review. J. Control. Release 2000, 65, 271–284. [CrossRef] 49. Singh, P.; Pandit, S.; Mokkapati, V.R.S.S.; Garg, A.; Ravikumar, V.; Mijakovic, I. Gold Nanoparticles in Diagnostics and Therapeutics for Human Cancer. Int. J. Mol. Sci. 2018, 19, 1979. [CrossRef] 50. Wei, Y.; Quan, L.; Zhou, C.; Zhan, Q. Factors Relating to the Biodistribution & Clearance of Nanoparticles & Their Effects on in Vivo Application. Nanomedicine 2018, 13, 1495–1512. [CrossRef] 51. Angelov, B.; Angelova, A.; Filippov, S.K.; Drechsler, M.; Štep ˇ ánek, P.; Lesieur, S. Multicompartment Lipid Cubic Nanoparticles with High Protein Upload: Millisecond Dynamics of Formation. ACS Nano 2014, 8, 5216–5226. [CrossRef] 52. Dou, Y.; Yang, X. Novel High-Sensitive Fluorescent Detection of Deoxyribonuclease I Based on DNA-Templated Gold/silver Nanoclusters. Anal. Chim. Acta 2013, 784, 53–58. [CrossRef] 53. Weadick, D.S.; Liu, J. Phosphorothioate DNA Stabilized Fluorescent Gold and Silver Nanoclusters. Nanomaterials 2015, 5, 804–813. [CrossRef] 54. Lee, Y.J.; Ahn, E.-Y.; Park, Y. Shape-Dependent Cytotoxicity and Cellular Uptake of Gold Nanoparticles Synthesized Using Green Tea Extract. Nanoscale Res. Lett. 2019, 14, 129. [CrossRef] [PubMed] 55. Xie, X.; Liao, J.; Shao, X.; Li, Q.; Lin, Y. The Effect of Shape on Cellular Uptake of Gold Nanoparticles in the Forms of Stars, Rods, and Triangles. Sci. Rep. 2017, 7, 3827. [CrossRef] [PubMed] 56. Scarabelli, L.; Coronado-Puchau, M.; Giner-Casares, J.J.; Langer, J.; Liz-Marzán, L.M. Monodisperse Gold Nanotriangles: Size Control, Large-Scale Self-Assembly, and Performance in Surface-Enhanced Raman Scattering. ACS Nano 2014, 8, 5833–5842. [CrossRef] [PubMed] 57. Sironi, L.; Freddi, S.; Caccia, M.; Pozzi, P.; Rossetti, L.; Pallavicini, P.; Donà, A.; Cabrini, E.; Gualtieri, M.; Rivolta, I.; et al. Gold Branched Nanoparticles for Cellular Treatments. J. Phys. Chem. C Nanomater. Interfaces 2012, 116, 18407–18418. [CrossRef] ChemEngineering 2021, 5, 69 19 of 24 58. Steckiewicz, K.P.; Barcinska, E.; Malankowska, A.; Zauszkiewicz-Pawlak, A.; Nowaczyk, G.; Zaleska-Medynska, A.; Inkielewicz- Stepniak, I. Impact of Gold Nanoparticles Shape on Their Cytotoxicity against Human Osteoblast and Osteosarcoma in in Vitro Model. Evaluation of the Safety of Use and Anti-Cancer Potential. J. Mater. Sci. Mater. Med. 2019, 30, 22. [CrossRef] [PubMed] 59. Suchomel, P.; Kvitek, L.; Prucek, R.; Panacek, A.; Halder, A.; Vajda, S.; Zboril, R. Simple Size-Controlled Synthesis of Au Nanoparticles and Their Size-Dependent Catalytic Activity. Sci. Rep. 2018, 8, 4589. [CrossRef] 60. Xu, M.; Soliman, M.G.; Sun, X.; Pelaz, B.; Feliu, N.; Parak, W.J.; Liu, S. How Entanglement of Different Physicochemical Properties Complicates the Prediction of in Vitro and in Vivo Interactions of Gold Nanoparticles. ACS Nano 2018, 12, 10104–10113. [CrossRef] 61. Tenzer, S.; Docter, D.; Rosfa, S.; Wlodarski, A.; Kuharev, J.; Rekik, A.; Knauer, S.K.; Bantz, C.; Nawroth, T.; Bier, C.; et al. Nanoparticle Size Is a Critical Physicochemical Determinant of the Human Blood Plasma Corona: A Comprehensive Quantitative Proteomic Analysis. ACS Nano 2011, 5, 7155–7167. [CrossRef] 62. Walkey, C.D.; Olsen, J.B.; Song, F.; Liu, R.; Guo, H.; Olsen, D.W.H.; Cohen, Y.; Emili, A.; Chan, W.C.W. Protein Corona Fingerprinting Predicts the Cellular Interaction of Gold and Silver Nanoparticles. ACS Nano 2014, 8, 2439–2455. [CrossRef] 63. Rozengurt, E.; Heppel, L.A. A Speciﬁc Effect of External ATP on the Permeability of Transformed 3T3 Cells. Biochem. Biophys. Res. Commun. 1975, 67, 1581–1588. [CrossRef] 64. Liu, H.; Pierre-Pierre, N.; Huo, Q. Dynamic Light Scattering for Gold Nanorod Size Characterization and Study of Nanorod– protein Interactions. Gold Bull. 2012, 45, 187–195. [CrossRef] 65. Duncan, B.; Kim, C.; Rotello, V.M. Gold Nanoparticle Platforms as Drug and Biomacromolecule Delivery Systems. J. Control. Release 2010, 148, 122–127. [CrossRef] 66. Love, J.C.; Estroff, L.A.; Kriebel, J.K.; Nuzzo, R.G.; Whitesides, G.M. Self-Assembled Monolayers of Thiolates on Metals as a Form of Nanotechnology. Chem. Rev. 2005, 105, 1103–1169. [CrossRef] 67. Hostetler, M.J.; Wingate, J.E.; Zhong, C.-J.; Harris, J.E.; Vachet, R.W.; Clark, M.R.; Londono, J.D.; Green, S.J.; Stokes, J.J.; Wignall, G.D.; et al. Alkanethiolate Gold Cluster Molecules with Core Diameters from 1.5 to 5.2 Nm: Core and Monolayer Properties as a Function of Core Size. Langmuir 1998, 14, 17–30. [CrossRef] 68. Rana, S.; Bajaj, A.; Mout, R.; Rotello, V.M. Monolayer Coated Gold Nanoparticles for Delivery Applications. Adv. Drug Deliv. Rev. 2012, 64, 200–216. [CrossRef] 69. Perrault, S.D.; Walkey, C.; Jennings, T.; Fischer, H.C.; Chan, W.C.W. Mediating Tumor Targeting Efﬁciency of Nanoparticles through Design. Nano Lett. 2009, 9, 1909–1915. [CrossRef] [PubMed] 70. Maeda, H.; Nakamura, H.; Fang, J. The EPR Effect for Macromolecular Drug Delivery to Solid Tumors: Improvement of Tumor Uptake, Lowering of Systemic Toxicity, and Distinct Tumor Imaging in Vivo. Adv. Drug Deliv. Rev. 2013, 65, 71–79. [CrossRef] 71. Park, J.; Choi, Y.; Chang, H.; Um, W.; Ryu, J.H.; Kwon, I.C. Alliance with EPR Effect: Combined Strategies to Improve the EPR Effect in the Tumor Microenvironment. Theranostics 2019, 9, 8073–8090. [CrossRef] [PubMed] 72. Pérez-Ortiz, M.; Zapata-Urzúa, C.; Acosta, G.A.; Álvarez-Lueje, A.; Albericio, F.; Kogan, M.J. Gold Nanoparticles as an Efﬁcient Drug Delivery System for GLP-1 Peptides. Colloids Surf. B Biointerfaces 2017, 158, 25–32. [CrossRef] [PubMed] 73. He, B.; Yang, D.; Qin, M.; Zhang, Y.; He, B.; Dai, W.; Wang, X.; Zhang, Q.; Zhang, H.; Yin, C. Increased Cellular Uptake of Peptide-Modiﬁed PEGylated Gold Nanoparticles. Biochem. Biophys. Res. Commun. 2017, 494, 339–345. [CrossRef] 74. Halamoda-Kenzaoui, B.; Ceridono, M.; Urbán, P.; Bogni, A.; Ponti, J.; Gioria, S.; Kinsner-Ovaskainen, A. The Agglomeration State of Nanoparticles Can Inﬂuence the Mechanism of Their Cellular Internalisation. J. Nanobiotechnol. 2017, 15, 48. [CrossRef] 75. Odhner, J.H.; Moore Tibbetts, K.; Tangeysh, B.; Wayland, B.B.; Levis, R.J. Mechanism of Improved Au Nanoparticle Size Distributions Using Simultaneous Spatial and Temporal Focusing for Femtosecond Laser Irradiation of Aqueous KAuCl4. J. Phys. Chem. C Nanomater. Interfaces 2014, 118, 23986–23995. [CrossRef] 76. Zhang, S.; Gao, H.; Bao, G. Physical Principles of Nanoparticle Cellular Endocytosis. ACS Nano 2015, 9, 8655–8671. [CrossRef] 77. Nakase, I.; Niwa, M.; Takeuchi, T.; Sonomura, K.; Kawabata, N.; Koike, Y.; Takehashi, M.; Tanaka, S.; Ueda, K.; Simpson, J.C.; et al. Cellular Uptake of Arginine-Rich Peptides: Roles for Macropinocytosis and Actin Rearrangement. Mol. Ther. 2004, 10, 1011–1022. [CrossRef] 78. Kapur, A.; Medina, S.H.; Wang, W.; Palui, G.; Schneider, J.P.; Mattoussi, H. Intracellular Delivery of Gold Nanocolloids Promoted by a Chemically Conjugated Anticancer Peptide. ACS Omega 2018, 3, 12754–12762. [CrossRef] 79. Gaspar, D.; Veiga, A.S.; Sinthuvanich, C.; Schneider, J.P.; Castanho, M.A.R.B. Anticancer Peptide SVS-1: Efﬁcacy Precedes Membrane Neutralization. Biochemistry 2012, 51, 6263–6265. [CrossRef] 80. Sinthuvanich, C.; Veiga, A.S.; Gupta, K.; Gaspar, D.; Blumenthal, R.; Schneider, J.P. Anticancer -Hairpin Peptides: Membrane- Induced Folding Triggers Activity. J. Am. Chem. Soc. 2012, 134, 6210–6217. [CrossRef] [PubMed] 81. Giljohann, D.A.; Seferos, D.S.; Daniel, W.L.; Massich, M.D.; Patel, P.C.; Mirkin, C.A. Gold Nanoparticles for Biology and Medicine. Angew. Chem. Int. Ed. Engl. 2010, 49, 3280–3294. [CrossRef] [PubMed] 82. Patel, P.C.; Giljohann, D.A.; Daniel, W.L.; Zheng, D.; Prigodich, A.E.; Mirkin, C.A. Scavenger Receptors Mediate Cellular Uptake of Polyvalent Oligonucleotide-Functionalized Gold Nanoparticles. Bioconjug. Chem. 2010, 21, 2250–2256. [CrossRef] [PubMed] 83. McIntosh, C.M.; Esposito, E.A., 3rd; Boal, A.K.; Simard, J.M.; Martin, C.T.; Rotello, V.M. Inhibition of DNA Transcription Using Cationic Mixed Monolayer Protected Gold Clusters. J. Am. Chem. Soc. 2001, 123, 7626–7629. [CrossRef] 84. Sandhu, K.K.; McIntosh, C.M.; Simard, J.M.; Smith, S.W.; Rotello, V.M. Gold Nanoparticle-Mediated Transfection of Mammalian Cells. Bioconjug. Chem. 2002, 13, 3–6. [CrossRef] ChemEngineering 2021, 5, 69 20 of 24 85. Ding, Y.; Jiang, Z.; Saha, K.; Kim, C.S.; Kim, S.T.; Landis, R.F.; Rotello, V.M. Gold Nanoparticles for Nucleic Acid Delivery. Mol. Ther. 2014, 22, 1075–1083. [CrossRef] 86. Kunoh, T.; Takeda, M.; Matsumoto, S.; Suzuki, I.; Takano, M.; Kunoh, H.; Takada, J. Green Synthesis of Gold Nanoparticles Coupled with Nucleic Acid Oxidation. ACS Sustain. Chem. Eng. 2018, 6, 364–373. [CrossRef] 87. Labala, S.; Mandapalli, P.K.; Kurumaddali, A.; Venuganti, V.V.K. Layer-by-Layer Polymer Coated Gold Nanoparticles for Topical Delivery of Imatinib Mesylate to Treat Melanoma. Mol. Pharm. 2015, 12, 878–888. [CrossRef] [PubMed] 88. Labala, S.; Jose, A.; Chawla, S.R.; Khan, M.S.; Bhatnagar, S.; Kulkarni, O.P.; Venuganti, V.V.K. Effective Melanoma Cancer Suppression by Iontophoretic Co-Delivery of STAT3 siRNA and Imatinib Using Gold Nanoparticles. Int. J. Pharm. 2017, 525, 407–417. [CrossRef] [PubMed] 89. Kwong, L.N.; Davies, M.A. Targeted Therapy for Melanoma: Rational Combinatorial Approaches. Oncogene 2014, 33, 1–9. [CrossRef] [PubMed] 90. Deng, R.; Ji, B.; Yu, H.; Bao, W.; Yang, Z.; Yu, Y.; Cui, Y.; Du, Y.; Song, M.; Liu, S.; et al. Multifunctional Gold Nanoparticles Overcome MicroRNA Regulatory Network Mediated-Multidrug Resistant Leukemia. Sci. Rep. 2019, 9, 5348. [CrossRef] 91. Lynn, R.C.; Poussin, M.; Kalota, A.; Feng, Y.; Low, P.S.; Dimitrov, D.S.; Powell, D.J., Jr. Targeting of Folate Receptor on Acute Myeloid Leukemia Blasts with Chimeric Antigen Receptor-Expressing T Cells. Blood 2015, 125, 3466–3476. [CrossRef] [PubMed] 92. Peng, Y.; Zhao, Z.; Liu, T.; Li, X.; Hu, X.; Wei, X.; Zhang, X.; Tan, W. Smart Human-Serum-Albumin-As O Nanodrug with Self-Ampliﬁed Folate Receptor-Targeting Ability for Chronic Myeloid Leukemia Treatment. Angew. Chem. Int. Ed. Engl. 2017, 56, 10845–10849. [CrossRef] 93. Shang, Y.; Zhang, Z.; Liu, Z.; Feng, B.; Ren, G.; Li, K.; Zhou, L.; Sun, Y.; Li, M.; Zhou, J.; et al. miR-508-5p Regulates Multidrug Resistance of Gastric Cancer by Targeting ABCB1 and ZNRD1. Oncogene 2014, 33, 3267–3276. [CrossRef] 94. Zhao, X.; Yang, L.; Hu, J.; Ruan, J. miR-138 Might Reverse Multidrug Resistance of Leukemia Cells. Leuk. Res. 2010, 34, 1078–1082. [CrossRef] [PubMed] 95. Lee, J.; Choi, K.-J.; Moon, S.U.; Kim, S. Theragnosis-Based Combined Cancer Therapy Using Doxorubicin-Conjugated microRNA- 221 Molecular Beacon. Biomaterials 2016, 74, 109–118. [CrossRef] 96. Shiao, Y.-S.; Chiu, H.-H.; Wu, P.-H.; Huang, Y.-F. Aptamer-Functionalized Gold Nanoparticles as Photoresponsive Nanoplatform for Co-Drug Delivery. ACS Appl. Mater. Interfaces 2014, 6, 21832–21841. [CrossRef] 97. Xiang, D.; Shigdar, S.; Qiao, G.; Wang, T.; Kouzani, A.Z.; Zhou, S.-F.; Kong, L.; Li, Y.; Pu, C.; Duan, W. Nucleic Acid Aptamer- Guided Cancer Therapeutics and Diagnostics: The next Generation of Cancer Medicine. Theranostics 2015, 5, 23–42. [CrossRef] 98. Saravanakumar, K.; Sathiyaseelan, A.; Mariadoss, A.V.A.; Hu, X.; Venkatachalam, K.; Wang, M.-H. Nucleolin Targeted Delivery of Aptamer Tagged Trichoderma Derived Crude Protein Coated Gold Nanoparticles for Improved Cytotoxicity in Cancer Cells. Process. Biochem. 2021, 102, 325–332. [CrossRef] 99. Shaabani, E.; Shariﬁaghdam, M.; de Keersmaecker, H.; de Rycke, R.; de Smedt, S.; Faridi-Majidi, R.; Braeckmans, K.; Fraire, J.C. Layer by Layer Assembled Chitosan-Coated Gold Nanoparticles for Enhanced siRNA Delivery and Silencing. Int. J. Mol. Sci. 2021, 22, 831. [CrossRef] [PubMed] 100. Sreelakshmi, C.; Goel, N.; Datta, K.K.R.; Addlagatta, A.; Ummanni, R.; Reddy, B.V.S. Green Synthesis of Curcumin Capped Gold Nanoparticles and Evaluation of Their Cytotoxicity. Nanosci. Nanotechnol. Lett. 2013, 5, 1258–1265. [CrossRef] 101. Bertolino, V.; Cavallaro, G.; Lazzara, G.; Merli, M.; Milioto, S.; Parisi, F.; Sciascia, L. Effect of the Biopolymer Charge and the Nanoclay Morphology on Nanocomposite Materials. Ind. Eng. Chem. Res. 2016, 55, 7373–7380. [CrossRef] 102. Bertolino, V.; Cavallaro, G.; Lazzara, G.; Milioto, S.; Parisi, F. Biopolymer-Targeted Adsorption onto Halloysite Nanotubes in Aqueous Media. Langmuir 2017, 33, 3317–3323. [CrossRef] 103. Deljoo, S.; Rabiee, N.; Rabiee, M. Curcumin-Hybrid Nanoparticles in Drug Delivery System (Review). Asian J. Nanosci. Mater. 2019, 2, 66–91. [CrossRef] 104. Wang, F.; Wang, Y.-C.; Dou, S.; Xiong, M.-H.; Sun, T.-M.; Wang, J. Doxorubicin-Tethered Responsive Gold Nanoparticles Facilitate Intracellular Drug Delivery for Overcoming Multidrug Resistance in Cancer Cells. ACS Nano 2011, 5, 3679–3692. [CrossRef] 105. Ruan, S.; Hu, C.; Tang, X.; Cun, X.; Xiao, W.; Shi, K.; He, Q.; Gao, H. Increased Gold Nanoparticle Retention in Brain Tumors by in Situ Enzyme-Induced Aggregation. ACS Nano 2016, 10, 10086–10098. [CrossRef] 106. Mats, L.; Logue, F.; Oleschuk, R.D. “Particle-Free” Magnetic Actuation of Droplets on Superhydrophobic Surfaces Using Dissolved Paramagnetic Salts. Anal. Chem. 2016, 88, 9486–9494. [CrossRef] 107. Suarasan, S.; Focsan, M.; Potara, M.; Soritau, O.; Florea, A.; Maniu, D.; Astilean, S. Doxorubicin-Incorporated Nanotherapeutic Delivery System Based on Gelatin-Coated Gold Nanoparticles: Formulation, Drug Release, and Multimodal Imaging of Cellular Internalization. ACS Appl. Mater. Interfaces 2016, 8, 22900–22913. [CrossRef] 108. Ou, Y.-C.; Webb, J.A.; Faley, S.; Shae, D.; Talbert, E.M.; Lin, S.; Cutright, C.C.; Wilson, J.T.; Bellan, L.M.; Bardhan, R. Gold Nanoantenna-Mediated Photothermal Drug Delivery from Thermosensitive Liposomes in Breast Cancer. ACS Omega 2016, 1, 234–243. [CrossRef] [PubMed] 109. Zhu, J.; Wang, G.; Alves, C.S.; Tomás, H.; Xiong, Z.; Shen, M.; Rodrigues, J.; Shi, X. Multifunctional Dendrimer-Entrapped Gold Nanoparticles Conjugated with Doxorubicin for pH-Responsive Drug Delivery and Targeted Computed Tomography Imaging. Langmuir 2018, 34, 12428–12435. [CrossRef] [PubMed] 110. Hu, F.-Q.; Liu, L.-N.; Du, Y.-Z.; Yuan, H. Synthesis and Antitumor Activity of Doxorubicin Conjugated Stearic Acid-G-Chitosan Oligosaccharide Polymeric Micelles. Biomaterials 2009, 30, 6955–6963. [CrossRef] ChemEngineering 2021, 5, 69 21 of 24 111. Shen, W.C.; Ryser, H.J. Cis-Aconityl Spacer between Daunomycin and Macromolecular Carriers: A Model of pH-Sensitive Linkage Releasing Drug from a Lysosomotropic Conjugate. Biochem. Biophys. Res. Commun. 1981, 102, 1048–1054. [CrossRef] 112. Liu, H.; Wang, H.; Xu, Y.; Shen, M.; Zhao, J.; Zhang, G.; Shi, X. Synthesis of PEGylated Low Generation Dendrimer-Entrapped Gold Nanoparticles for CT Imaging Applications. Nanoscale 2014, 6, 4521–4526. [CrossRef] [PubMed] 113. Peng, C.; Zheng, L.; Chen, Q.; Shen, M.; Guo, R.; Wang, H.; Cao, X.; Zhang, G.; Shi, X. PEGylated Dendrimer-Entrapped Gold Nanoparticles for in Vivo Blood Pool and Tumor Imaging by Computed Tomography. Biomaterials 2012, 33, 1107–1119. [CrossRef] 114. Khutale, G.V.; Casey, A. Synthesis and Characterization of a Multifunctional Gold-Doxorubicin Nanoparticle System for pH Triggered Intracellular Anticancer Drug Release. Eur. J. Pharm. Biopharm. 2017, 119, 372–380. [CrossRef] [PubMed] 115. Mallick, A.; More, P.; Ghosh, S.; Chippalkatti, R.; Chopade, B.A.; Lahiri, M.; Basu, S. Dual Drug Conjugated Nanoparticle for Simultaneous Targeting of Mitochondria and Nucleus in Cancer Cells. ACS Appl. Mater. Interfaces 2015, 7, 7584–7598. [CrossRef] [PubMed] 116. Venkatesan, R.; Pichaimani, A.; Hari, K.; Balasubramanian, P.K.; Kulandaivel, J.; Premkumar, K. Doxorubicin Conjugated Gold Nanorods: A Sustained Drug Delivery Carrier for Improved Anticancer Therapy. J. Mater. Chem. B Mater. Biol. Med. 2013, 1, 1010–1018. [CrossRef] [PubMed] 117. Rabiee, N.; Ahmadi, S.; Arab, Z.; Bagherzadeh, M.; Safarkhani, M.; Nasseri, B.; Rabiee, M.; Tahriri, M.; Webster, T.J.; Tayebi, L. Aptamer Hybrid Nanocomplexes as Targeting Components for Antibiotic/Gene Delivery Systems and Diagnostics: A Review. Int. J. Nanomed. 2020, 15, 4237–4256. [CrossRef] 118. Ahmadi Nasab, N.; Hassani Kumleh, H.; Beygzadeh, M.; Teimourian, S.; Kazemzad, M. Delivery of Curcumin by a pH-Responsive Chitosan Mesoporous Silica Nanoparticles for Cancer Treatment. Artif. Cells Nanomed. Biotechnol. 2018, 46, 75–81. [CrossRef] [PubMed] 119. Xie, J.; Fan, Z.; Li, Y.; Zhang, Y.; Yu, F.; Su, G.; Xie, L.; Hou, Z. Design of pH-Sensitive Methotrexate Prodrug-Targeted Curcumin Nanoparticles for Efﬁcient Dual-Drug Delivery and Combination Cancer Therapy. Int. J. Nanomed. 2018, 13, 1381–1398. [CrossRef] 120. Yan, J.; Wang, Y.; Zhang, X.; Liu, S.; Tian, C.; Wang, H. Targeted Nanomedicine for Prostate Cancer Therapy: Docetaxel and Curcumin Co-Encapsulated Lipid-Polymer Hybrid Nanoparticles for the Enhanced Anti-Tumor Activity in Vitro and in Vivo. Drug Deliv. 