Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Mechanism for Regulation of Melanoma Cell Death via Activation of Thermo-TRPV4 and TRPV2

Mechanism for Regulation of Melanoma Cell Death via Activation of Thermo-TRPV4 and TRPV2 Hindawi Journal of Oncology Volume 2019, Article ID 7362875, 14 pages https://doi.org/10.1155/2019/7362875 Research Article Mechanism for Regulation of Melanoma Cell Death via Activation of Thermo-TRPV4 and TRPV2 1 1,2 1 1 1 Jiaojiao Zheng, Fangyuan Liu, Sha Du, Mei Li, Tian Wu, 2 1 Xuejing Tan , and Wei Cheng Institute of Cancer Stem Cell, Dalian Medical University, No. 9 West Section Lvshun South Road, Dalian 116044, China eTh First Affiliated Hospital, Dalian Medical University, No. 222 Zhongshan Road, Dalian 116011, China Correspondence should be addressed to Xuejing Tan; xjtan72@hotmail.com and Wei Cheng; wcheng@dmu.edu.cn Received 15 May 2018; Revised 30 September 2018; Accepted 27 December 2018; Published 7 February 2019 Academic Editor: Ozkan Kanat Copyright © 2019 Jiaojiao Zheng et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. er Th mo-TRPs (temperature-sensitive transient receptor potential channels) belong to the TRP (transient receptor potential) channel superfamily. Emerging evidence implied that thermo-TRPs have been involved in regulation of cell fate in certain tumors. However, their distribution profiles and roles in melanoma remain incompletely understood. Methods.Westernblot and digital PCR approaches were performed to identify the distribution profiles of six thermo-TRPs. MTT assessment was employed to detect cell viability. Flow cytometry was applied to test cell cycle and apoptosis. Calcium imaging was used to determine the function of channels. Five cell lines, including one normal human primary epidermal melanocytes and two human malignant melanoma (A375, G361) and two human metastatic melanoma (A2058, SK-MEL-3) cell lines, were chosen for this research. Results.Inthe present study, six thermo-TRPs including TRPV1/2/3/4, TRPA1, and TRPM8 were examined in human primary melanocytes and melanoma cells. We found that TRPV2/4, TRPA1, and TRPM8 exhibited ectopic distribution both in melanocytes and melanoma cells.Moreover,activationofTRPV2 andTRPV4couldleadtothe declineofcellviabilityformelanomaA2058andA375cells. Subsequently, activation of TRPV2 by 2-APB (IC =150𝜇M) induced cell necrosis in A2058 cells, while activation of TRPV4 by GSK1016790A (IC = 10 nM) enhanced apoptosis of A375 cells. Furthermore, TRPV4 mediated cell apoptosis of melanoma via phosphorylation of AKT and was involved in calcium regulation. Conclusion. Overall, our studies revealed that TRPV4 and TRPV2 mediated melanoma cell death via channel activation and characterized the mechanism of functional TRPV4 ion channel in regulating AKT pathway driven antitumor process. u Th s, they may serve as potential biomarkers for the prognosis and are targeted for the therapeutic use in human melanoma. 1. Introduction [9–11]. Fusi et al. reported that TRPV4 was detected in healthy or inflamed skin and lost both in premalignant lesions and Malignant melanoma is a very aggressive and lethal form nonmelanoma skin cancer. Selectively reduction of TRPV4 of cutaneous cancer. It usually derives from the transforma- distribution may represent a diagnostic biomarker of skin tion of melanocytes causing dysfunction to normal cellular carcinogenesis [12]. Meanwhile, study suggested that skin cancer may be closely related to TRPV1 and TRPV1 knockout growth. Increasing studies demonstrated that ion channels play important roles in regulating cellular physiology and mice were facile to induce skin carcinogenesis [13]. u Th s, pathology in cancers [1–5]. Melanoma cells harboring a diver- examination of the distribution pattern and function of TRP sity of ion channel types have been detected and described ion channels in human melanoma cells is necessary and [6–8]. useful for clinical practice. Human melanocytes are usually located in the skin and Recent studies have found that several TRPs presented in eyes. Several transient receptor potential channels (TRPs) melanoma cells. These TRPs were also involved in regulating such as TRPA1, TRPV3, TRPV4, TRPM4, and TRPM8 are cellular functions of human melanoma. In this regard, study expressed in the epithelial cells and keratinocytes of the skin identified that TRPM7 could be a protector and detoxifier in 2 Journal of Oncology both melanocytes and melanoma cells [14]. Further, TRPM8 melanocyte growth kit (ATCC, PCS-200-042) components. hasbeenreportedtoparticipate inmediatingagonist- Allcells were growninahumidiefi dincubator at37 C, 5% induced melanoma cell death [15]. CO atmosphere. Aer ft 1-2 days, cells were chosen to perform Temperature-sensitive transient receptor potential chan- calcium imaging or other functional experiments. nels (thermo-TRPs) belong to TRP channel superfamily. These channels act as multimode cellular sensors for detect- 6 7 2.3. Western Blot. Cells at density of 1∗10 -10 cells/well were ing a variety of environmental stimuli to confer crucial rinsed twice with phosphate-buffered saline (PBS) and then physiological functions, such as thermosensation, chemes- lysed on ice with 200𝜇lcoldcelllysisbueff rfor Westernand thesis, pain and inflammation, and sensation of taste, even IP containing 20 mM Tris-HCl (pH = 7.5), 150 mM NaCl, 1% a biomarker for certain metastatic cancers [16–23]. Several TritonX-100, 2.5 mM sodium pyrophosphate, 1% Na VO ,1 3 4 thermo-TRPs also have been identified to involve in cer- mM EDTA, 0.5𝜇g/ml leupeptin, and 1 mM phenylmethylsul- tain types of carcinoma malignancy [24–29]. Mergler et fonyl uo fl ride (PMSF) (Beyotime Biotechnology). The lysates al. reported that functional TRPV1, TRPM8, and TRPA1 were then centrifuged at 14000 g at 4 Cfor5minand were expressed in malignant human uveal melanoma tissues, thesupernatantswerestoredat-80 C as whole cell protein and some of these channels were also detected in human extracts. Protein concentrations were determined by BCA uveal melanoma cell lines [30]. Another study revealed that Protein Assay Kit. Proteins were separated by 8-12% SDS- overexpression of TRPM2 increased melanoma susceptibility PAGE gel and then transferred to NC membrane. The NC to apoptosis and necrosis [31]. Yamamura et al. found that membrane was blocked with 5% nonfat milk in TBS (10 functional TRPM8 expressed in human melanoma cell line mM Tris-HCl, pH = 8.0, 150 mM NaCl) for 1 h at room andactivationofTRPM8 couldinhibit cell viabilityofhuman temperature. The NC membrane was then incubated with melanoma G361 cells [15]. TRPM8 and TRPA1 channel primary antibody (1:500 dilution) in TBS at 4 Covernight. proteins have been identified to exhibit abnormal expression After incubation with IRDye 800CW Goat Anti-Rabbit IgG in melanoma cell lines. Certain compounds such as TRPA1 (H+L) (1:10000 dilution) in 5% nonfat milk in TBS for 40 activators like cinnamaldehyde and allyl isothiocyanate could min in the dark at room temperature, blots were detected reduce the proliferation of melanoma cells [32]. Although the using Odyssey imaging system (Odyssey CLx, LI-COR). All existing studies referred to that several thermo-TRPs were western blots were repeated at least three times for each distributedinmelanoma, therelevantroleshave remained experiment to confirm the reproducibility of the results. essentially unexplored. In thepresentstudy, sixthermo-TRPsincludingfourheat sensors of TRPV1/2/3/4 and two cold sensors of TRPA1 and 2.4. Validation of Gene Expression by Digital PCR. Total RNA TRPM8 have been investigated among human melanocytes was extracted from cultures of melanocytes and melanoma and melanoma cells. Based on current research, our study cell lines using RNAiso plus Kit (TaKaRa). Then, the reverse is to explore the mechanism of ectopic expression of several transcription was performed with PrimeScript RT reagent Kit thermo-TRPs involved in the regulation of cell fate of human with gDNA Eraser (TaKaRa). Primer and probe sequences melanoma. were designed using Primer-Blast of NCBI. To determine the expression profiles of thermo-TRPs in melanoma and melanocytes, digital PCR approach was applied using Eva- 2. Materials and Methods Green Kit (Bio-Rad). Primer sequences were given in Table 1. 