Access the full text.
Sign up today, get DeepDyve free for 14 days.
References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.
Hindawi Journal of Healthcare Engineering Volume 2022, Article ID 8944588, 7 pages https://doi.org/10.1155/2022/8944588 Research Article mir-204-5p Acts as a Tumor Suppressor by Targeting DNM2 in Osteosarcoma Cells 1 2 1 Liangliang Qu , Zhongqiu Li , and Pinduan Liu Department of Orthopedics, e First Affiliated Hospital of Jinzhou Medical University, Jinzhou 121001, Liaoning, China Department of Hepatobiliary Diseases, e First Affiliated Hospital of Jinzhou Medical University, Jinzhou 121001, Liaoning, China Correspondence should be addressed to Pinduan Liu; liupinduan@jzmu.edu.cn Received 7 December 2021; Revised 23 December 2021; Accepted 29 December 2021; Published 9 February 2022 Academic Editor: Balakrishnan Nagaraj Copyright © 2022 Liangliang Qu et al. ,is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Osteosarcoma is a malignant bone tumor composed of interstitial cells. We aim to seek the function of mir-204-5p/DNM2 in osteosarcoma cells. From April 2017 to August 2019, 58 cases of cancer tissues and paracancer tissues were obtained from patients with osteosarcoma in our hospital. qPCR was used to detect mir-204-5p in excisional cancer tissues and paracarcinoma tissues of osteosarcoma patients. ,e overexpression vector of mir-204-5p was established and transfected into osteosarcoma cells, and the propagation, invasiveness, migration, and apoptosis of osteosarcoma cells were observed. StarBase was employed to forecast the binding site of mir-204-5p and DNM2. ,e targeting connection of mir-204-5p with DNM2 was detected via double luciferase reporter gene. mir-204-5p was lessened in osteosarcoma (p< 0.05). mir-204-5p overexpression suppressed propagation and accelerated apoptosis of osteosarcoma cells (p< 0.05). ,e results of double luciferase reporter gene revealed that the fluorescence activity of mir-204-5p was obviously declined when binding to DNM2 (p< 0.05). mir-204-5p functions as a tumor inhibitor by targeting DNM2 in osteosarcoma cells. Our research is helpful to provide new ideas for clinical treatment. have shown that many physiological processes and patho- 1. Introduction logical results (including cancer) are highly dependent on Osteosarcoma is a malignant bone tumor composed of miRNA [8]. miRNA-based therapy has great potential to interstitial cells, which often develops in children and ad- restore or inhibit miRNA expression and activity, which can olescents and produces osteoid and immature bone [1, 2]. At be used as a negative modulator of gene expression and present, the treatment of osteosarcoma includes surgical regulate a series of biological functions, including cell sur- resection combined with systemic chemotherapy to control vival, proliferation, apoptosis, tumor growth, and metastasis micrometastasis. For patients with local osteosarcoma, this [9]. As a member of miRNA family, the pathological will result in about 70% of 5-year event-free survival, while function of mir-204-5p (mir-204) has been observed in some the overall survival rate of patients with metastatic or re- diseases including pulmonary hypertension, diabetes, and crudescent diseases is <20% [3, 4]. Although there are many various types of cancers [7]. Some studies have shown that attempts to enhance the treatment by increasing the dose mir-204 decreased in KGN cells and ovarian cortex tissues of and adding chemotherapeutic agents in large clinical trials, patients with polycystic ovary syndrome [10]. It has also the survival rate of osteosarcoma has been stagnant in the been studied that downregulation