2016, 23, 1757–1762. [CrossRef] 121. Rao, K.M.; Kumar, A.; Suneetha, M.; Han, S.S. pH and near-Infrared Active; Chitosan-Coated Halloysite Nanotubes Loaded with Curcumin-Au Hybrid Nanoparticles for Cancer Drug Delivery. Int. J. Biol. Macromol. 2018, 112, 119–125. [CrossRef] 122. Yang, Q.; Peng, J.; Xiao, Y.; Li, W.; Tan, L.; Xu, X.; Qian, Z. Porous Au@Pt Nanoparticles: Therapeutic Platform for Tumor Chemo-Photothermal Co-Therapy and Alleviating Doxorubicin-Induced Oxidative Damage. ACS Appl. Mater. Interfaces 2018, 10, 150–164. [CrossRef] 123. Norouzi, H.; Khoshgard, K.; Akbarzadeh, F. In Vitro Outlook of Gold Nanoparticles in Photo-Thermal Therapy: A Literature Review. Lasers Med. Sci. 2018, 33, 917–926. [CrossRef] 124. Zhang, D.; Wu, T.; Qin, X.; Qiao, Q.; Shang, L.; Song, Q.; Yang, C.; Zhang, Z. Intracellularly Generated Immunological Gold Nanoparticles for Combinatorial Photothermal Therapy and Immunotherapy against Tumor. Nano Lett. 2019, 19, 6635–6646. [CrossRef] 125. Riley, R.S.; Day, E.S. Gold Nanoparticle-Mediated Photothermal Therapy: Applications and Opportunities for Multimodal Cancer Treatment. Wiley Interdiscip. Rev. Nanomed. Nanobiotechnol. 2017, 9. [CrossRef] 126. Cheng, X.; Sun, R.; Yin, L.; Chai, Z.; Shi, H.; Gao, M. Light-Triggered Assembly of Gold Nanoparticles for Photothermal Therapy and Photoacoustic Imaging of Tumors In Vivo. Adv. Mater. 2017, 29. [CrossRef] [PubMed] 127. Ali, M.R.K.; Wu, Y.; El-Sayed, M.A. Gold-Nanoparticle-Assisted Plasmonic Photothermal Therapy Advances toward Clinical Application. J. Phys. Chem. C Nanomater. Interfaces 2019, 123, 15375–15393. [CrossRef] 128. Liu, Y.; Crawford, B.M.; Vo-Dinh, T. Gold Nanoparticles-Mediated Photothermal Therapy and Immunotherapy. Immunotherapy 2018, 10, 1175–1188. [CrossRef] 129. Yang, W.; Liang, H.; Ma, S.; Wang, D.; Huang, J. Gold Nanoparticle Based Photothermal Therapy: Development and Application for Effective Cancer Treatment. Sustain. Mater. Technol. 2019, 22, e00109. [CrossRef] 130. Sun, M.; Peng, D.; Hao, H.; Hu, J.; Wang, D.; Wang, K.; Liu, J.; Guo, X.; Wei, Y.; Gao, W. Thermally Triggered in Situ Assembly of Gold Nanoparticles for Cancer Multimodal Imaging and Photothermal Therapy. ACS Appl. Mater. Interfaces 2017, 9, 10453–10460. [CrossRef] 131. Kim, H.S.; Lee, D.Y. Photothermal Therapy with Gold Nanoparticles as an Anticancer Medication. J. Pharm. Investig. 2017, 47, 19–26. [CrossRef] 132. Beik, J.; Asadi, M.; Khoei, S.; Laurent, S.; Abed, Z.; Mirrahimi, M.; Farashahi, A.; Hashemian, R.; Ghaznavi, H.; Shakeri-Zadeh, A. Simulation-Guided Photothermal Therapy Using MRI-Traceable Iron Oxide-Gold Nanoparticle. J. Photochem. Photobiol. B 2019, 199, 111599. [CrossRef] [PubMed] 133. Neshastehriz, A.; Tabei, M.; Maleki, S.; Eynali, S.; Shakeri-Zadeh, A. Photothermal Therapy Using Folate Conjugated Gold Nanoparticles Enhances the Effects of 6MV X-Ray on Mouth Epidermal Carcinoma Cells. J. Photochem. Photobiol. B 2017, 172, 52–60. [CrossRef] [PubMed] 134. Jiang, X.; Du, B.; Huang, Y.; Yu, M.; Zheng, J. Cancer Photothermal Therapy with ICG-Conjugated Gold Nanoclusters. Bioconjug. Chem. 2020, 31, 1522–1528. [CrossRef] ChemEngineering 2021, 5, 69 22 of 24 135. Kim, H.S.; Lee, D.Y. Near-Infrared-Responsive Cancer Photothermal and Photodynamic Therapy Using Gold Nanoparticles. Polymers 2018, 10, 961. [CrossRef] 136. Sun, Z.; Zhang, Y.; Yu, H.; Yan, C.; Liu, Y.; Hong, S.; Tao, H.; Robertson, A.W.; Wang, Z.; Pádua, A.A.H. New Solvent-Stabilized Few-Layer Black Phosphorus for Antibacterial Applications. Nanoscale 2018, 10, 12543–12553. [CrossRef] 137. Wang, X.; Shao, J.; Abd El Raouf, M.; Xie, H.; Huang, H.; Wang, H.; Chu, P.K.; Yu, X.-F.; Yang, Y.; AbdEl-Aal, A.M.; et al. Near-Infrared Light-Triggered Drug Delivery System Based on Black Phosphorus for in Vivo Bone Regeneration. Biomaterials 2018, 179, 164–174. [CrossRef] [PubMed] 138. Yang, G.; Liu, Z.; Li, Y.; Hou, Y.; Fei, X.; Su, C.; Wang, S.; Zhuang, Z.; Guo, Z. Facile Synthesis of Black Phosphorus-Au Nanocomposites for Enhanced Photothermal Cancer Therapy and Surface-Enhanced Raman Scattering Analysis. Biomater. Sci. 2017, 5, 2048–2055. [CrossRef] [PubMed] 139. Moradi, S.; Mokhtari-Dizaji, M.; Ghassemi, F.; Sheibani, S.; Amoli, F.A. The Effect of Ultrasound Hyperthermia with Gold Nanoparticles on Retinoblastoma Y79 Cells. Gold Bull. 2020, 53, 111–120. [CrossRef] 140. Katifelis, H.; Mukha, I.; Lyberopoulou, A.; Vityuk, N.; Grammatikaki, M.; Pylypchuk, I.; Lazaris, F.; Storozhuk, L.; Kouloulias, V.; Gazouli, M. In Vitro Effect of Hyperthermic Ag and Au Fe O Nanoparticles in Cancer Cells. Beilstein Arch. 2019, 2019, 101. 3 4 141. Shanei, A.; Sazgarnia, A. An Overview of Therapeutic Applications of Ultrasound Based on Synergetic Effects with Gold Nanoparticles and Laser Excitation. Iran. J. Basic Med. Sci. 2019, 22, 848–855. [CrossRef] 142. Canavese, G.; Ancona, A.; Racca, L.; Canta, M.; Dumontel, B.; Barbaresco, F.; Limongi, T.; Cauda, V. Nanoparticle-Assisted Ultrasound: A Special Focus on Sonodynamic Therapy against Cancer. Chem. Eng. J. 2018, 340, 155–172. [CrossRef] 143. Beik, J.; Khademi, S.; Attaran, N.; Sarkar, S.; Shakeri-Zadeh, A.; Ghaznavi, H.; Ghadiri, H. A Nanotechnology-Based Strategy to Increase the Efﬁciency of Cancer Diagnosis and Therapy: Folate-Conjugated Gold Nanoparticles. Curr. Med. Chem. 2017, 24, 4399–4416. [CrossRef] 144. Izadifar, Z.; Izadifar, Z.; Chapman, D.; Babyn, P. An Introduction to High Intensity Focused Ultrasound: Systematic Review on Principles, Devices, and Clinical Applications. J. Clin. Med. Res. 2020, 9, 460. [CrossRef] 145. Kennedy, J.E. High-Intensity Focused Ultrasound in the Treatment of Solid Tumours. Nat. Rev. Cancer 2005, 5, 321–327. [CrossRef] 146. Yu, T.; Wang, Z.; Jiang, S. Potentiation of Cytotoxicity of Adriamycin on Human Ovarian Carcinoma Cell Line 3AO by Low-Level Ultrasound. Ultrasonics 2001, 39, 307–309. [CrossRef] 147. Yu, T.; Wang, Z.; Mason, T.J. A Review of Research into the Uses of Low Level Ultrasound in Cancer Therapy. Ultrason. Sonochem. 2004, 11, 95–103. [CrossRef] 148. Marmottant, P.; Hilgenfeldt, S. Controlled Vesicle Deformation and Lysis by Single Oscillating Bubbles. Nature 2003, 423, 153–156. [CrossRef] [PubMed] 149. Tang, H.; Wang, C.C.J.; Blankschtein, D.; Langer, R. An Investigation of the Role of Cavitation in Low-Frequency Ultrasound- Mediated Transdermal Drug Transport. Pharm. Res. 2002, 19, 1160–1169. [CrossRef] [PubMed] 150. Barnett, S.B.; ter Haar, G.R.; Ziskin, M.C.; Nyborg, W.L.; Maeda, K.; Bang, J. Current Status of Research on Biophysical Effects of Ultrasound. Ultrasound Med. Biol. 1994, 20, 205–218. [CrossRef] 151. Barnett, S.B. Conclusions and Recommendations on Thermal and Non-Thermal Mechanisms for Biological Effects of Ultrasound; CSIRO Research Publications Repository: Melbourne, Australia, 1996. 152. Tuziuti, T.; Yasui, K.; Sivakumar, M.; Iida, Y.; Miyoshi, N. Correlation between Acoustic Cavitation Noise and Yield Enhancement of Sonochemical Reaction by Particle Addition. J. Phys. Chem. A 2005, 109, 4869–4872. [CrossRef] 153. Farny, C.H.; Wu, T.; Holt, R.G.; Murray, T.W.; Roy, R.A. Nucleating Cavitation from Laser-Illuminated Nano-Particles. Acoust. Res. Lett. Online 2005, 6, 138–143. [CrossRef] 154. Victor, E.G.; Silveira, P.C.L.; Possato, J.C.; da Rosa, G.L.; Munari, U.B.; de Souza, C.T.; Pinho, R.A.; da Silva, L.; Streck, E.L.; Paula, M.M.S. Pulsed ultrasound Associated with Gold Nanoparticle Gel Reduces Oxidative Stress Parameters and Expression of pro-Inﬂammatory Molecules in an Animal Model of Muscle Injury. J. Nanobiotechnol. 2012, 10, 11. [CrossRef] 155. Serrano, A.L.; Baeza-Raja, B.; Perdiguero, E.; Jardí, M.; Muñoz-Cánoves, P. Interleukin-6 Is an Essential Regulator of Satellite Cell-Mediated Skeletal Muscle Hypertrophy. Cell Metab. 2008, 7, 33–44. [CrossRef] 156. Li, Y.-P. TNF-Alpha Is a Mitogen in Skeletal Muscle. Am. J. Physiol. Cell Physiol. 2003, 285, C370–C376. [CrossRef] 157. Tsai, C.-Y.; Shiau, A.-L.; Chen, S.-Y.; Chen, Y.-H.; Cheng, P.-C.; Chang, M.-Y.; Chen, D.-H.; Chou, C.-H.; Wang, C.-R.; Wu, C.-L. Amelioration of Collagen-Induced Arthritis in Rats by Nanogold. Arthritis Rheum. 2007, 56, 544–554. [CrossRef] 158. Beik, J.; Abed, Z.; Shakeri-Zadeh, A.; Nourbakhsh, M.; Shiran, M.B. Evaluation of the Sonosensitizing Properties of Nano- Graphene Oxide in Comparison with Iron Oxide and Gold Nanoparticles. Phys. E Low Dimens. Syst. Nanostruct. 2016, 81, 308–314. [CrossRef] 159. Aminabad, N.S.; Farshbaf, M.; Akbarzadeh, A. Recent Advances of Gold Nanoparticles in Biomedical Applications: State of the Art. Cell Biochem. Biophys. 2019, 77, 123–137. [CrossRef] [PubMed] 160. Mieszawska, A.J.; Mulder, W.J.M.; Fayad, Z.A.; Cormode, D.P. Multifunctional Gold Nanoparticles for Diagnosis and Therapy of Disease. Mol. Pharm. 2013, 10, 831–847. [CrossRef] [PubMed] 161. Cordeiro, M.; Ferreira Carlos, F.; Pedrosa, P.; Lopez, A.; Baptista, P.V. Gold Nanoparticles for Diagnostics: Advances towards Points of Care. Diagnostics 2016, 6, 43. [CrossRef] [PubMed] 162. Kang, J.W.; So, P.T.C.; Dasari, R.R.; Lim, D.-K. High Resolution Live Cell Raman Imaging Using Subcellular Organelle-Targeting SERS-Sensitive Gold Nanoparticles with Highly Narrow Intra-Nanogap. Nano Lett. 2015, 15, 1766–1772. [CrossRef] ChemEngineering 2021, 5, 69 23 of 24 163. Kumar, S.; Kumar, S.; Tiwari, S.; Augustine, S.; Srivastava, S.; Yadav, B.K.; Malhotra, B.D. Highly Sensitive Protein Functionalized Nanostructured Hafnium Oxide Based Biosensing Platform for Non-Invasive Oral Cancer Detection. Sens. Actuators B Chem. 2016, 235, 1–10. [CrossRef] 164. Fleischmann, M.; Hendra, P.J.; McQuillan, A.J. Raman Spectra of Pyridine Adsorbed at a Silver Electrode. Chem. Phys. Lett. 1974, 26, 163–166. [CrossRef] 165. Feng, S.; Chen, R.; Lin, J.; Pan, J.; Wu, Y.; Li, Y.; Chen, J.; Zeng, H. Gastric Cancer Detection Based on Blood Plasma Surface- Enhanced Raman Spectroscopy Excited by Polarized Laser Light. Biosens. Bioelectron. 2011, 26, 3167–3174. [CrossRef] [PubMed] 166. Yan, B.; Li, B.; Wen, Z.; Luo, X.; Xue, L.; Li, L. Label-Free Blood Serum Detection by Using Surface-Enhanced Raman Spectroscopy and Support Vector Machine for the Preoperative Diagnosis of Parotid Gland Tumors. BMC Cancer 2015, 15, 650. [CrossRef] [PubMed] 167. Tan, Y.; Yan, B.; Xue, L.; Li, Y.; Luo, X.; Ji, P. Surface-Enhanced Raman Spectroscopy of Blood Serum Based on Gold Nanoparticles for the Diagnosis of the Oral Squamous Cell Carcinoma. Lipids Health Dis. 2017, 16, 73. [CrossRef] [PubMed] 168. Ma, X.; Qu, Q.; Zhao, Y.; Luo, Z.; Zhao, Y.; Ng, K.W.; Zhao, Y. Graphene Oxide Wrapped Gold Nanoparticles for Intracellular Raman Imaging and Drug Delivery. J. Mater. Chem. B Mater. Biol. Med. 2013, 1, 6495–6500. [CrossRef] [PubMed] 169. Li, W.; Chen, X. Gold Nanoparticles for Photoacoustic Imaging. Nanomedicine 2015, 10, 299–320. [CrossRef] 170. Song, J.; Kim, J.; Hwang, S.; Jeon, M.; Jeong, S.; Kim, C.; Kim, S. “Smart” Gold Nanoparticles for Photoacoustic Imaging: An Imaging Contrast Agent Responsive to the Cancer Microenvironment and Signal Ampliﬁcation via pH-Induced Aggregation. Chem. Commun. 2016, 52, 8287–8290. [CrossRef] 171. Sun, I.-C.; Dumani, D.; Emelianov, S.Y. Ultrasound-Guided Photoacoustic Imaging of Lymph Nodes with Biocompatible Gold Nanoparticles as a Novel Contrast Agent (Conference Presentation). In Proceedings of the Colloidal Nanoparticles for Biomedical Applications XII, San Francisco, CA, USA, 28 January–2 February 2017; Liang, X.-J., Parak, W.J., Osinski, ´ M., Eds.; SPIE: Bellingham, WA, USA, 2017. 172. Jin, H.-Y.; Li, D.-W.; Zhang, N.; Gu, Z.; Long, Y.-T. Analyzing Carbohydrate-Protein Interaction Based on Single Plasmonic Nanoparticle by Conventional Dark Field Microscopy. ACS Appl. Mater. Interfaces 2015, 7, 12249–12253. [CrossRef] [PubMed] 173. Qian, W.; Huang, X.; Kang, B.; El-Sayed, M.A. Dark-Field Light Scattering Imaging of Living Cancer Cell Component from Birth through Division Using Bioconjugated Gold Nanoprobes. J. Biomed. Opt. 2010, 15, 046025. [CrossRef] 174. Ma, J.; Liu, Y.; Gao, P.F.; Zou, H.Y.; Huang, C.Z. Precision Improvement in Dark-Field Microscopy Imaging by Using Gold Nanoparticles as an Internal Reference: A Combined Theoretical and Experimental Study. Nanoscale 2016, 8, 8729–8736. [CrossRef] [PubMed] 175. Cao, Y.; He, Y.; Liu, H.; Luo, Y.; Shen, M.; Xia, J.; Shi, X. Targeted CT Imaging of Human Hepatocellular Carcinoma Using Low-Generation Dendrimer-Entrapped Gold Nanoparticles Modiﬁed with Lactobionic Acid. J. Mater. Chem. B Mater. Biol. Med. 2015, 3, 286–295. [CrossRef] 176. Meir, R.; Shamalov, K.; Betzer, O.; Motiei, M.; Horovitz-Fried, M.; Yehuda, R.; Popovtzer, A.; Popovtzer, R.; Cohen, C.J. Nanomedicine for Cancer Immunotherapy: Tracking Cancer-Speciﬁc T-Cells in Vivo with Gold Nanoparticles and CT Imaging. ACS Nano 2015, 9, 6363–6372. [CrossRef] 177. Kim, J.; Lee, N.; Hyeon, T. Recent Development of Nanoparticles for Molecular Imaging. Philos. Trans. A Math. Phys. Eng. Sci. 2017, 375. [CrossRef] 178. Na, H.B.; Song, I.C.; Hyeon, T. Inorganic Nanoparticles for MRI Contrast Agents. Adv. Mater. 2009, 21, 2133–2148. [CrossRef] 179. Huang, J.-Y.; Lin, H.-T.; Chen, T.-H.; Chen, C.-A.; Chang, H.-T.; Chen, C.-F. Signal Ampliﬁed Gold Nanoparticles for Cancer Diagnosis on Paper-Based Analytical Devices. ACS Sens. 2018, 3, 174–182. [CrossRef] [PubMed] 180. Guo, J.; Chen, Y.; Jiang, Y.; Ju, H. Polyadenine-Modulated DNA Conformation Monitored by Surface-Enhanced Raman Scattering (SERS) on Multibranched Gold Nanoparticles and Its Sensing Application. Chemistry 2017, 23, 9332–9337. [CrossRef] [PubMed] 181. Cheung-Lau, J.C.; Liu, D.; Pulsipher, K.W.; Liu, W.; Dmochowski, I.J. Engineering a Well-Ordered, Functional Protein-Gold Nanoparticle Assembly. J. Inorg. Biochem. 2014, 130, 59–68. [CrossRef] [PubMed] 182. Tang, C.K.; Vaze, A.; Shen, M.; Rusling, J.F. High-Throughput Electrochemical Microﬂuidic Immunoarray for Multiplexed Detection of Cancer Biomarker Proteins. ACS Sens. 2016, 1, 1036–1043. [CrossRef] 183. Saeed, A.A.; Sánchez, J.L.A.; O’Sullivan, C.K.; Abbas, M.N. DNA Biosensors Based on Gold Nanoparticles-Modiﬁed Graphene Oxide for the Detection of Breast Cancer Biomarkers for Eary Diagnosis. Bioelectrochemistry 2017, 118, 91–99. [CrossRef] [PubMed] 184. Saha, K.; Agasti, S.S.; Kim, C.; Li, X.; Rotello, V.M. Gold Nanoparticles in Chemical and Biological Sensing. Chem. Rev. 2012, 112, 2739–2779. [CrossRef] 185. Zeng, S.; Yong, K.-T.; Roy, I.; Dinh, X.-Q.; Yu, X.; Luan, F. A Review on Functionalized Gold Nanoparticles for Biosensing Applications. Plasmonics 2011, 6, 491–506. [CrossRef] 186. Pingarrón, J.M.; Yáñez-Sedeño, P.; González-Cortés, A. Gold Nanoparticle-Based Electrochemical Biosensors. Electrochim. Acta 2008, 53, 5848–5866. [CrossRef] 187. Meola, A.; Rao, J.; Chaudhary, N.; Sharma, M.; Chang, S.D. Gold Nanoparticles for Brain Tumor Imaging: A Systematic Review. Front. Neurol. 2018, 9, 328. [CrossRef] [PubMed] 188. Bahadar, H.; Maqbool, F.; Niaz, K.; Abdollahi, M. Toxicity of Nanoparticles and an Overview of Current Experimental Models. Iran. Biomed. J. 2016, 20, 1–11. [CrossRef] ChemEngineering 2021, 5, 69 24 of 24 189. Kim, D.-Y.; Kim, M.; Shinde, S.; Sung, J.-S.; Ghodake, G. Cytotoxicity and Antibacterial Assessment of Gallic Acid Capped Gold Nanoparticles. Colloids Surf. B Biointerfaces 2017, 149, 162–167. [CrossRef] 190. Bhamidipati, M.; Fabris, L. Multiparametric Assessment of Gold Nanoparticle Cytotoxicity in Cancerous and Healthy Cells: The Role of Size, Shape, and Surface Chemistry. Bioconjug. Chem. 2017, 28, 449–460. [CrossRef] [PubMed] 191. Albanese, A.; Walkey, C.D.; Olsen, J.B.; Guo, H.; Emili, A.; Chan, W.C.W. Secreted Biomolecules Alter the Biological Identity and Cellular Interactions of Nanoparticles. ACS Nano 2014, 8, 5515–5526. [CrossRef] [PubMed] 192. Grainger, D.W.; Castner, D.G. Nanobiomaterials and Nanoanalysis: Opportunities for Improving the Science to Beneﬁt Biomedical Technologies. Adv. Mater. 2008, 20, 867–877. [CrossRef] 193. Walkey, C.D.; Olsen, J.B.; Guo, H.; Emili, A.; Chan, W.C.W. Nanoparticle Size and Surface Chemistry Determine Serum Protein Adsorption and Macrophage Uptake. J. Am. Chem. Soc. 2012, 134, 2139–2147. [CrossRef] 194. Bailly, A.-L.; Correard, F.; Popov, A.; Tselikov, G.; Chaspoul, F.; Appay, R.; Al-Kattan, A.; Kabashin, A.V.; Braguer, D.; Esteve, M.-A. In Vivo Evaluation of Safety, Biodistribution and Pharmacokinetics of Laser-Synthesized Gold Nanoparticles. Sci. Rep. 2019, 9, 12890. [CrossRef] 195. Wilhelm, S.; Tavares, A.J.; Dai, Q.; Ohta, S.; Audet, J.; Dvorak, H.F.; Chan, W.C.W. Analysis of Nanoparticle Delivery to Tumours. Nat. Rev. Mater. 2016, 1, 16014. [CrossRef] 196. Dai, Q.; Bertleff-Zieschang, N.; Braunger, J.A.; Björnmalm, M.; Cortez-Jugo, C.; Caruso, F. Particle Targeting in Complex Biological Media. Adv. Healthc. Mater. 2018, 7, 1700575. [CrossRef] [PubMed] http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png ChemEngineering Multidisciplinary Digital Publishing Institute http://www.deepdyve.com/lp/multidisciplinary-digital-publishing-institute/application-of-gold-nanoparticle-based-materials-in-cancer-therapy-and-ZUU0QjoDVE