2.1. Antibodies and Regents. All antibodies to six thermo- The intact cDNA samples were added to the Bio-Rad 2X TRPs were purchased from Pierce Biotechnology (anti- ddPCR EvaGreen Supermix at concentration of 50 ng DNA TRPV1, anti-TRPV2, anti-TRPV3, anti-TRPV4, anti-TRPA1, per 20𝜇l ddPCR reaction. Reaction mixes were thoroughly and anti-TRPM8); other antibodies were obtained from mixed by brief vortex as avoiding the formation of bubbles, Cell Signaling Technology (CST, anti-AKT, anti-pAKT, anti- centrifuged for 20 sec and allowed reaction mixes to equili- P38, anti-pP38, anti-JNK, anti-pJNK, anti-ErK1/2, and anti- brate at room temperature for about 3 min, then loaded 20𝜇l pErK1/2). All chemical agents were obtained from Sigma of each reaction mix into a sample well of a DG8 Cartridge (Merck). for QX200 droplet generator (Bio-Rad) followed by 70 𝜇l of QX200 droplet generation oil for EvaGreen into the oil 2.2. Cell Culture. Human melanoma cell line A375 wells, according to the QX200 droplet generator instruction (malignant, CRL-1619), G361 (malignant, CRL-1424), A2058 manual. Aer ft droplet generation, droplets were transferred (metastatic, CRL-11147), SK-MEL-3 (metastatic, HTB-69), into a clean 96-well plate (twin. tec real-time PCR plates, normal human primary epidermal melanocytes (PCS- Eppendorf) and sealed with the PX1PCR plate sealer (Bio- 200-013) were all purchased from American Type Culture Rad). en Th the sealed plate was proceeded to a thermal cycler Collection (ATCC). A375, A2058 cell lines were cultured in (T100, Bio-Rad) following standard cycling conditions: 95 C ∘ ∘ DMEM (ATCC) supplemented with 10% fetal bovine serum for 5 min, then 40 cycles of 95 Cfor 30sec; 60 Cfor 60 sec, ∘ ∘ ∘ (FBS, Gibco). G361, SK-MEL-3 cell lines were cultured in 4 Cfor 5min,then90 Cfor 5min,and4 C infinitely; aeft r McCoy’s 5A (ATCC) supplemented with 10% and 15% fetal thermal cycling, 96-well sealed plate was placed in the QX200 bovine serum (FBS, Gibco), respectively. Normal human droplet reader (Bio-Rad), which automatically acquired data primary epidermal melanocytes were grown in dermal cell of the droplets from each well of the plate. Data analysis basal media (ATCC, PCS-200-030) supplemented with adult was performed using QuantaSoft software (Bio-Rad). Using Journal of Oncology 3 Poisson statistics, the concentration of DNA sample was suspended in fresh stain-detergent solution for flow cytome- determined. try (LSRFortessa, Becton Dickinson) analysis with an argon- in laser tuned to 488 nm and measured red uo fl rescence. 2.5. Intracellular Calcium Measurement. Calcium imaging was performed to determine intracellular calcium using 2.9. Posttranscriptional Gene Silencing. Gene silencing was Fluo-4 Direct Calcium Assay Kit (Invitrogen) according to used to knockdown targeted proteins of interest. The Dhar- manufacturer’s protocol. Cells at confluence of 40-50% in macon GIPZ lentiviral shRNA were purchased from GE 35mm culture plate or 6-well plate with 2∗10 cells were which have been bioinformatically verified to match NCBI incubated with Fluo-4 AM (1.25𝜇M)for60mininthedark sequence data. Plasmid was purified using Midi Kit (QIA- 2+ GEN). eTh following sequences as sense strand for TRPV2 at room temperature. Intracellular Ca signals were acquired and TRPV4 were shown as 5 -GCTGAACCTGCTTTACTA- by either ImageXpress Micro XL system (Molecular Devices) 耠 耠 耠 T-3 and 5 -ACCAAGTTTGTTACCAAGA-3 ,respectively. or living cell imaging system (Leica DMI6000B). eTh Fluo- Transfections of shRNA were performed using Lipofectamine 4 uo fl rescence was measured at an excitation wavelength of 3000 (Invitrogen) following manufacturer’s instruction. eTh 488 nm and emission wavelength of 516 nm from the bottom silencing efficiency was detected by western blot analysis. of the plate. Loading and imaging were carried out in Fluo-4 Direct calcium assay bueff r at 37 C. Data were then analysed with MetaMorph software (Molecular Devices). 2.10. Statistical Analysis. The results were expressed as means ± standard error of the mean (SEM). Statistical signicfi ance was evaluated by two-tailed student's t-test. All statistical 2.6. Cell Proliferation Assay (MTT Test). Cells were cultured tests were performed via GraphPad Prism 5 as well as Adobe in 96-well plate containing a final volume of 200 𝜇l/well Illustrator CS6. Significance was set at ∗ P< 0.05,∗∗ P< 0.01, at density of 5∗10 cells, and then applied compounds or∗∗∗ P< 0.001. to cells and incubated at 37 Cfor24 h. eTh cellswere prepared by adding 10 𝜇l 3-(4,5-dimethylthiazol-2-y1)-2,5- diphenyltetrazolium bromide (MTT) solution per well to 3. Results achieve a n fi al concentration of 0.45 mg/ml with incubation 2-4 h at 37 C, following 100𝜇l application of solubilization 3.1. er Th mo-TRPs Exhibited Ectopic Expression Pattern in Human Melanoma Cells and Melanocytes. To investigate six solution to each well to dissolve formazan crystals, mixed to ensure complete solubilization. eTh quantity of formazan thermo-TRPs expression patterns in human melanoma, four was measured by recording changes in absorbance at 570 melanoma cell lines and primary epidermal melanocytes nm using a plate reader (EnSpire 2300, PerkinElmer). A were chosen for western blot analysis. eTh assessments clearly reference wavelength of 630 nm was used. The experiments showed differential expression profiles of thermo-TRPs, in were repeated at least three times. which TRPV1 was hardly detected in human melanocytes, and very weak expression was found in human melanoma 2.7. Apoptosis Detection with Flow Cytometer. Asinglecell cells (Figure 1(a)(i)). TRPV2 was decreased in G361 and suspension at 1∗10 cells/ml washed in phosphate-bueff red SK-MEL-3 melanoma cells compared to primary epidermal saline (PBS) was prepared, then centrifuged and resuspended melanocytes (Figure 1(a)(ii)). Neither in melanocytes nor in in 10 mM Hepes/NaOH buer ff (pH = 7.4). The cells were melanoma cells TRPV3 protein was found (Figure 1(a)(iii)). added FITC-Annexin V to a final concentration of 1 𝜇g/ml, However, TRPV4 protein was significantly increased in A375 incubated 10 min in the dark at room temperature. en Th and A2058 cells (Figure 1(a)(iv)). Moreover, previous study PI was added to a final concentration of 2 𝜇g/ml, incubated has reported that TRPA1 and TRPM8 were expressed in for a further 5 min. Apoptosis was determined by recording human melanoma [15, 32]; our data showed that TRPA1 right angle and forward light scatter, log green (520 nm) protein increased in all four melanoma cells (Figure 1(a)(v)), andlogredfluorescence( > 650 nm) with flow cytometer and TRPM8 protein level was increased in A375 and A2058 (LSRFortessa, Becton Dickinson). Green uo fl rescence was cells compared to melanocytes (Figure 1(a)(vi)). using the u fl orescein filter and a deep red filter was used for To further confirm the expression profiles of these six red. Care must be taken not to exclude any apoptotic cells. thermo-TRPs in melanoma, digital PCR assessment was then The percentage of apoptotic cells was determined in three conducted and the results showed differential expression pat- independent experiments. tern of thermo-TRPs in human melanocytes and melanoma cells. Specifically, TRPV1 and TRPV3 transcripts showed 2.8. Cell Cycle Analysis by Flow Cytometry. Cells were seeded very weak expression both in human melanocytes and at density of 1∗10 cells/ml and incubated overnight. Then a melanoma cells (Figures 1(b)(i) & 1(b)(iii)) which exhibited stain-detergent solution was made up containing 50𝜇g/ml good concordance with protein distribution, while TRPV2 isotonic propidium iodide (PI) in 0.1% trisodium citrate was markedly decreased in all four melanoma cell lines dihydride with 0.3𝜇l/ml of Nonidet P-40. Culture medium compared to melanocytes (Figure 1(b)(ii)), which was discor- was removed and cells were rinsed with PBS once, then stain- dant with our protein expression results. TRPV4 mRNA was detergent solution was added and cells were scraped by a increased significantly in A375 cells compared to melanocytes rubber policeman, shook vigorously, and dislodged by a ne fi (Figure 1(b)(iv)). Moreover, TRPA1 showed apparent increase tipped pipette. Harvested cells were then centrifuged and in G361 cells other than melanocytes and other melanoma 4 Journal of Oncology Table 1: Primer sequences and reference number of human TRP-specific primers used in digital PCRs. Channel Forward primer Reverse primer NM-number TRPV1 ATCGCCCGTCCTGGTATCA CCTCCTCCGAGTCACCCTT NM 