of miR-204 in smooth past three decades [5]. ,erefore, it is necessary to find new muscle of pulmonary arterioles may be related to pulmonary effective treatment methods. hypertension [11]. All these reveal that the imbalance of mir- MicroRNA (miRNA) is a small RNA molecule, which 204-5p may be bound up with the development of diseases. plays a role in gene silencing and translation inhibition by ,e miR-204-5p is abnormal in many diseases. Previous binding with target mRNA [6, 7]. More and more evidences research has shown that miR-204-5p in glioma tissue is 2 Journal of Healthcare Engineering obviously lower than that in normal brain tissue, and miR- Kanglang Biotechnology Co., Ltd.), enzyme-labeling in- 204-5p is obviously bound up with the grade of glioma [12]. strument (Beijing Image Trading Co., Ltd.), and synthesis of Other researchers have shown that miR-204-5p in prostate mir-204-5P and internal reference primers (Beijing carcinoma tissues and serum samples with osseous metas- Zhongmei Taihe Biotechnology Co., Ltd.) (Table 1). tasis is lower than that in prostate cancer tissues and serum samples without osseous metastasis, which is related to the late clinicopathological features of prostate carcinoma pa- 2.4. Methods tients and the presence or absence of poor bone metastasis 2.4.1. Determination of mir-204-5p via qPCR. ,e [13]. mir-204-5p in osteosarcoma and adjacent tissues was tested Nevertheless, miR-204-5p in osteosarcoma is still un- via qRT-PCR, and the general RNA was obtained from the clear. ,erefore, in this research, the expression and influ- specimen by TRIzol in strict accordance with operation ence of mir-204-5p in osteosarcoma were investigated to specifications. ,e level and purity of general RNA were provide new ideas for clinical treatment. tested by the ultraviolet spectrophotometer. RNA with OD260/OD280 ratio of 1.8 with 2.0 was obtained, and then, 2. Materials and Methods cDNA was compounded by reverse transcriptase and oli- gonucleotide according to the operating instructions. ,e 2.1. Specimen Collection. Recent reports indicate that ab- transcription reaction system (20 μL) consists of buffer normal overexpression of DNM2 protein can lead to dys- (4 μL), reverse transcriptase (2 μL), total RNA (2 μL), and function of internal circulation, resulting in unbalanced RNase-free water (12 μL). Reaction conditions were at the expression of regulatory growth factor receptor (including ° ° waterbath at 42 C for 1 hour and waterbath at 95 C for 5 epidermal growth factor receptor) on the cells surface, thus minutes. PCR was used for amplification reaction. U6 was accelerating the growth, invasiveness, and proliferation of used as internal reference, and the specific primers of mir- abnormal cells [14]. Studies have also shown that NME2 204-5p were used to detect the mir-204-5p in fluorescence plays a part in regulating the movements and metastases of quantitative PCR according to the operation instructions. tumor cells [15, 16]. From April 2017 to August 2019, 58 cases of carcinoma tissues and corresponding adjacent ,e PCR reaction system (20 μL) consists the following: forward primer (0.4 μL), reverse primer (0.4 μL), and 0.5 μL normal tissues were obtained from sufferers with osteo- of Taq DNA polymerase, and the rest was supplemented sarcoma in our hospital, including 34 males and 24 females. with ddH O. ,e reaction conditions were predenatured at ,e average age was 17.82 ± 4.23 years old. ,e average ° ° ° 95 C for 30 s, at 95 C for 5 s, and at 60 C for 30 s, with a total weight was 55.57± 4.89 kg. of 40 cycles. ,ree multiple holes were set in each experi- ment, and the experiment was repeated three times. ,e 