Loading next page...

References (197)

M. Bhamidipati, L. Fabris (2017)
Multiparametric Assessment of Gold Nanoparticle Cytotoxicity in Cancerous and Healthy Cells: The Role of Size, Shape, and Surface Chemistry.
Bioconjugate chemistry, 28 2
Z. Izadifar, Z. Izadifar, D. Chapman, P. Babyn (2020)
An Introduction to High Intensity Focused Ultrasound: Systematic Review on Principles, Devices, and Clinical Applications
Journal of Clinical Medicine, 9
Y. Shang, Zhuochao Zhang, Zhengcai Liu, B. Feng, Gui Ren, Kai Li, Lin Zhou, Yi Sun, Mengyang Li, Jinfeng Zhou, Y. An, Kaichun Wu, Y. Nie, D. Fan (2014)
miR-508-5p regulates multidrug resistance of gastric cancer by targeting ABCB1 and ZNRD1
Oncogene, 33
K. Saravanakumar, A. Sathiyaseelan, A. Mariadoss, Xiaowen Hu, K. Venkatachalam, Myeon-Hyeon Wang (2021)
Nucleolin targeted delivery of aptamer tagged Trichoderma derived crude protein coated gold nanoparticles for improved cytotoxicity in cancer cells
Process Biochemistry, 102
C. Walkey, Jonathan Olsen, Hongbo Guo, A. Emili, W. Chan (2012)
Nanoparticle size and surface chemistry determine serum protein adsorption and macrophage uptake.
Journal of the American Chemical Society, 134 4
Ya Ding, Ziwen Jiang, Krishnendu Saha, Chang Kim, Sung Kim, Ryan Landis, V. Rotello (2014)
Gold nanoparticles for nucleic acid delivery.
Molecular therapy : the journal of the American Society of Gene Therapy, 22 6
S. Tenzer, D. Docter, Susanne Rosfa, A. Wlodarski, Jörg Kuharev, Alexander Rekik, S. Knauer, Christoph Bantz, T. Nawroth, C. Bier, Jarinratn Sirirattanapan, W. Mann, L. Treuel, R. Zellner, M. Maskos, H. Schild, R. Stauber (2011)
Nanoparticle size is a critical physicochemical determinant of the human blood plasma corona: a comprehensive quantitative proteomic analysis.
ACS nano, 5 9
Mingjun Xuan, Jingxin Shao, Jie Zhao, Qi Li, L. Dai, Junbai Li (2018)
Magnetic Mesoporous Silica Nanoparticles Cloaked by Red Blood Cell Membranes: Applications in Cancer Therapy.
Angewandte Chemie, 57 21
A. Matos, B. Carreira, C. Peres, L. Moura, João Conniot, T. Fourniols, A. Scomparin, Águeda Martínez-Barriocanal, D. Arango, J. Conde, V. Préat, R. Satchi‐Fainaro, H. Florindo (2019)
Nanotechnology is an important strategy for combinational innovative chemo-immunotherapies against colorectal cancer.
Journal of controlled release : official journal of the Controlled Release Society
H. Daraee, A. Eatemadi, E. Abbasi, Sedigheh Aval, M. Kouhi, A. Akbarzadeh (2016)
Application of gold nanoparticles in biomedical and drug delivery
Artificial Cells, Nanomedicine, and Biotechnology, 44
Dongxi Xiang, S. Shigdar, Greg Qiao, Tao Wang, A. Kouzani, Shufeng Zhou, L. Kong, Yong Li, Chunwen Pu, W. Duan (2015)
Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: the Next Generation of Cancer Medicine
Theranostics, 5
D. Grainger, D. Castner (2008)
Nanobiomaterials and Nanoanalysis: Opportunities for Improving the Science to Benefit Biomedical Technologies
Advanced Materials, 20
H. Tang, Chiao Wang, D. Blankschtein, R. Langer (2002)
An Investigation of the Role of Cavitation in Low-Frequency Ultrasound-Mediated Transdermal Drug Transport
Pharmaceutical Research, 19
H. Katifelis, I. Mukha, A. Lyberopoulou, N. Vityuk, M. Grammatikaki, Ievgen Pylypchuk, Foivos Lazaris, L. Storozhuk, V. Kouloulias, M. Gazouli (2019)
In vitro effect of hyperthermic Ag and Au Fe3O4 nanoparticles in cancer cells.
Journal of B.U.ON. : official journal of the Balkan Union of Oncology, 25 2
Yang Liu, Bridget Crawford, T. Vo‐Dinh (2018)
Gold nanoparticles-mediated photothermal therapy and immunotherapy.
Immunotherapy, 10 13
C. Sreelakshmi, N. Goel, K. Datta, A. Addlagatta, R. Ummanni, B. Reddy (2013)
Green Synthesis of Curcumin Capped Gold Nanoparticles and Evaluation of Their Cytotoxicity
Nanoscience and Nanotechnology Letters, 5
Qian Yang, Jinrong Peng, Yao Xiao, Wenting Li, Liwei Tan, Xiaohong Xu, Z. Qian (2018)
Porous Au@Pt Nanoparticles: Therapeutic Platform for Tumor Chemo-Photothermal Co-Therapy and Alleviating Doxorubicin-Induced Oxidative Damage.
ACS applied materials & interfaces, 10 1
J. Kang, P. So, R. Dasari, Dong-Kwon Lim (2015)
High resolution live cell Raman imaging using subcellular organelle-targeting SERS-sensitive gold nanoparticles with highly narrow intra-nanogap.
Nano letters, 15 3
L. Kwong, M. Davies (2014)
Targeted therapy for melanoma: rational combinatorial approaches
Oncogene, 33
Tinghe Yu, Zhibiao Wang, T. Mason (2004)
A review of research into the uses of low level ultrasound in cancer therapy.
Ultrasonics sonochemistry, 11 2
A. Mieszawska, W. Mulder, Z. Fayad, D. Cormode (2013)
Multifunctional gold nanoparticles for diagnosis and therapy of disease.
Molecular pharmaceutics, 10 3
J. Love, L. Estroff, J. Kriebel, R. Nuzzo, G. Whitesides (2005)
Self-assembled monolayers of thiolates on metals as a form of nanotechnology.
Chemical reviews, 105 4
Anne-Laure Bailly, F. Correard, A. Popov, G. Tselikov, F. Chaspoul, R. Appay, A. Al-Kattan, A. Kabashin, D. Braguer, Marie-Anne Estève (2019)
In vivo evaluation of safety, biodistribution and pharmacokinetics of laser-synthesized gold nanoparticles
Scientific Reports, 9
Feng Wang, Yu-Cai Wang, Shuang Dou, Menghua Xiong, Tian-meng Sun, Jun Wang (2011)
Doxorubicin-tethered responsive gold nanoparticles facilitate intracellular drug delivery for overcoming multidrug resistance in cancer cells.
ACS nano, 5 5
Pinal Patel, D. Giljohann, Weston Daniel, Dan Zheng, Andrew Prigodich, C. Mirkin (2010)
Scavenger receptors mediate cellular uptake of polyvalent oligonucleotide-functionalized gold nanoparticles.
Bioconjugate chemistry, 21 12
I. Nakase, M. Niwa, T. Takeuchi, K. Sonomura, N. Kawabata, Y. Koike, M. Takehashi, Seigo Tanaka, K. Ueda, J. Simpson, A. Jones, Y. Sugiura, S. Futaki (2004)
Cellular uptake of arginine-rich peptides: roles for macropinocytosis and actin rearrangement.
Molecular therapy : the journal of the American Society of Gene Therapy, 10 6
O. Palesh, Caroline Scheiber, S. Kesler, K. Mustian, C. Koopman, L. Schapira (2018)
Management of side effects during and post‐treatment in breast cancer survivors
The Breast Journal, 24
B. Yan, Bo Li, Zhi-ning Wen, Xianyang Luo, Lili Xue, Longjiang Li (2015)
Label-free blood serum detection by using surface-enhanced Raman spectroscopy and support vector machine for the preoperative diagnosis of parotid gland tumors
BMC Cancer, 15
S. Rana, Avinash Bajaj, R. Mout, V. Rotello (2012)
Monolayer coated gold nanoparticles for delivery applications.
Advanced drug delivery reviews, 64 2
Shixuan Chen, Ruiquan Li, Xiaoran Li, Jingwei Xie (2018)
Electrospinning: An enabling nanotechnology platform for drug delivery and regenerative medicine☆
Advanced Drug Delivery Reviews, 132
B. Halamoda-Kenzaoui, M. Ceridono, P. Urban, A. Bogni, J. Ponti, S. Gioria, A. Kinsner-Ovaskainen (2017)
The agglomeration state of nanoparticles can influence the mechanism of their cellular internalisation
Journal of Nanobiotechnology, 15
Jiajiang Xie, Zhongxiong Fan, Yang Li, Yinying Zhang, Fei Yu, Guanghao Su, Liya Xie, Zhenqing Hou (2018)
Design of pH-sensitive methotrexate prodrug-targeted curcumin nanoparticles for efficient dual-drug delivery and combination cancer therapy
International Journal of Nanomedicine, 13
Qiong Dai, N. Bertleff-Zieschang, Julia Braunger, M. Björnmalm, Christina Cortez-Jugo, F. Caruso (2018)
Particle Targeting in Complex Biological Media
Advanced Healthcare Materials, 7
L. Carlson, U. Subnis, Katherine-Anne Piedalue, James Vallerand, M. Speca, S. Lupichuk, P. Tang, P. Faris, R. Wolever (2019)
The ONE-MIND Study: Rationale and protocol for assessing the effects of ONlinE MINDfulness-based cancer recovery for the prevention of fatigue and other common side effects during chemotherapy.
European journal of cancer care
T. Pearman, J. Beaumont, D. Mroczek, Mary O'Connor, D. Cella (2018)
Validity and usefulness of a single‐item measure of patient‐reported bother from side effects of cancer therapy
Cancer, 124
W. Shen, H. Ryser (1981)
cis-Aconityl spacer between daunomycin and macromolecular carriers: a model of pH-sensitive linkage releasing drug from a lysosomotropic conjugate.
Biochemical and biophysical research communications, 102 3
P. Suchomel, L. Kvítek, R. Prucek, A. Panacek, A. Halder, Š. Vajda, R. Zbořil (2018)
Simple size-controlled synthesis of Au nanoparticles and their size-dependent catalytic activity
Scientific Reports, 8
L. Sironi, S. Freddi, M. Caccia, P. Pozzi, Leone Rossetti, P. Pallavicini, A. Donà, E. Cabrini, M. Gualtieri, I. Rivolta, A. Panariti, L. D’alfonso, M. Collini, G. Chirico (2012)
Gold Branched Nanoparticles for Cellular Treatments
Journal of Physical Chemistry C, 116
Jia-Yu Huang, Hongxia Lin, Tzu-Heng Chen, Chung-An Chen, Huan‐Tsung Chang, Chien-Fu Chen (2018)
Signal Amplified Gold Nanoparticles for Cancer Diagnosis on Paper-Based Analytical Devices.
ACS sensors, 3 1
G. Pillai (2019)
Nanotechnology Toward Treating Cancer
Applications of Targeted Nano Drugs and Delivery Systems
M. Riaz, Muhammad Riaz, Xue Zhang, Congcong Lin, Ka Wong, Xiaoyu Chen, Ge Zhang, Aiping Lu, Zhijun Yang (2018)
Surface Functionalization and Targeting Strategies of Liposomes in Solid Tumor Therapy: A Review
International Journal of Molecular Sciences, 19
Hasan Norouzi, K. Khoshgard, F. Akbarzadeh (2018)
In vitro outlook of gold nanoparticles in photo-thermal therapy: a literature review
Lasers in Medical Science, 33
E. Dreaden, A. Alkilany, Xiaohua Huang, C. Murphy, M. El-Sayed (2012)
The Golden Age: Gold Nanoparticles for Biomedicine
ChemInform, 43
P. Yáñez-Sedeño, J. Pingarrón (2005)
Gold nanoparticle-based electrochemical biosensors
Analytical and Bioanalytical Chemistry, 382
F. Hu, Lina Liu, Yongzhong Du, Hong Yuan (2009)
Synthesis and antitumor activity of doxorubicin conjugated stearic acid-g-chitosan oligosaccharide polymeric micelles.
Biomaterials, 30 36
E. Victor, Paulo Silveira, J. Possato, Guilherme Rosa, Uillian Munari, C. Souza, Ricardo Pinho, L. Silva, E. Streck, Marcos Paula (2012)
Pulsed ultrasound associated with gold nanoparticle gel reduces oxidative stress parameters and expression of pro-inflammatory molecules in an animal model of muscle injury
Journal of Nanobiotechnology, 10
Nicholas Zaorsky, T. Churilla, B. Egleston, S. Fisher, J. Ridge, E. Horwitz, J. Meyer (2016)
Causes of death among cancer patients
Annals of Oncology, 28
Somayeh Moradi, Manijeh Mokhtari-Dizaji, Fariba Ghassemi, S. Sheibani, F. Amoli (2020)
The effect of ultrasound hyperthermia with gold nanoparticles on retinoblastoma Y79 cells
Gold Bulletin, 53
Karol Steckiewicz, Ewelina Barcińska, Anna Malankowska, A. Zauszkiewicz-Pawlak, G. Nowaczyk, A. Zaleska-Medynska, Iwona Inkielewicz-Stępniak (2019)
Impact of gold nanoparticles shape on their cytotoxicity against human osteoblast and osteosarcoma in in vitro model. Evaluation of the safety of use and anti-cancer potential
Journal of Materials Science. Materials in Medicine, 30
C. Sielaff, S. Mousa (2018)
Status and future directions in the management of pancreatic cancer: potential impact of nanotechnology
Journal of Cancer Research and Clinical Oncology, 144
D. Cibula, R. Pötter, F. Planchamp, E. Åvall-Lundqvist, D. Fischerová, C. Meder, C. Köhler, F. Landoni, S. Lax, J. Lindegaard, U. Mahantshetty, P. Mathevet, W. McCluggage, M. McCormack, R. Naik, R. Nout, S. Pignata, J. Ponce, D. Querleu, F. Raspagliesi, A. Rodolakis, K. Tamussino, P. Wimberger, M. Raspollini (2018)
The European Society of Gynaecological Oncology/European Society for Radiotherapy and Oncology/European Society of Pathology Guidelines for the Management of Patients With Cervical Cancer
International Journal of Gynecologic Cancer, 28
Dae-Young Kim, Min Kim, Surendra Shinde, J. Sung, G. Ghodake (2017)
Cytotoxicity and antibacterial assessment of gallic acid capped gold nanoparticles.
Colloids and surfaces. B, Biointerfaces, 149
Jonghoon Kim, N. Lee, T. Hyeon (2017)
Recent development of nanoparticles for molecular imaging
Philosophical Transactions of the Royal Society A: Mathematical, Physical and Engineering Sciences, 375
N. Cândido, M. Melo, L. Franchi, F. Primo, A. Tedesco, P. Rahal, M. Calmon (2018)
Combining Photodynamic Therapy and Chemotherapy: Improving Breast Cancer Treatment with Nanotechnology.
Journal of biomedical nanotechnology, 14 5
M. Ziskin, K. Maeda, W. Nyborg, G. Haar, H. Rott, J. Bang, E. Carstensen, M. Delius, F. Duck, P. Edmonds, L. Frizzell, M. Hogaki, M. Ide, T. Leighton, Douglas Miller, Royal Preston, M. Stratmeyer, H. Takeuchi, Y. Takeuchi, Roy Williams (1998)
World Federation for Ultrasound in Medicine and Biology, task group report for safety committee of the WFUMB: conclusions and recommendations on thermal and non-thermal mechanisms for biological effects of ultrasound
Chomdao Sinthuvanich, A. Veiga, K. Gupta, D. Gaspar, R. Blumenthal, J. Schneider (2012)
Anticancer β-hairpin peptides: membrane-induced folding triggers activity.
Journal of the American Chemical Society, 134 14
John McGowan, R. Chung, A. Maulik, I. Piotrowska, J Walker, D. Yellon (2017)
Anthracycline Chemotherapy and Cardiotoxicity
Cardiovascular Drugs and Therapy, 31
M. Cordeiro, Fábio Carlos, Pedro Pedrosa, A. López, P. Baptista (2016)
Gold Nanoparticles for Diagnostics: Advances towards Points of Care
Diagnostics, 6
Xueping Xie, Jinfeng Liao, X. Shao, Qianshun Li, Yunfeng Lin (2017)
The Effect of shape on Cellular Uptake of Gold Nanoparticles in the forms of Stars, Rods, and Triangles
Scientific Reports, 7
Leonardo Scarabelli, Marc Coronado-Puchau, J. Giner-Casares, J. Langer, L. Liz‐Marzán (2014)
Monodisperse gold nanotriangles: size control, large-scale self-assembly, and performance in surface-enhanced Raman scattering.
ACS nano, 8 6
Daniel Weadick, Juewen Liu (2015)
Phosphorothioate DNA Stabilized Fluorescent Gold and Silver Nanoclusters
Nanomaterials, 5
Shuwen Zeng, K. Yong, I. Roy, X. Dinh, Xia Yu, F. Luan (2011)
A Review on Functionalized Gold Nanoparticles for Biosensing Applications
Plasmonics, 6
Chiau-Yuang Tsai, A. Shiau, Shih-Yao Chen, Yu-Hung Chen, Pai-Chiao Cheng, Meng‐Ya Chang, Dong-Hwang Chen, C. Chou, Chrong-Reen Wang, Chao-Liang Wu (2007)
Amelioration of collagen-induced arthritis in rats by nanogold.
Arthritis and rheumatism, 56 2
B. Duncan, Chaekyu Kim, V. Rotello (2010)
Gold nanoparticle platforms as drug and biomacromolecule delivery systems.
Journal of controlled release : official journal of the Controlled Release Society, 148 1
Chenyang Zhao, Rui Cheng, Zhe Yang, Z. Tian (2018)
Nanotechnology for Cancer Therapy Based on Chemotherapy
Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry, 23
Report on Cancer: Setting Priorities, Investing Wisely and Providing Care for All
Nardine Abadeer, C. Murphy (2016)
Recent Progress in Cancer Thermal Therapy Using Gold Nanoparticles
Journal of Physical Chemistry C, 120
H. Tu, Chi-Pang Wen, S. Tsai, W. Chow, C. Wen, Y. Ye, Hua Zhao, M. Tsai, Maosheng Huang, C. Dinney, C. Tsao, Xifeng Wu (2018)
Cancer risk associated with chronic diseases and disease markers: prospective cohort study
The BMJ, 360
Guangcun Yang, Zhiming Liu, Yi Li, Yuqing Hou, Xixi Fei, Chengkang Su, Songmao Wang, Z. Zhuang, Zhouyi Guo (2017)
Facile synthesis of black phosphorus-Au nanocomposites for enhanced photothermal cancer therapy and surface-enhanced Raman scattering analysis.
Biomaterials science, 5 10
S. Barnett, G. Haar, M. Ziskin, W. Nyborg, K. Maeda, J. Bang (1994)
Current status of research on biophysical effects of ultrasound.
Ultrasound in medicine & biology, 20 3
Xiaju Cheng, Rui Sun, Ling Yin, Z. Chai, Haibin Shi, Mingyuan Gao (2017)
Light‐Triggered Assembly of Gold Nanoparticles for Photothermal Therapy and Photoacoustic Imaging of Tumors In Vivo
Advanced Materials, 29
Yongbo Peng, Zilong Zhao, Teng Liu, Xiong Li, Xiaoxiao Hu, Xiao-ping Wei, Xiaobing Zhang, W. Tan (2017)
Smart Human-Serum-Albumin-As2 O3 Nanodrug with Self-Amplified Folate Receptor-Targeting Ability for Chronic Myeloid Leukemia Treatment.
Angewandte Chemie, 56 36
S. Labala, P. Mandapalli, Abhinav Kurumaddali, V. Venuganti (2015)
Layer-by-layer polymer coated gold nanoparticles for topical delivery of imatinib mesylate to treat melanoma.
Molecular pharmaceutics, 12 3
Shaobo Ruan, Chuan Hu, Xian Tang, Xingli Cun, Wei Xiao, Kairong Shi, Qin He, Huile Gao (2016)
Increased Gold Nanoparticle Retention in Brain Tumors by in Situ Enzyme-Induced Aggregation.
ACS nano, 10 11
Jingxing Guo, Yunlong Chen, Yongjia Jiang, H. Ju (2017)
Polyadenine-Modulated DNA Conformation Monitored by Surface-Enhanced Raman Scattering (SERS) on Multibranched Gold Nanoparticles and Its Sensing Application.
Chemistry, 23 39
Xingya Jiang, Bujie Du, Yingyu Huang, Mengxiao Yu, Jie Zheng (2020)
Cancer Photothermal Therapy with ICG-conjugated Gold Nanoclusters.
Bioconjugate chemistry
Rinat Meir, Katerina Shamalov, O. Betzer, M. Motiei, Miryam Horovitz-Fried, R. Yehuda, A. Popovtzer, R. Popovtzer, C. Cohen (2015)
Nanomedicine for Cancer Immunotherapy: Tracking Cancer-Specific T-Cells in Vivo with Gold Nanoparticles and CT Imaging.
ACS nano, 9 6
Zhe Wang, Xiangping Deng, Jinsong Ding, Wenhu Zhou, Xing Zheng, Guotao Tang (2018)
Mechanisms of drug release in pH-sensitive micelles for tumour targeted drug delivery system: A review.
International journal of pharmaceutics, 535 1-2
A. Saeed, Josep Sánchez, C. O’Sullivan, M. Abbas (2017)
DNA biosensors based on gold nanoparticles-modified graphene oxide for the detection of breast cancer biomarkers for early diagnosis.
Bioelectrochemistry, 118
Abhik Mallick, P. More, Sougata Ghosh, Rohan Chippalkatti, B. Chopade, M. Lahiri, Sudipta Basu (2015)
Dual drug conjugated nanoparticle for simultaneous targeting of mitochondria and nucleus in cancer cells.
ACS applied materials & interfaces, 7 14
Hongrun Jin, Dawei Li, N. Zhang, Zhen Gu, Yitao Long (2015)
Analyzing Carbohydrate-Protein Interaction Based on Single Plasmonic Nanoparticle by Conventional Dark Field Microscopy.
ACS applied materials & interfaces, 7 22
Helin Liu, Nickisha Pierre-Pierre, Q. Huo (2012)
Dynamic light scattering for gold nanorod size characterization and study of nanorod–protein interactions
Gold Bulletin, 45
S. Labala, A. Jose, Sumeet Chawla, M. Khan, Shubhmita Bhatnagar, O. Kulkarni, V. Venuganti (2017)
Effective melanoma cancer suppression by iontophoretic co-delivery of STAT3 siRNA and imatinib using gold nanoparticles.
International journal of pharmaceutics, 525 2
Yanchun Wei, Li Quan, Chao Zhou, Qiuqiang Zhan (2018)
Factors relating to the biodistribution & clearance of nanoparticles & their effects on in vivo application.
Nanomedicine, 13 12
Martyna Janicka, J. Gubernator (2017)
Use of nanotechnology for improved pharmacokinetics and activity of immunogenic cell death inducers used in cancer chemotherapy
Expert Opinion on Drug Delivery, 14
M. Pérez-Ortiz, C. Zapata-Urzúa, G. Acosta, A. Álvarez-Lueje, F. Albericio, M. Kogan (2017)
Gold nanoparticles as an efficient drug delivery system for GLP-1 peptides.
Colloids and surfaces. B, Biointerfaces, 158
A. Meola, J. Rao, Navjot Chaudhary, Mayur Sharma, Steven Chang (2018)
Gold Nanoparticles for Brain Tumor Imaging: A Systematic Review
Frontiers in Neurology, 9
Yu Cai, Pingping Liang, Qianyun Tang, Xiaoyan Yang, Weili Si, Wei Huang, Qi Zhang, Xiaochen Dong (2017)
Diketopyrrolopyrrole-Triphenylamine Organic Nanoparticles as Multifunctional Reagents for Photoacoustic Imaging-Guided Photodynamic/Photothermal Synergistic Tumor Therapy.
ACS nano, 11 1
Jasmina Cheung-Lau, Dage Liu, K. Pulsipher, Wei-Ren Liu, I. Dmochowski (2014)
Engineering a well-ordered, functional protein-gold nanoparticle assembly.
Journal of inorganic biochemistry, 130
A. Ariza-Garcia, M. Lozano-Lozano, N. Galiano-Castillo, P. Postigo-Martín, M. Arroyo-Morales, I. Cantarero-Villanueva (2019)
A Web-Based Exercise System (e-CuidateChemo) to Counter the Side Effects of Chemotherapy in Patients With Breast Cancer: Randomized Controlled Trial
Journal of Medical Internet Research, 21
S. Perrault, C. Walkey, T. Jennings, H. Fischer, W. Chan (2009)
Mediating tumor targeting efficiency of nanoparticles through design.
Nano letters, 9 5
C. Walkey, Jonathan Olsen, Fayi Song, Rong Liu, Hongbo Guo, Wesley Olsen, Y. Cohen, A. Emili, W. Chan (2014)
Protein corona fingerprinting predicts the cellular interaction of gold and silver nanoparticles.
ACS nano, 8 3
Mengmeng Sun, Dong Peng, Hanjun Hao, Jin Hu, Dongliang Wang, Kun Wang, Jing Liu, Xi-min Guo, Yen Wei, Weiping Gao (2017)
Thermally Triggered in Situ Assembly of Gold Nanoparticles for Cancer Multimodal Imaging and Photothermal Therapy.
ACS applied materials & interfaces, 9 12
Jooho Park, Yongwhan Choi, Hyeyoun Chang, W. Um, J. Ryu, I. Kwon (2019)
Alliance with EPR Effect: Combined Strategies to Improve the EPR Effect in the Tumor Microenvironment
Theranostics, 9
Hyung Kim, Dong Lee (2018)
Near-Infrared-Responsive Cancer Photothermal and Photodynamic Therapy Using Gold Nanoparticles
Polymers, 10
S. Feng, Rong Chen, Juqiang Lin, Jianji Pan, Yanan Wu, Yong-zeng Li, Jiesi Chen, H. Zeng (2011)
Gastric cancer detection based on blood plasma surface-enhanced Raman spectroscopy excited by polarized laser light.
Biosensors & bioelectronics, 26 7
Bo He, Dan Yang, Mengmeng Qin, Y. Zhang, Bing He, Wenbing Dai, Xueqing Wang, Qiang Zhang, Hua Zhang, C. Yin (2017)
Increased cellular uptake of peptide-modified PEGylated gold nanoparticles.
Biochemical and biophysical research communications, 494 1-2
Guosheng Song, Liang Cheng, Y. Chao, Kai Yang, Zhuang Liu (2017)
Emerging Nanotechnology and Advanced Materials for Cancer Radiation Therapy
Advanced Materials, 29
Wanwan Li, Xiaoyuan Chen (2015)
Gold nanoparticles for photoacoustic imaging.
Nanomedicine, 10 2
Harshita Mishra, P. Mishra, A. Ekielski, M. Jaggi, Z. Iqbal, S. Talegaonkar (2018)
Melanoma treatment: from conventional to nanotechnology
Journal of Cancer Research and Clinical Oncology, 144
Yao Dou, Xiaoming Yang (2013)
Novel high-sensitive fluorescent detection of deoxyribonuclease I based on DNA-templated gold/silver nanoclusters.
Analytica chimica acta, 784
Jaejung Song, Jeesu Kim, Sekyu Hwang, Mansik Jeon, Sanghwa Jeong, Chulhong Kim, Sungjee Kim (2016)
"Smart" gold nanoparticles for photoacoustic imaging: an imaging contrast agent responsive to the cancer microenvironment and signal amplification via pH-induced aggregation.