080705.3 TRPV2 TCTTCCTTTTCGGCTTCGC CCCTCGTCCTCCTGTCCCT NM 016113.4 TRPV3 GCTGCGTGGAGGAGTTGG CAGGTCTTCCCCGTGTCG NM 001258205.1 TRPV4 TGGAGTCACATAAGCCAACGC GGCAAATCCCAGACACTACAGA NM 021625.4 TRPA1 GTTTGGCAGTTGGCGACA GGATACACGATGGTGGATTTCT NM 007332.2 TRPM8 GCAATGCCATCTCCTACGC TGAAGGTCAGCAGACTCCCA NM 024080.4 𝛽-actin TGGCATCCACGAAACTACCTT TCGTCATACTCCTGCTTGCTG NM 001101.3 cells (Figure 1(b)(v)). TRPM8 was found increased in A375 suppress proliferation of human melanoma A375 cells but not and A2058 cells which was identical with protein expression for primary epidermal melanocytes. pattern (Figure 1(b)(vi)). Calcium imaging assay also identified that TRPV2 has Because the prior results suggested a discrepancy between functional activation by 2-APB and channel could be blocked protein and mRNA distributions in melanoma, we then by ruthenium red (Figure 2(e)(i), (n = 12, p < 0.01)). By comparing functional TRPV2 and TRPV1 in A2058 cells examined calcium influx during channel activation and aeff cted by its different expression, TRPV1 agonist (capsaicin, blockade. Calcium imaging indicated that TRPV4 ion chan- 10 𝜇M) was applied, but no apparent calcium signal was nel was functionally expressed in A375 cells, while in A2058 detected by calcium imaging approach (Figure 2(e)(ii), (n = and G361 cells, channel functions were observed inconspic- 19)). This may be due to very much low expression of TRPV1 uously (see Figure S1a (i) & (ii)). For TRPV2, both channel ion channel in A2058 cells which could not dominate calcium common activator of 2-APB (2-aminoethoxydiphenyl borate) inu fl x aeft r channel activation. and specific agonist of probenecid were inducing similar To further prove that TRPV2 ion channel was modulated calcium influx in A2058 cells (Figure S1b (i)), while 2-APB by 2-APB in melanoma cells, TRPV2 was knockdown by elicited very small calcium influx in G361 cells (Figure S1b using shRNA to produce RNA interference in A2058 cells (ii)). Our data indicated that both TRPV4 in A375 cells and (Figure S2a). As shown in Figure S2, apparent change was TRPV2 in A2058 cells might dominate calcium influx during hardly observed by treatment of 2-APB in cell viability (Fig- channel activation. But how these two channels function in ure S2b). These data suggested that 2-APB targeted TRPV2 melanoma remains to be elucidated. ion channel in melanoma A2058 cells and may be implicated in cell fate. 3.2. Inhibition of Melanoma Cells Proliferation Modulated by Activation of eTh rmo-TRPVs. Due to the signica fi nt upreg- 3.3. Activation of TRPV2 Channel Promoted Necrosis for ulation of TRPV4 which has been detected in melanoma A2058 Melanoma Cells. As activation of TRPV2 could inhibit A375 cells, GSK1016790A, a selective activator of TRPV4, cell viability of A2058 melanoma cells, the function of TRPV2 hasbeenappliedto A375cellsaswellasmelanocytes. in A2058 cells requires further investigation. Flow cytometry Microscopic imaging showed that the proliferation of A375 analysisforeithercellcycle orcell apoptosishasbeen cells was inhibited aeft r GSK1016790A application but not assessed, respectively. After treatment with 2-APB (100 𝜇M for melanocytes (Figures 2(a)(i) & 2(a)(ii)). In addition, -400𝜇M) for 24 h, cell cycle changed negligibly (data not proliferation was quantified with MTT assay of GSK1016790A shown), while there was significant increase from 3.9% to (1 nM-50 nM) for 24 h, and GSK1016790A prominently 56.4% in the necrotic and late apoptotic cells. Meanwhile, the inhibited cell proliferation of A375 cells but with no effect on number of early apoptotic cells was also increased from 7.1% = 10 nM). Meanwhile, 2-APB, melanocytes (Figure 2(b), IC to 15.1% (Figures 3(a)(i) & 3(a)(ii)). an activator of TRPV2 (also activates TRPV1 and TRPV3 but Moreover, microscopic imaging clearly showed that 2- does not aeff ct TRPV4), clearly attenuated the proliferation APB could inhibit proliferation of A2058 melanoma cells, of A2058 melanoma cells (Figure 2(c), IC =150𝜇M). and cell swelling and loss of plasma membrane integrity To determine whether TRPV4 ion channel functionally were observed (Figure 3(b)). Taken together, these results mediates the viability of melanoma A375 cells, the activities indicated that activation of TRPV2 by 2-APB could induce of TRPV4 then have been investigated. Calcium influx via necrosis and apoptosis but does not affect cell cycle for A2058 GSK1016790A application to melanoma A375 cell line was melanoma cells. observed by using calcium imaging approach. Assessment by intracellular calcium signals with addition of 2 nM GSK1016790A clearly showed significant increase of calcium 3.4. Repression of TRPV4 Abolished Agonist Mediated Sig- signal compared with negative control one by DMSO appli- naling Pathway. To further prove that functional TRPV4 cation, and this calcium influx was clearly attenuated when ion channel mediated melanoma A375 cell viability, TRPV4 a TRP channel blocker, ruthenium red was applied (Figures was knockdown by using shRNA to produce RNA interfer- 2(d)(i), 2(d)(ii), and 2(d)(iii), (n = 12, p < 0.01)). These ence in A375 cells (Figure 4(a)). With TRPV4 knockdown, data demonstrated that functional TRPV4 expression could no significant change was observed in cell viability aer ft Journal of Oncology 5 TRPV1 TRPV2 94KD IB: TRPV1 95KD IB: TRPV2 IB: -actin IB: -actin 42KD 42KD (i) (ii) TRPV3 TRPV4 90KD IB: TRPV3 100KD IB: TRPV4 IB: -actin IB: -actin 42KD 42KD (iii) (iv) TRPA1 TRPM8 120KD IB: TRPA1 IB: TRPM8 130KD 42KD 42KD IB: -actin IB: -actin (v) (vi) (a) TRPV1 TRPV2 0 0 (i) (ii) TRPV3 TRPV4 (iii) (iv) TRPA1 TRPM8 12 120 6 60 (v) (vi) (b) Figure 1: The distribution profiles of six thermo-TRPs in human melanoma cells and melanocytes. (a) Western blot analysis of TRPV1 (i), TRPV2 (ii), TRPV3 (iii), TRPV4 (iv), TRPA1 (v), and TRPM8 (vi) ion channels expression level in protein samples collected from primary epidermal melanocytes, and melanoma cells of A375, G361, A2058, and SK-MEL-3. (b) Droplet digital PCR detection of six thermo-TRPs for TRPV1 (i), TRPV2 (ii), TRPV3 (iii), TRPV4 (iv), TRPA1 (v), and TRPM8 (vi) in primary epidermal melanocytes, and melanoma cells of A375, G361, A2058, and SK-MEL-3. Total mRNA from human primary epidermal melanocytes and melanoma cells of A375, G361, A2058, and SK-MEL-3 were isolated, and digital PCR screening analysis for the indicated genes was performed. Determination of copy numbers per genome of six samples. Concentration values for indicated genes (◻). Error bars represented 95% confidence intervals, NTC represented nontemplate control.𝛽-actin was used as a positive control, and all tests were performed in at least three independent experiments. -Melanocyte -A375 -G361 -A2058 -SK-MEL-3 -Melanocyte -A375 -G361 -A2058 -SK-MEL-3 -Melanocyte -Melanocyte -A375 -A375 -G361 -G361 -A2058 -A2058 -SK-MEL-3 -SK-MEL-3 -Melanocyte -A375 -G361 -A2058 -SK-MEL-3 -Melanocyte Melanocyte -A375 A375 -G361 G361 -A2058 A2058 -SK-MEL-3 SK-MEL-3 NTC Melanocyte A375 Melanocyte A375 G361 A2058 G361 SK-MEL-3 A2058 NTC SK-MEL-3 NTC Melanocyte Melanocyte A375 A375 G361 G361 A2058 A2058 SK-MEL-3 NTC SK-MEL-3 NTC Melanocyte A375 G361 A2058 SK-MEL-3 NTC Concentration (copies/ul) Concentration (copies/ul) Concentration (copies/ul) Concentration (copies/ul) Concentration (copies/ul) Concentration (copies/ul) 6 Journal of Oncology A375 Control 20nM 50nM Melanocyte Control 20nM 50nM 24h 24h (i) (ii) (a) Melanocyte A375 1.5 1.5 (n=6) (n=6) (n=6) (n=6) (n=6) (n=6) 1.0 1.0 (n=6) 0.5 0.5 (n=6) (n=6) (n=6) 0.0 0.0 DMSO 1nM 10nM 20nM 50nM DMSO 1nM 10nM 20nM 50nM GSK1016790A GSK1016790A (i) (ii) (b) Melanocyte A2058 1.5 1.5 (n=6) (n=6) (n=6) (n=6) (n=6) 1.0 1.0 (n=6) (n=6) (n=6) (n=6) (n=6) 0.5 0.5 (n=6) (n=6) 0.0 0.0 D MSO 50uM 100 uM 150uM 200uM 400uM DMSO 50uM 100uM 150uM 200uM 400uM 2-APB 2-APB (i) (ii) (c) 2+ C； base line 100 M 2-APB 5M RR A2058 025 50 75 100 125 150 Time (sec) (i) (i) 100 100 2+ 2+ C； base line 2 nM GSK 5M RR C； base line 10 M capsaicin A375 A2058 0 25 50 75 100 125 150 025 50 75 100 Time (sec) Time (sec) (ii) (iii) (ii) (d) (e) Figure 2: Functional TRPVs mediated proliferation of melanoma cells. (a) Cells morphologically changed after GSK1016790A (20 nM and 50 nM) application to A375 melanoma cells and melanocytes via microscopy imaging (i) & (ii). (b) Cell viability test by MTT experiment exhibited inhibition of cell proliferation for melanoma A375 cells but not