2.2. Exclusion and Inclusion Criteria experimental results were analyzed by the relative quanti- tative method, and the relative expression of mir-204-5p was Inclusion criteria: all patients were confirmed as having −△△CT calculated by 2 . osteosarcoma by MRI or CT [17]. ,is research was ratified by the ethics committee of our hospital, and the family members and patients were notified and signed 2.4.2. Cell Culture and Transfection. ,e high-sugar DMEM the informed consent before the experiment. medium containing 10% fetal bovine serum solution + 1% Exclusion criteria: patients with severe hepatic and penicillin/streptomycin solution was used for routine sub- renal insufficiency, patients who had received other culture. ,e growth conditions were in a cell incubator at treatments before the experiment, and patients who 37 C with 5% carbon dioxide, and the cells were inoculated were mentally disturbed and uncooperative. in a 6-hole plate, so that the cell density reached 60–70%. ,e cells were treated with miR-204-5pmimcs and NC mimics vectors through the Lipofectamine 2000 kit according to 2.3. Main Instruments and Materials. ,ere was osteosar- the operation instructions. coma cell U-2 OS (Shanghai Xuanya Biotechnology Co., Ltd.), real-time fluorescence quantitative PCR instrument (Guangzhou Huafeng Biotechnology Co., Ltd.), 10% fetal 2.4.3. Detection of Cell Growth Curve. ,e transfected cells bovine serum (Shanghai Lianshuo Baowei Biotechnology were made into suspension, which was inoculated into 96- Co., Ltd.), DMEM medium (Qingdao Jieshikang Biotech- hole plates with 100 μL/well of cell suspension, respectively, nology Co., Ltd.), transfection reagent Lipofectamine and each well was provided with three multiple wells. At four (Suzhou Yuheng Biotechnology Co., Ltd.), apoptosis kit time points (24 h, 48 h, 72 h, and 96 h), 20 μL of cell pro- (Hangzhou Beiwo Medical Technology Co., Ltd.), TRIzol liferation colorimetric assay reagent (cck8) was added to reagent (Beijing Biolab Technology Co., Ltd.), CCK8 kit each well at 2 h before the end of culture and then cultivated (Beijing Jinkong Biotechnology Co., Ltd.), UV spectro- at 37 C and 5%CO . After 2 h, the absorbance was measured photometer (Shanghai Qinxiang Scientific Instrument Co., at 490 nm by using an automatic enzyme-labeling instru- Ltd.), BD flow cytometer (Beijing Delika Biotechnology Co., ment to observe the cell proliferation. ,e experiment was Ltd.), transwell chamber (Shanghai Shengbo Biomedical reduplicated three times. Technology Co., Ltd.), reverse transcriptase (Shanghai Journal of Healthcare Engineering 3 Table 1: Primers sequence. Forward primers (5′-3′) Reverse primers (5′-3′) miR-204-5p GCCAGATCTGGAAGAAGATGGTGGTTAGT GGCGAATTCACAGTTGCCTACAGTATTCA U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 2.4.4. Detection of the Migratory and Invasive Ability of Cells. relative expression level of mir-204-5p in osteosarcoma ,e cell suspension (5 ×10 cells/hole) was put in the upper tissue was lower (p< 0.05) (Figure 1). compartment in serum-free culture media. ,e media comprising 10% FBS in the lower compartment were used as 3.2. Effect of mir-204-5p after Transfection. After transfec- a chemic attractant. After culture for 24 hours, cells that did tion, the mir-204-5p in mir-204-5pmimcs and NC mimics not migrate were removed from the upper surface of the was (2.69± 0.62) and (1.27± 0.56), respectively. Compared filter by scrubbing with cotton swabs. Next, the film was with that in NC mimics, the relative expression of mir-204- fixed with 4% formaldehyde at ambient temperature for 15 5p in mir-204-5pmimcs was higher after transfection minutes and dyed with 0.5% crystal violet for 15 minutes. (p< 0.05), indicating that the expression of mir-204-5p was For the determination of cell invasion, 8% matrix glue was obviously upregulated (Figure 2). applied in the above steps. ,e experiment was reduplicated three times. 