Chemical communications, 52 53
Xiaohong Zhao, Li Yang, Jianguo Hu, Jigang Ruan (2010)
miR-138 might reverse multidrug resistance of leukemia cells.
Leukemia research, 34 8
M. Delaunay, J. Cadranel, A. Lusque, N. Meyer, Valérie Gounaut, D. Moro-Sibilot, J. Michot, J. Raimbourg, N. Girard, F. Guisier, D. Planchard, A. Metivier, P. Tomasini, É. Dansin, M. Pérol, M. Campana, O. Gautschi, M. Früh, Jean-David Fumet, C. Audigier-Valette, S. Couraud, S. Dalle, M. Leccia, M. Jaffro, S. Collot, G. Prévôt, J. Milia, J. Mazières (2017)
Immune-checkpoint inhibitors associated with interstitial lung disease in cancer patients
, 50
A. Sud, B. Kinnersley, R. Houlston (2017)
Genome-wide association studies of cancer: current insights and future perspectives
Nature Reviews Cancer, 17
Nana Gegechkori, Lindsay Haines, Jenny Lin (2017)
Long-Term and Latent Side Effects of Specific Cancer Types.
The Medical clinics of North America, 101 6
Priyanka Singh, S. Pandit, V. Mokkapati, Abhroop Garg, Vaishnavi Ravikumar, I. Mijakovic (2018)
Gold Nanoparticles in Diagnostics and Therapeutics for Human Cancer
International Journal of Molecular Sciences, 19
Hyung Kim, Dong Lee (2016)
Photothermal therapy with gold nanoparticles as an anticancer medication
Journal of Pharmaceutical Investigation, 47
Suveen Kumar, Saurabh Kumar, Sachchidanand Tiwari, S. Augustine, S. Srivastava, B. Yadav, B. Malhotra (2016)
Highly sensitive protein functionalized nanostructured hafnium oxide based biosensing platform for non-invasive oral cancer detection
Sensors and Actuators B-chemical, 235
Yi-Ping Li (2003)
TNF-α is a mitogen in skeletal muscle
American Journal of Physiology-cell Physiology, 285
Xing Ma, Qiuyu Qu, Yun Zhao, Zhong Luo, Yang Zhao, K. Ng, Yanli Zhao (2013)
Graphene oxide wrapped gold nanoparticles for intracellular Raman imaging and drug delivery.
Journal of materials chemistry. B, 1 47
M. Hostetler, Julia Wight, C. Zhong, Jay Harris, R. Vachet, M. Clark, J. Londono, S. Green, J. Stokes, G. Wignall, G. Glish, M. Porter, Neal Evans, R. Murray (1998)
Alkanethiolate Gold Cluster Molecules with Core Diameters from 1.5 to 5.2 nm: Core and Monolayer Properties as a Function of Core Size
Langmuir, 14
You Lee, Eun-young Ahn, Youmie Park (2019)
Shape-dependent cytotoxicity and cellular uptake of gold nanoparticles synthesized using green tea extract
Nanoscale Research Letters, 14
Rajiu Venkatesan, Arunkumar Pichaimani, Kalpana Hari, Preetha Balasubramanian, J. Kulandaivel, K. Premkumar (2013)
Doxorubicin conjugated gold nanorods: a sustained drug delivery carrier for improved anticancer therapy.
Journal of materials chemistry. B, 1 7
D. Gaspar, A. Veiga, Chomdao Sinthuvanich, J. Schneider, M. Castanho (2012)
Anticancer peptide SVS-1: efficacy precedes membrane neutralization.
Biochemistry, 51 32
Jieke Yan, Yuzhen Wang, Xufeng Zhang, Shuangde Liu, C. Tian, Hong-wei Wang (2016)
Targeted nanomedicine for prostate cancer therapy: docetaxel and curcumin co-encapsulated lipid–polymer hybrid nanoparticles for the enhanced anti-tumor activity in vitro and in vivo
Drug Delivery, 23
C. Farny, Tianmin Wu, R. Holt, T. Murray, Ronald Roy (2005)
Nucleating cavitation from laser-illuminated nano-particles
Acoustics Research Letters Online-arlo, 6
Lili Mats, Fiona Logue, R. Oleschuk (2016)
"Particle-Free" Magnetic Actuation of Droplets on Superhydrophobic Surfaces Using Dissolved Paramagnetic Salts.
Analytical chemistry, 88 19
G. Canavese, A. Ancona, L. Racca, M. Canta, B. Dumontel, Federica Barbaresco, T. Limongi, V. Cauda (2018)
Nanoparticle-assisted ultrasound: A special focus on sonodynamic therapy against cancer
Chemical engineering journal (Lausanne, Switzerland : 1996), 340
Sulin Zhang, Huajian Gao, G. Bao (2015)
Physical Principles of Nanoparticle Cellular Endocytosis.
ACS nano, 9 9
V. Bertolino, G. Cavallaro, G. Lazzara, M. Merli, S. Milioto, F. Parisi, L. Sciascia (2016)
Effect of the Biopolymer Charge and the Nanoclay Morphology on Nanocomposite Materials
Industrial & Engineering Chemistry Research, 55
Moustafa Ali, Yue Wu, M. El-Sayed (2019)
Gold-Nanoparticle-Assisted Plasmonic Photothermal Therapy Advances Toward Clinical Application
The Journal of Physical Chemistry C
P. Falagan-Lotsch, Elissa Grzincic, C. Murphy (2017)
New Advances in Nanotechnology-Based Diagnosis and Therapeutics for Breast Cancer: An Assessment of Active-Targeting Inorganic Nanoplatforms.
Bioconjugate chemistry, 28 1
Alexander Cryer, A. Thorley (2019)
Nanotechnology in the diagnosis and treatment of lung cancer.
Pharmacology & therapeutics, 198
Peng Wang, Lingmin Zhang, Wenfu Zheng, L. Cong, Zhaorong Guo, Yangzhouyun Xie, Le Wang, Rongbing Tang, Qiang Feng, Yoh Hamada, K. Gonda, Zhijian Hu, Xiaochun Wu, Xingyu Jiang (2018)
Thermo-triggered Release of CRISPR-Cas9 System by Lipid-Encapsulated Gold Nanoparticles for Tumor Therapy.
Angewandte Chemie, 57 6
M. Demaria, Monique O’Leary, Jianhui Chang, Lijian Shao, Su Liu, F. Alimirah, Kristin Koenig, Catherine Le, N. Mitin, A. Deal, S. Alston, Emmeline Academia, Sumner Kilmarx, Alexis Valdovinos, Boshi Wang, A. Bruin, B. Kennedy, S. Melov, Daohong Zhou, N. Sharpless, H. Muss, J. Campisi (2017)
Cellular Senescence Promotes Adverse Effects of Chemotherapy and Cancer Relapse.
Cancer discovery, 7 2
Hui Liu, Han Wang, Yanhong Xu, Mingwu Shen, Jing-long Zhao, Guixiang Zhang, Xiangyang Shi (2014)
Synthesis of PEGylated low generation dendrimer-entrapped gold nanoparticles for CT imaging applications.
Nanoscale, 6 9
W. Qian, Xiaohua Huang, B. Kang, M. El-Sayed (2010)
Dark-field light scattering imaging of living cancer cell component from birth through division using bioconjugated gold nanoprobes.
Journal of biomedical optics, 15 4
D. Giljohann, D. Seferos, Weston Daniel, Matthew Massich, Pinal Patel, C. Mirkin (2010)
Gold nanoparticles for biology and medicine.
Angewandte Chemie, 49 19
Rong Deng, Bai Ji, Hongliang Yu, Wei Bao, Zhuoqi Yang, Ying Yu, Yahan Cui, Yangyang Du, Meiyu Song, Shujun Liu, K. Meguellati, Fei Yan (2019)
Multifunctional Gold Nanoparticles Overcome MicroRNA Regulatory Network Mediated-Multidrug Resistant Leukemia
Scientific Reports, 9
Anshika Kapur, Scott Medina, Wentao Wang, G. Palui, J. Schneider, H. Mattoussi (2018)
Intracellular Delivery of Gold Nanocolloids Promoted by a Chemically Conjugated Anticancer Peptide
ACS Omega, 3
Yu-Chuan Ou, J. Webb, S. Faley, Daniel Shae, Eric Talbert, Sharon Lin, Camden Cutright, John Wilson, L. Bellan, Rizia Bardhan (2016)
Gold Nanoantenna-Mediated Photothermal Drug Delivery from Thermosensitive Liposomes in Breast Cancer
ACS Omega, 1
Dan Zhang, Tingting Wu, Xianya Qin, Qi Qiao, Lihuan Shang, Qingle Song, Conglian Yang, Zhiping Zhang (2019)
Intracellularly generated immunological gold nanoparticles for combinatorial photothermal therapy and immunotherapy against tumor.
Nano letters
A. Shanei, A. Sazgarnia (2019)
An overview of therapeutic applications of ultrasound based on synergetic effects with gold nanoparticles and laser excitation
Iranian Journal of Basic Medical Sciences, 22
Yiyun Cao, Yao He, Hui Liu, Yu Luo, Mingwu Shen, Jindong Xia, Xiangyang Shi (2015)
Targeted CT imaging of human hepatocellular carcinoma using low-generation dendrimer-entrapped gold nanoparticles modified with lactobionic acid.
Journal of materials chemistry. B, 3 2
Jonghwa Lee, Kyung-ju Choi, S. Moon, Soonhag Kim (2016)
Theragnosis-based combined cancer therapy using doxorubicin-conjugated microRNA-221 molecular beacon.
Biomaterials, 74
H. Maeda, Hideaki Nakamura, Jun Fang (2013)
The EPR effect for macromolecular drug delivery to solid tumors: Improvement of tumor uptake, lowering of systemic toxicity, and distinct tumor imaging in vivo.
Advanced drug delivery reviews, 65 1
J. Beik, Mohamadreza Asadi, S. Khoei, S. Laurent, Z. Abed, Mehri Mirrahimi, Ali Farashahi, R. Hashemian, H. Ghaznavi, A. Shakeri-Zadeh (2019)
Simulation-guided photothermal therapy using MRI-traceable iron oxide-gold nanoparticle.
Journal of photochemistry and photobiology. B, Biology, 199
Rachel Lynn, M. Poussin, A. Kalota, Yang Feng, P. Low, D. Dimitrov, D. Powell (2015)
Targeting of folate receptor β on acute myeloid leukemia blasts with chimeric antigen receptor-expressing T cells.
Blood, 125 22
K. Rao, Anuj Kumar, M. Suneetha, S. Han (2018)
pH and near-infrared active; chitosan-coated halloysite nanotubes loaded with curcumin-Au hybrid nanoparticles for cancer drug delivery.
International journal of biological macromolecules, 112
T. Tuziuti, K. Yasui, M. Sivakumar, Y. Iida, N. Miyoshi (2005)
Correlation between acoustic cavitation noise and yield enhancement of sonochemical reaction by particle addition.
The journal of physical chemistry. A, 109 21
Ganesh Khutale, A. Casey (2017)
Synthesis and characterization of a multifunctional gold‐doxorubicin nanoparticle system for pH triggered intracellular anticancer drug release
European Journal of Pharmaceutics and Biopharmaceutics, 119
Xuan Yang, Miaoxin Yang, Bo Pang, M. Vara, Younan Xia (2015)
Gold Nanomaterials at Work in Biomedicine.
Chemical reviews, 115 19
Wantong Song, A. Anselmo, Leaf Huang (2019)
Nanotechnology intervention of the microbiome for cancer therapy
Nature Nanotechnology, 14
Xuzhu Wang, Jundong Shao, Mustafa Raouf, Hanhan Xie, Hao Huang, Huaiyu Wang, P. Chu, Xuefeng Yu, Yang Yang, A. AbdEl-Aal, N. Mekkawy, R. Miron, Yufeng Zhang (2018)
Near-infrared light-triggered drug delivery system based on black phosphorus for in vivo bone regeneration.
Biomaterials, 179
Jingyi Zhu, Guoying Wang, Carla Alves, H. Tomás, Zhijuan Xiong, Mingwu Shen, João Rodrigues, Xiangyang Shi (2018)
Multifunctional Dendrimer-Entrapped Gold Nanoparticles Conjugated with Doxorubicin for pH-Responsive Drug Delivery and Targeted Computed Tomography Imaging.
Langmuir : the ACS journal of surfaces and colloids, 34 41
A. Neshastehriz, Mousa Tabei, Shayan Maleki, Samira Eynali, A. Shakeri-Zadeh (2017)
Photothermal therapy using folate conjugated gold nanoparticles enhances the effects of 6MV X-ray on mouth epidermal carcinoma cells.
Journal of photochemistry and photobiology. B, Biology, 172
Haji Bahadar, Faheem Maqbool, K. Niaz, M. Abdollahi (2016)
Toxicity of Nanoparticles and an Overview of Current Experimental Models
Iranian Biomedical Journal, 20
Navid Rabiee, S. Ahmadi, Zeynab Arab, M. Bagherzadeh, Moein Safarkhani, B. Nasseri, M. Rabiee, M. Tahriri, T. Webster, L. Tayebi (2020)
Aptamer Hybrid Nanocomplexes as Targeting Components for Antibiotic/Gene Delivery Systems and Diagnostics: A Review
International Journal of Nanomedicine, 15
S. Suarasan, M. Focșan, M. Potara, O. Sorițău, A. Florea, D. Maniu, S. Aștilean (2016)
Doxorubicin-Incorporated Nanotherapeutic Delivery System Based on Gelatin-Coated Gold Nanoparticles: Formulation, Drug Release, and Multimodal Imaging of Cellular Internalization.
ACS applied materials & interfaces, 8 35
E. Mostafavi, Pooneh Soltantabar, T. Webster (2019)
Nanotechnology and picotechnology
Biomaterials in Translational Medicine
H. Maeda, J. Wu, T. Sawa, Y. Matsumura, K. Hori (2000)
Tumor vascular permeability and the EPR effect in macromolecular therapeutics: a review.
Journal of controlled release : official journal of the Controlled Release Society, 65 1-2
E. Rozengurt, L. Heppel (1975)
A Specific effect of external ATP on the permeability of transformed 3T3 cells.
Biochemical and biophysical research communications, 67 4
Yi-Syun Shiao, Huai-hsuan Chiu, P. Wu, Yu‐Fen Huang (2014)
Aptamer-functionalized gold nanoparticles as photoresponsive nanoplatform for co-drug delivery.
ACS applied materials & interfaces, 6 24
J. Beik, M. Khateri, Z. Khosravi, S. Kamrava, Siavash Kooranifar, H. Ghaznavi, A. Shakeri-Zadeh (2019)
Gold nanoparticles in combinatorial cancer therapy strategies
Coordination Chemistry Reviews
Wei Tao, X. Ji, Xiaoding Xu, M. Islam, Zhongjun Li, Si Chen, P. Saw, Han Zhang, Z. Bharwani, Zilei Guo, Jinjun Shi, O. Farokhzad (2017)
Antimonene Quantum Dots: Synthesis and Application as Near-Infrared Photothermal Agents for Effective Cancer Therapy.
Angewandte Chemie, 56 39
Qingyan Jia, Jiechao Ge, Weimin Liu, Xiuli Zheng, Mengqi Wang, Hongyan Zhang, Pengfei Wang (2017)
Biocompatible Iron Phthalocyanine-Albumin Assemblies as Photoacoustic and Thermal Theranostics in Living Mice.
ACS applied materials & interfaces, 9 25
H. Abdel-Qadir, P. Austin, Douglas Lee, E. Amir, J. Tu, P. Thavendiranathan, K. Fung, G. Anderson (2017)
A Population-Based Study of Cardiovascular Mortality Following Early-Stage Breast Cancer
JAMA Cardiology, 2
Stefan Wilhelm, A. Tavares, Qin Dai, S. Ohta, J. Audet, H. Dvorak, W. Chan (2016)
Analysis of nanoparticle delivery to tumours
Nature Reviews Materials, 1
Chi Tang, A. Vaze, Min Shen, J. Rusling (2016)
High-Throughput Electrochemical Microfluidic Immunoarray for Multiplexed Detection of Cancer Biomarker Proteins.
ACS sensors, 1 8
Rachel Riley, E. Day (2017)
Gold nanoparticle-mediated photothermal therapy: applications and opportunities for multimodal cancer treatment.
Wiley interdisciplinary reviews. Nanomedicine and nanobiotechnology, 9 4
J. Kennedy (2005)
High-intensity focused ultrasound in the treatment of solid tumours
Nature Reviews Cancer, 5
Somayeh Deljoo, Navid Rabiee, M. Rabiee (2019)
Curcumin-hybrid Nanoparticles in Drug Delivery System (Review)
Asian Journal of Nanoscience and Materials
N. Nasab, Hassan Kumleh, M. Beygzadeh, S. Teimourian, M. Kazemzad (2018)
Delivery of curcumin by a pH-responsive chitosan mesoporous silica nanoparticles for cancer treatment
Artificial Cells, Nanomedicine, and Biotechnology, 46
Elnaz Shaabani, Maryam Sharifiaghdam, H. Keersmaecker, R. Rycke, S. Smedt, R. Faridi‐Majidi, K. Braeckmans, J. Fraire (2021)
Layer by Layer Assembled Chitosan-Coated Gold Nanoparticles for Enhanced siRNA Delivery and Silencing
International Journal of Molecular Sciences, 22
C. Peng, Lin-feng Zheng, Qian Chen, Mingwu Shen, Rui Guo, Han Wang, Xueyan Cao, Guixiang Zhang, Xiangyang Shi (2012)
PEGylated dendrimer-entrapped gold nanoparticles for in vivo blood pool and tumor imaging by computed tomography.
Biomaterials, 33 4
A. Albanese, C. Walkey, Jonathan Olsen, Hongbo Guo, A. Emili, W. Chan (2014)
Secreted biomolecules alter the biological identity and cellular interactions of nanoparticles.
ACS nano, 8 6
In-Cheol Sun, Diego Dumani, S. Emelianov (2017)
Ultrasound-guided photoacoustic imaging of lymph nodes with biocompatible gold nanoparticles as a novel contrast agent (Conference Presentation)
, 10078
Huan Deng, Zhiping Zhang (2018)
The application of nanotechnology in immune checkpoint blockade for cancer treatment
Journal of Controlled Release, 290
Zhenyu Sun, Yuqin Zhang, Haoyu Yu, Chao Yan, Yongchao Liu, Song Hong, Hengcong Tao, A. Robertson, Zhuo Wang, A. Pádua (2018)
New solvent-stabilized few-layer black phosphorus for antibacterial applications.
Nanoscale, 10 26
G. Curigliano, D. Lenihan, M. Fradley, Sarju Ganatra, A. Barac, A. Blaes, J. Herrmann, Charles Porter, A. Lyon, P. Lancellotti, Aarti Patel, J. DeCara, Joshua Mitchell, E. Harrison, J. Moslehi, R. Witteles, M. Calabró, R. Orecchia, E. Azambuja, J. Zamorano, R. Krone, Z. Iakobishvili, J. Carver, S. Armenian, B. Ky, D. Cardinale, C. Cipolla, Susan Dent, K. Jordan (2020)
Management of cardiac disease in cancer patients throughout oncological treatment: ESMO consensus recommendations.
Annals of oncology : official journal of the European Society for Medical Oncology, 31 2
Kulmeet Sandhu, C. McIntosh, J. Simard, Sallie Smith, V. Rotello (2002)
Gold nanoparticle-mediated transfection of mammalian cells.
Bioconjugate chemistry, 13 1
Negar Aminabad, M. Farshbaf, A. Akbarzadeh (2018)
Recent Advances of Gold Nanoparticles in Biomedical Applications: State of the Art
Cell Biochemistry and Biophysics, 77
J. Odhner, K. Tibbetts, Behzad Tangeysh, B. Wayland, R. Levis (2014)
Mechanism of Improved Au Nanoparticle Size Distributions Using Simultaneous Spatial and Temporal Focusing for Femtosecond Laser Irradiation of Aqueous KAuCl4
Journal of Physical Chemistry C, 118
T. Kunoh, M. Takeda, S. Matsumoto, I. Suzuki, M. Takano, H. Kunoh, J. Takada (2018)
Green Synthesis of Gold Nanoparticles Coupled with Nucleic Acid Oxidation
ACS Sustainable Chemistry & Engineering, 6
R. Yarchoan, T. Uldrick (2018)
HIV‐Associated Cancers and Related Diseases
The New England Journal of Medicine, 378
J. Beik, S. Khademi, N. Attaran, S. Sarkar, A. Shakeri-Zadeh, H. Ghaznavi, H. Ghadiri (2017)
A Nanotechnology-based Strategy to Increase the Efficiency of Cancer Diagnosis and Therapy: Folate-conjugated Gold Nanoparticles.
Current medicinal chemistry, 24 39
M. Tocut, R. Brenner, G. Zandman-Goddard (2018)
Autoimmune phenomena and disease in cancer patients treated with immune checkpoint inhibitors.
Autoimmunity reviews, 17 6
Yi-Ping Li (2003)
TNF-alpha is a mitogen in skeletal muscle.
American journal of physiology. Cell physiology, 285 2
P. Marmottant, S. Hilgenfeldt (2003)
Controlled vesicle deformation and lysis by single oscillating bubbles
Nature, 423
Jun Ma, Yue Liu, P. Gao, H. Zou, C. Huang (2016)
Precision improvement in dark-field microscopy imaging by using gold nanoparticles as an internal reference: a combined theoretical and experimental study.
Nanoscale, 8 16
Krishnendu Saha, Sarit Agasti, Chaekyu Kim, Xiaoning Li, V. Rotello (2012)
Gold nanoparticles in chemical and biological sensing.
Chemical reviews, 112 5
C. Fitzmaurice, T. Akinyemiju, F. Lami, Tahiya Alam, R. Alizadeh-Navaei, Christine Allen, U. Alsharif, N. Alvis-Guzmán, E. Amini, B. Anderson, O. Aremu, A. Artaman, S. Asgedom, Reza Assadi, T. Atey, L. Ávila-Burgos, A. Awasthi, Huda Saleem, A. Barać, James Bennett, I. Benseñor, N. Bhakta, H. Brenner, Lucero Cahuana-Hurtado, C. Castañeda-Orjuela, F. Catalá-López, J. Choi, D. Christopher, Sheng-Chia Chung, M. Curado, L. Dandona, R. Dandona, J. Neves, Subhojit Dey, S. Dharmaratne, D. Doku, T. Driscoll, M. Dubey, H. Ebrahimi, Dumessa Edessa, Z. El-Khatib, A. Endries, F. Fischer, Lisa Force, Kyle Foreman, S. Gebrehiwot, S. Gopalani, G. Grosso, Rahul Gupta, B. Gyawali, R. Hamadeh, S. Hamidi, James Harvey, H. Hassen, R. Hay, S. Hay, B. Heibati, Molla Hiluf, N. Horita, H. Hosgood, O Ilesanmi, K. Innos, F. Islami, M. Jakovljevic, Sarah Johnson, J. Jonas, A. Kasaeian, T. Kassa, Y. Khader, E. Khan, G. Khan, Y. Khang, Mohammad Khosravi, J. Khubchandani, J. Kopec, G. Kumar, Michael Kutz, D. Lad, A. Lafranconi, Q. Lan, Yirga Legesse, J. Leigh, S. Linn, R. Lunevicius, A. Majeed, R. Malekzadeh, D. Malta, L. Mantovani, B. McMahon, T. Meier, Y. Melaku, M. Melku, P. Memiah, W. Mendoza, T. Meretoja, H. Mezgebe, T. Miller, S. Mohammed, A. Mokdad, M. Moosazadeh, P. Moraga, Seyyed Mousavi, V. Nangia, C. Nguyen, V. Nong, F. Ogbo, A. Olagunju, Mahesh Pa, Eun‐Kee Park, Tejas Patel, David Pereira, F. Pishgar, M. Postma, F. Pourmalek, M. Qorbani, Anwar Rafay, S. Rawaf, D. Rawaf, G. Roshandel, S. Safiri, H. Salimzadeh, J. Sanabria, M. Milićević, B. Sartorius, Maheswar Satpathy, S. Sepanlou, K. Shackelford, M. Shaikh, M. Sharif-Alhoseini, Jun She, Min-Jeong Shin, I. Shiue, M. Shrime, A. Sinke, M. Sisay, Amber Sligar, M. Sufiyan, Bryan Sykes, R. Tabarés-Seisdedos, G. Tessema, R. Topor-Madry, T. Tran, B. Tran, K. Ukwaja, V. Vlassov, S. Vollset, E. Weiderpass, H. Williams, N. Yimer, N. Yonemoto, M. Younis, C. Murray, M. Naghavi (2018)
Global, Regional, and National Cancer Incidence, Mortality, Years of Life Lost, Years Lived With Disability, and Disability-Adjusted Life-Years for 29 Cancer Groups, 1990 to 2016
JAMA Oncology, 4
Ali Aghebati-Maleki, S. Dolati, M. Ahmadi, Amir Baghbanzhadeh, M. Asadi, A. Fotouhi, M. Yousefi, L. Aghebati-Maleki (2020)
Nanoparticles and cancer therapy: Perspectives for application of nanoparticles in the treatment of cancers
Journal of Cellular Physiology, 235
B. Angelov, A. Angelova, S. Filippov, M. Drechsler, P. Štěpánek, S. Lesieur (2014)
Multicompartment lipid cubic nanoparticles with high protein upload: millisecond dynamics of formation.
ACS nano, 8 5
M. Fleischmann, P. Hendra, A. McQuillan (1974)
Raman spectra of pyridine adsorbed at a silver electrode
Chemical Physics Letters, 26
Wenjie Yang, Huazheng Liang, Song Ma, De-shun Wang, Jun Huang (2019)
Gold nanoparticle based photothermal therapy: Development and application for effective cancer treatment
Sustainable Materials and Technologies
Ming Xu, Mahmoud Soliman, Xing Sun, B. Pelaz, N. Feliu, W. Parak, Sijin Liu (2018)
How Entanglement of Different Physicochemical Properties Complicates the Prediction of in Vitro and in Vivo Interactions of Gold Nanoparticles.
ACS nano, 12 10
J. Beik, Z. Abed, A. Shakeri-Zadeh, M. Nourbakhsh, M. Shiran (2016)
Evaluation of the sonosensitizing properties of nano-graphene oxide in comparison with iron oxide and gold nanoparticles
Physica E-low-dimensional Systems & Nanostructures, 81
Yingyun Tan, B. Yan, Lili Xue, Yi Li, Xianyang Luo, Ping Ji (2017)
Surface-enhanced Raman spectroscopy of blood serum based on gold nanoparticles for the diagnosis of the oral squamous cell carcinoma
Lipids in Health and Disease, 16
A. Serrano, B. Baeza-Raja, Eusebio Perdiguero, M. Jardí, P. Muñoz-Cánoves (2008)
Interleukin-6 is an essential regulator of satellite cell-mediated skeletal muscle hypertrophy.
Cell metabolism, 7 1
Livia Mendes, Jiayi Pan, V. Torchilin (2017)
Dendrimers as Nanocarriers for Nucleic Acid and Drug Delivery in Cancer Therapy
Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry, 22
T. Yu, Z. Wang, S. Jiang (2001)
Potentiation of cytotoxicity of adriamycin on human ovarian carcinoma cell line 3AO by low-level ultrasound.
Ultrasonics, 39 4
A. Pearce, M. Haas, R. Viney, Sallie-Anne Pearson, P. Haywood, Chris Brown, R. Ward (2017)
Incidence and severity of self-reported chemotherapy side effects in routine care: A prospective cohort study
PLoS ONE, 12
V. Bertolino, G. Cavallaro, G. Lazzara, S. Milioto, F. Parisi (2017)
Biopolymer-Targeted Adsorption onto Halloysite Nanotubes in Aqueous Media.
Langmuir : the ACS journal of surfaces and colloids, 33 13
H. Na, I. Song, T. Hyeon (2009)
Inorganic Nanoparticles for MRI Contrast Agents
Advanced Materials, 21
C. McIntosh, Edward Esposito, A. Boal, J. Simard, Craig Martin, V. Rotello (2001)
Inhibition of DNA transcription using cationic mixed monolayer protected gold clusters.
Journal of the American Chemical Society, 123 31