for primary epidermal melanocytes by treatment of either DMSO (control) or TRPV4 specific activator of GSK1016790A (1 nM, 10 nM, 20 nM, 50 nM) (i) & (ii). (c) Cell viability test by MTT experiment exhibited inhibition of cell proliferation for melanoma A2058 cells but not for primary epidermal melanocytes by treatment of either DMSO (control) or 2-APB (50𝜇M, 100 𝜇M, 150 𝜇M, 200 𝜇M, 400 𝜇M) (i) & (ii). (d) Measurement of calcium imaging in GSK1016790A application with 2 nM concentration in A375 melanoma cells was carried out, and intracellular calcium that dramatically enhanced was observed and calcium signal receded aer ft a blocker of ruthenium red was applied (i). A representative single cell (ii) recording by time course showed calcium influx uc fl tuation before and aer ft GSK1016790A application and channel blocker was added (iii), (n = 12, p < 0.01). (e) Measurement of calcium imaging showed 2-APB could induce calcium influx which could be blocked by TRP channel blocker of ruthenium red in A2058 cells(i),(n=12,p< 0.01). When TRPV1 agonist of capsaicin was applied, there was no apparent calcium signal observed in A2058 melanoma cells (ii), (n = 19). Cell Viability Cell Viability GSK1016790A ΔF (Average Intensity) GSK1016790A Cell Viability Cell Viability ΔF (Average Intensity) ΔF (Average Intensity) Journal of Oncology 7 2-APB (100M - 400 M) A2058-Control A2058-2-APB (100uM) A2058-2-APB (200uM) A2058-2-APB (400uM) 5 5 5 10 10 10 4 4 10 10 10 3 3 3 10 10 10 2 2 2 10 10 2 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 FITC-A FITC-A FITC-A FITC-A Annexin V A2058-Control A2058-2-APB (100uM) A2058-2-APB (200uM) A2058-2-APB (400uM) 200 150 32.6% 11% 13.3% 100 50 0 0 0 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5 00 10 10 10 10 10 10 10 00 10 10 10 10 10 10 10 10 −311 −166 −131 −121 PE-A PE-A PE-A PE-A PI (i) A2058 A2058 ∗∗∗ 60 ∗ (n=3) ∗∗∗ (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) 0 0 2-APB 2-APB (ii) (a) A2058 Control 1M 10M 100M 200M 400M 0h 24h 48h 2-APB (b) Figure 3: TRPV2 activation dominated A2058 melanoma cells undergoi ng necrosis. (a) Flow cytometry analysis via FITC-Annexin V and PI staining showed A2058 melanoma cells with 2-APB (100𝜇M, 200 𝜇M, and 400 𝜇M) treatment undergoing necrosis and enhanced apoptosis (i) & (ii). (b) Morphology measurement by microscopic imaging for A2058 melanoma cells with 2-APB (1𝜇M, 10 𝜇M, 100 𝜇M, 200 𝜇M, and 400𝜇M) treatment exhibited prominent necrotic and apoptotic cells. DMSO 100uM 200uM 400uM DMSO 100uM 200uM 400uM PI Necrosis% PE-A Count Count PE-A PE-A Early Apoptosis% Count PE-A Count 8 Journal of Oncology GSK1016790A or alternative TRPV4 agonist of 4𝛼-PDD for permeability of calcium. Activation of TRPV4 ion channel treatment (Figures 4(b) and 4(c)). These results suggested would trigger calcium influx. As an important intracellu- that deficient of TRPV4 could abolish the inhibition of cell lar second messenger, calcium is involved in a bunch of proliferation induced by GSK1016790A and 4𝛼-PDD. physiological and pathological processes via ion channels Moreover, pretreatment of GSK2193874, a selective [33, 34]. Is calcium involved in the regulation of functional inhibitor of TRPV4, clearly abrogated the inhibition induced TRPV4 in melanoma? Calcium chelator of EGTA (ethylene by GSK1016790A (Figures 4(d) and 4(e)). Meanwhile, ruthe- glycol tetra-acetic acid) and BAPTA-AM were applied, and nium red was also used for pretreatment to suppress TRPV4 the AKT signals were collected from calcium/calcium free function, and similar results were obtained in A375 cells medium incubation cells of GSK1016790A addition. In the treated with 20 nM and 50 nM GSK1016790A for 24 h absenceofextracellularcalciumchelatorofEGTAorintracel- (Figure 4(f)). Together, our data demonstrated that TRPV4 lular calcium chelator of BAPTA-AM, 20 nM GSK1016790A channel was functionally involved in cell viability for A375 addition could enhance the phosphorylation of AKT, while melanoma cells. depletion of extracellular calcium by EGTA, GSK1016790A even potentiated the phosphorylation of AKT signal greater in A375 cells. Meanwhile, in the presence of intracellular 3.5. Pharmacological Activation of TRPV4 Induced Apoptosis calcium chelator of BAPTA-AM, GSK1016790A seemed to of A375 Melanoma Cells. Given that pharmacological acti- have similar effects as EGTA application on the phosphory- vation of TRPV4 could inhibit cell viability, to assess the lation of AKT pathway. Indeed, when there was depletion of lethality of GSK1016790A to melanoma cell lines, A375 cells both extra- and intracellular calcium, AKT phosphorylation were treated with GSK1016790A at various concentrations inducedbyGSK1016790A wasattenuatedinA375cells. for24handthenanalysedbyflow cytometrywithFITC These data indicated that calcium was involved in regulation conjugated Annexin V and PI. As illustrated in Figure 5, of AKT phosphorylation following GSK1016790A treatment 50 nM GSK1016790A prominently increased the number of since EGTA or BAPTA-AM pretreatment clearly enhanced apoptotic cells from 8.9% to 23.3% (Figure 5(a)). This data GSK1016790A induced rise in AKT phosphorylation via implied that pharmacological application of GSK1017690A TRPV4 ion channel (Figure 6(c)). u Th s, AKT functioned could induce apoptosis of A375 cells by activation of TRPV4 as downstream eeff ctors for calcium signaling mediated by channel. Meanwhile, 4𝛼-PDD, an agonist of TRPV4 channel, TRPV4 in human A375 melanoma cells. was also applied (500 nM, 2 𝜇M) and the data exhibited similar apoptosis induction from 7.5% to 20.6% in A375 cells 4. Discussion (Figure 5(b)). We also examined cell apoptosis by using microscopy Thermo-TRPs are not only localized in sensory neurons as imaging with Hochest33342 and PI staining. Treatment with polymodal cellular sensors but also functionally expressed GSK1016790A clearly enhanced the chromatin condenses in in a plethora of nonneuronal cell types involved in reg- A375 cells. Consistently, after application of channel blocker ulating various physiological and pathophysiological func- of ruthenium red, cell viability and chromatin have been tions [35–40]. In TRPM subfamily, TRPM2 and TRPM8 observed protected from GSK1016790A addition (20 nM and were implicated in the regulation of melanocytic behaviors. 50 nM) for 24 h in A375 cells (Figure 5(c)). Together, our TRPM2 was capable of inducing melanoma apoptosis and data indicated that pharmacological activation of TRPV4 ion necrosis. TRPM8 could mediate agonist-induced melanoma channel could induce cell apoptosis of human melanoma. cell death [41]. In the present study, six thermo-TRPs such as TRPV1/2/3/4, TRPA1, and TRPM8 were examined. Our 3.6. Functional TRPV4 Channel Involved in Mediating AKT data showed that there was discordance between protein Signaling Pathway via Enhancing AKT Phosphorylation. How and gene expression, such as TRPV2 in human melanoma TRPV4 mediated apoptosis of A375 cells by its activation cells. Previous studies have revealed that discrepancy between is unclear. Since AKT and MAPK signaling pathways are protein and mRNA expression levels was widely variable. For commonly associated with cell apoptosis, we hypothesized example, mRNA and protein discordance has been reported that TRPV4 may mediate cell apoptosis of melanoma via tovary from 32%[42]to83.5%[43]intheLNCaPprostate AKT or MAPK signaling pathway. Phosphorylation of AKT cancer cell line. er Th e are several factors that could result was significantly greater in GSK1016790A application in A375 in the discordance. According to our results, thermo-TRPs cells compared to control one (Figures 6(a) and 6(b)), while are low abundant membrane proteins, and actual biological ErK/JNK/P38 of MAPK signal pathways were not influenced differences between transcript and protein abundance may in application of GSK1016790A (Figure 6(a)). These data sug- aeff ct the correlation between gene and protein expression gested that the increased phosphorylation and activation of levels just as previous studies indicated [44]. AKT pathway (Figure 6(b)) may be involved in GSK1016790A Recent studies have tried to elucidate the distributions inducing cell apoptosis of melanoma via functional TRPV4 and roles of several thermo-TRPs in cancer. Fusi and col- ion channel. leagues investigated a subset of TRP ion channels including TRPV1/2/3/4 and TRPA1 in human nonmelanoma skin 3.7. Calcium