3.3. Growth of Osteosarcoma Cells after Transfection. At 24 h, there were no differences in the development of osteosar- 2.4.5. Apoptosis Detection. ,e apoptosis detection kit was coma cells between mir-204-5pmimcs and NC mimics used to detect the apoptosis of cells, and the test followed the (p> 0.05). From 48 h to 96 h, the growth of osteosarcoma operation instructions. ,e BD flow cytometer was used to cells of mir-204-5pmimcs was obviously lower compared detect the cells which had been transfected for 48 hours and with that of NC mimics (p< 0.05), which indicated that the stained by Annexin V and PI in a 6-hole plate, and the growth of osteosarcoma cells was inhibited when mir-204- experiment was repeated three times. 5p was obviously enhanced (Figure 3). 3.4. Migration and Invasiveness of Osteosarcoma Cells after 2.4.6. Detection of the Targeting Connection of mir-204-5p with DNM2 by Double Luciferase. A DNA fragment of Transfection. After transfection, the number of cell migra- tion of mir-204-5pmimcs and NC mimics was (75.18± 5.49) DNM2mRNA 3′-UTR comprising the putative combining and (116.54± 9.41), respectively. Compared with that of NC site of mir-204-5p was synthesized. ,en, the fragment was mimics, the number of cell migration of mir-204-5pmimcs subcloned to Xho I and Not I sites downstream of the coding was lower (p< 0.05) (Figure 4). After transfection, the region of renilla luciferase in psiCHECK2 vector and verified number of cell invasion of mir-204-5pmimcs and NC by Sangon Biotech sequencing. PsiCHECK2-DNM2-wt or mimics was (61.42± 5.75) and (104.46± 8.19), respectively. PsiCHECK2-DNM2-mut was constructed, and miR-204- 5pmimcs or miR-NC and Wt-DNM2 or Mut-DNM2 were Compared with that of NC mimics, the number of cell invasion of mir-204-5pmimcs was lower (p< 0.05) transfected into cells by Lipofectamine 2000. After transfection for 48 hours, cells were obtained. Next, the (Figure 5). activities of firefly and Ranilla luciferase were analyzed by double luciferase reporting assay (Promega) in line with the 3.5. Apoptosis of Osteosarcoma Cells after Transfection. makers’ specifications. After transfection, the apoptotic rates of mir-204-5pmimcs and NC mimics were (32.41± 3.82)% and (5.71± 1.59)%, respectively. ,e apoptotic rate of mir-204-5pmimcs was 2.5. Statistical Analysis. ,e differences were verified by higher than that of NC mimics (p< 0.05) (Figure 6). statistic software SPSS 21.0 (SPSS, Inc., Chicago, IL, USA). ,e t-test was applied to express the measurement data, which were expressed by the mean number± standard de- 3.6. mir-204-5p Targeted DNM2 Directly. We forecasted the viation (x ± sd). Repetitive measurement and analysis of binding locus of mir-204-5p with DNM2 by StarBase, and variance were used to compare multiple time points within the findings of double luciferase reporter gene revealed that the group, which was expressed by F. ,e difference was mir-204-5pmimcs could reduce the luciferase activity of statistically significant with p< 0.05. DNM2-Wt, but it did not impact the luciferase activity of DNM2-Mut, indicating that the fluorescence activity of mir- 204-5pmimcs decreased significantly when binding to 3. Research Findings DNM2 (p< 0.05) (Figure 7). ,en, we observed the effect of 3.1. mir-204-5p in Osteosarcoma and Adjacent Tissues. interfering DNM2 on osteosarcoma cells and reexpressed ,e relative expressions of mir-204-5p in osteosarcoma and DNM2 in osteosarcoma cells treated with mir-204-5p. ,e adjacent tissues were (1.21± 0.53) and (3.14± 0.86), re- findings revealed that DNM2 reexpression saved the growth spectively. Compared with that in paracarcinoma tissues, the defects after transfection of a mimetic agent (Figure 8). 