Publisher: Multidisciplinary Digital Publishing Institute
Copyright: © 1996-2021 MDPI (Basel, Switzerland) unless otherwise stated Disclaimer The statements, opinions and data contained in the journals are solely those of the individual authors and contributors and not of the publisher and the editor(s). MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Terms and Conditions Privacy Policy
ISSN: 2305-7084
DOI: 10.3390/chemengineering5040069
Publisher site: See Article on Publisher Site

Abstract

chemengineering Review Application of Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics 1 , 1 1 2 Andrey A. Vodyashkin * , Marko George Halim Rizk , Parfait Kezimana , Anatoly A. Kirichuk and Yaroslav M. Stanishevskiy Institute of Biochemical Technology and Nanotechnology, Peoples’ Friendship University of Russia (RUDN University), 6 Miklukho-Maklaya Street, 117198 Moscow, Russia; rizk_m@pfur.ru (M.G.H.R.); kezipar@outlook.com (P.K.); stanishevskiy_yam@pfur.ru (Y.M.S.) Department of Forensic Ecology with the Course of Human Ecology, Peoples’ Friendship University of Russia (RUDN University), 6 Miklukho-Maklaya Street, 117198 Moscow, Russia; kirichuk-aa@rudn.ru * Correspondence: vodyashkin_aa@pfur.ru or av.andrey2013@yandex.ru Abstract: Several metal nanoparticles have been developed for medical application. While all have their beneﬁts, gold nanoparticles (AuNPs) are ideal in cancer therapy and diagnosis as they are chemically inert and minimally toxic. Several studies have shown the potential of AuNPs in the therapeutic ﬁeld, as photosensitizing agents in sonochemical and photothermal therapy and as drug delivery, as well as in diagnostics and theranostics. Although there is a signiﬁcant number of reviews on the application of AuNPs in cancer medicine, there is no comprehensive review on their application both in therapy and diagnostics. Therefore, considering the high number of studies on AuNPs’ applications, this review summarizes data on the application of AuNPs in cancer therapy and diagnostics. In addition, we looked at the inﬂuence of AuNPs’ shape and size on their biological properties. We also present the potential use of hybrid materials based on AuNPs in sonochemical Citation: Vodyashkin, A.A.; Rizk, and photothermal therapy and the possibility of their use in diagnostics. Despite their potential, M.G.H.; Kezimana, P.; Kirichuk, A.A.; the use of AuNPs and derivatives in cancer medicine still has some limitations. In this review, we Stanishevskiy, Y.M. Application of provide an overview of the biological, physicochemical, and legal constraints on using AuNPs in Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics. cancer medicine. ChemEngineering 2021, 5, 69. https://doi.org/10.3390/ Keywords: gold nanoparticles; cancer; diagnosis; therapy; drug delivery; theranostics; hybrid materials chemengineering5040069 Academic Editor: Jacek B. Jasinski 1. Introduction Received: 31 July 2021 Cancer is one of the most global and widespread health problems, as it is the second Accepted: 29 September 2021 leading cause of death globally [1,2]. However, conventional cancer treatments have severe Published: 16 October 2021 drawbacks and often fail to provide satisfactory results [3–10]. After traditional cancer therapy, patients usually take a long time to recover from side effects [10–15]. Moreover, Publisher’s Note: MDPI stays neutral most methods are not highly effective against cancer cells, and cancer chemotherapy with regard to jurisdictional claims in causes disorders in many body organs (heart, kidneys, bladder, nervous system, and published maps and institutional afﬁl- lungs) [16–19]. iations. In recent years, great interest has arisen in applying nanotechnology to diagnose and treat tumor diseases [20,21], mainly because nanotechnology can offer unique methods for the study and control of various biological and medical processes. Therefore, it provides high expectations of creating new techniques with a revolutionary impact on the diagnosis Copyright: © 2021 by the authors. and treatment of cancer [22,23]. Licensee MDPI, Basel, Switzerland. Currently, several varieties of nano-objects of biomedical signiﬁcance are in use, in- This article is an open access article cluding polymer nanoparticles, metal nanoparticles, liposomes, micelles, quantum dots, distributed under the terms and dendrimers, and nanoscale assemblies [24–29]. Among all of them, the use of nanoparticles conditions of the Creative Commons offers more potential in different medical applications [30,31], as shown by their success- Attribution (CC BY) license (https:// ful use as image-enhancing sensors, delivery agents, toxic agents (for example, for the creativecommons.org/licenses/by/ destruction of cancer cells), and diagnostic agents [32,33]. 4.0/). ChemEngineering 2021, 5, 69. https://doi.org/10.3390/chemengineering5040069 https://www.mdpi.com/journal/chemengineering ChemEngineering 2021, 5, 69 2 of 24 In addition, the use of nanoparticles can enhance the effect of various treatments when used in combination with them [34–36]. Moreover, in clinical oncology, there is a new trend of transition from monotherapy towards combination therapy in the presence of valuable nanomaterials [37–39], allowing interactions between different types of treatment and leading to a much more potent therapeutic effect than the separate use of the corresponding monotherapies [40–44]. AuNPs have become promising agents for the therapy and diagnosis of diseases [45,46], as they can passively accumulate and retain in the tumor site because of increased perme- ability and retention (EPR) arising from leaking vascular network and ineffective lymphatic drainage of tumor tissue [47,48]. Further, while many reviews highlight different beneﬁts of AuNPs in cancer medicine, our study presents the recent progress towards the therapeutic and diagnostic application of AuNPs and their derivatives in cancer medicine. However, with the biocompatibility and cytotoxicity of nanoparticles being more or less dependent on their shape and size, we also decided to add an overview of the impact of these two parameters on the applications of AuNPs. Therefore, the present review is divided into seven sections. The impact of the shape and size of AuNPs on their cytotoxicity and biocompatibility is reviewed in Section 2, “Form and Size Dependence on the Biological Properties of Gold Nanoparticles”. The therapeutic application of AuNPs is highlighted in Section 3 Drug Delivery. In the drug delivery section, we review the use of AuNPs in peptide and nucleic acids’ delivery and the potential of hybrid gold-based materials for drug delivery. We continue the review on recent progress in using AuNPs as photosensitizing agents in Section 4. Photothermal therapy and in Section 5. Sonochemical therapy, we also highlight the efﬁcacity of AuNPs in improving these therapeutic methods. In Section 6. Gold Nanoparticles as a Diagnostic Material, we describe the promising developments in the use of AuNPs in diagnosis and theranostics of oncological diseases. Finally, in Section 7. Current Major Restrictions on the Use of Gold Nanoparticles for Medical Purposes, we reviewed the current major restrictions on the use of gold nanoparticles for medical purposes including highlights of the main problems still to be resolved before the widespread use of AuNPs in cancer medicine. For this review, electronic scientiﬁc databases such as PubMed, Science Direct, Web of Science, Scopus, and Medline were used to analyze studies on AuNPs and their application in cancer medicine using keywords such gold nanoparticles, cancer, drug delivery, cancer therapy, cancer treatment, and diagnostics. Data were sorted from 2010 to provide the latest and most current information, but, when there was a need for more clariﬁcation, ulterior data were also used. 2. Form and Size Dependence on the Biological Properties of Gold Nanoparticles The application of gold nanoparticles (AuNPs) in anti-cancer therapy is inﬂuenced by many factors, as reviewed by Singh P. et al., 2018 [49]; among those factors are the preparation methods, the presence of stabilizing agents, surface charge, the presence of hydrophobic/hydrophilic groups on the surface, as well as the size and shape of the AuNPs. Currently, there are several studies on the preparation methods of AuNPs, including those with a modiﬁed surface by particular groups; so, in this review, we will not look at those different ways of preparing AuNPs, but will instead focus exclusively on the application of these gold nanoparticle-based materials products [49,50]. In recent years, studies have shown the impact of both the size and shape of AuNPs on their biological properties, especially their cytotoxicity, and owing to the EPR effect (enhanced permeability and retention effect), nanoparticles smaller than 200 nm can be used (Figure 1). However, particles smaller than 6 nm are quickly excreted by the kidneys, while for those in the region of 10–100 nm, their half-life increases with increasing size [50,51]. ChemEngineering 2021, 5, 69 3 of 24 ChemEngineering 2021, 5, x FOR PEER REVIEW 3 of 25 Figure 1. Owing to the EPR effect (enhanced permeability and retention effect), nanoparticles up Figure 1. Owing to the EPR effect (enhanced permeability and retention effect), nanoparticles up to 2 to 00200 nmnm cancan enter enter andand accum accumulate ulate in th in e the tumtumor or cellscells, , and and cause cause tumo tumor r cell de cell ath death (crea(cr ted eated with with Bio- Render.com). BioRender.com). In addition, studies show that, with inﬂammation, the endothelial lining of the blood In addition, studies show that, with inflammation, the endothelial lining of the blood v vessel essel wa wall ll iis s m mor ore e pe permeable rmeable th than an iin n n normal ormal co conditions, nditions, so so pa particles rticles o of f 1 10 0 to to 2 200 00 n nm m iin n si size ze ca can n lleave eave th the e b bloodstr loodstre eam am a and nd a accumulate ccumulate i inside nside th the e i interstitial nterstitial tissues. tissues. Moreover, different organs accumulate particles of a particular shape; for example, the Moreover, different organs accumulate particles of a particular shape; for example, preferred localization of irregularly shaped nanoparticles is the spleen and the lungs for rod- the preferred localization of irregularly shaped nanoparticles is the spleen and the lungs shaped particles, but the exact mechanism of this preference is still unknown [52,53]. Finally, for rod-shaped particles, but the exact mechanism of this preference is still unknown the impact of their shape is also closely related to their movement in the bloodstream. [52,53]. Finally, the impact of their shape is also closely related to their movement in the From studies on the effect of size and shape on the biodistribution of AuNPs after bloodstream. intravenous administration, we note the following: From studies on the effect of size and shape on the biodistribution of AuNPs after i(a) ntravThe enous size adand minishape stration str , we ongly note af th fect e fo the llow kinetics ing: of accumulation and excretion of (AuNPs a) The si in ze ﬁltering and sha or pe gans; strongly affect the kinetics of accumulation and excretion of A (b) uNPs Spherical in filteri and ng o star rga-shaped ns; AuNPs showed the same percentage of accumulation, but (others b) Spher localize ical anin d st the ar-liver; shaped AuNPs showed the same percentage of accumulation, b (c) ut oth Only ers lstellate ocalize (or in th star e li -shaped) ver; AuNPs can accumulate in the lungs; (d) Changes in geometry did not improve the passage of the blood–brain barrier. Overall, (c) Only stellate (or star-shaped) AuNPs can accumulate in the lungs; the study is a reliable starting point for the synthesis and functionalization of potential (d) Changes in geometry did not improve the passage of the blood–brain barrier. candidates for theranostic purposes in many research areas [54]. Overall, the study is a reliable starting point for the synthesis and functionalization of potential candidates for theranostic purposes in many research areas [54]. In addition to the accumulation and distribution of gold nanoparticles within the In addition to the accumulation and distribution of gold nanoparticles within the body, their cytotoxicity is assessed depending on their shape and size. Studies show body, their cytotoxicity is assessed depending on their shape and size. Studies show that that cytotoxicity also depends on these parameters. For example, the toxicity tests on cytotoxicity also depends on these parameters. For example, the toxicity tests on three three different forms of chitosan-coated gold nanoparticles (nanospheres, nanostars, and d nanor ifferent ods) forms showed of chi that, tosan even -coated at low gold concentrations, nanoparticles (like nano 8sph M erAu, es, nnanor anosta ods rs, aexhibited nd nano- ro cytotoxicity ds) showed [ 55 th]. at, Mor even eover at lo,w the con IC centra value tions, was like 127.1 8 μM A M u, Au nanfor orod nanospher s exhibited es cyto against tox- HepG2 cells, 81.8 M Au for nanostars, and 22.7 M Au for nanorods, thus showing icity [55]. Moreover, the IC50 value was 127.1 μM Au for nanospheres against HepG2 cells, 8 that 1.8 μ nanor M Au ods for ar ne an the ostmost ars, an cytotoxic, d 22.7 μM followed Au for n by ano nro anostars, ds, thus sh and owi nanospher ng that n es—the anorods least are cytotoxic to HepG2 cells [56]. the most cytotoxic, followed by nanostars, and nanospheres—the least cytotoxic to HepG2 In addition, analysis on cellular uptake of nanoparticles showed that it is also de- cells [56]. pendent on the shape, with a study of the absorption of AuNPs (5 M Au—a non-toxic In addition, analysis on cellular uptake of nanoparticles showed that it is also de- concentration in four types of cancer cells) showing the highest absorption for nanospheres pendent on the shape, with a study of the absorption of AuNPs (5 μM Au—a non-toxic (58.0%), followed by nanorods (52.7%) and nanostars (41.5%). Therefore, not only cyto- concentration in four types of cancer cells) showing the highest absorption for nano- toxicity (nanorods > nanostars > nanospheres), but also the level of cellular absorption spheres (58.0%), followed by nanorods (52.7%) and nanostars (41.5%). Therefore, not only (nanospheres > nanorods > nanostars) depend on the shape of the particles [57]. cytotoxicity (nanorods > nanostars > nanospheres), but also the level of cellular absorption The cytotoxicity of different shapes of AuNPs (rods, stars, and spheres) have also been (nanospheres > nanorods > nanostars) depend on the shape of the particles [57]. analyzed on human cells using in vitro model cells—hFOB 1.19, 143B, MG63, and hTERT- The cytotoxicity of different shapes of AuNPs (rods, stars, and spheres) have also HPNE. The results showed that the IC values were the lowest in 143B cell compared been analyzed on human cells using in vitro model cells—hFOB 1.19, 143B, MG63, and with hFOB 1.19 and MG63 cell lines. AuNPs induced apoptosis in human osteosarcoma in hTERT-HPNE. The results showed that the IC50 values were the lowest in 143B cell ChemEngineering 2021, 5, 69 4 of 24 both 143B and MG63, and AuNPs of all types penetrated the cell membrane and caused ultrastructural changes. AuNPs-nanostars were more cytotoxic to 143B, while hFOB 1.19 cells were more resistant to AuNPs-nanostars (2.5 and 5 g/mL). After exposure to a low concentration of AuNPs-nanostars (0.3 and 0.6 g/mL), hFOB 1.19 and MG63 cells had a similar survival rate. In the MTT test, AuNPs signiﬁcantly reduced the viability of hFOB 1.19, MG63, and 143B cells. The neutral-red uptake analysis (NR analysis) showed that hFOB 1.19 are resistant to the cytotoxic effect of AuNPs-rods at concentrations of 0.3 to 2.5 g/mL, MG63 to AuNPs-rods at the concentration of 0.3 to 0.6 g/mL, and 143B cells to AuNPs-rods at the concentration of 0.3–1.2 g/mL. The AuNPs-spheres were the least cytotoxic compared with the other nanoparticles. MTT tests showed that AuNPs-spheres did not reduce the viability of hFOB1.19 and MG-63 cells. In contrast, the NR assay showed no statistically signiﬁcant effect of AuNPs-spheres on the viability of hFOB1.19, MG63, and 143B cells over the analyzed concentration range. Thus, AuNPs-nanostars were the most cytotoxic, and thus have the highest anti-cancer potential, while AuNPs-spheres have the lowest anti-cancer potential [58]. An analysis of the catalytic activity of AuNPs showed that it is dependent on their size, as Suchomel P. et al. found that decreasing the size causes an increase in the catalytic activity of AuNPs obtained by the reduction of HAuCl with maltose in the presence of Tween 80 [59]. Other properties of AuNPs have also been studied, such as their biological proper- ties based on in vivo and in vitro results. It has been shown that their physicochemical properties can be explained by their hydrodynamic diameter and their zeta potential [60]. However, in an analysis of multidimensional set, no direct relationship between physico- chemical parameters and biological properties was established [61,62], which is most likely because of a large number of parameters that are difﬁcult to take into account and makes it difﬁcult to predict the biological effect of AuNPs in the case of a simultaneous change in several physicochemical properties [63,64]. The results of several studies show that the shape, size, surface charge, and presence of special groups have an impact on the potential and effectivity of AuNPs, so it should be recommended that nano-objects are specially developed for the intended application taking into account all its subtleties, as it would increase the efﬁciency of AuNPs in therapy or diagnosis of the disease. 3. Drug Delivery The ability to customize AuNPs makes it possible to create particles of various core diameters with complete control over size dispersion [65]. Owing to the high surface area to volume ratio, dense loading of ligands with multiple functions involved in therapy, diagnosis, and targeting can be anchored to the surface of AuNPs [66]. There are two main types of anchoring of drugs to the surface of nanoparticles: 1. Conjugation (attachment to the surface of a nanoparticle through linker molecules); 2. Sorption (ﬁxation on the surface due to non-covalent bonds and the developed surface of nanoparticles). Hostetler et al. demonstrated the covalent conjugation of almost 100 molecules with one AuNP with a core diameter of 2 nm [67]. In addition, the delicate surface treatment of AuNPs with different multifunctional monolayers provides ideal functional diversity, making them a versatile platform for drug delivery [68]. The most efﬁcient cellular uptake occurs for particles ranging in size from 25 to 50 nm. In addition, a study on in vivo uptake of AuNPs and their passive accumulation in the tumor showed that the penetration of nanoparticles through the interstitial space of a tumor is highly size-dependent. While the larger AuNPs accumulate near the vasculature, the smaller AuNPs rapidly diffuse from the vasculature and are distributed throughout the tumor matrix [69]. There are two main types of targeted drug delivery: ChemEngineering 2021, 5, 69 5 of 24 1. Passive transfer (delivery is carried out in areas of increased permeability, which cancer cells often have); 2. Active transfer (accumulation in the tumor due to the binding of a speciﬁc ligand and a damage marker). A critical factor in drug delivery is the EPR effect, which occurs because of the extrava- sation of macromolecules or nanoparticles through the tumor ’s blood vessels. Nanoprobe delivery based on the EPR effect is also helpful for tumor imaging agents using ﬂuorescent or radio nuclei in nanoprobes [70]. Several researchers have conﬁrmed that extravasation through EPR does not have a reverse mechanism, so an object penetrating inside is delayed for a long time [45,46]. Cur- rently, there are some mechanisms aimed at improving the EPR effect and the treatment’s effectiveness; one of them is a combination of pharmacological and physical methods of treatment [48,71]. 3.1. Peptide Delivery Given the potential of peptides as drugs, nanoparticles of different sizes from 1 to 100 nm have been used to deliver peptides into cells to improve their therapeutic effect. Pérez-Ortiz M. et al. showed that AuNPs synthesized by reducing HAuCl with sodium citrate could serve as a basis for creating a glucagon-like peptide from conjugates, which can be used as a drug. This method helps increase the peptide half-life and drug stability. They found that the complex of nanoparticles and peptides had no effect on the integrity of tight junctions and had no adverse impact on the metabolic activity (viability) of intestinal epithelial cells after 2 and 20 months. Their study also showed that the modiﬁcation with polyethylene glycol improves biocompatibility with biological barriers and increases the efﬁciency of the conjugate absorption, which indicates that AuNPs are highly promising for delivering peptide drugs [72]. Other researchers have also shown the potential of AuNPs in peptide delivery, as they synthesized AuNPs by reduction with tannin and sodium citrate, after which they functionalized PEG together with peptides PFV (CALNNPFVYLI) or R8 (CALRRRRRRRR) [73]. Data on cellular uptake at 4 C show that nanoparticles enter cells through energy- dependent endocytosis, which has been studied on nanoparticles of 10 to 100 nm in size [74]. In addition, nanoparticles with peptides can inhibit macropinocytosis by blocking the sodium–proton exchange. Most nanoparticles with peptides are absorbed by cells in the pathways of clathrin-mediated endocytosis and micropinocytosis, and it was revealed that they had increased cellular uptake in comparison with conventional nanoparticles, which should undoubtedly be used in the design of various delivery systems for the treatment of multiple diseases [75–77]. Kapur A. et al. used the complexes of peptides with gold nanoparticles and nanorods for direct translocation across the plasma membrane [78], showing that those peptides could help avoid the limitations currently encountered during the delivery of nano-objects into tumor cells. In addition, the complex of AuNPs and peptides can also be used as a biosensor inside the cell, thanks to the high electronic contrast provided by AuNPs [79,80]. 3.2. Nucleic Acid Delivery Another class of compounds that are promising in treating various diseases, includ- ing cancer diseases, is nucleic acids. To attach oligonucleotides to gold nanoparticles, covalent functionalization with thiol-modiﬁed oligonucleotides is used [81,82]. A layer of nucleic acids on the surface of gold nanoparticles inhibits the action of nucleases, and thus preserves the payload. The non-covalent interaction of nucleic acids and gold nanoparti- cles is used to deliver unmodiﬁed nucleic acids useful for gene therapy [83,84]. For the successful application of this method, it is important to consider several factors, such as carrier/nucleotide size, surface charge, and surface hydrophobicity [85]. Kunoh T. et al. showed in their green biosynthesis of AuNPs using Leptothrix cells (iron-oxidizing bacteria) that nucleic acids bind to ready-made gold nanoparticles and ChemEngineering 2021, 5, 69 6 of 24 participate in the formation of nanoparticles, acting as a reducing agent and a coating agent [86]. Furthermore, they showed that ﬁne-grained spherical AuNPs could be formed owing to the oxidation of the guanine fragment without the need for any reducing agents or physical modiﬁcations, which makes this material very promising for medical applica- tions [87,88]. AuNPs can also be obtained by reduction with chitosan combined with siRNA STAT3 0 0 on its surface (sense sequence: 5 AAAUGAAGGUGGUGGAGAAUU3 ; antisense sequence: 0 0 5 UUCUCCACCACCUUCAUUUUU3 ) and imatinib for one hour [87]. Intratumoral delivery of siRNA STAT3 and imatinib with AuNPs showed a decrease in tumor weight by 45% and in intramuscular load by 30% [88]. In vitro studies have demonstrated that co-delivery of the two drugs (siRNA STAT3 and imatinib) signiﬁcantly reduces cell viability compared with siRNA STAT3 or imatinib alone. In the absence of a nucleotide portion, there was no effect on tumors. Therefore, the created complex hybrid material shows high efﬁciency in suppressing melanoma cancer [89]. Several researchers have developed AuNPs by reducing sodium citrate and function- alizing them through thiol modiﬁcations at the 5 -end of anti-221 nucleotides, miR-221 inhibitor, and AS1411 aptamer, a guanine-rich oligonucleotide that can form stable G- quadruplex structures for speciﬁc targeting of nucleolin, which is overexpressed on the surface of leukemic cells [90–92]. Such AuNPs were modiﬁed with PEG and loaded with doxorubicin. This hybrid material counteracts miR-221/p-glycoprotein-dependent mul- tidrug resistance in leukemia and sensitizes primary blasts in leukemic patients with a chemoresistant relapse to doxorubicin [93–96]. This method for oligonucleotide drug delivery in combination with doxorubicin is a unique antileukemic strategy that induces apoptosis of cancer cells and leads to the restoration of the expression of tumor suppressors p27kip1 and p15ink4b, as well as to a miR-221-mediated decrease in the expression of P-glycoprotein [97]. In a recent study, Saravanakumar K. et al. used AuNPs of 50 nm in size and spher- ical and hexagonal shape, obtained by incubation with the protein extract of the fungi Trichoderma harzianum. They modiﬁed them using the APT aptamer (AS1411). Cytotoxicity analysis showed that the modiﬁcation with APT aptamer increased cytotoxicity in lung cancer and human brain tumor cell lines compared with normal cells NIH3T3 because of a lower expression of nucleolin in the plasma membrane of normal cells NIH3T3 and higher expression of nucleolin in cancer cells. In addition, the crude protein content of Trichoderma was also associated with the toxicity of AuNPs to malignant cells. In addition, their results show that, during the action of AuNPs on cells, an excessive amount of ROS is released, causing damage to the nucleus and cell death and that fungal crude protein- coated gold nanoparticles functionalized with aptamer (APT-FE-AuNPs) bind to nucleolin in the plasma membrane of cancer cells and trigger apoptosis and necrosis (Figure 2) [98]. AuNPs have also been used in combination with biopolymers, capable of being incorporated into the human body and metabolized to deliver nucleic acids. A recent study shows the process of assembling a hybrid material based on AuNPs by reducing HAuCl4 in the presence of chitosan, which acts as a capping agent, thus obtaining chitosan-coated AuNPs of 20 nm on average. Those nanoparticles were used to deliver siRNA. The results show that, in addition to the high stability of the obtained particles in biological systems, there is increased efﬁciency in releasing the therapeutic agent and high absorption by cells owing to endocytosis. Cytotoxicity relative to lung epithelial cells H1299-eGFP, as well as suppression of biomarker signals, indicated a high efﬁciency of siRNA delivery using the developed system (Figure 3) [99]. ChemEngineering 2021, 5, x FOR PEER REVIEW 7 of 25 ChemEngineering 2021, 5, 69 7 of 24 ChemEngineering 2021, 5, x FOR PEER REVIEW 7 of 25 Figure 2. Schematic illustration of nucleolin targeted delivery of APT-FE-AuNPs to improve cyto- toxicity in cancer cells [98]. AuNPs have also been used in combination with biopolymers, capable of being in- corporated into the human body and metabolized to deliver nucleic acids. A recent study shows the process of assembling a hybrid material based on AuNPs by reducing HAuCl4 in the presence of chitosan, which acts as a capping agent, thus obtaining chitosan-coated AuNPs of 20 nm on average. Those nanoparticles were used to deliver siRNA. The results show that, in addition to the high stability of the obtained particles in biological systems, there is increased efficiency in releasing the therapeutic agent and high absorption by cells owing to endocytosis. Cytotoxicity relative to lung epithelial cells H1299-eGFP, as well as suppre Figure 2. ssSchematic ion of bioillustration marker sign of a nucleolin ls, indica tar ted geted a hi delivery gh efficof iency APTo -FE-AuNPs f siRNA dto eli impr very ove usi cytotox- ng the Figure 2. Schematic illustration of nucleolin targeted delivery of APT-FE-AuNPs to improve cyto- d icity tev oxici el in o ty pe cancer in d c sy ancells st cer em ( c[ el 98 ls Fi ]. [gure 98]. 