Signaling Mediated by TRPV4 Facilitated cancer.TheyfounddownregulationofTRPV4 couldact Apoptosis via Phosphorylation of AKT in A375 Melanoma as an early biomarker of skin carcinogenesis [12]. Tsavaler Cells. TRPV4 is a nonselective cationic channel with high et al. reported that TRPM8 was upregulated in prostate Journal of Oncology 9 100KD IB: TRPV4 IB: -actin 42KD 1.5 (i) 1.5 ∗∗ 1.0 (n=3) 1.0 0.5 (n=3) 0.5 0.0 0.0 GSK1016790A A375 (n=6) (ii) A375+shTRPV4 (n=6) (a) (b) 1.5 A375 1.5 1.0 1.0 (n=6) 0.5 0.5 0.0 0.0 4-PDD GSK2193874 A375 (n=6) A375+shTRPV4 (n=6) (c) (d) A375 1.5 A375 Control 20nM 50nM 1.0 (n=6) RR- 0.5 0.0 RR+ GSK2193874+GSK1016790A (e) (f) Figure 4: Silencing TRPV4 ion channel suppressed GSK1016790A mediating signals. (a) A representative western blot indicated the successful knockdown of TRPV4 protein by shRNA (i) & (ii). (b) Loss of TRPV4 fully suppressed the inhibition of proliferation for the treatment of GSK1016790A (1 nM, 10 nM, 20 nM, and 50 nM) to A375 melanoma cells. (c) Suppression of TRPV4 attenuated the inhibition of proliferation for the treatment of 4𝛼-PDD (100 nM, 200 nM, 400 nM, and 1 𝜇M) in A375 melanoma cells. (d) Inhibition of TRPV4 by GSK2193874 (10 nM, 50 nM, 100 nM and 200 nM) did not aeff ct melanoma cell proliferation. (e) Treatment with GSK1016790A (1 nM, 10 nM, 20 nM and 50 nM) and GSK2193874 (100 nM) did not aeff ct cell viability of melanoma. (f) Pretreatment of ruthenium red fully suppressed the inhibition of proliferation for the application of GSK1016790A with 20 nM and 50 nM to A375 melanoma cells. All tests were performed in at least three independent experiments. -A375 -A375+ shTRPV4 A375 A375+ shTRPV4 DMSO DMSO 100nM 1nM 200nM 10nM 400nM 20nM 1uM 50nM DMSO DMSO 1nM 10nM 10nM 50nM 20nM 100nM 50nM 200nM Percent% Cell Viability Cell Viability GSK1016790A Cell Viability Cell Viability 10 Journal of Oncology GSK1016790A (20 nM - 50nM) A375-DMSO A375-GSK (20nM) A375-GSK (50nM) A375 ∗∗∗ (n=3) 10 4 ∗∗∗ (n=3) (n=3) 10 3 3 10 2 −69 −78 −55 2 3 4 5 2 3 4 5 2 3 4 5 0 10 10 10 10 0 10 10 10 10 0 10 10 10 10 −65 −111 −74 GSK1016790A Annexin V FITC-A Annexin V FITC-A Annexin-V FITC-A Annexin V (i) (ii) (a) 4-PDD (500 nM - 2 M) A375 A375-DMSO A375-4a-PDD (500nM) A375-4a-PDD (2uM) 5 5 10 ∗ (n=3) (n=3) 4 4 10 10 (n=3) 3 5 3 3 10 10 10 10 2 3 4 5 4-PDD 2 3 4 5 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 FITC-A FITC-A FITC-A Annexin V (i) (ii) (b) GSK1016790A Control 20nM 50nM A375 RR- RR+ (c) Figure 5: GSK1016790A application induced apoptosis of human A375 melanoma cells. (a) Flow cytometry test via FITC-Annexin V and PI staining showed increasing apoptotic signals by treatment with GSK1016790A to A375 melanoma cells (i) & (ii). (b) Flow cytometry analysis via FITC-Annexin V and PI staining for 4𝛼-PDD treatment exhibited enhancing apoptotic cells in melanoma A375 cells (i) & (ii). (c) Pretreatment of ruthenium red prominently attenuated apoptotic cells for the application of GSK1016790A with 20 nM and 50 nM to A375 melanoma cells; cells were stained with Hochest33342 and PI. All tests were performed in at least three independent experiments. DMSO 20nM 50nM DMSO 500nM 2uM PI PI PE-A PIPE-A PE-A PIPE-A PE-A PIPE-A Early Apoptosis% Early Apoptosis% Journal of Oncology 11 GSK1016790A 0nM 20nM 50nM 44KD IB: ErK1/2 42KD 44KD IB: pErK1/2 42KD 54KD IB: JNK 46KD 54KD IB: pJNK 46KD 38KD IB: P38 38KD IB: pP38 60KD IB: AKT 60KD IB: pAKT (a) GSK1016790A 0nM 20nM 50nM A375 ---- ++++ -0.5mM EGTA -- + + - - + + -8M BAPTA-AM -+ +- + - + - -20nM GSK1016790A IB: AKT 60KD 60KD IB: AKT IB: pAKT 60KD 60KD IB: pAKT 42KD IB: -actin (b) (c) Figure 6: TRPV4 functionally mediated melanoma cells apoptosis via AKT pathway and was influenced by calcium. (a) Western blot analysis of MAPK as well as AKT signals was collected for activation of TRPV4 in A375 melanoma cells. Cells were treated by GSK1016790A with 20 nM and 50 nM for 24 h and lysates were then probed with the indicated antibodies,𝛽-actin was used as a loading control, and pAKT was observed upregulated. (b) Assessments of pAKT changes triggered by GSK1016790A with 20 nM and 50 nM within 10 min as well as 24 h in melanoma A375 cells. (c) Influences of calcium ion on GSK1016790 A-induced, TRPV4-mediated signal transduction. A375 cells were untreated or pretreated with EGTA or BAPTA-AM for 1 h before being stimulated with GSK1016790A. All tests were performed in at least three independent experiments. cancer when compared with normal prostate epithelial cells. mediated through EGFR/AKT/ mTOR signaling pathway [46]. Based on our examination, it is not the case for this In addition, TRPM8 also can be detected in tumors of study. Independent study reported that treatment of a TRPV1 breast,colon,lung,andskinbutnotinthe corresponding agonist of capsaicin could efficiently reduce proliferation and normal human tissues [45]. Our present study identified induce obvious apoptosis of renal carcinoma cells through upregulation of TRPV4 and activation of this ion chan- mediating caspases activation via P38 and JNK within MAPK nel could induce apparent intracellular calcium signaling pathway [47]. Other independent study revealed that TRPV6 in regulation of cell viability and apoptosis. Notably, cells might mediate growth factor signaling to induce PI3K-PKD1- underwent early apoptosis aer ft TRPV4 activation by 4 𝛼- AKTcascade viacalciuminhumancolon cancer [48].Inthis PDD (Figure 7(a)) as well as GSK1016790A. Meanwhile, in regard, AKT and MAPK signaling pathways were examined melanoma A2058 cells, pharmacological activation of TRPV2 in the present study. And our data highlighted that AKT with 2-APB could inhibit cell proliferation and promote cell signaling regulated cell fate of A375 melanoma cells during apoptosis as well. Interestingly, 2-APB application dominated TRPV4 activation via enhancing AKT phosphorylation. A2058 cells undergoing necrosis and late apoptosis other than Characteristics of cells including neoplastic human early apoptosis both via FITC-Annexin V/PI staining and 2+ Hochest33342/PI staining (Figure 7(b)), which was clearly melanoma cells are determined by Ca dependent cellular different from the activation of TRPV4 in melanoma A375 process. Intracellular calcium is predominantly regulated cells. Our data further indicated that activation of thermo- by TRPs [33]. us, Th calcium involvement was assessed in TRPV2/4 modulated distinct cellular behaviors in human the present study. Our results demonstrated that calcium melanoma cells. involved in TRPV4 mediation of AKT phosphorylation. Early studies suggested that TRPV1 was involved in Notably, depletion of either extracellular or intracellular cal- skin cancer [13, 46]. Inhibition of TRPV1 by antagonist cium could clearly potentiate AKT phosphorylation induced of AMG9810 could promote mouse skin tumorigenesis by GSK1016790A. These observations indicated that TRPV4 10min 24h 10min 24h 10min 24h 25 12 Journal of Oncology 4-PDD (500 nM - 2 M) A375-Control A375-4a-PDD (500nM) A375-4a-PDD (1uM) A375-4a-PDD (2uM) 5 5 5 5 10 10 10 10 4 4 4 4 10 10 10 10 3 3 10 10 10 10 2 2 10 10 10 10 2 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 FITC-A FITC-A FITC-A FITC-A Annexin V (i) A375 A375 ∗∗∗ ∗∗∗ 20 ∗∗∗ (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) DMSO 500nM 1uM 2uM DMSO 500nM 1uM 2uM 4-PDD 4-PDD (iii) (ii) (a) 2-APB (200 M - 400 M) A2058-DMSO A2058-2-APB (200uM) A2058-2-APB (300uM) A2058-2-APB (400uM) 5 5 5 5 10 10 10 4 4 4 4 10 10 10 3 3 3 3 10 10 10 10 2 2 2 10 10 10 2 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 Pacific Blue-A Pacific Blue-A Pacific Blue-A Pacific Blue-A Hochest33342 (i) A2058 A2058 ∗∗∗ (n=3) ∗∗∗ ∗∗∗ (n=3) ∗∗∗ 20 20 (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) DMSO 200uM 300uM 400uM DMSO 200uM 300uM 400uM 2-APB 2-APB (ii) (iii) (b) Figure 7: Functional TRPVs influenced melanoma cell fate in different profiles. (a) Flow cytometry assessment of 4 𝛼-PDD triggered apoptosis (i) of melanoma A375 cells via staining with FITC - Annexin V and PI. Activation of TRPV4 by 4𝛼-PDD induced human melanoma A375 cells undergoing early apoptosis (ii). A slight degree of necrotic cells was observed as well (iii). (b) Flow cytometry assessment of 2-APB triggered cell death of melanoma A2058 cells via staining with Hochest33342 and PI. Activation of TRPV2 by 2-APB in melanoma A2058 cells underwent late apoptosis as well as necrosis (i). 