4 Journal of Healthcare Engineering 5 150 mir-204-5pmimcs NC mimcs Osteosarcoma Paracancer tissue Figure 4: Migration of osteosarcoma cells after transfection. Comparison with NC mimics (p< 0.05). Figure 1: Relative expression of mir-204-5p in osteosarcoma and adjacent tissues. Comparison with the adjacent tissues (p< 0.05). 5 150 mir-204-5pmimcs NC mimcs mir-204-5pmimcs NC mimcs mir-204-5pmimcs Figure 5: Invasion of osteosarcoma cells after transfection. ,e NC mimcs number of cell invasion of mir-204-5pmimcs was lower than that of NC mimics (p< 0.05). Comparison with NC mimics (p< 0.05). Figure 2: Effect of mir-204-5p after transfection. Comparison with NC mimics (p< 0.05). 1.5 40 1.0 0.5 0.0 24 h 48 h 72 h 96 h mir-204-5pmimcs NC mimcs mir-204-5pmimcs Figure 6: Apoptosis of osteosarcoma cells after transfection. NC mimcs Comparison with NC mimics (p< 0.05). Figure 3: Growth of osteosarcoma cells after transfection. Comparison with NC mimics (p< 0.05). was lower than that in adjacent tissues. ,e findings indi- cated that mir-204-5p was declined in osteosarcoma, and it might be a carcinogen in osteosarcoma. More and more 4. Discussion evidences have shown that miRNA can be used as a cancer Similarly, research studies have shown that miR-204-5p in suppressor or oncogene to interfere with the progress of cells and patients with esophageal squamous cell carcinoma cancer [19]. We observed the influence of mir-204-5p on the is lower than that in normal tissues and cells, and it has also biological behavior of osteosarcoma cells by interfering with shown that the continuous decline of miR-204-5p is bound miR-204-5P in osteosarcoma cells. ,e findings revealed up with unfavorable prognosis of sufferers [18]. that upregulation of mir-204-5p obviously inhibited the In this experiment, we first tested mir-204-5p in oste- growth activity and migrating of osteosarcoma cells and osarcoma and paracarcinoma tissues by qRT-PCR. ,e accelerated apoptosis. ,e research has shown that findings revealed that mir-204-5p in osteosarcoma tissue miR-204-5p has been previously declined in melanoma Relative expression level Relative expression level Absorbance (A) of mir-204-5p of mir-204-5p Apoptosis rate (%) Cell migration Cell invasion Journal of Healthcare Engineering 5 Position 836-843 of DNM2 3' UTR 5' …UUAAUAAACUAAAAUAAAGGGAA… 1.5 hsa-miR-204-5p 3' UCCGUAUCCUACUGUUUCCCUU 1.0 0.5 0.0 DNM2-Wt DNM2-Mut mir-204-5pmimcs NC mimcs (a) (b) Figure 7: mir-204-5p targeted DNM2 directly. (a) Target gene map. (b) Results of double luciferase reporter gene: mir-204-5pmimcs could reduce the luciferase activity of DNM2-Wt, but it had no effect on the luciferase activity of DNM2-Mut (p< 0.05). Comparison with NC mimics (p< 0.05). 1.5 1.0 0.5 50 0.0 0 24 h 48 h 72 h 96 h mir-204- NC mir-204- mir-204- NC mir-204- 5pmimcs mimcs 5pmimcs 5pmimcs mimcs 5pmimcs mir-204-5pmimcs +DNM2 +DNM2 NC mimcs mir-204-5pmimcs+DNM2 (a) (b) (c) mir-204- NC mir-204- 5pmimcs mimcs 5pmimcs +DNM2 (d) Figure 8: Rescue experiment chart. ,e reexpression of DNM2 saved the growth defects, migration, and invasion after transfection of mimetic agents. (a) Growth of cells in each group after retransfection of DNM2. (b) Migration of cells in each group after retransfection of DNM2. (c) Invasion of cells in each group after retransfection of DNM2. (d) Apoptosis in each group after retransfection of DNM2. Comparison with NC mimics (p< 0.05). compared