3) [99]. AuNPs have also been used in combination with biopolymers, capable of being in- corporated into the human body and metabolized to deliver nucleic acids. A recent study shows the process of assembling a hybrid material based on AuNPs by reducing HAuCl4 in the presence of chitosan, which acts as a capping agent, thus obtaining chitosan-coated AuNPs of 20 nm on average. Those nanoparticles were used to deliver siRNA. The results show that, in addition to the high stability of the obtained particles in biological systems, there is increased efficiency in releasing the therapeutic agent and high absorption by cells owing to endocytosis. Cytotoxicity relative to lung epithelial cells H1299-eGFP, as well as suppression of biomarker signals, indicated a high efficiency of siRNA delivery using the developed system (Figure 3) [99]. Fig Figure ure 3 3. . S Schematic chematic r rep epr res esentation entation of of t the he chitosan-coated chitosan-coated AuNPs AuNPs for for siRNA siRNA delivery delivery [[9 99 9]. ]. 3.3. Hybrid Gold-Based Materials for Drug Delivery Recently, hybrid materials based on AuNPs have become more promising for anti- cancer drug delivery, as an example of the complex of AuNPs with gallauseite nanotubes. This complex is prepared with biological methods, giving it a tremendous advantage for biomedical purposes [100–103]. Several methods can be used to attach AuNPs to a drug-using particular group, such as a pH-sensitive linker. Such a type of attachment of the drug to AuNPs allows the intracellular release of the drug from the nanoparticle to be triggered when they enter the acidic organelles (Figure 4) [104]. AuNPs, developed through a modiﬁcation with polyethylene glycol and conjugated with doxorubicin using a hydrazine linker, were used Figure 3. Schematic representation of the chitosan-coated AuNPs for siRNA delivery [99]. to release a model drug (doxorubicin). The drug release was found to be dependent on ChemEngineering 2021, 5, 69 8 of 24 ChemEngineering 2021, 5, x FOR PEER the REV pH IEW of the medium, as at pH 7.4, after incubation for 48 h, only 20% of the drug9was of 25 released, and at pH 5, more than 80% was released. Figure 4. (A) Schematic illustration of doxorubicin (DOX)-tethered responsive gold nanoparticles Figure 4. (A) Schematic illustration of doxorubicin (DOX)-tethered responsive gold nanoparticles and (B) their cooperation between enhanced doxorubicin cellular entry and a responsive intracellu- and (B) their cooperation between enhanced doxorubicin cellular entry and a responsive intracellular lar release of doxorubicin into the cells to overcome drug resistance [104]. release of doxorubicin into the cells to overcome drug resistance [104]. 4. Photothermal Therapy The attachment of doxorubicin to the surface of AuNPs protects it from P-gp efﬂux, thus increasing the retention of doxorubicin in cells [105,106], and that combined with Photothermal therapy (PTT) is one of the non-surgical methods based on the use of high drug loading capacity and effective drug release under pH control combined with the particular photosensitizing substances, which selectively accumulate in pathologic cells advantage of multimodal visualization inside cells show the high potential of this delivery and increase their sensitivity to light. Photothermal therapy has several advantages over system in medicine [107]. Furthermore, drug delivery systems, by binding cytotoxic drugs other methods, for example, high efficiency in the treatment of skin cancer, the absence of to the surface of AuNPs through an acid–labile bond, have demonstrated their potential to complicated procedures in preparation for treatment, and the possibility of using it in inhibit the growth of cancer cells (for instance, MCF-7/ADR) owing to the high efﬁciency of hard-to-reach places [123]. cellular uptake through endocytosis and subsequent acid-dependent release in cells [108]. Usually, PTT is carried out in two stages (Figure 5): the introduction of a photosensi- Our literature analysis also showed another hybrid system—a complex of AuNPs tizer drug into the tumor area (or vein) and its accumulation in cancer cells, after which with dendrimer G5-FD conjugated with doxorubicin [109–111]. Further, it has been demon- the tumor area is irradiated with a laser with a specific wavelength [124]. strated that such a complex has a therapeutic effect and provides targeted inhibition of FAR-expressing cancer cells [112,113]. AuNPs (20–25 nm) modiﬁed with PEG and carboxylated dendrimer PAMAM G4 have also been used to deliver doxorubicin [114]. While nanoparticles have shown high stability over a wide pH range [115,116], Wang F. et al. in their work established a relationship between drug release at different pH, with more than 50% of doxorubicin released in an acidic medium (pH 4), thus suggesting a high efﬁciency against cancer cells [104]. Apart from doxorubicin, the drug delivery ability of AuNP-based hybrid materials was tested by loading it with the model drug, curcumin; it was found that, at pH 5.5, about ChemEngineering 2021, 5, 69 9 of 24 95% of curcumin was released within 48 h, and at pH 7.4, only 10% was released. Thus, conﬁrming that hybrid nanoparticles have a pH-dependent drug delivery process and are more efﬁcient in the acidic medium [117–121]. Drug release from nanosystems is controlled; ﬁrst, it enters the cytoplasm, accumulates in the lysosomes, and then, after 24 h, the drug is released from the lysosomes going into the cell nucleus [45]. Thus, the new multifunctional nanosystem based on AuNPs may provide a unique platform for intracellularly releasing an anti-cancer drug at tumor sites. AuNPs coated with a platinum layer and modiﬁed with the cRGD peptide of various sizes were loaded with doxorubicin. Yang Q. et al. showed in their in vivo experiments the effectiveness of the complex AuNPs-DOX comparison with free doxorubicin [122]. The antitumor properties of the complex were additionally conﬁrmed by immunohistochemi- cal/immunoﬂuorescence analysis of tumor tissues during various treatments. Furthermore, the complex showed high absorption in the near-infrared range, which was used for pho- tothermal therapy and showed a high degree of inhibition of MDA-MB-231 tumor with a low level of laser radiation (1.5 W/cm for 5 min) and a low dose of medication. This complex has combined therapeutic functions, including an antioxidant effect on injuries caused by oxidative stress. It may be an ideal candidate for maximizing the results of chemothermal therapy, compensating for their adverse effects [122]. 4. Photothermal Therapy Photothermal therapy (PTT) is one of the non-surgical methods based on the use of particular photosensitizing substances, which selectively accumulate in pathologic cells and increase their sensitivity to light. Photothermal therapy has several advantages over other methods, for example, high efﬁciency in the treatment of skin cancer, the absence of complicated procedures in preparation for treatment, and the possibility of using it in hard-to-reach places [123]. ChemEngineering 2021, 5, x FOR PEER REVIEW 10 of 25 Usually, PTT is carried out in two stages (Figure 5): the introduction of a photosensi- tizer drug into the tumor area (or vein) and its accumulation in cancer cells, after which the tumor area is irradiated with a laser with a speciﬁc wavelength [124]. Figure 5. Schematic illustration of PTT on skin cancer (created with BioRender.com). Figure 5. Schematic illustration of PTT on skin cancer (created with BioRender.com). AuNPs actively absorb radiation in the near-infrared range owing to the relative AuNPs actively absorb radiation in the near-infrared range owing to the relative transparency of the human body and its large surface area, and these properties are transparency of the human body and its large surface area, and these properties are the the reason for the use of AuNPs in PTT [125,126]. Upon absorption of light energy, the reason for the use of AuNPs in PTT [125,126]. Upon absorption of light energy, the pho- photosensitizer excites the surrounding oxygen molecules into the singlet state, destroying tosensitizer excites the surrounding oxygen molecules into the singlet state, destroying cells by oxidation. Thus, for AuNPs, there is intense heating of cells, followed by their cells by oxidation. Thus, for AuNPs, there is intense heating of cells, followed by their death. The depth of light penetration increases as its spectrum shifts to the red region, death. The depth of light penetration increases as its spectrum shifts to the red region, so so the development of photosensitizers based on metal NPs, including AuNPs, activated the development of photosensitizers based on metal NPs, including AuNPs, activated by by infrared radiation, should increase the depth of the photodynamic effect by several infrared radiation, should increase the depth of the photodynamic effect by several times times [127,128]. [127,128]. An ideal candidate for a photothermal therapy role requires several conditions [129–133]: An ideal candidate for a photothermal therapy role requires several conditions [129– (i) nanoparticles of suitable size and uniform shape; 133]: (ii) possessing a good dispersibility in aqueous solutions; (i) nanoparticles of suitable size and uniform shape; (ii) possessing a good dispersibility in aqueous solutions; (iii) respond to near-infrared light in range (650–950 nm) to prevent damage to surround- ing healthy tissue, to ensure sufficient photothermal efficiency, and to ensure enough penetration depth; (iv) sufficiently photostable to allow adequate diffusion time to reach tumors before los- ing their light sensitivity; (v) exhibit low or no cytotoxicity in living systems. Gold is already used as a therapeutic method in nanomedicine, with colloidal gold, covalently linked to adenovirus vectors, used to selectively target cancer and induce hy- perthermia by near-infrared (NIR) laser radiation. Moreover, gold nanoparticles have sev- eral advantages that make them suitable for photothermal cancer treatments [134,135]: (1) The ability to focus on the local region of the tumor while minimizing non-specific distribution; (2) They can be activated through near-infrared (NIR) laser light, creating the ability to penetrate deep into biological tissues; (3) They can be modulated to create multifaceted drug delivery systems and cancer photothermal therapy. Several studies have proposed a unique hybrid material based on AuNPs and black phosphorus. Black phosphorus (BP), a new type of two-dimensional nanomaterial, has received serious attention in recent years thanks to its excellent properties and enormous potential in various chemical, physical, and biological fields [136,137]. The hybrid material is obtained by sonicating black phosphorus suspension, mixing it in boiling water with a HAuCl4 solution for 2 min. Finally, the solution is centrifuged to obtain gold nanoparticles in black phosphorus (BP-AuNPs). To assess the potential of BP-AuNPs, both in vivo and in vitro experiments showed encouraging results, with BP-AuNPs for 4 h inducing a more severe photothermal damage and 75% of cancer cells being destroyed after incubation with 30 μg/mL. Furthermore, the in vivo experiment with 4T1 mammary tumors in mice showed that photothermal treatment of tumors with BP-AuNPs provides high therapeutic ChemEngineering 2021, 5, 69 10 of 24 (iii) respond to near-infrared light in range (650–950 nm) to prevent damage to surround- ing healthy tissue, to ensure sufﬁcient photothermal efﬁciency, and to ensure enough penetration depth; (iv) sufﬁciently photostable to allow adequate diffusion time to reach tumors before losing their light sensitivity; (v) exhibit low or no cytotoxicity in living systems. Gold is already used as a therapeutic method in nanomedicine, with colloidal gold, covalently linked to adenovirus vectors, used to selectively target cancer and induce hyperthermia by near-infrared (NIR) laser radiation. Moreover, gold nanoparticles have several advantages that make them suitable for photothermal cancer treatments [134,135]: (1) The ability to focus on the local region of the tumor while minimizing non-speciﬁc distribution; (2) They can be activated through near-infrared (NIR) laser light, creating the ability to penetrate deep into biological tissues; (3) They can be modulated to create multifaceted drug delivery systems and cancer photothermal therapy. Several studies have proposed a unique hybrid material based on AuNPs and black phosphorus. Black phosphorus (BP), a new type of two-dimensional nanomaterial, has received serious attention in recent years thanks to its excellent properties and enormous potential in various chemical, physical, and biological ﬁelds [136,137]. The hybrid material is obtained by sonicating black phosphorus suspension, mixing it in boiling water with a HAuCl solution for 2 min. Finally, the solution is centrifuged to obtain gold nanoparticles in black phosphorus (BP-AuNPs). To assess the potential of BP-AuNPs, both in vivo and in vitro experiments showed encouraging results, with BP-AuNPs for 4 h inducing a more severe photothermal damage and 75% of cancer cells being destroyed after incubation with 30 g/mL. Furthermore, the in vivo experiment with 4T1 mammary tumors in mice showed that photothermal treatment of tumors with BP-AuNPs provides high therapeutic efﬁcacy without obvious neoplasms. Thus, the BP-AuNPs have an excellent photothermal effect and high antitumor activity, indicating their promising biomedicine potential [138]. AuNPs can also be used to increase the sensitivity of tumor cells to hyperthermia treatment, as proven by the work of Moradi S. et al. They analyzed the viability of Y79 cells 48 h after 0.5–11 min hyperthermia with and without AuNPs using MTT analysis and found that the percentage of cell viability was 50% after hyperthermia with AuNPs for 4.5 min; to achieve a similar effect without nanoparticles, it took 9 min. Thus, proving that AuNPs help increase tumor cells’ sensitivity to hyperthermia treatment [139]. Another latest advancement in the hyperthermal treatment of tumor diseases was Fe O nanoparticles coated with gold and silver shells. Colloidal solutions of magnetite 3 4 nanoparticles coated with gold and silver with 10–20 nm had a cytotoxic effect on HCT116 cells. Concentrations of 400 g/mL and 600 g/mL of the Fe O core with a shell of AuNPs 3 4 led to a decrease in the viability by about 40% and 55%, respectively [140]. 5. Sonochemical Therapy In recent years, scientists have widely explored various approaches in cancer therapy based on the action of ultrasound waves on the tumor [141]. There are a few studies on the use of ultrasound techniques in cancer control [142,143]. The therapeutic effect of ultrasound is based on its interaction with tissues, causing some biological effects [142]. There are three main methods of ultrasound therapy for tumor diseases (Table 1): high intensity focused ultrasound (HIFU), low-intensity ultrasound (LIU), and sonody- namic therapy (SDT) [144–147]. The biological effects of ultrasound are mainly caused by heat, mechanical stress, and cavitation (Figure 6) [148]. Inertial cavitation is consid- ered a more promising method of using ultrasound therapy as it does not cause thermal effects [149–151]. ChemEngineering 2021, 5, x FOR PEER REVIEW 11 of 25 efficacy without obvious neoplasms. Thus, the BP-AuNPs have an excellent photothermal effect and high antitumor activity, indicating their promising biomedicine potential [138]. AuNPs can also be used to increase the sensitivity of tumor cells to hyperthermia treatment, as proven by the work of Moradi S. et al. They analyzed the viability of Y79 ChemEngineering 2021, 5, 69 11 of 24 cells 48 h after 0.5–11 min hyperthermia with and without AuNPs using MTT analysis and found that the percentage of cell viability was 50% after hyperthermia with AuNPs for 4.5 min; to achieve a similar effect without nanoparticles, it took 9 min. Thus, proving that A Table uNPs 1. Main help methods increase of tum ultrasound or cells’therapy sensitiv for ity to cancer hy .perthermia treatment [139]. Another latest advancement in the hyperthermal treatment of tumor diseases was Ultrasound Therapy Fe3O4 nanoparticles coated with gold and silver shells. Colloidal solutions of magnetite Type of Therapy Intensity, W/cm Frequency Effect Features nanoparticles coated with gold and silver with 10–20 nm had a cytotoxic effect on HCT116 cells. Concentrations of 400 μg/mL and 600 μg/mL of the Fe3O4 core with a shell of AuNPs High intensity focused local overheating of the tissue with a 100–20,000 0.25–10 MHz heat to destroy cells ultrasound (HIFU) led to a decrease in the viability by about 40% and 55%, re temperatur spectively [ e fr1 om 40]60 . to 85 C increased the activity of 5. Sonochemical Therapy chemotherapeutic molecules in cancer therapy; used for direct action on cells In recent years, scientists have widely explored various approaches in cancer therapy slight heating, and their components (sonoporation); based on the action of ultrasound waves on the tumor [141]. There are a few studies on Low-intensity 0.1–5 1 Hz–100 kHz improved it has been used for the delivery or ultrasound (LIU) the use of ultrasound techniques in cancer control [142,143]. The therapeutic effect of ul- permeability transfection of genes and for trasound is based on its interaction with tissues, causing some biological effects [142]. accelerating tissue heating, as well as There are three main methods of ultrasound thera for py its foanti-vascular r tumor disea effect ses on (Ta the ble 1): neovascular network of the tumor high intensity focused ultrasound (HIFU), low-intensity ultrasound (LIU), and sono- dynamic therapy (SDT) [144–147]. The biological effects of ultrasound are mainly caused free radical nature the combined effect on the tumor of Sonodynamic by heat, mechanical stress, and ca associated vitation ( with Figure the 6) [148]. In ultrasound ertial caviand tatio chemical n is considered 1–10 0.5–2 MHz therapy (SDT) cavitation effects of non-medicinal compounds that a more promising method of using ultrasound therapy as it does not cause thermal effects ultrasound enhance the therapeutic effect [149–151]. Figure 6. Schematic illustration of sonochemical therapy (created with BioRender.com). Figure 6. Schematic illustration of sonochemical therapy (created with BioRender.com). The main application of nanoparticles in ultrasound therapy for cancer is reduced Table 1. Main methods of ultrasound therapy for cancer. to the formation of bubbles on their rough surface, which causes evaporation in the environment and, ther Ult eby rasou , vapor nd Tcavities herapy (Figure 7). The method of sonodynamic therapy seems to be very attractive because, owing to the high penetrating ability of ultrasound (up Type of Therapy Intensity, W/cm Frequency Effect Features to tens of centimeters, depending on the frequency), it allows acting on intensely localized tumors that are inaccessible for photodynamic therapy [152,153]. High intensity fo- heat to destroy local overheating of the tissue with Sonodynamic therapy uses the synergistic effect of a non-toxic and selective agent cused ultrasound 100–20,000 0.25–10 MHz cells a temperature from 60 to 85 C (sensitizer). AuNPs can have tremendous therapeutic effects, together with SDT, through (HIFU) biocompatibility, selectivity, and biodistribution [142]. An example of ultrasound therapy increased the activity of chemo- and AuNPs is the recovery after anti-cancer therapy involving active forms of oxygen- ROS. Victor et al. demonstrated that nanoparticles and ther therapeutic apeutic mo pulsed lecules ultrasound in cancer reduce the content of pro-inﬂammatory cytokines in tissues [154]. During the inﬂammatory slight heating, im- therapy; used for direct action on Low-intensity ul- phase of the healing process, ultrasound can activate immune cells to migrate to the injury 0.1–5 1 Hz–100 kHz proved permeabil- cells and their components (sono- trasound (LIU) site [155,156]. At the same time, gold compounds can suppress the expression of NF-B ity poration); it has been used for the and other inﬂammatory responses [157]. AuNPs can play a positive role after therapy with delivery or transfection of genes ROS participation, because, in combination with pulsed ultrasound, they reduce the effect and for accelerating tissue heating, of reactive oxidative forms on damaged tissues, thereby reducing the structural damage caused by this effect. Beik et al. compared the pine-sensitizing effect of nanographene oxide and AuNPs. They noted that the ultrasound-induced heating of AuNPs was much higher than that of nanographene, which, in combination with vectors that can direct the nanoparticle to the tumor (for example, folic acid and peptide vectors), are promising for targeted sonodynamic therapy [158]. ChemEngineering 2021, 5, x FOR PEER REVIEW 12 of 25 as well as for its anti-vascular effect on the neovascular network of the tumor free radical nature the combined effect on the tumor Sonodynamic associated with the of ultrasound and chemical non- 1–10 0.5–2 MHz therapy (SDT) cavitation effects of medicinal compounds that enhance ultrasound the therapeutic effect The main application of nanoparticles in ultrasound therapy for cancer is reduced to the formation of bubbles on their rough surface, which causes evaporation in the environ- ment and, thereby, vapor cavities (Figure 7). The method of sonodynamic therapy seems to be very attractive because, owing to the high penetrating ability of ultrasound (up to ChemEngineering 2021, 5, 69 12 of 24 tens of centimeters, depending on the frequency), it allows acting on intensely localized tumors that are inaccessible for photodynamic therapy [152,153]. Figure 7. Schematic illustration of the cavitation effect in the eukaryotic cell, with a demonstration of Figure 7. Schematic illustration of the cavitation effect in the eukaryotic cell, with a demonstration ROS secretion and cell membrane rupture (created with BioRender.com). of ROS secretion and cell membrane rupture (created with BioRender.com). 6. Gold Nanoparticles as a Diagnostic Material Sonodynamic therapy uses the synergistic effect of a non-toxic and selective agent One of the promising areas of application of gold nanoparticles is the diagnosis (sensitizer). AuNPs can have tremendous therapeutic effects, together with SDT, through and theranostics of oncological diseases. Furthermore, AuNPs are a practical choice for biocompatibility, selectivity, and biodistribution [142]. An example of ultrasound therapy biosensors and bioimaging applications because of their unique light absorption and and AuNPs is the recovery after anti-cancer therapy involving active forms of oxygen- scattering properties. In addition, the electrochemical response of AuNPs can be used as a ROS. Victor et al. demonstrated that nanoparticles and therapeutic pulsed ultrasound re- detection signal [159]. duce the content of pro-inflammatory cytokines in tissues [154]. During the inflammatory Raman imaging, the technique that uses non-emitting electromagnetic waves (near-IR phase of the healing process, ultrasound can activate immune cells to migrate to the injury spectrum) to obtain a chemical composition from the Raman spectrum of a sample [159], site [155,156]. At the same time, gold compounds can suppress the expression of NF-κB is used to assess the chemical composition of cells and tissues in the body and, therefore, and other inflammatory responses [157]. AuNPs can play a positive role after therapy with is used to track any change in the chemical structure due to tumor formation. AuNPs ROS participation, because, in combination with pulsed ultrasound, they reduce the effect are used to diagnose cancer owing to their surface-enhanced Raman scattering (SERS) effect [160,161]. They can also be used for rapid intracellular Raman imaging, increasing the sensitivity and selectivity of the method and monitoring changes in cell morphology during toxic-induced cell death [162]. While Raman imaging methods are already successfully used in cancer diagno- sis [163–166], Raman imaging diagnostics using AuNPs allow noticing speciﬁc differences related to speciﬁc components, reﬂecting different levels of nucleic acids, proteins, and lipids in cancers and normal serum [167]. For example, in a study with people with various oral cavity diseases, AuNPs allowed obtaining high-quality SERS-spectra of oral squamous cell carcinoma (OSCC) proteins, thus showing their efﬁciency in the diagnostics of OSCC. Thus, the Raman imaging method with AuNPs allows accurately determining the chemical composition of tissues and, therefore, diagnosing diseases and their localization with a high degree of probability. However, the methods’ sensitivity and effectiveness still depend on many factors, such as stage of the disease, localization of the disease, and the use or absence of additional agents. Moreover, AuNPs used in combination with graphene oxide can be the next generation of nanotherapeutics, with the SERS signal from graphene oxide wrapped gold nanoparticles ChemEngineering 2021, 5, 69 13 of 24 being used for intracellular Raman imaging in cancer cells, while an anti-cancer drug, attached to the nanoparticle, is being delivered into the cells [168]. Photoacoustic imaging (PAI), a biomedical analysis technique that provides practical information about the molecular characteristics of tissue, is a newly developed hybrid method of biomedical imaging for monitoring tumor angiogenesis and detecting skin melanoma, as well as monitoring and diagnosing other various neoplasms. Gold nanopar- ticles of different shapes are used in PAI, a method based on the absorption of waves and the subsequent generation of ultrasonic signals. Gold nanoparticles have great potential for use as biocompatible contrast agents, as reviewed in the work of Li W. and Chen, X. They suggest that the potential of AuNPs is due to their inherent and geometrically induced optical properties [169]. Moreover, as AuNPs are responsive to acidic environments, they can be used as imaging agents. Furthermore, they have a cancer-speciﬁc accumulation at the cellular level, and can thus provide an ampliﬁed signal for imaging cancer cells [170]. Another critical step is diagnosing metastasis, and biocompatible gold nanoparticles can be used as a contrast agent in diagnosing lymph-node-related diseases and metastasis, as they usually spread through the lymphatic system [171]. Dark-ﬁeld microscopy, the type of microscopy in which the image contrast is increased by registering only the light scattered by the studied sample, provides a unique opportunity to research living and unstained biological samples in detail. Gold is one of the best markers for dark-ﬁeld microscopy, which, combined with the properties of nanoparticles, can be a unique system for diagnosing tumor markers and a detailed study of tumor cells. Gold nanoparticles can be used as non-bleaching markers in dark-ﬁeld microscopy. They are also used to analyze carbohydrate–protein interaction, correlated with biological processes, such as cancer metastasis, in a method based on a single plasmonic nanoparticle by conventional dark ﬁeld microscopy [172]. Qian W. et al. showed that peptide conjugated AuNPs could be delivered to the cytoplasmic or nuclear region of a cell and used as light scattering contrast agents, thus enabling to track the complete cycle of cancer cells from birth to division [173]. Moreover, AuNPs have been used as an internal reference to reduce the deviations and ﬂuctuations from the dark-ﬁeld microscopy technique and improve the precision of the acquired data through post-data analysis [174]. Computed tomography (CT), the non-destructive layer-by-layer examination of the internal structure of tissue using X-ray radiation, is used for cell imaging. However, a more accurate image is obtained by injecting a contrast agent intravenously in the diagnosis of tumor diseases. Cao Y. et al. showed that gold nanoparticles could be used as a nanoscale contrast agent, as they used their dendrimer-entrapped AuNPs for targeted CT imaging of hepatocellular carcinoma (HCC), and their ﬂow cytometry results revealed that dendrimer-entrapped gold nanoparticles modiﬁed with lactobionic acid could speciﬁcally target HepG2 cells [175]. Furthermore, an in vivo cell tracking method using gold nanoparticles was developed and tested using a melanoma-speciﬁc T-cell receptor labeled with AuNPs. The AuNPs-labeled T-cells were injected intravenously into mice and, with CT imaging, they were able to study the distribution, migration, and kinetics of T- cells [176]. Apart from CT, other molecular imaging techniques used in cancer diagnostics, such as magnetic resonance imaging (MRI), have also beneﬁted from the development of targeted contrast agents, such as gold nanoparticles, which enables targeted imaging via site-speciﬁc accumulation of nanoparticles in the cells of interest [177,178]. In addition to the traditional diagnostic methods, various diagnostic and theranostics systems based on gold nanoparticles are currently being created, like a highly sensitive method for amplifying an enzyme signal using gold nanoparticles to detect a speciﬁc antigen in human serum. In addition, a smartphone application was developed for quick analysis of the results within 15 min, displaying them on the smartphone screen [179]. In addition, AuNPs are also used as carriers of the biorecognition of antibody aKLK3 and HRP-streptavidin/biotinylated poly-A-ssDNA sequences for the speciﬁc and sensitive analysis of KLK3, an important marker for the diagnosis of prostate cancer [180–182]. ChemEngineering 2021, 5, 69 14 of 24 A DNA biosensor based on a hybrid material consisting of graphene oxide and gold nanoparticles (Figure 8) was developed. It uses a sandwich hybridization assay by immo- bilizing a DNA probe on gold nanoparticles and capturing target DNA biomarkers [183]. The device is based on electrochemical DNA interactions, and its signal is measured by amperometric detection [184,185]. Using amperometric detection, breast cancer biomarkers were obtained with a sensitivity of 378 nA/nM and 219 nA/nM for the target ERBB2 and CD24, respectively, which is several times higher than the target content of these ChemEngineering 2021, 5, x FOR PEER REVIEW 15 of 25 compounds in the tumor [186]. Figure 8. Schematic illustration of a DNA sensor showing the hybrid material consisting of graphene Figure 8. Schematic illustration of a DNA sensor showing the hybrid material consisting of graphene oxide and gold nanoparticles and the hybridization of target DNA [183]. oxide and gold nanoparticles and the hybridization of target DNA [183]. 