2-APB application induced a slight degree of early apoptotic cells (ii) and dominated cells undergoing necrosis and late apoptosis (iii). Early Apoptosis% PI PI PE-A Early Apoptosis% PE-A PE-A PE-A PE-A PE-A Necrosis% Necrosis% PE-A PE-A Journal of Oncology 13 served as distinct cellular linker between calcium ions Supplementary Materials and calcium signaling pathway and thus was expected to See Figures S1 and S2 in the Supplementary Materials for dynamically modulate AKT phosphorylation process. Fur- comprehensive image analysis. (Supplementary Materials) ther studies are needed to fully understand the cooperative modulation among calcium changes and related downstream signaling of AKT. References [1] Z.H. Zhou,J.W.Song, W.Liet al., “ea Th cid-sensingion channel, ASIC2, promotes invasion and metastasis of colorectal 5. Conclusions cancer under acidosis by activating the calcineurin/NFAT1 axis,” Journal of Experimental & Clinical Cancer Research,vol. Taken together, here we have demonstrated that TRPV2 and 36,no.130, pp.1–12, 2017. TRPV4 were distributed in human melanoma A2058 and [2] A. A. Peters, S. Y. N. Jamaludin, K. T. D. S. Yapa et al., “Oncosis A375 cells as well as melanocytes. Pharmacological activa- and apoptosis induction by activation of an overexpressed ion tion of TRPV4 could inhibit cell proliferation and induce channel in breast cancer cells,” Oncogene,vol.36, no.46, pp. cell apoptosis of A375 cells. Furthermore, the activation of 6490–6500, 2017. TRPV4-AKT pathway with calcium signaling involvement [3] R.K.Adapala,R.J.Thoppil,K.Ghosh et al.,“Activation drove antitumor effect in A375 cells. Our data suggested that of mechanosensitive ion channel TRPV4 normalizes tumor TRPV4 ion channel therefore may serve as a potential clinical vasculature and improves cancer therapy,” Oncogene,vol.35,no. therapeutic strategy in human melanoma. 3,pp.314–322,2016. [4] J.-H.Ko,E.A.Ko,W. Gu,I.Lim,H. Bang,andT. Zhou, “Expression profiling of ion channel genes predicts clinical Abbreviations outcome in breast cancer,” Molecular Cancer,vol.12,no.1,article 106, 2013. GSK: GSK1016790A [5] S. P. Fraser, J. A. Grimes, M. B. A. Djamgoz et al., “Effects PI: Propidium iodide of voltage-gated ion channel modulators on rat prostatic Pro: Probenecid cancer cell proliferation: Comparison of strongly and weakly TRP: Transient Receptor Potential metastatic cell lines,” The Prostate ,vol.44,no.1,pp.61–76,2000. TRPV: Transient Receptor Potential Vanilloid [6] H. F. Cantiello, A. G. Prat, J. V. Bonventre, C. C. Cunningham, RR: Ruthenium red. J. H. Hartwig, and D. A. Ausiello, “Actin-binding protein contributes to cell volume regulatory ion channel activation in melanoma cells,” eJ Th ournalofBiologicalChemistry ,vol.268, no.7,pp. 4596–4599, 1993. Data Availability [7] D. H. Allen, A. Lepple-Wienhues, M. D. Cahalan et al., “Ion channel phenotype of melanoma cell lines,” Journal of Mem- ed Th ata usedtosupportthefindingsofthisstudy are brane Biology,vol.155,no.1, pp.27–34,1997. available from the corresponding author upon request. [8] B. Nilius, T. Bo¨hm, W. Wohlrabetal.,“Properties of a potassium-selective ion channel in human melanoma cells,” Pfl u¨gers Archiv - European Journal of Physiology,vol.417,no.3, Conflicts of Interest pp. 269–277, 1990. [9] P. Facer, M. A. Casula, G. D. Smith et al., “Differential expression eTh authors declare no conflicts of interest regarding the of the capsaicin receptor TRPV1 and related novel receptors publication of this paper. TRPV3, TRPV4 and TRPM8 in normal human tissues and changes in traumatic and diabetic neuropathy,” BMC Neurology, vol. 7, article 11, pp. 1–12, 2007. Authors’ Contributions [10] A. M. Peier, A. J. Reeve, D. A. Andersson et al., “A heat-sensitive TRP channel expressed in keratinocytes,” Science,vol.296,no. Wei Cheng and Xuejing Tan designed the research; Jiao- 5575, pp. 2046–2049, 2002. jiao Zheng and Fangyuan Liu performed most research [11] B. I. Tot ˜ h, A. Ola´h,A.G.Szol ¨ losi ´ , and T. B´ıro, ˜ “TRP channels experiments; Sha Du, Mei Li, and Tian Wu conducted flow in the skin,” British Journal of Pharmacology,vol.171,no.10,pp. cytometry experiments as well as data analysis; and Wei 2568–2581, 2014. Cheng wrote the manuscript. Jiaojiao Zheng and Fangyuan [12] C. Fusi, S. Materazzi, D. Minocci et al., “Transient recep- Liu contributed equally to this work. tor potential vanilloid 4 (TRPV4) is downregulated in ker- atinocytes in human non-melanoma skin cancer,” Journal of Investigative Dermatology,vol.134,no.9, pp.2408–2417,2014. Acknowledgments [13] A. M. Bode, Y.-Y. Cho, D. Zheng et al., “Transient receptor potential type vanilloid 1 suppresses skin carcinogenesis,” Can- We thank Dr. Jie Zheng for his generous gisft of various cer Research,vol.69,no.3,pp. 905–913, 2009. constructs of thermo-TRPs and current laboratory members [14] M. S.McNeill,J.Paulsen,G.Bonde,E.Burnight,M.-Y. Hsu,and for assistance and discussions. This work was supported R. A. Cornell, “Cell death of melanophores in zebrash fi TRPM7 by part of the grant from the National Natural Science of mutant embryos depends on melanin synthesis,” Journal of Foundation in China (81301720 to Wei Cheng). Investigative Dermatology,vol.127,no. 8,pp.2020–2030,2007. 14 Journal of Oncology [15] H. Yamamura, S. Ugawa, T. Ueda, A. Morita, and S. Shimada, cinnamaldehyde,” Naunyn-Schmiedeberg’s Archives of Pharma- “TRPM8 activation suppresses cellular viability in human cology,vol.385,no. 6, pp.555–563,2012. melanoma,” American Journal of Physiology-Cell Physiology,vol. [33] D. E. Clapham, “Calcium Signaling,” Cell,vol.131,no.6,pp. 295, no. 2, pp. C296–C301, 2008. 1047–1058, 2007. [16] M. J. Caterina, M. A. Schumacher, M. Tominaga, T. A. Rosen, [34] C. Montell, “eTh latest waves in calcium signaling,” Cell,vol.122, J. D. Levine, and D. Julius, “The capsaicin receptor: a heat- no. 2, pp. 157–163, 2005. activated ion channel in the pain pathway,” Nature,vol.389,no. [35] X. Cheng, J. Jin, L. Hu et al., “TRP channel regulates EGFR 6653, pp. 816–824, 1997. signaling in hair morphogenesis and skin barrier formation,” [17] A. M. Peier, A. Moqrich, A. C. Hergarden et al., “A TRP channel Cell,vol.141,no. 2,pp.331–343,2010. that senses cold stimuli and menthol,” Cell,vol.108,no. 5,pp. [36] Y.Miao,G.Li,X. Zhang, H. Xu,andS.N.Abraham, “A TRP 705–715, 2002. channel senses lysosome neutralization by pathogens to trigger [18] D. E. Clapham, “TRP channels as cellular sensors,” Nature,vol. their expulsion,” Cell,vol.161,no.6, pp.1306–1319,2015. 426, no. 6966, pp. 517–524, 2003. [37] B.Nilius,T.Voets,J.Petersetal.,“TRP channels in disease,” [19] Y. Zhang, M. A. Hoon, J. Chandrashekar et al., “Coding of sweet, Science’s STKE,” Signal Transduction Knowledge Environment, bitter, and umami tastes: different receptor cells sharing similar vol. 2005, no. 295, 2005. signaling pathways,” Cell,vol.112,no. 3,pp.293–301,2003. [38] A. G. Szol ¨ losi ˝ , N. Vasas, A. Angyal et al., “Activation of [20] K. Talavera, K. Yasumatsu, T. Voets et al., “Heat activation of TRPV3 Regulates Inflammatory Actions of Human Epidermal TRPM5 underlies thermal sensitivity of sweet taste,” Nature,vol. Keratinocytes,” Journal of Investigative Dermatology,vol.138, 438, no. 7070, pp. 1022–1025, 2005. no. 2, pp. 365–374, 2018. [21] C. J. Bohlen,A.Priel,S.Zhou,D.King,J.Siemens,and D.Julius, [39] W. D. Tracey Jr., R. I. Wilson, G. Laurent, and S. Benzer, “A bivalent tarantula toxin activates the capsaicin receptor, “painless, a Drosophila gene essential for nociception,” Cell,vol. TRPV1, by targeting the outer pore domain,” Cell,vol.141,no.5, 113, no. 2, pp. 261–273, 2003. pp.834–845,2010. [40] R.Xiao,B.Zhang,Y.Dongetal.,“Agenetic programpromotes [22] Y. R. Park, J. N. Chun, I. So et al., “Data-driven analysis of C. elegans longevity at cold temperatures via a thermosensitive TRP channels in cancer: linking variation in gene expression TRP channel,” Cell,vol.152,no. 4, pp.806–817,2013. to clinical significance,” Cancer Genomics & Proteomics,vol.13, [41] H. Guo, J. A. Carlson, A. Slominski et al., “Role of TRPM in no. 1, pp. 83–90, 2016. melanocytes and melanoma,” Experimental Dermatology,vol. [23] M. A. Schumacher, “Transient receptor potential channels 21, no. 9, pp. 650–654, 2012. in pain and inflammation: therapeutic opportunities,” Pain [42] A. Waghray, F. Feroze, M. S. Schober et al., “Identification of Practice,vol.10,no.3,pp.185–200, 2010. androgen-regulated genes in the prostate cancer cell line LNCaP [24] N. Prevarskaya, L. Zhang, and G. Barritt, “TRP channels in by serial analysis of gene expression and proteomic analysis,” cancer,” Biochimica et Biophysica Acta (BBA) - Molecular Basis Proteomics,vol.1,no.10,pp. 1327–1338, 2001. of Disease,vol.1772,no.8,pp. 937–946, 2007. [43] B. Lin, J. T. White, W. Lu et al., “Evidence for the presence of [25] D. Gkika and N. Prevarskaya, “Molecular mechanisms of TRP disease-perturbed networks in prostate cancer cells by genomic regulation in tumor growth and metastasis,” Biochimica et and proteomic analyses: A systems approach to disease,” Cancer Biophysica Acta (BBA) - Molecular Cell Research,vol.1793,no. Research,vol.65, no.8,pp. 3081–3091, 2005. 