with melanocytic nevus, and miR-204-5p mimetic carcinoma cell strains can inhibit the viability of cells and can lead to the reduction of melanoma cell growth and increase apoptosis [22]. All these indicate that the biological continued migration and invasion of tissues [20]. Other behavior of tumor cells can be influenced by regulating research studies have revealed that miR-204-5p is signifi- miR-204-5p. DNM2 is a GTP enzyme, which plays a crucial cantly downregulated in triple negative breast carcinoma, role in the formation and transportation of intracellular and miR-204-5p ectopic expression in breast carcinoma cells vesicles, cytokinesis, and receptor endocytosis [23, 24]. can greatly reduce the migratory and invasiveness of car- However, there is no specific clinical study on the role of the cinoma cells [21]. Other research studies have shown that two in osteosarcoma. In this research, we predicted the mir-204-5p overexpression in human hepatocellular binding locus between mir-204-5p and DNM2 through Absorbance (A) Cell migration Apoptosis rate (%) Dual luciferase report Cell invasion 6 Journal of Healthcare Engineering 211-5p contribute to BRAF inhibitor resistance in mela- StarBase, and the results of double luciferase reporter gene noma,” Cancer Research, vol. 78, no. 4, pp. 1017–1030, 2018. indicated that the fluorescence activity of mir-204-5pmimcs [7] T. Li, H. Pan, and R. Li, “,e dual regulatory role of miR-204 decreased obviously when binding to DNM2. ,en, we in cancer,” Tumor Biology, vol. 37, no. 9, pp. 11667–11677, observed the effect of interfering DNM2 on osteosarcoma cells and reexpressed DNM2 in osteosarcoma cells treated [8] M. Correia de Sousa, M. Gjorgjieva, D. Dolicka, with mir-204-5p. C. Sobolewski, and M. Foti, “Deciphering miRNAs’ action through miRNA editing,” International Journal of Molecular 5. Conclusion Sciences, vol. 20, no. 24, p. 6249, 2019 Published 2019 Dec 11. [9] A. Ganju, S. Khan, B. B. Hafeez et al., “miRNA nano- In conclusion, mir-204-5p is declined in osteosarcoma, and therapeutics for cancer,” Drug Discovery Today, vol. 22, no. 2, its upregulation can effectively inhibit growth activity of cell pp. 424–432, 2017. and induce apoptosis, and mir-204-5p may act on osteo- [10] X. Sun, S. Su, G. Zhang, H. Zhang, and X. Yu, “MiR-204 sarcoma cells by directly targeting DNM2. ,e findings suppresses cell proliferation and promotes apoptosis in revealed that DNM2 reexpression saved the growth defects ovarian granulosa cells via targeting TPT1 in polycystic ovary syndrome,” Biochemistry and Cell Biology, vol. 97, no. 5, after transfection of a mimetic agent. ,ese findings revealed pp. 554–562, 2019. that mir-204-5p might control the biological behavior of [11] M. Gabani, J. Liu, K. Ait-Aissa et al., “MiR-204 regulates type osteosarcoma cells by directly targeting DNM2. 1 IP3R to control vascular smooth muscle cell contractility and blood pressure,” Cell Calcium, vol. 80, pp. 18–24, 2019. Data Availability [12] J. Shen, J. Xiong, X. Shao et al., “Knockdown of the long noncoding RNA XIST suppresses glioma progression by ,e datasets used and/or analyzed during the current study upregulating miR-204-5p,” Journal of Cancer, vol. 11, no. 15, are available from the corresponding author upon request. pp. 4550–4559, 2020, Published 2020 May 18. [13] Q. Wa, S. Huang, J. Pan et al., “miR-204-5p represses bone Disclosure metastasis via inactivating NF-κB signaling in prostate can- cer,” Molecular erapy - Nucleic Acids, vol. 18, pp. 567–579, Liangliang Qu and Zhongqiu Li are the co-first authors. [14] S. Raja, S. Shah, A. Tariq et al., “Caveolin‑1 and dynamin‑2 overexpression is associated with the