7. Current Major Restrictions on the Use of Gold Nanoparticles for Medical Purposes One of the most challenging tumor diseases to diagnose is brain cancer, but now, diagnostic 7.1. Toxicitand y: Safe theranostic ty Test systems based on gold nanoparticles are being actively created, as reviewed by Meola A. et al. [187]. Currently, there are several standard methods for assessing the toxicity/safety of na- noparticles in vitro. In addition, researchers have developed recommendations for deter- mining the toxicity of various nanoparticles [188]. However, these techniques are individ- ual for each type of nanoparticle and cannot be applied to more complex or hybrid mate- rials. This leads to uncertain and unpredictable results for real objects, leading to a lack of therapeutic/diagnostic action or being more detrimental to the body. As mentioned in the section on the effect of shape and size on the biological proper- ties of nanoparticles, there are a considerable number of factors affecting the toxicity of nanoparticles (size, shape, surface charge, and capping agents), and this complicates the possibility of developing an appropriate method for determining toxicity. In addition, it was reported that the toxicity does not depend only on the type of nanoparticles, but also on the target. For different tumor cells, the effect of gold nanoparticles occurs at different ChemEngineering 2021, 5, 69 15 of 24 In conclusion, AuNPs possess a unique structure that can be actively used both as a carrier of test systems and as a signal source for the diagnosis of tumor markers and an excellent contrast agent for various diagnostic methods currently used. 7. Current Major Restrictions on the Use of Gold Nanoparticles for Medical Purposes 7.1. Toxicity: Safety Test Currently, there are several standard methods for assessing the toxicity/safety of nanoparticles in vitro. In addition, researchers have developed recommendations for determining the toxicity of various nanoparticles [188]. However, these techniques are individual for each type of nanoparticle and cannot be applied to more complex or hybrid materials. This leads to uncertain and unpredictable results for real objects, leading to a lack of therapeutic/diagnostic action or being more detrimental to the body. As mentioned in the section on the effect of shape and size on the biological properties of nanoparticles, there are a considerable number of factors affecting the toxicity of nanopar- ticles (size, shape, surface charge, and capping agents), and this complicates the possibility of developing an appropriate method for determining toxicity. In addition, it was reported that the toxicity does not depend only on the type of nanoparticles, but also on the target. For different tumor cells, the effect of gold nanoparticles occurs at different concentrations. In this regard, it can be concluded that it is necessary to create several universal procedures (similar to GLP) that allow assessing the safety of nanoparticles in each speciﬁc case, which will be used for all similar objects around the world (personalized) [188–190]. 7.2. Adsorption from Physiological Media Size, developed surface, shape, and charge contribute to the adsorption of the protein on the surface of nanoparticles. Consequently, this leads to a change in physicochemical parameters and, thereby, worsens the therapeutic properties. Therefore, the development of new agents that would modify the surface could help realistically evaluate the properties of nanoparticles by their physicochemical properties [191]. In addition, several delivery methods that consider the formation of the corona protein and allow it to be used for various purposes are being developed [192,193]. 7.3. Pharmacodynamics: Pharmacokinetics Even though studies on gold nanoparticles are very relevant, there have still not been comprehensive studies on their kinetics, clearance, and biodistribution inside the organism. The lack of studies on the pharmacokinetics of gold nanoparticles inside the human body limits the possibility of the massive use of gold nanoparticles in treating tumor diseases. Analysis of these parameters is complicated by the difﬁculty of determining nanoparticles’ distribution in the organism, as experiments in vivo and in vitro do not give a complete picture of the biodistribution of nanoparticles within the organism. It is important to note that gold nanoparticles are a convenient object for studying inside the organism, compared with other nano-objects, owing to surface plasma resonance and a high extinction coefﬁcient [194]. 7.4. Low Efﬁciency Wilhelm S. et al. studied the nanoparticles’ delivery to tumors and found that, on average, only 0.7% of nanoparticles reach the cancer cells, and only in exceptional cases, nanoparticles reach the tumors in more than 5%. Furthermore, when nanoparticles are injected, the mononuclear phagocytic system (MPS) and the renal clearance pathway absorb most of the nanoparticles, drastically reducing the effectiveness and harming the MPS organs [195]. 7.5. Lack of Clinical Trials There are currently few clinical trials using gold nanoparticles (around 15 studies in https://clinicaltrials.gov (accessed on 5 September 2021 )), which do not yet allow ChemEngineering 2021, 5, 69 16 of 24 comprehensive research on various factors and indicators (clearance, biodistribution, and protein sorption), and thus limit the use of nanoparticles in medical practice. The onset of clinical trials could expand and clarify the therapeutic and diagnostic potential of nanoparticles. Still, they should be carried out after comprehensive safety and toxicity tests of these nanoparticles [196]. 8. Conclusions Cancer remains the most common cause of death currently. Hence, there is a need to develop new and improved cancer treatment and diagnosis, which requires new and modern approaches, and AuNPs can become one of these new approaches. Although there have been several scientiﬁc studies on NPs’ application in cancer medicine, studies on AuNPs’ use in cancer therapy and diagnostics are emerging. Therefore, in this review, we analyzed available data on the applications of AuNPs in oncotherapy and cancer diagnos- tics. Studies have shown that, while shape, size, and charge have a considerable impact on the properties of AuNPs, no direct correlation was found between those parameters and the effectiveness of AuNPs’ use in therapy. Moreover, for each type of tumor disease, a per- sonalized approach is required to establish the optimal physical and chemical parameters of AuNPs that will ensure maximum efﬁciency and safety. In therapy, AuNPs can effectively be used as delivery systems for various molecules, including high-molecular compounds. They can also be used as auxiliary agents for sonochemistry and sensitizers for photodynamic therapy. Thanks to their physicochemical properties, they are a very promising sensitizer for these therapeutic methods, which are most relevant for treating skin cancer, as they are highly effective and safe. In addition, AuNPs play a special role in the diagnosis and theranostics of tumor diseases, with several methods already developed for the diagnosis of diseases successfully using AuNPs as auxiliary agents and sensitizers. AuNPs and their hybrid materials derivatives are very promising components that will soon help in the early diagnosis of tumor markers. Although the beneﬁts of AuNPs in cancer medicine are visible, there remain several constraints that need to be studied, analyzed, and solved before any large-scale use of gold nanoparticles in the therapy and diagnosis of cancer, along with traditional drugs. Author Contributions: Methodology, A.A.V.; writing—original draft preparation, A.A.V. and P.K.; writing—review and editing, M.G.H.R., A.A.K. and Y.M.S. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Acknowledgments: This paper was supported by the RUDN University Strategic Academic Leader- ship Program. Conﬂicts of Interest: The authors declare no conﬂict of interest. References 1. World Health Organization. WHO Report on Cancer: Setting Priorities, Investing Wisely and Providing Care for All; World Health Organization: Geneva, Switzerland, 2020; ISBN 9789240001299. 2. Abdel-Qadir, H.; Austin, P.C.; Lee, D.S.; Amir, E.; Tu, J.V.; Thavendiranathan, P.; Fung, K.; Anderson, G.M. A Population-Based Study of Cardiovascular Mortality Following Early-Stage Breast Cancer. JAMA Cardiol. 2017, 2, 88–93. [CrossRef] [PubMed] 3. Sud, A.; Kinnersley, B.; Houlston, R.S. Genome-Wide Association Studies of Cancer: Current Insights and Future Perspectives. Nat. Rev. Cancer 2017, 17, 692–704. [CrossRef] [PubMed] 4. Global Burden of Disease Cancer Collaboration Global, Regional, and National Cancer Incidence, Mortality, Years of Life Lost, Years Lived with Disability, and Disability-Adjusted Life-Years for 29 Cancer Groups, 1990 to 2016: A Systematic Analysis for the Global Burden of Disease Study. JAMA Oncol. 2018, 4, 1553–1568. [CrossRef] ChemEngineering 2021, 5, 69 17 of 24 5. Cibula, D.; Pötter, R.; Planchamp, F.; Avall-Lundqvist, E.; Fischerova, D.; Haie-Meder, C.; Köhler, C.; Landoni, F.; Lax, S.; Linde- gaard, J.C.; et al. The European Society of Gynaecological Oncology/European Society for Radiotherapy and Oncology/European Society of Pathology Guidelines for the Management of Patients with Cervical Cancer. Virchows Arch. 2018, 472, 919–936. [CrossRef] 6. Tu, H.; Wen, C.P.; Tsai, S.P.; Chow, W.-H.; Wen, C.; Ye, Y.; Zhao, H.; Tsai, M.K.; Huang, M.; Dinney, C.P.; et al. Cancer Risk Associated with Chronic Diseases and Disease Markers: Prospective Cohort Study. BMJ 2018, 360, k134. [CrossRef] 7. Palesh, O.; Scheiber, C.; Kesler, S.; Mustian, K.; Koopman, C.; Schapira, L. Management of Side Effects during and Post-Treatment in Breast Cancer Survivors. Breast J. 2018, 24, 167–175. [CrossRef] 8. Zaorsky, N.G.; Churilla, T.M.; Egleston, B.L.; Fisher, S.G.; Ridge, J.A.; Horwitz, E.M.; Meyer, J.E. Causes of Death among Cancer Patients. Ann. Oncol. 2017, 28, 400–407. [CrossRef] 9. Yarchoan, R.; Uldrick, T.S. HIV-Associated Cancers and Related Diseases. N. Engl. J. Med. 2018, 378, 1029–1041. [CrossRef] 10. Tocut, M.; Brenner, R.; Zandman-Goddard, G. Autoimmune Phenomena and Disease in Cancer Patients Treated with Immune Checkpoint Inhibitors. Autoimmun. Rev. 2018, 17, 610–616. [CrossRef] 11. Delaunay, M.; Cadranel, J.; Lusque, A.; Meyer, N.; Gounant, V.; Moro-Sibilot, D.; Michot, J.-M.; Raimbourg, J.; Girard, N.; Guisier, F.; et al. Immune-Checkpoint Inhibitors Associated with Interstitial Lung Disease in Cancer Patients. Eur. Respir. J. 2017, 50, 1700050. [CrossRef] 12. Curigliano, G.; Lenihan, D.; Fradley, M.; Ganatra, S.; Barac, A.; Blaes, A.; Herrmann, J.; Porter, C.; Lyon, A.R.; Lancellotti, P.; et al. Management of Cardiac Disease in Cancer Patients throughout Oncological Treatment: ESMO Consensus Recommendations. Ann. Oncol. 2020, 31, 171–190. [CrossRef] [PubMed] 13. Pearman, T.P.; Beaumont, J.L.; Mroczek, D.; O’Connor, M.; Cella, D. Validity and Usefulness of a Single-Item Measure of Patient-Reported Bother from Side Effects of Cancer Therapy. Cancer 2018, 124, 991–997. [CrossRef] 14. Pearce, A.; Haas, M.; Viney, R.; Pearson, S.-A.; Haywood, P.; Brown, C.; Ward, R. Incidence and Severity of Self-Reported Chemotherapy Side Effects in Routine Care: A Prospective Cohort Study. PLoS ONE 2017, 12, e0184360. [CrossRef] 15. Demaria, M.; O’Leary, M.N.; Chang, J.; Shao, L.; Liu, S.; Alimirah, F.; Koenig, K.; Le, C.; Mitin, N.; Deal, A.M.; et al. Cellular Senescence Promotes Adverse Effects of Chemotherapy and Cancer Relapse. Cancer Discov. 2017, 7, 165–176. [CrossRef] 16. Ariza-Garcia, A.; Lozano-Lozano, M.; Galiano-Castillo, N.; Postigo-Martin, P.; Arroyo-Morales, M.; Cantarero-Villanueva, I. A Web-Based Exercise System (e-CuidateChemo) to Counter the Side Effects of Chemotherapy in Patients with Breast Cancer: Randomized Controlled Trial. J. Med. Internet Res. 2019, 21, e14418. [CrossRef] 17. Carlson, L.E.; Subnis, U.B.; Piedalue, K.-A.L.; Vallerand, J.; Speca, M.; Lupichuk, S.; Tang, P.; Faris, P.; Wolever, R.Q. The ONE-MIND Study: Rationale and Protocol for Assessing the Effects of ONlinE MINDfulness-Based Cancer Recovery for the Prevention of Fatigue and Other Common Side Effects during Chemotherapy. Eur. J. Cancer Care 2019, 28, e13074. [CrossRef] 18. Gegechkori, N.; Haines, L.; Lin, J.J. Long-Term and Latent Side Effects of Speciﬁc Cancer Types. Med. Clin. N. Am. 2017, 101, 1053–1073. [CrossRef] [PubMed] 19. McGowan, J.V.; Chung, R.; Maulik, A.; Piotrowska, I.; Walker, J.M.; Yellon, D.M. Anthracycline Chemotherapy and Cardiotoxicity. Cardiovasc. Drugs Ther. 2017, 31, 63–75. [CrossRef] 20. Mostafavi, E.; Soltantabar, P.; Webster, T.J. Nanotechnology and picotechnology. In Biomaterials in Translational Medicine; Elsevier: Amsterdam, The Netherlands, 2019; pp. 191–212. ISBN 9780128134771. 21. Chen, S.; Li, R.; Li, X.; Xie, J. Electrospinning: An Enabling Nanotechnology Platform for Drug Delivery and Regenerative Medicine. Adv. Drug Deliv. Rev. 2018, 132, 188–213. [CrossRef] [PubMed] 22. Abadeer, N.S.; Murphy, C.J. Recent Progress in Cancer Thermal Therapy Using Gold Nanoparticles. J. Phys. Chem. C Nanomater. Interfaces 2016, 120, 4691–4716. [CrossRef] 23. Song, W.; Anselmo, A.C.; Huang, L. Nanotechnology Intervention of the Microbiome for Cancer Therapy. Nat. Nanotechnol. 2019, 14, 1093–1103. [CrossRef] [PubMed] 24. Riaz, M.K.; Riaz, M.A.; Zhang, X.; Lin, C.; Wong, K.H.; Chen, X.; Zhang, G.; Lu, A.; Yang, Z. Surface Functionalization and Targeting Strategies of Liposomes in Solid Tumor Therapy: A Review. Int. J. Mol. Sci. 2018, 19, 195. [CrossRef] [PubMed] 25. Wang, Z.; Deng, X.; Ding, J.; Zhou, W.; Zheng, X.; Tang, G. Mechanisms of Drug Release in pH-Sensitive Micelles for Tumour Targeted Drug Delivery System: A Review. Int. J. Pharm. 2018, 535, 253–260. [CrossRef] [PubMed] 26. Tao, W.; Ji, X.; Xu, X.; Islam, M.A.; Li, Z.; Chen, S.; Saw, P.E.; Zhang, H.; Bharwani, Z.; Guo, Z.; et al. Antimonene Quantum Dots: Synthesis and Application as near-Infrared Photothermal Agents for Effective Cancer Therapy. Angew. Chem. Weinh. Bergstr. Ger. 2017, 129, 12058–12062. [CrossRef] 27. Palmerston Mendes, L.; Pan, J.; Torchilin, V.P. Dendrimers as Nanocarriers for Nucleic Acid and Drug Delivery in Cancer Therapy. Molecules 2017, 22, 1401. [CrossRef] 28. Jia, Q.; Ge, J.; Liu, W.; Zheng, X.; Wang, M.; Zhang, H.; Wang, P. Biocompatible Iron Phthalocyanine-Albumin Assemblies as Photoacoustic and Thermal Theranostics in Living Mice. ACS Appl. Mater. Interfaces 2017, 9, 21124–21132. [CrossRef] 29. Wang, P.; Zhang, L.; Zheng, W.; Cong, L.; Guo, Z.; Xie, Y.; Wang, L.; Tang, R.; Feng, Q.; Hamada, Y.; et al. Thermo-Triggered Release of CRISPR-Cas9 System by Lipid-Encapsulated Gold Nanoparticles for Tumor Therapy. Angew. Chem. Int. Ed. Engl. 2018, 57, 1491–1496. [CrossRef] 30. Daraee, H.; Eatemadi, A.; Abbasi, E.; Fekri Aval, S.; Kouhi, M.; Akbarzadeh, A. Application of Gold Nanoparticles in Biomedical and Drug Delivery. Artif. Cells Nanomed. Biotechnol. 2016, 44, 410–422. [CrossRef] ChemEngineering 2021, 5, 69 18 of 24 31. Cai, Y.; Liang, P.; Tang, Q.; Yang, X.; Si, W.; Huang, W.; Zhang, Q.; Dong, X. Diketopyrrolopyrrole-Triphenylamine Organic Nanoparticles as Multifunctional Reagents for Photoacoustic Imaging-Guided Photodynamic/Photothermal Synergistic Tumor Therapy. ACS Nano 2017, 11, 1054–1063. [CrossRef] 32. Aghebati-Maleki, A.; Dolati, S.; Ahmadi, M.; Baghbanzhadeh, A.; Asadi, M.; Fotouhi, A.; Youseﬁ, M.; Aghebati-Maleki, L. Nanoparticles and Cancer Therapy: Perspectives for Application of Nanoparticles in the Treatment of Cancers. J. Cell. Physiol. 2020, 235, 1962–1972. [CrossRef] 33. Xuan, M.; Shao, J.; Zhao, J.; Li, Q.; Dai, L.; Li, J. Magnetic Mesoporous Silica Nanoparticles Cloaked by Red Blood Cell Membranes: Applications in Cancer Therapy. Angew. Chem. Int. Ed. Engl. 2018, 57, 6049–6053. [CrossRef] [PubMed] 34. Mishra, H.; Mishra, P.K.; Ekielski, A.; Jaggi, M.; Iqbal, Z.; Talegaonkar, S. Melanoma Treatment: From Conventional to Nanotech- nology. J. Cancer Res. Clin. Oncol. 2018, 144, 2283–2302. [CrossRef] [PubMed] 35. Candido, N.M.; de Melo, M.T.; Franchi, L.P.; Primo, F.L.; Tedesco, A.C.; Rahal, P.; Calmon, M.F. Combining Photodynamic Therapy and Chemotherapy: Improving Breast Cancer Treatment with Nanotechnology. J. Biomed. Nanotechnol. 2018, 14, 994–1008. [CrossRef] [PubMed] 36. Janicka, M.; Gubernator, J. Use of Nanotechnology for Improved Pharmacokinetics and Activity of Immunogenic Cell Death Inducers Used in Cancer Chemotherapy. Expert Opin. Drug Deliv. 2017, 14, 1059–1075. [CrossRef] 37. Zhao, C.-Y.; Cheng, R.; Yang, Z.; Tian, Z.-M. Nanotechnology for Cancer Therapy Based on Chemotherapy. Molecules 2018, 23, 826. [CrossRef] 38. Falagan-Lotsch, P.; Grzincic, E.M.; Murphy, C.J. New Advances in Nanotechnology-Based Diagnosis and Therapeutics for Breast Cancer: An Assessment of Active-Targeting Inorganic Nanoplatforms. Bioconjug. Chem. 2017, 28, 135–152. [CrossRef] 39. Matos, A.I.; Carreira, B.; Peres, C.; Moura, L.I.F.; Conniot, J.; Fourniols, T.; Scomparin, A.; Martínez-Barriocanal, Á.; Arango, D.; Conde, J.P.; et al. Nanotechnology Is an Important Strategy for Combinational Innovative Chemo-Immunotherapies against Colorectal Cancer. J. Control. Release 2019, 307, 108–138. [CrossRef] 40. Pillai, G. Nanotechnology toward treating cancer. In Applications of Targeted Nano Drugs and Delivery Systems; Elsevier: Amsterdam, The Netherlands, 2019; pp. 221–256. ISBN 9780128140291. 41. Sielaff, C.M.; Mousa, S.A. Status and Future Directions in the Management of Pancreatic Cancer: Potential Impact of Nanotech- nology. J. Cancer Res. Clin. Oncol. 2018, 144, 1205–1217. [CrossRef] 42. Song, G.; Cheng, L.; Chao, Y.; Yang, K.; Liu, Z. Emerging Nanotechnology and Advanced Materials for Cancer Radiation Therapy. Adv. Mater. 2017, 29, 1604894. [CrossRef] 43. Deng, H.; Zhang, Z. The Application of Nanotechnology in Immune Checkpoint Blockade for Cancer Treatment. J. Control. Release 2018, 290, 28–45. [CrossRef] 44. Cryer, A.M.; Thorley, A.J. Nanotechnology in the Diagnosis and Treatment of Lung Cancer. Pharmacol. Ther. 2019, 198, 189–205. [CrossRef] [PubMed] 45. Yang, X.; Yang, M.; Pang, B.; Vara, M.; Xia, Y. Gold Nanomaterials at Work in Biomedicine. Chem. Rev. 2015, 115, 10410–10488. [CrossRef] [PubMed] 46. Dreaden, E.C.; Alkilany, A.M.; Huang, X.; Murphy, C.J.; El-Sayed, M.A. The Golden Age: Gold Nanoparticles for Biomedicine. Chem. Soc. Rev. 2012, 41, 2740–2779. [CrossRef] [PubMed] 47. Beik, J.; Khateri, M.; Khosravi, Z.; Kamrava, S.K.; Kooranifar, S.; Ghaznavi, H.; Shakeri-Zadeh, A. Gold Nanoparticles in Combinatorial Cancer Therapy Strategies. Coord. Chem. Rev. 2019, 387, 299–324. [CrossRef] 48. Maeda, H.; Wu, J.; Sawa, T.; Matsumura, Y.; Hori, K. Tumor Vascular Permeability and the EPR Effect in Macromolecular Therapeutics: A Review. J. Control. Release 2000, 65, 271–284. [CrossRef] 49. Singh, P.; Pandit, S.; Mokkapati, V.R.S.S.; Garg, A.; Ravikumar, V.; Mijakovic, I. Gold Nanoparticles in Diagnostics and Therapeutics for Human Cancer. Int. J. Mol. Sci. 2018, 19, 1979. [CrossRef] 50. Wei, Y.; Quan, L.; Zhou, C.; Zhan, Q. Factors Relating to the Biodistribution & Clearance of Nanoparticles & Their Effects on in Vivo Application. Nanomedicine 2018, 13, 1495–1512. [CrossRef] 51. Angelov, B.; Angelova, A.; Filippov, S.K.; Drechsler, M.; Štep ˇ ánek, P.; Lesieur, S. Multicompartment Lipid Cubic Nanoparticles with High Protein Upload: Millisecond Dynamics of Formation. ACS Nano 2014, 8, 5216–5226. [CrossRef] 52. Dou, Y.; Yang, X. Novel High-Sensitive Fluorescent Detection of Deoxyribonuclease I Based on DNA-Templated Gold/silver Nanoclusters. Anal. Chim. Acta 2013, 784, 53–58. [CrossRef] 53. Weadick, D.S.; Liu, J. Phosphorothioate DNA Stabilized Fluorescent Gold and Silver Nanoclusters. Nanomaterials 2015, 5, 804–813. [CrossRef] 54. Lee, Y.J.; Ahn, E.-Y.; Park, Y. Shape-Dependent Cytotoxicity and Cellular Uptake of Gold Nanoparticles Synthesized Using Green Tea Extract. Nanoscale Res. Lett. 2019, 14, 129. [CrossRef] [PubMed] 55. Xie, X.; Liao, J.; Shao, X.; Li, Q.; Lin, Y. The Effect of Shape on Cellular Uptake of Gold Nanoparticles in the Forms of Stars, Rods, and Triangles. Sci. Rep. 2017, 7, 3827. [CrossRef] [PubMed] 56. Scarabelli, L.; Coronado-Puchau, M.; Giner-Casares, J.J.; Langer, J.; Liz-Marzán, L.M. Monodisperse Gold Nanotriangles: Size Control, Large-Scale Self-Assembly, and Performance in Surface-Enhanced Raman Scattering. ACS Nano 2014, 8, 5833–5842. [CrossRef] [PubMed] 57. Sironi, L.; Freddi, S.; Caccia, M.; Pozzi, P.; Rossetti, L.; Pallavicini, P.; Donà, A.; Cabrini, E.; Gualtieri, M.; Rivolta, I.; et al. Gold Branched Nanoparticles for Cellular Treatments. J. Phys. Chem. C Nanomater. Interfaces 2012, 116, 18407–18418. [CrossRef] ChemEngineering 2021, 5, 69 19 of 24 58. Steckiewicz, K.P.; Barcinska, E.; Malankowska, A.; Zauszkiewicz-Pawlak, A.; Nowaczyk, G.; Zaleska-Medynska, A.; Inkielewicz- Stepniak, I. Impact of Gold Nanoparticles Shape on Their Cytotoxicity against Human Osteoblast and Osteosarcoma in in Vitro Model. Evaluation of the Safety of Use and Anti-Cancer Potential. J. Mater. Sci. Mater. Med. 2019, 30, 22. [CrossRef] [PubMed] 59. Suchomel, P.; Kvitek, L.; Prucek, R.; Panacek, A.; Halder, A.; Vajda, S.; Zboril, R. Simple Size-Controlled Synthesis of Au Nanoparticles and Their Size-Dependent Catalytic Activity. Sci. Rep. 2018, 8, 4589. [CrossRef] 60. Xu, M.; Soliman, M.G.; Sun, X.; Pelaz, B.; Feliu, N.; Parak, W.J.; Liu, S. How Entanglement of Different Physicochemical Properties Complicates the Prediction of in Vitro and in Vivo Interactions of Gold Nanoparticles. ACS Nano 2018, 12, 10104–10113. [CrossRef] 61. Tenzer, S.; Docter, D.; Rosfa, S.; Wlodarski, A.; Kuharev, J.; Rekik, A.; Knauer, S.K.; Bantz, C.; Nawroth, T.; Bier, C.; et al. Nanoparticle Size Is a Critical Physicochemical Determinant of the Human Blood Plasma Corona: A Comprehensive Quantitative Proteomic Analysis. ACS Nano 2011, 5, 7155–7167. [CrossRef] 62. Walkey, C.D.; Olsen, J.B.; Song, F.; Liu, R.; Guo, H.; Olsen, D.W.H.; Cohen, Y.; Emili, A.; Chan, W.C.W. Protein Corona Fingerprinting Predicts the Cellular Interaction of Gold and Silver Nanoparticles. ACS Nano 2014, 8, 2439–2455. [CrossRef] 63. Rozengurt, E.; Heppel, L.A. A Speciﬁc Effect of External ATP on the Permeability of Transformed 3T3 Cells. Biochem. Biophys. Res. Commun. 1975, 67, 1581–1588. [CrossRef] 64. Liu, H.; Pierre-Pierre, N.; Huo, Q. Dynamic Light Scattering for Gold Nanorod Size Characterization and Study of Nanorod– protein Interactions. Gold Bull. 2012, 45, 187–195. [CrossRef] 65. Duncan, B.; Kim, C.; Rotello, V.M. Gold Nanoparticle Platforms as Drug and Biomacromolecule Delivery Systems. J. Control. Release 2010, 148, 122–127. [CrossRef] 66. Love, J.C.; Estroff, L.A.; Kriebel, J.K.; Nuzzo, R.G.; Whitesides, G.M. Self-Assembled Monolayers of Thiolates on Metals as a Form of Nanotechnology. Chem. Rev. 2005, 105, 1103–1169. [CrossRef] 67. Hostetler, M.J.; Wingate, J.E.; Zhong, C.-J.; Harris, J.E.; Vachet, R.W.; Clark, M.R.; Londono, J.D.; Green, S.J.; Stokes, J.J.; Wignall, G.D.; et al. Alkanethiolate Gold Cluster Molecules with Core Diameters from 1.5 to 5.2 Nm: Core and Monolayer Properties as a Function of Core Size. Langmuir 1998, 14, 17–30. [CrossRef] 68. Rana, S.; Bajaj, A.; Mout, R.; Rotello, V.M. Monolayer Coated Gold Nanoparticles for Delivery Applications. Adv. Drug Deliv. Rev. 2012, 64, 200–216. [CrossRef] 69. Perrault, S.D.; Walkey, C.; Jennings, T.; Fischer, H.C.; Chan, W.C.W. Mediating Tumor Targeting Efﬁciency of Nanoparticles through Design. Nano Lett. 2009, 9, 1909–1915. [CrossRef] [PubMed] 70. Maeda, H.; Nakamura, H.; Fang, J. The EPR Effect for Macromolecular Drug Delivery to Solid Tumors: Improvement of Tumor Uptake, Lowering of Systemic Toxicity, and Distinct Tumor Imaging in Vivo. Adv. Drug Deliv. Rev. 2013, 65, 71–79. [CrossRef] 71. Park, J.; Choi, Y.; Chang, H.; Um, W.; Ryu, J.H.; Kwon, I.C. Alliance with EPR Effect: Combined Strategies to Improve the EPR Effect in the Tumor Microenvironment. Theranostics 2019, 9, 8073–8090. [CrossRef] [PubMed] 72. Pérez-Ortiz, M.; Zapata-Urzúa, C.; Acosta, G.A.; Álvarez-Lueje, A.; Albericio, F.; Kogan, M.J. Gold Nanoparticles as an Efﬁcient Drug Delivery System for GLP-1 Peptides. Colloids Surf. B Biointerfaces 2017, 158, 25–32. [CrossRef] [PubMed] 73. He, B.; Yang, D.; Qin, M.; Zhang, Y.; He, B.; Dai, W.; Wang, X.; Zhang, Q.; Zhang, H.; Yin, C. Increased Cellular Uptake of Peptide-Modiﬁed PEGylated Gold Nanoparticles. Biochem. Biophys. Res. Commun. 2017, 494, 339–345. [CrossRef] 74. Halamoda-Kenzaoui, B.; Ceridono, M.; Urbán, P.; Bogni, A.; Ponti, J.; Gioria, S.; Kinsner-Ovaskainen, A. The Agglomeration State of Nanoparticles Can Inﬂuence the Mechanism of Their Cellular Internalisation. J. Nanobiotechnol. 