6, pp. 953–958, 2009. [44] L. E. Pascal, L. D. True, D. S. Campbell et al., “Correlation of [26] M. Gautier, I. Dhennin-Duthille, A. S. Ay, P. Rybarczyk, I. mRNA and protein levels: Cell type-specific gene expression of Korichneva, and H. Ouadid-Ahidouch, “New insights into cluster designation antigens in the prostate,” BMC Genomics, pharmacological tools to TR(i)P cancer up,” British Journal of vol. 9, article no. 246, 2008. Pharmacology,vol.171,no.10,pp.2582–2592, 2014. [45] L.Tsavaler,M.H.Shapero,S.Morkowski,andR.Laus,“Trp- [27] M. Boddin ¨ g, “TRP proteins and cancer,” Cellular Signalling,vol. p8, a novel prostate-specific gene, is up-regulated in prostate 19, no. 3, pp. 617–624, 2007. cancer and other malignancies and shares high homology with [28] V. Lehen’Kyi and N. Prevarskaya, “Oncogenic TRP channels,” transient receptor potential calcium channel proteins,” Cancer Advances in Experimental Medicine and Biology,vol.704,pp. Research,vol.61,no.9,pp. 3760–3769, 2001. 929–945, 2011. [46] S. Liy, A. M. Bodey, F. Zhuy et al., “TRPV1-antagonist AMG9810 [29] V. U. Bai, S. Murthy, K. Chinnakannu et al., “Androgen regulated promotes mouse skin tumorigenesis through EGFR/Akt signal- TRPM8 expression: A potential mRNA marker for metastatic ing,” Carcinogenesis,vol.32, no.5,pp. 779–785, 2011. prostate cancer detection in body uids, fl ” International Journal [47] T. Liu, G. Wang, H. Tao et al., “Capsaicin mediates caspases of Oncology,vol.36,no.2,pp. 443–450, 2010. activation andinduces apoptosis throughP38 andJNK MAPK [30] S. Mergler, R. Derckx, P. S. Reinach et al., “Calcium regulation pathways in human renal carcinoma,” BMC Cancer,vol.16,no. by temperature-sensitive transient receptor potential channels 1, article no. 790, 2016. in human uveal melanoma cells,” Cellular Signalling,vol.26, no. [48] W. Dai, Y. Bai, L. Hebda et al., “Calcium deficiency-induced and 1, pp.56–69,2014. TRP channel-regulated IGF1R-PI3K-Akt signaling regulates [31] U. Orfanelli, A.-K. Wenke, C. Doglioni, V. Russo, A. K. abnormal epithelial cell proliferation,” Cell Death & Dier ff entia- Bosserhoff, and G. Lavorgna, “Identification of novel sense and tion,vol.21, no.4,pp. 568–581, 2014. antisense transcription at the TRPM2 locus in cancer,” Cell Research, vol. 18, no. 11, pp. 1128–1140, 2008. [32] B. Oehler, A. Scholze, M. Schaefer, and K. Hill, “TRPA1 is functionally expressed in melanoma cells but is not critical for impaired proliferation caused by allyl isothiocyanate or MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Oncology Hindawi Publishing Corporation

Mechanism for Regulation of Melanoma Cell Death via Activation of Thermo-TRPV4 and TRPV2

Download PDF
15 pages

Loading next page...
 
/lp/hindawi-publishing-corporation/mechanism-for-regulation-of-melanoma-cell-death-via-activation-of-m6bqpxoogo

References (54)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2019 Jiaojiao Zheng et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8450
eISSN
1687-8469
DOI
10.1155/2019/7362875
Publisher site
See Article on Publisher Site

Abstract

Hindawi Journal of Oncology Volume 2019, Article ID 7362875, 14 pages https://doi.org/10.1155/2019/7362875 Research Article Mechanism for Regulation of Melanoma Cell Death via Activation of Thermo-TRPV4 and TRPV2 1 1,2 1 1 1 Jiaojiao Zheng, Fangyuan Liu, Sha Du, Mei Li, Tian Wu, 2 1 Xuejing Tan , and Wei Cheng Institute of Cancer Stem Cell, Dalian Medical University, No. 9 West Section Lvshun South Road, Dalian 116044, China eTh First Affiliated Hospital, Dalian Medical University, No. 222 Zhongshan Road, Dalian 116011, China Correspondence should be addressed to Xuejing Tan; xjtan72@hotmail.com and Wei Cheng; wcheng@dmu.edu.cn Received 15 May 2018; Revised 30 September 2018; Accepted 27 December 2018; Published 7 February 2019 Academic Editor: Ozkan Kanat Copyright © 2019 Jiaojiao Zheng et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. er Th mo-TRPs (temperature-sensitive transient receptor potential channels) belong to the TRP (transient receptor potential) channel superfamily. Emerging evidence implied that thermo-TRPs have been involved in regulation of cell fate in certain tumors. However, their distribution profiles and roles in melanoma remain incompletely understood. Methods.Westernblot and digital PCR approaches were performed to identify the distribution profiles of six thermo-TRPs. MTT assessment was employed to detect cell viability. Flow cytometry was applied to test cell cycle and apoptosis. Calcium imaging was used to determine the function of channels. Five cell lines, including one normal human primary epidermal melanocytes and two human malignant melanoma (A375, G361) and two human metastatic melanoma (A2058, SK-MEL-3) cell lines, were chosen for this research. Results.Inthe present study, six thermo-TRPs including TRPV1/2/3/4, TRPA1, and TRPM8 were examined in human primary melanocytes and melanoma cells. We found that TRPV2/4, TRPA1, and TRPM8 exhibited ectopic distribution both in melanocytes and melanoma cells.Moreover,activationofTRPV2 andTRPV4couldleadtothe declineofcellviabilityformelanomaA2058andA375cells. Subsequently, activation of TRPV2 by 2-APB (IC =150𝜇M) induced cell necrosis in A2058 cells, while activation of TRPV4 by GSK1016790A (IC = 10 nM) enhanced apoptosis of A375 cells. Furthermore, TRPV4 mediated cell apoptosis of melanoma via phosphorylation of AKT and was involved in calcium regulation. Conclusion. Overall, our studies revealed that TRPV4 and TRPV2 mediated melanoma cell death via channel activation and characterized the mechanism of functional TRPV4 ion channel in regulating AKT pathway driven antitumor process. u Th s, they may serve as potential biomarkers for the prognosis and are targeted for the therapeutic use in human melanoma. 1. Introduction [9–11]. Fusi et al. reported that TRPV4 was detected in healthy or inflamed skin and lost both in premalignant lesions and Malignant melanoma is a very aggressive and lethal form nonmelanoma skin cancer. Selectively reduction of TRPV4 of cutaneous cancer. It usually derives from the transforma- distribution may represent a diagnostic biomarker of skin tion of melanocytes causing dysfunction to normal cellular carcinogenesis [12]. Meanwhile, study suggested that skin cancer may be closely related to TRPV1 and TRPV1 knockout growth. Increasing studies demonstrated that ion channels play important roles in regulating cellular physiology and mice were facile to induce skin carcinogenesis [13]. u Th s, pathology in cancers [1–5]. Melanoma cells harboring a diver- examination of the distribution pattern and function of TRP sity of ion channel types have been detected and described ion channels in human melanoma cells is necessary and [6–8]. useful for clinical practice. Human melanocytes are usually located in the skin and Recent studies have found that several TRPs presented in eyes. Several transient receptor potential channels (TRPs) melanoma cells. These TRPs were also involved in regulating such as TRPA1, TRPV3, TRPV4, TRPM4, and TRPM8 are cellular functions of human melanoma. In this regard, study expressed in the epithelial cells and keratinocytes of the skin identified that TRPM7 could be a protector and detoxifier in 2 Journal of Oncology both melanocytes and melanoma cells [14]. Further, TRPM8 melanocyte growth kit (ATCC, PCS-200-042) components. hasbeenreportedtoparticipate inmediatingagonist- Allcells were growninahumidiefi dincubator at37 C, 5% induced melanoma cell death [15]. CO atmosphere. Aer ft 1-2 days, cells were chosen to perform Temperature-sensitive transient receptor potential chan- calcium imaging or other functional experiments. nels (thermo-TRPs) belong