progression of bladder Conflicts of Interest cancer,” Oncology Letters, vol. 18, no. 1, pp. 219–226, 2019. ,e authors declare that they have no conflicts of interest. [15] I. Khan, B. Gril, and P. S. Steeg, “Metastasis suppressors NME1 and NME2 promote dynamin 2 oligomerization and regulate tumor cell endocytosis, motility, and metastasis,” Authors’ Contributions Cancer Research, vol. 79, no. 18, pp. 4689–4702, 2019. [16] M. Chatterjee, E. Ben-Josef, D. G. ,omas et al., “Caveolin-1 is Liangliang Qu and Zhongqiu Li contributed equally to this associated with tumor progression and confers a multi-mo- work. dality resistance phenotype in pancreatic cancer,” Scientific Reports, vol. 5, no. 1, p. 10867, 2015 Published 2015 Jun 12. Acknowledgments [17] X. Zhang and Z. Guan, “PET/CT in the diagnosis and prognosis of osteosarcoma,” Frontiers in Bioscience, vol. 23, ,is project was supported by funds from the Natural pp. 2157–2165, 2018, Published 2018 Jun 1. Science Foundation of Liaoning Province, China [18] Z. Shen, T. Chai, F. Luo et al., “Loss of miR-204-5p promotes (201602304). tumor proliferation, migration, and invasion through tar- geting YWHAZ/PI3K/AKT pathway in esophageal squamous References cell carcinoma,” OncoTargets and erapy, vol. 13, pp. 4679–4690, 2020, Published 2020 May 26. [1] A. Biazzo and M. De Paolis, “Multidisciplinary approach to [19] J. Guo, P. Zhao, Z. Liu et al., “MiR-204-3p inhibited the osteosarcoma,” Acta Orthopaedica Belgica, vol. 82, no. 4, proliferation of bladder cancer cells via modulating lactate pp. 690–698, 2016. dehydrogenase-mediated glycolysis,” Frontiers in Oncology, [2] H. K. Brown, M. Tellez-Gabriel, and D. Heymann, “Cancer vol. 9, p. 1242, 2019 Published 2019 Nov 29. stem cells in osteosarcoma,” Cancer Letters, vol. 386, [20] N. Palkina, A. Komina, M. Aksenenko, A. Moshev, pp. 189–195, 2017. A. Savchenko, and T. Ruksha, “miR‑204‑5p and miR‑3065‑5p [3] D. J. Harrison, D. S. Geller, J. D. Gill, V. O. Lewis, and exert antitumor effects on melanoma cells,” Oncology Letters, R. Gorlick, “Current and future therapeutic approaches for vol. 15, no. 6, pp. 8269–8280, 2018. osteosarcoma,” Expert Review of Anticancer erapy, vol. 18, [21] H. Toda, S. Kurozumi, Y. Kijima et al., “Molecular patho- no. 1, pp. 39–50, 2018. genesis of triple-negative breast cancer based on microRNA [4] L. Kager, G. Tamamyan, and S. Bielack, “Novel insights and expression signatures: antitumor miR-204-5p targets AP1S3,” therapeutic interventions for pediatric osteosarcoma,” Future Journal of Human Genetics, vol. 63, no. 12, pp. 1197–1210, Oncology, vol. 13, no. 4, pp. 357–368, 2017. [5] M. W. Bishop, K. A. Janeway, and R. Gorlick, “Future di- [22] G. Jiang, L. Wen, H. Zheng, Z. Jian, and W. Deng, “miR-204- rections in the treatment of osteosarcoma,” Current Opinion 5p targeting SIRT1 regulates hepatocellular carcinoma pro- in Pediatrics, vol. 28, no. 1, pp. 26–33, 2016. gression,” Cell Biochemistry and Function, vol. 34, no. 7, [6] M. D´ıaz-Mart´ınez, L. Benito-Jardon, ´ L. Alonso, L. Koetz- pp. 505–510, 2016. Ploch, E. Hernando, and J. Teixido, ´ “miR-204-5p and miR- Journal of Healthcare Engineering 7 [23] Z. Ge, Y. Gu, Q. Han et al., “Targeting high dynamin-2 (DNM2) expression by restoring ikaros function in acute lymphoblastic leukemia,” Scientific Reports, vol. 6, no. 1, Published 2016 Nov 25, Article ID 38004, 2016. [24] M. Zhao, N. Maani, and J. J. Dowling, “Dynamin 2 (DNM2) as cause of, and modifier for, human neuromuscular disease,” Neurotherapeutics, vol. 15, no. 4, pp. 966–975, 2018.
Journal of Healthcare Engineering – Hindawi Publishing Corporation
Published: Feb 9, 2022
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.