2017, 15, 48. [CrossRef] 75. Odhner, J.H.; Moore Tibbetts, K.; Tangeysh, B.; Wayland, B.B.; Levis, R.J. Mechanism of Improved Au Nanoparticle Size Distributions Using Simultaneous Spatial and Temporal Focusing for Femtosecond Laser Irradiation of Aqueous KAuCl4. J. Phys. Chem. C Nanomater. Interfaces 2014, 118, 23986–23995. [CrossRef] 76. Zhang, S.; Gao, H.; Bao, G. Physical Principles of Nanoparticle Cellular Endocytosis. ACS Nano 2015, 9, 8655–8671. [CrossRef] 77. Nakase, I.; Niwa, M.; Takeuchi, T.; Sonomura, K.; Kawabata, N.; Koike, Y.; Takehashi, M.; Tanaka, S.; Ueda, K.; Simpson, J.C.; et al. Cellular Uptake of Arginine-Rich Peptides: Roles for Macropinocytosis and Actin Rearrangement. Mol. Ther. 2004, 10, 1011–1022. [CrossRef] 78. Kapur, A.; Medina, S.H.; Wang, W.; Palui, G.; Schneider, J.P.; Mattoussi, H. Intracellular Delivery of Gold Nanocolloids Promoted by a Chemically Conjugated Anticancer Peptide. ACS Omega 2018, 3, 12754–12762. [CrossRef] 79. Gaspar, D.; Veiga, A.S.; Sinthuvanich, C.; Schneider, J.P.; Castanho, M.A.R.B. Anticancer Peptide SVS-1: Efﬁcacy Precedes Membrane Neutralization. Biochemistry 2012, 51, 6263–6265. [CrossRef] 80. Sinthuvanich, C.; Veiga, A.S.; Gupta, K.; Gaspar, D.; Blumenthal, R.; Schneider, J.P. Anticancer -Hairpin Peptides: Membrane- Induced Folding Triggers Activity. J. Am. Chem. Soc. 2012, 134, 6210–6217. [CrossRef] [PubMed] 81. Giljohann, D.A.; Seferos, D.S.; Daniel, W.L.; Massich, M.D.; Patel, P.C.; Mirkin, C.A. Gold Nanoparticles for Biology and Medicine. Angew. Chem. Int. Ed. Engl. 2010, 49, 3280–3294. [CrossRef] [PubMed] 82. Patel, P.C.; Giljohann, D.A.; Daniel, W.L.; Zheng, D.; Prigodich, A.E.; Mirkin, C.A. Scavenger Receptors Mediate Cellular Uptake of Polyvalent Oligonucleotide-Functionalized Gold Nanoparticles. Bioconjug. Chem. 2010, 21, 2250–2256. [CrossRef] [PubMed] 83. McIntosh, C.M.; Esposito, E.A., 3rd; Boal, A.K.; Simard, J.M.; Martin, C.T.; Rotello, V.M. Inhibition of DNA Transcription Using Cationic Mixed Monolayer Protected Gold Clusters. J. Am. Chem. Soc. 2001, 123, 7626–7629. [CrossRef] 84. Sandhu, K.K.; McIntosh, C.M.; Simard, J.M.; Smith, S.W.; Rotello, V.M. Gold Nanoparticle-Mediated Transfection of Mammalian Cells. Bioconjug. Chem. 2002, 13, 3–6. [CrossRef] ChemEngineering 2021, 5, 69 20 of 24 85. Ding, Y.; Jiang, Z.; Saha, K.; Kim, C.S.; Kim, S.T.; Landis, R.F.; Rotello, V.M. Gold Nanoparticles for Nucleic Acid Delivery. Mol. Ther. 2014, 22, 1075–1083. [CrossRef] 86. Kunoh, T.; Takeda, M.; Matsumoto, S.; Suzuki, I.; Takano, M.; Kunoh, H.; Takada, J. Green Synthesis of Gold Nanoparticles Coupled with Nucleic Acid Oxidation. ACS Sustain. Chem. Eng. 2018, 6, 364–373. [CrossRef] 87. Labala, S.; Mandapalli, P.K.; Kurumaddali, A.; Venuganti, V.V.K. Layer-by-Layer Polymer Coated Gold Nanoparticles for Topical Delivery of Imatinib Mesylate to Treat Melanoma. Mol. Pharm. 2015, 12, 878–888. [CrossRef] [PubMed] 88. Labala, S.; Jose, A.; Chawla, S.R.; Khan, M.S.; Bhatnagar, S.; Kulkarni, O.P.; Venuganti, V.V.K. Effective Melanoma Cancer Suppression by Iontophoretic Co-Delivery of STAT3 siRNA and Imatinib Using Gold Nanoparticles. Int. J. Pharm. 2017, 525, 407–417. [CrossRef] [PubMed] 89. Kwong, L.N.; Davies, M.A. Targeted Therapy for Melanoma: Rational Combinatorial Approaches. Oncogene 2014, 33, 1–9. [CrossRef] [PubMed] 90. Deng, R.; Ji, B.; Yu, H.; Bao, W.; Yang, Z.; Yu, Y.; Cui, Y.; Du, Y.; Song, M.; Liu, S.; et al. Multifunctional Gold Nanoparticles Overcome MicroRNA Regulatory Network Mediated-Multidrug Resistant Leukemia. Sci. Rep. 2019, 9, 5348. [CrossRef] 91. Lynn, R.C.; Poussin, M.; Kalota, A.; Feng, Y.; Low, P.S.; Dimitrov, D.S.; Powell, D.J., Jr. Targeting of Folate Receptor on Acute Myeloid Leukemia Blasts with Chimeric Antigen Receptor-Expressing T Cells. Blood 2015, 125, 3466–3476. [CrossRef] [PubMed] 92. Peng, Y.; Zhao, Z.; Liu, T.; Li, X.; Hu, X.; Wei, X.; Zhang, X.; Tan, W. Smart Human-Serum-Albumin-As O Nanodrug with Self-Ampliﬁed Folate Receptor-Targeting Ability for Chronic Myeloid Leukemia Treatment. Angew. Chem. Int. Ed. Engl. 2017, 56, 10845–10849. [CrossRef] 93. Shang, Y.; Zhang, Z.; Liu, Z.; Feng, B.; Ren, G.; Li, K.; Zhou, L.; Sun, Y.; Li, M.; Zhou, J.; et al. miR-508-5p Regulates Multidrug Resistance of Gastric Cancer by Targeting ABCB1 and ZNRD1. Oncogene 2014, 33, 3267–3276. [CrossRef] 94. Zhao, X.; Yang, L.; Hu, J.; Ruan, J. miR-138 Might Reverse Multidrug Resistance of Leukemia Cells. Leuk. Res. 2010, 34, 1078–1082. [CrossRef] [PubMed] 95. Lee, J.; Choi, K.-J.; Moon, S.U.; Kim, S. Theragnosis-Based Combined Cancer Therapy Using Doxorubicin-Conjugated microRNA- 221 Molecular Beacon. Biomaterials 2016, 74, 109–118. [CrossRef] 96. Shiao, Y.-S.; Chiu, H.-H.; Wu, P.-H.; Huang, Y.-F. Aptamer-Functionalized Gold Nanoparticles as Photoresponsive Nanoplatform for Co-Drug Delivery. ACS Appl. Mater. Interfaces 2014, 6, 21832–21841. [CrossRef] 97. Xiang, D.; Shigdar, S.; Qiao, G.; Wang, T.; Kouzani, A.Z.; Zhou, S.-F.; Kong, L.; Li, Y.; Pu, C.; Duan, W. Nucleic Acid Aptamer- Guided Cancer Therapeutics and Diagnostics: The next Generation of Cancer Medicine. Theranostics 2015, 5, 23–42. [CrossRef] 98. Saravanakumar, K.; Sathiyaseelan, A.; Mariadoss, A.V.A.; Hu, X.; Venkatachalam, K.; Wang, M.-H. Nucleolin Targeted Delivery of Aptamer Tagged Trichoderma Derived Crude Protein Coated Gold Nanoparticles for Improved Cytotoxicity in Cancer Cells. Process. Biochem. 2021, 102, 325–332. [CrossRef] 99. Shaabani, E.; Shariﬁaghdam, M.; de Keersmaecker, H.; de Rycke, R.; de Smedt, S.; Faridi-Majidi, R.; Braeckmans, K.; Fraire, J.C. Layer by Layer Assembled Chitosan-Coated Gold Nanoparticles for Enhanced siRNA Delivery and Silencing. Int. J. Mol. Sci. 2021, 22, 831. [CrossRef] [PubMed] 100. Sreelakshmi, C.; Goel, N.; Datta, K.K.R.; Addlagatta, A.; Ummanni, R.; Reddy, B.V.S. Green Synthesis of Curcumin Capped Gold Nanoparticles and Evaluation of Their Cytotoxicity. Nanosci. Nanotechnol. Lett. 2013, 5, 1258–1265. [CrossRef] 101. Bertolino, V.; Cavallaro, G.; Lazzara, G.; Merli, M.; Milioto, S.; Parisi, F.; Sciascia, L. Effect of the Biopolymer Charge and the Nanoclay Morphology on Nanocomposite Materials. Ind. Eng. Chem. Res. 2016, 55, 7373–7380. [CrossRef] 102. Bertolino, V.; Cavallaro, G.; Lazzara, G.; Milioto, S.; Parisi, F. Biopolymer-Targeted Adsorption onto Halloysite Nanotubes in Aqueous Media. Langmuir 2017, 33, 3317–3323. [CrossRef] 103. Deljoo, S.; Rabiee, N.; Rabiee, M. Curcumin-Hybrid Nanoparticles in Drug Delivery System (Review). Asian J. Nanosci. Mater. 2019, 2, 66–91. [CrossRef] 104. Wang, F.; Wang, Y.-C.; Dou, S.; Xiong, M.-H.; Sun, T.-M.; Wang, J. Doxorubicin-Tethered Responsive Gold Nanoparticles Facilitate Intracellular Drug Delivery for Overcoming Multidrug Resistance in Cancer Cells. ACS Nano 2011, 5, 3679–3692. [CrossRef] 105. Ruan, S.; Hu, C.; Tang, X.; Cun, X.; Xiao, W.; Shi, K.; He, Q.; Gao, H. Increased Gold Nanoparticle Retention in Brain Tumors by in Situ Enzyme-Induced Aggregation. ACS Nano 2016, 10, 10086–10098. [CrossRef] 106. Mats, L.; Logue, F.; Oleschuk, R.D. “Particle-Free” Magnetic Actuation of Droplets on Superhydrophobic Surfaces Using Dissolved Paramagnetic Salts. Anal. Chem. 2016, 88, 9486–9494. [CrossRef] 107. Suarasan, S.; Focsan, M.; Potara, M.; Soritau, O.; Florea, A.; Maniu, D.; Astilean, S. Doxorubicin-Incorporated Nanotherapeutic Delivery System Based on Gelatin-Coated Gold Nanoparticles: Formulation, Drug Release, and Multimodal Imaging of Cellular Internalization. ACS Appl. Mater. Interfaces 2016, 8, 22900–22913. [CrossRef] 108. Ou, Y.-C.; Webb, J.A.; Faley, S.; Shae, D.; Talbert, E.M.; Lin, S.; Cutright, C.C.; Wilson, J.T.; Bellan, L.M.; Bardhan, R. Gold Nanoantenna-Mediated Photothermal Drug Delivery from Thermosensitive Liposomes in Breast Cancer. ACS Omega 2016, 1, 234–243. [CrossRef] [PubMed] 109. Zhu, J.; Wang, G.; Alves, C.S.; Tomás, H.; Xiong, Z.; Shen, M.; Rodrigues, J.; Shi, X. Multifunctional Dendrimer-Entrapped Gold Nanoparticles Conjugated with Doxorubicin for pH-Responsive Drug Delivery and Targeted Computed Tomography Imaging. Langmuir 2018, 34, 12428–12435. [CrossRef] [PubMed] 110. Hu, F.-Q.; Liu, L.-N.; Du, Y.-Z.; Yuan, H. Synthesis and Antitumor Activity of Doxorubicin Conjugated Stearic Acid-G-Chitosan Oligosaccharide Polymeric Micelles. Biomaterials 2009, 30, 6955–6963. [CrossRef] ChemEngineering 2021, 5, 69 21 of 24 111. Shen, W.C.; Ryser, H.J. Cis-Aconityl Spacer between Daunomycin and Macromolecular Carriers: A Model of pH-Sensitive Linkage Releasing Drug from a Lysosomotropic Conjugate. Biochem. Biophys. Res. Commun. 1981, 102, 1048–1054. [CrossRef] 112. Liu, H.; Wang, H.; Xu, Y.; Shen, M.; Zhao, J.; Zhang, G.; Shi, X. Synthesis of PEGylated Low Generation Dendrimer-Entrapped Gold Nanoparticles for CT Imaging Applications. Nanoscale 2014, 6, 4521–4526. [CrossRef] [PubMed] 113. Peng, C.; Zheng, L.; Chen, Q.; Shen, M.; Guo, R.; Wang, H.; Cao, X.; Zhang, G.; Shi, X. PEGylated Dendrimer-Entrapped Gold Nanoparticles for in Vivo Blood Pool and Tumor Imaging by Computed Tomography. Biomaterials 2012, 33, 1107–1119. [CrossRef] 114. Khutale, G.V.; Casey, A. Synthesis and Characterization of a Multifunctional Gold-Doxorubicin Nanoparticle System for pH Triggered Intracellular Anticancer Drug Release. Eur. J. Pharm. Biopharm. 2017, 119, 372–380. [CrossRef] [PubMed] 115. Mallick, A.; More, P.; Ghosh, S.; Chippalkatti, R.; Chopade, B.A.; Lahiri, M.; Basu, S. Dual Drug Conjugated Nanoparticle for Simultaneous Targeting of Mitochondria and Nucleus in Cancer Cells. ACS Appl. Mater. Interfaces 2015, 7, 7584–7598. [CrossRef] [PubMed] 116. Venkatesan, R.; Pichaimani, A.; Hari, K.; Balasubramanian, P.K.; Kulandaivel, J.; Premkumar, K. Doxorubicin Conjugated Gold Nanorods: A Sustained Drug Delivery Carrier for Improved Anticancer Therapy. J. Mater. Chem. B Mater. Biol. Med. 2013, 1, 1010–1018. [CrossRef] [PubMed] 117. Rabiee, N.; Ahmadi, S.; Arab, Z.; Bagherzadeh, M.; Safarkhani, M.; Nasseri, B.; Rabiee, M.; Tahriri, M.; Webster, T.J.; Tayebi, L. Aptamer Hybrid Nanocomplexes as Targeting Components for Antibiotic/Gene Delivery Systems and Diagnostics: A Review. Int. J. Nanomed. 2020, 15, 4237–4256. [CrossRef] 118. Ahmadi Nasab, N.; Hassani Kumleh, H.; Beygzadeh, M.; Teimourian, S.; Kazemzad, M. Delivery of Curcumin by a pH-Responsive Chitosan Mesoporous Silica Nanoparticles for Cancer Treatment. Artif. Cells Nanomed. Biotechnol. 2018, 46, 75–81. [CrossRef] [PubMed] 119. Xie, J.; Fan, Z.; Li, Y.; Zhang, Y.; Yu, F.; Su, G.; Xie, L.; Hou, Z. Design of pH-Sensitive Methotrexate Prodrug-Targeted Curcumin Nanoparticles for Efﬁcient Dual-Drug Delivery and Combination Cancer Therapy. Int. J. Nanomed. 2018, 13, 1381–1398. [CrossRef] 120. Yan, J.; Wang, Y.; Zhang, X.; Liu, S.; Tian, C.; Wang, H. Targeted Nanomedicine for Prostate Cancer Therapy: Docetaxel and Curcumin Co-Encapsulated Lipid-Polymer Hybrid Nanoparticles for the Enhanced Anti-Tumor Activity in Vitro and in Vivo. Drug Deliv. 2016, 23, 1757–1762. [CrossRef] 121. Rao, K.M.; Kumar, A.; Suneetha, M.; Han, S.S. pH and near-Infrared Active; Chitosan-Coated Halloysite Nanotubes Loaded with Curcumin-Au Hybrid Nanoparticles for Cancer Drug Delivery. Int. J. Biol. Macromol. 2018, 112, 119–125. [CrossRef] 122. Yang, Q.; Peng, J.; Xiao, Y.; Li, W.; Tan, L.; Xu, X.; Qian, Z. Porous Au@Pt Nanoparticles: Therapeutic Platform for Tumor Chemo-Photothermal Co-Therapy and Alleviating Doxorubicin-Induced Oxidative Damage. ACS Appl. Mater. Interfaces 2018, 10, 150–164. [CrossRef] 123. Norouzi, H.; Khoshgard, K.; Akbarzadeh, F. In Vitro Outlook of Gold Nanoparticles in Photo-Thermal Therapy: A Literature Review. Lasers Med. Sci. 2018, 33, 917–926. [CrossRef] 124. Zhang, D.; Wu, T.; Qin, X.; Qiao, Q.; Shang, L.; Song, Q.; Yang, C.; Zhang, Z. Intracellularly Generated Immunological Gold Nanoparticles for Combinatorial Photothermal Therapy and Immunotherapy against Tumor. Nano Lett. 2019, 19, 6635–6646. [CrossRef] 125. Riley, R.S.; Day, E.S. Gold Nanoparticle-Mediated Photothermal Therapy: Applications and Opportunities for Multimodal Cancer Treatment. Wiley Interdiscip. Rev. Nanomed. Nanobiotechnol. 2017, 9. [CrossRef] 126. Cheng, X.; Sun, R.; Yin, L.; Chai, Z.; Shi, H.; Gao, M. Light-Triggered Assembly of Gold Nanoparticles for Photothermal Therapy and Photoacoustic Imaging of Tumors In Vivo. Adv. Mater. 2017, 29. [CrossRef] [PubMed] 127. Ali, M.R.K.; Wu, Y.; El-Sayed, M.A. Gold-Nanoparticle-Assisted Plasmonic Photothermal Therapy Advances toward Clinical Application. J. Phys. Chem. C Nanomater. Interfaces 2019, 123, 15375–15393. [CrossRef] 128. Liu, Y.; Crawford, B.M.; Vo-Dinh, T. Gold Nanoparticles-Mediated Photothermal Therapy and Immunotherapy. Immunotherapy 2018, 10, 1175–1188. [CrossRef] 129. Yang, W.; Liang, H.; Ma, S.; Wang, D.; Huang, J. Gold Nanoparticle Based Photothermal Therapy: Development and Application for Effective Cancer Treatment. Sustain. Mater. Technol. 2019, 22, e00109. [CrossRef] 130. Sun, M.; Peng, D.; Hao, H.; Hu, J.; Wang, D.; Wang, K.; Liu, J.; Guo, X.; Wei, Y.; Gao, W. Thermally Triggered in Situ Assembly of Gold Nanoparticles for Cancer Multimodal Imaging and Photothermal Therapy. ACS Appl. Mater. Interfaces 2017, 9, 10453–10460. [CrossRef] 131. Kim, H.S.; Lee, D.Y. Photothermal Therapy with Gold Nanoparticles as an Anticancer Medication. J. Pharm. Investig. 2017, 47, 19–26. [CrossRef] 132. Beik, J.; Asadi, M.; Khoei, S.; Laurent, S.; Abed, Z.; Mirrahimi, M.; Farashahi, A.; Hashemian, R.; Ghaznavi, H.; Shakeri-Zadeh, A. Simulation-Guided Photothermal Therapy Using MRI-Traceable Iron Oxide-Gold Nanoparticle. J. Photochem. Photobiol. B 2019, 199, 111599. [CrossRef] [PubMed] 133. Neshastehriz, A.; Tabei, M.; Maleki, S.; Eynali, S.; Shakeri-Zadeh, A. Photothermal Therapy Using Folate Conjugated Gold Nanoparticles Enhances the Effects of 6MV X-Ray on Mouth Epidermal Carcinoma Cells. J. Photochem. Photobiol. B 2017, 172, 52–60. [CrossRef] [PubMed] 134. Jiang, X.; Du, B.; Huang, Y.; Yu, M.; Zheng, J. Cancer Photothermal Therapy with ICG-Conjugated Gold Nanoclusters. Bioconjug. Chem. 2020, 31, 1522–1528. [CrossRef] ChemEngineering 2021, 5, 69 22 of 24 135. Kim, H.S.; Lee, D.Y. Near-Infrared-Responsive Cancer Photothermal and Photodynamic Therapy Using Gold Nanoparticles. Polymers 2018, 10, 961. [CrossRef] 136. Sun, Z.; Zhang, Y.; Yu, H.; Yan, C.; Liu, Y.; Hong, S.; Tao, H.; Robertson, A.W.; Wang, Z.; Pádua, A.A.H. New Solvent-Stabilized Few-Layer Black Phosphorus for Antibacterial Applications. Nanoscale 2018, 10, 12543–12553. [CrossRef] 137. Wang, X.; Shao, J.; Abd El Raouf, M.; Xie, H.; Huang, H.; Wang, H.; Chu, P.K.; Yu, X.-F.; Yang, Y.; AbdEl-Aal, A.M.; et al. Near-Infrared Light-Triggered Drug Delivery System Based on Black Phosphorus for in Vivo Bone Regeneration. Biomaterials 2018, 179, 164–174. [CrossRef] [PubMed] 138. Yang, G.; Liu, Z.; Li, Y.; Hou, Y.; Fei, X.; Su, C.; Wang, S.; Zhuang, Z.; Guo, Z. Facile Synthesis of Black Phosphorus-Au Nanocomposites for Enhanced Photothermal Cancer Therapy and Surface-Enhanced Raman Scattering Analysis. Biomater. Sci. 2017, 5, 2048–2055. [CrossRef] [PubMed] 139. Moradi, S.; Mokhtari-Dizaji, M.; Ghassemi, F.; Sheibani, S.; Amoli, F.A. The Effect of Ultrasound Hyperthermia with Gold Nanoparticles on Retinoblastoma Y79 Cells. Gold Bull. 2020, 53, 111–120. [CrossRef] 140. Katifelis, H.; Mukha, I.; Lyberopoulou, A.; Vityuk, N.; Grammatikaki, M.; Pylypchuk, I.; Lazaris, F.; Storozhuk, L.; Kouloulias, V.; Gazouli, M. In Vitro Effect of Hyperthermic Ag and Au Fe O Nanoparticles in Cancer Cells. Beilstein Arch. 2019, 2019, 101. 3 4 141. Shanei, A.; Sazgarnia, A. An Overview of Therapeutic Applications of Ultrasound Based on Synergetic Effects with Gold Nanoparticles and Laser Excitation. Iran. J. Basic Med. Sci. 2019, 22, 848–855. [CrossRef] 142. Canavese, G.; Ancona, A.; Racca, L.; Canta, M.; Dumontel, B.; Barbaresco, F.; Limongi, T.; Cauda, V. Nanoparticle-Assisted Ultrasound: A Special Focus on Sonodynamic Therapy against Cancer. Chem. Eng. J. 2018, 340, 155–172. [CrossRef] 143. Beik, J.; Khademi, S.; Attaran, N.; Sarkar, S.; Shakeri-Zadeh, A.; Ghaznavi, H.; Ghadiri, H. A Nanotechnology-Based Strategy to Increase the Efﬁciency of Cancer Diagnosis and Therapy: Folate-Conjugated Gold Nanoparticles. Curr. Med. Chem. 2017, 24, 4399–4416. [CrossRef] 144. Izadifar, Z.; Izadifar, Z.; Chapman, D.; Babyn, P. An Introduction to High Intensity Focused Ultrasound: Systematic Review on Principles, Devices, and Clinical Applications. J. Clin. Med. Res. 2020, 9, 460. [CrossRef] 145. Kennedy, J.E. High-Intensity Focused Ultrasound in the Treatment of Solid Tumours. Nat. Rev. Cancer 2005, 5, 321–327. [CrossRef] 146. Yu, T.; Wang, Z.; Jiang, S. Potentiation of Cytotoxicity of Adriamycin on Human Ovarian Carcinoma Cell Line 3AO by Low-Level Ultrasound. Ultrasonics 2001, 39, 307–309. [CrossRef] 147. Yu, T.; Wang, Z.; Mason, T.J. A Review of Research into the Uses of Low Level Ultrasound in Cancer Therapy. Ultrason. Sonochem. 2004, 11, 95–103. [CrossRef] 148. Marmottant, P.; Hilgenfeldt, S. Controlled Vesicle Deformation and Lysis by Single Oscillating Bubbles. Nature 2003, 423, 153–156. [CrossRef] [PubMed] 149. Tang, H.; Wang, C.C.J.; Blankschtein, D.; Langer, R. An Investigation of the Role of Cavitation in Low-Frequency Ultrasound- Mediated Transdermal Drug Transport. Pharm. Res. 2002, 19, 1160–1169. [CrossRef] [PubMed] 150. Barnett, S.B.; ter Haar, G.R.; Ziskin, M.C.; Nyborg, W.L.; Maeda, K.; Bang, J. Current Status of Research on Biophysical Effects of Ultrasound. Ultrasound Med. Biol. 1994, 20, 205–218. [CrossRef] 151. Barnett, S.B. Conclusions and Recommendations on Thermal and Non-Thermal Mechanisms for Biological Effects of Ultrasound; CSIRO Research Publications Repository: Melbourne, Australia, 1996. 152. Tuziuti, T.; Yasui, K.; Sivakumar, M.; Iida, Y.; Miyoshi, N. Correlation between Acoustic Cavitation Noise and Yield Enhancement of Sonochemical Reaction by Particle Addition. J. Phys. Chem. A 2005, 109, 4869–4872. [CrossRef] 153. Farny, C.H.; Wu, T.; Holt, R.G.; Murray, T.W.; Roy, R.A. Nucleating Cavitation from Laser-Illuminated Nano-Particles. Acoust. Res. Lett. Online 2005, 6, 138–143. [CrossRef] 154. Victor, E.G.; Silveira, P.C.L.; Possato, J.C.; da Rosa, G.L.; Munari, U.B.; de Souza, C.T.; Pinho, R.A.; da Silva, L.; Streck, E.L.; Paula, M.M.S. Pulsed ultrasound Associated with Gold Nanoparticle Gel Reduces Oxidative Stress Parameters and Expression of pro-Inﬂammatory Molecules in an Animal Model of Muscle Injury. J. Nanobiotechnol. 2012, 10, 11. [CrossRef] 155. Serrano, A.L.; Baeza-Raja, B.; Perdiguero, E.; Jardí, M.; Muñoz-Cánoves, P. Interleukin-6 Is an Essential Regulator of Satellite Cell-Mediated Skeletal Muscle Hypertrophy. Cell Metab. 2008, 7, 33–44. [CrossRef] 156. Li, Y.-P. TNF-Alpha Is a Mitogen in Skeletal Muscle. Am. J. Physiol. Cell Physiol. 2003, 285, C370–C376. [CrossRef] 157. Tsai, C.-Y.; Shiau, A.-L.; Chen, S.-Y.; Chen, Y.-H.; Cheng, P.-C.; Chang, M.-Y.; Chen, D.-H.; Chou, C.-H.; Wang, C.-R.; Wu, C.-L. Amelioration of Collagen-Induced Arthritis in Rats by Nanogold. Arthritis Rheum. 2007, 56, 544–554. [CrossRef] 158. Beik, J.; Abed, Z.; Shakeri-Zadeh, A.; Nourbakhsh, M.; Shiran, M.B. Evaluation of the Sonosensitizing Properties of Nano- Graphene Oxide in Comparison with Iron Oxide and Gold Nanoparticles. Phys. E Low Dimens. Syst. Nanostruct. 2016, 81, 308–314. [CrossRef] 159. Aminabad, N.S.; Farshbaf, M.; Akbarzadeh, A. Recent Advances of Gold Nanoparticles in Biomedical Applications: State of the Art. Cell Biochem. Biophys. 2019, 77, 123–137. [CrossRef] [PubMed] 160. Mieszawska, A.J.; Mulder, W.J.M.; Fayad, Z.A.; Cormode, D.P. Multifunctional Gold Nanoparticles for Diagnosis and Therapy of Disease. Mol. Pharm. 2013, 10, 831–847. [CrossRef] [PubMed] 161. Cordeiro, M.; Ferreira Carlos, F.; Pedrosa, P.; Lopez, A.; Baptista, P.V. Gold Nanoparticles for Diagnostics: Advances towards Points of Care. Diagnostics 2016, 6, 43. [CrossRef] [PubMed] 162. Kang, J.W.; So, P.T.C.; Dasari, R.R.; Lim, D.-K. High Resolution Live Cell Raman Imaging Using Subcellular Organelle-Targeting SERS-Sensitive Gold Nanoparticles with Highly Narrow Intra-Nanogap. Nano Lett. 2015, 15, 1766–1772. [CrossRef] ChemEngineering 2021, 5, 69 23 of 24 163. Kumar, S.; Kumar, S.; Tiwari, S.; Augustine, S.; Srivastava, S.; Yadav, B.K.; Malhotra, B.D. Highly Sensitive Protein Functionalized Nanostructured Hafnium Oxide Based Biosensing Platform for Non-Invasive Oral Cancer Detection. Sens. Actuators B Chem. 2016, 235, 1–10. [CrossRef] 164. Fleischmann, M.; Hendra, P.J.; McQuillan, A.J. Raman Spectra of Pyridine Adsorbed at a Silver Electrode. Chem. Phys. Lett. 1974, 26, 163–166. [CrossRef] 165. Feng, S.; Chen, R.; Lin, J.; Pan, J.; Wu, Y.; Li, Y.; Chen, J.; Zeng, H. Gastric Cancer Detection Based on Blood Plasma Surface- Enhanced Raman Spectroscopy Excited by Polarized Laser Light. Biosens. Bioelectron. 2011, 26, 3167–3174. [CrossRef] [PubMed] 166. Yan, B.; Li, B.; Wen, Z.; Luo, X.; Xue, L.; Li, L. Label-Free Blood Serum Detection by Using Surface-Enhanced Raman Spectroscopy and Support Vector Machine for the Preoperative Diagnosis of Parotid Gland Tumors. BMC Cancer 2015, 15, 650. [CrossRef] [PubMed] 167. Tan, Y.; Yan, B.; Xue, L.; Li, Y.; Luo, X.; Ji, P. Surface-Enhanced Raman Spectroscopy of Blood Serum Based on Gold Nanoparticles for the Diagnosis of the Oral Squamous Cell Carcinoma. Lipids Health Dis. 2017, 16, 73. [CrossRef] [PubMed] 168. Ma, X.; Qu, Q.; Zhao, Y.; Luo, Z.; Zhao, Y.; Ng, K.W.; Zhao, Y. Graphene Oxide Wrapped Gold Nanoparticles for Intracellular Raman Imaging and Drug Delivery. J. Mater. Chem. B Mater. Biol. Med. 2013, 1, 6495–6500. [CrossRef] [PubMed] 169. Li, W.; Chen, X. Gold Nanoparticles for Photoacoustic Imaging. Nanomedicine 2015, 10, 299–320. [CrossRef] 170. Song, J.; Kim, J.; Hwang, S.; Jeon, M.; Jeong, S.; Kim, C.; Kim, S. “Smart” Gold Nanoparticles for Photoacoustic Imaging: An Imaging Contrast Agent Responsive to the Cancer Microenvironment and Signal Ampliﬁcation via pH-Induced Aggregation. Chem. Commun. 2016, 52, 8287–8290. [CrossRef] 171. Sun, I.-C.; Dumani, D.; Emelianov, S.Y. Ultrasound-Guided Photoacoustic Imaging of Lymph Nodes with Biocompatible Gold Nanoparticles as a Novel Contrast Agent (Conference Presentation). In Proceedings of the Colloidal Nanoparticles for Biomedical Applications XII, San Francisco, CA, USA, 28 January–2 February 2017; Liang, X.-J., Parak, W.J., Osinski, ´ M., Eds.; SPIE: Bellingham, WA, USA, 2017. 172. Jin, H.-Y.; Li, D.-W.; Zhang, N.; Gu, Z.; Long, Y.-T. Analyzing Carbohydrate-Protein Interaction Based on Single Plasmonic Nanoparticle by Conventional Dark Field Microscopy. ACS Appl. Mater. Interfaces 2015, 7, 12249–12253. [CrossRef] [PubMed] 173. Qian, W.; Huang, X.; Kang, B.; El-Sayed, M.A. Dark-Field Light Scattering Imaging of Living Cancer Cell Component from Birth through Division Using Bioconjugated Gold Nanoprobes. J. Biomed. Opt. 2010, 15, 046025. [CrossRef] 174. Ma, J.; Liu, Y.; Gao, P.F.; Zou, H.Y.; Huang, C.Z. Precision Improvement in Dark-Field Microscopy Imaging by Using Gold Nanoparticles as an Internal Reference: A Combined Theoretical and Experimental Study. Nanoscale 2016, 8, 8729–8736. [CrossRef] [PubMed] 175. Cao, Y.; He, Y.; Liu, H.; Luo, Y.; Shen, M.; Xia, J.; Shi, X. Targeted CT Imaging of Human Hepatocellular Carcinoma Using Low-Generation Dendrimer-Entrapped Gold Nanoparticles Modiﬁed with Lactobionic Acid. J. Mater. Chem. B Mater. Biol. Med. 2015, 3, 286–295. [CrossRef] 176. Meir, R.; Shamalov, K.; Betzer, O.; Motiei, M.; Horovitz-Fried, M.; Yehuda, R.; Popovtzer, A.; Popovtzer, R.; Cohen, C.J. Nanomedicine for Cancer Immunotherapy: Tracking Cancer-Speciﬁc T-Cells in Vivo with Gold Nanoparticles and CT Imaging. ACS Nano 2015, 9, 6363–6372. [CrossRef] 177. Kim, J.; Lee, N.; Hyeon, T. Recent Development of Nanoparticles for Molecular Imaging. Philos. Trans. A Math. Phys. Eng. Sci. 2017, 375. [CrossRef] 178. Na, H.B.; Song, I.C.; Hyeon, T. Inorganic Nanoparticles for MRI Contrast Agents. Adv. Mater. 2009, 21, 2133–2148. [CrossRef] 179. Huang, J.-Y.; Lin, H.-T.; Chen, T.-H.; Chen, C.-A.; Chang, H.-T.; Chen, C.-F. Signal Ampliﬁed Gold Nanoparticles for Cancer Diagnosis on Paper-Based Analytical Devices. ACS Sens. 2018, 3, 174–182. [CrossRef] [PubMed] 180. Guo, J.; Chen, Y.; Jiang, Y.; Ju, H. Polyadenine-Modulated DNA Conformation Monitored by Surface-Enhanced Raman Scattering (SERS) on Multibranched Gold Nanoparticles and Its Sensing Application. Chemistry 2017, 23, 9332–9337. [CrossRef] [PubMed] 181. Cheung-Lau, J.C.; Liu, D.; Pulsipher, K.W.; Liu, W.; Dmochowski, I.J. Engineering a Well-Ordered, Functional Protein-Gold Nanoparticle Assembly. J. Inorg. Biochem. 2014, 130, 59–68. [CrossRef] [PubMed] 182. Tang, C.K.; Vaze, A.; Shen, M.; Rusling, J.F. High-Throughput Electrochemical Microﬂuidic Immunoarray for Multiplexed Detection of Cancer Biomarker Proteins. ACS Sens. 2016, 1, 1036–1043. [CrossRef] 183. Saeed, A.A.; Sánchez, J.L.A.; O’Sullivan, C.K.; Abbas, M.N. DNA Biosensors Based on Gold Nanoparticles-Modiﬁed Graphene Oxide for the Detection of Breast Cancer Biomarkers for Eary Diagnosis. Bioelectrochemistry 2017, 118, 91–99. [CrossRef] [PubMed] 184. Saha, K.; Agasti, S.S.; Kim, C.; Li, X.; Rotello, V.M. Gold Nanoparticles in Chemical and Biological Sensing. Chem. Rev. 2012, 112, 2739–2779. [CrossRef] 185. Zeng, S.; Yong, K.-T.; Roy, I.; Dinh, X.-Q.; Yu, X.; Luan, F. A Review on Functionalized Gold Nanoparticles for Biosensing Applications. Plasmonics 2011, 6, 491–506. [CrossRef] 186. Pingarrón, J.M.; Yáñez-Sedeño, P.; González-Cortés, A. Gold Nanoparticle-Based Electrochemical Biosensors. Electrochim. Acta 2008, 53, 5848–5866. [CrossRef] 187. Meola, A.; Rao, J.; Chaudhary, N.; Sharma, M.; Chang, S.D. Gold Nanoparticles for Brain Tumor Imaging: A Systematic Review. Front. Neurol. 2018, 9, 328. [CrossRef] [PubMed] 188. Bahadar, H.; Maqbool, F.; Niaz, K.; Abdollahi, M. Toxicity of Nanoparticles and an Overview of Current Experimental Models. Iran. Biomed. J. 2016, 20, 1–11. [CrossRef] ChemEngineering 2021, 5, 69 24 of 24 189. Kim, D.-Y.; Kim, M.; Shinde, S.; Sung, J.-S.; Ghodake, G. Cytotoxicity and Antibacterial Assessment of Gallic Acid Capped Gold Nanoparticles. Colloids Surf. B Biointerfaces 2017, 149, 162–167. [CrossRef] 190. Bhamidipati, M.; Fabris, L. Multiparametric Assessment of Gold Nanoparticle Cytotoxicity in Cancerous and Healthy Cells: The Role of Size, Shape, and Surface Chemistry. Bioconjug. Chem. 2017, 28, 449–460. [CrossRef] [PubMed] 191. Albanese, A.; Walkey, C.D.; Olsen, J.B.; Guo, H.; Emili, A.; Chan, W.C.W. Secreted Biomolecules Alter the Biological Identity and Cellular Interactions of Nanoparticles. ACS Nano 2014, 8, 5515–5526. [CrossRef] [PubMed] 192. Grainger, D.W.; Castner, D.G. Nanobiomaterials and Nanoanalysis: Opportunities for Improving the Science to Beneﬁt Biomedical Technologies. Adv. Mater. 2008, 20, 867–877. [CrossRef] 193. Walkey, C.D.; Olsen, J.B.; Guo, H.; Emili, A.; Chan, W.C.W. Nanoparticle Size and Surface Chemistry Determine Serum Protein Adsorption and Macrophage Uptake. J. Am. Chem. Soc. 2012, 134, 2139–2147. [CrossRef] 194. Bailly, A.-L.; Correard, F.; Popov, A.; Tselikov, G.; Chaspoul, F.; Appay, R.; Al-Kattan, A.; Kabashin, A.V.; Braguer, D.; Esteve, M.-A. In Vivo Evaluation of Safety, Biodistribution and Pharmacokinetics of Laser-Synthesized Gold Nanoparticles. Sci. Rep. 2019, 9, 12890. [CrossRef] 195. Wilhelm, S.; Tavares, A.J.; Dai, Q.; Ohta, S.; Audet, J.; Dvorak, H.F.; Chan, W.C.W. Analysis of Nanoparticle Delivery to Tumours. Nat. Rev. Mater. 2016, 1, 16014. [CrossRef] 196. Dai, Q.; Bertleff-Zieschang, N.; Braunger, J.A.; Björnmalm, M.; Cortez-Jugo, C.; Caruso, F. Particle Targeting in Complex Biological Media. Adv. Healthc. Mater. 2018, 7, 1700575. [CrossRef] [PubMed]

Journal

ChemEngineering – Multidisciplinary Digital Publishing Institute

Published: Oct 16, 2021

Keywords: gold nanoparticles; cancer; diagnosis; therapy; drug delivery; theranostics; hybrid materials

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Application of Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics

Application of Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Application of Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics

Application of Gold Nanoparticle-Based Materials in Cancer Therapy and Diagnostics

References (197)

Abstract

Journal

Recommended Articles

There are no references for this article.

Our policy towards the use of cookies