to TRP channel superfamily. These channels act as multimode cellular sensors for detect- 6 7 2.3. Western Blot. Cells at density of 1∗10 -10 cells/well were ing a variety of environmental stimuli to confer crucial rinsed twice with phosphate-buffered saline (PBS) and then physiological functions, such as thermosensation, chemes- lysed on ice with 200𝜇lcoldcelllysisbueff rfor Westernand thesis, pain and inflammation, and sensation of taste, even IP containing 20 mM Tris-HCl (pH = 7.5), 150 mM NaCl, 1% a biomarker for certain metastatic cancers [16–23]. Several TritonX-100, 2.5 mM sodium pyrophosphate, 1% Na VO ,1 3 4 thermo-TRPs also have been identified to involve in cer- mM EDTA, 0.5𝜇g/ml leupeptin, and 1 mM phenylmethylsul- tain types of carcinoma malignancy [24–29]. Mergler et fonyl uo fl ride (PMSF) (Beyotime Biotechnology). The lysates al. reported that functional TRPV1, TRPM8, and TRPA1 were then centrifuged at 14000 g at 4 Cfor5minand were expressed in malignant human uveal melanoma tissues, thesupernatantswerestoredat-80 C as whole cell protein and some of these channels were also detected in human extracts. Protein concentrations were determined by BCA uveal melanoma cell lines [30]. Another study revealed that Protein Assay Kit. Proteins were separated by 8-12% SDS- overexpression of TRPM2 increased melanoma susceptibility PAGE gel and then transferred to NC membrane. The NC to apoptosis and necrosis [31]. Yamamura et al. found that membrane was blocked with 5% nonfat milk in TBS (10 functional TRPM8 expressed in human melanoma cell line mM Tris-HCl, pH = 8.0, 150 mM NaCl) for 1 h at room andactivationofTRPM8 couldinhibit cell viabilityofhuman temperature. The NC membrane was then incubated with melanoma G361 cells [15]. TRPM8 and TRPA1 channel primary antibody (1:500 dilution) in TBS at 4 Covernight. proteins have been identified to exhibit abnormal expression After incubation with IRDye 800CW Goat Anti-Rabbit IgG in melanoma cell lines. Certain compounds such as TRPA1 (H+L) (1:10000 dilution) in 5% nonfat milk in TBS for 40 activators like cinnamaldehyde and allyl isothiocyanate could min in the dark at room temperature, blots were detected reduce the proliferation of melanoma cells [32]. Although the using Odyssey imaging system (Odyssey CLx, LI-COR). All existing studies referred to that several thermo-TRPs were western blots were repeated at least three times for each distributedinmelanoma, therelevantroleshave remained experiment to confirm the reproducibility of the results. essentially unexplored. In thepresentstudy, sixthermo-TRPsincludingfourheat sensors of TRPV1/2/3/4 and two cold sensors of TRPA1 and 2.4. Validation of Gene Expression by Digital PCR. Total RNA TRPM8 have been investigated among human melanocytes was extracted from cultures of melanocytes and melanoma and melanoma cells. Based on current research, our study cell lines using RNAiso plus Kit (TaKaRa). Then, the reverse is to explore the mechanism of ectopic expression of several transcription was performed with PrimeScript RT reagent Kit thermo-TRPs involved in the regulation of cell fate of human with gDNA Eraser (TaKaRa). Primer and probe sequences melanoma. were designed using Primer-Blast of NCBI. To determine the expression profiles of thermo-TRPs in melanoma and melanocytes, digital PCR approach was applied using Eva- 2. Materials and Methods Green Kit (Bio-Rad). Primer sequences were given in Table 1. 2.1. Antibodies and Regents. All antibodies to six thermo- The intact cDNA samples were added to the Bio-Rad 2X TRPs were purchased from Pierce Biotechnology (anti- ddPCR EvaGreen Supermix at concentration of 50 ng DNA TRPV1, anti-TRPV2, anti-TRPV3, anti-TRPV4, anti-TRPA1, per 20𝜇l ddPCR reaction. Reaction mixes were thoroughly and anti-TRPM8); other antibodies were obtained from mixed by brief vortex as avoiding the formation of bubbles, Cell Signaling Technology (CST, anti-AKT, anti-pAKT, anti- centrifuged for 20 sec and allowed reaction mixes to equili- P38, anti-pP38, anti-JNK, anti-pJNK, anti-ErK1/2, and anti- brate at room temperature for about 3 min, then loaded 20𝜇l pErK1/2). All chemical agents were obtained from Sigma of each reaction mix into a sample well of a DG8 Cartridge (Merck). for QX200 droplet generator (Bio-Rad) followed by 70 𝜇l of QX200 droplet generation oil for EvaGreen into the oil 2.2. Cell Culture. Human melanoma cell line A375 wells, according to the QX200 droplet generator instruction (malignant, CRL-1619), G361 (malignant, CRL-1424), A2058 manual. Aer ft droplet generation, droplets were transferred (metastatic, CRL-11147), SK-MEL-3 (metastatic, HTB-69), into a clean 96-well plate (twin. tec real-time PCR plates, normal human primary epidermal melanocytes (PCS- Eppendorf) and sealed with the PX1PCR plate sealer (Bio- 200-013) were all purchased from American Type Culture Rad). en Th the sealed plate was proceeded to a thermal cycler Collection (ATCC). A375, A2058 cell lines were cultured in (T100, Bio-Rad) following standard cycling conditions: 95 C ∘ ∘ DMEM (ATCC) supplemented with 10% fetal bovine serum for 5 min, then 40 cycles of 95 Cfor 30sec; 60 Cfor 60 sec, ∘ ∘ ∘ (FBS, Gibco). G361, SK-MEL-3 cell lines were cultured in 4 Cfor 5min,then90 Cfor 5min,and4 C infinitely; aeft r McCoy’s 5A (ATCC) supplemented with 10% and 15% fetal thermal cycling, 96-well sealed plate was placed in the QX200 bovine serum (FBS, Gibco), respectively. Normal human droplet reader (Bio-Rad), which automatically acquired data primary epidermal melanocytes were grown in dermal cell of the droplets from each well of the plate. Data analysis basal media (ATCC, PCS-200-030) supplemented with adult was performed using QuantaSoft software (Bio-Rad). Using Journal of Oncology 3 Poisson statistics, the concentration of DNA sample was suspended in fresh stain-detergent solution for flow cytome- determined. try (LSRFortessa, Becton Dickinson) analysis with an argon- in laser tuned to 488 nm and measured red uo fl rescence. 2.5. Intracellular Calcium Measurement. Calcium imaging was performed to determine intracellular calcium using 2.9. Posttranscriptional Gene Silencing. Gene silencing was Fluo-4 Direct Calcium Assay Kit (Invitrogen) according to used to knockdown targeted proteins of interest. The Dhar- manufacturer’s protocol. Cells at confluence of 40-50% in macon GIPZ lentiviral shRNA were purchased from GE 35mm culture plate or 6-well plate with 2∗10 cells were which have been bioinformatically verified to match NCBI incubated with Fluo-4 AM (1.25𝜇M)for60mininthedark sequence data. Plasmid was purified using Midi Kit (QIA- 2+ GEN). eTh following sequences as sense strand for TRPV2 at room temperature. Intracellular Ca signals were acquired and TRPV4 were shown as 5 -GCTGAACCTGCTTTACTA- by either ImageXpress Micro XL system (Molecular Devices) 耠 耠 耠 T-3 and 5 -ACCAAGTTTGTTACCAAGA-3 ,respectively. or living cell imaging system (Leica DMI6000B). eTh Fluo- Transfections of shRNA were performed using Lipofectamine 4 uo fl rescence was measured at an excitation wavelength of 3000 (Invitrogen) following manufacturer’s instruction. eTh 488 nm and emission wavelength of 516 nm from the bottom silencing efficiency was detected by western blot analysis. of the plate. Loading and imaging were carried out in Fluo-4 Direct calcium assay bueff r at 37 C. Data were then analysed with MetaMorph software (Molecular Devices). 2.10. Statistical Analysis. The results were expressed as means ± standard error of the mean (SEM). Statistical signicfi ance was evaluated by two-tailed student's t-test. All statistical 2.6. Cell Proliferation Assay (MTT Test). Cells were cultured tests were performed via GraphPad Prism 5 as well as Adobe in 96-well plate containing a final volume of 200 𝜇l/well Illustrator CS6. Significance was set at ∗ P< 0.05,∗∗ P< 0.01, at density of 5∗10 cells, and then applied compounds or∗∗∗ P< 0.001. to cells and incubated at 37 Cfor24 h. eTh cellswere prepared by adding 10 𝜇l 3-(4,5-dimethylthiazol-2-y1)-2,5- diphenyltetrazolium bromide (MTT) solution per well to 3. Results achieve a n fi al concentration of 0.45 mg/ml with incubation 2-4 h at 37 C, following 100𝜇l application of solubilization 3.1. er Th mo-TRPs Exhibited Ectopic Expression Pattern in Human Melanoma Cells and Melanocytes. To investigate six solution to each well to dissolve formazan crystals, mixed to ensure complete solubilization. eTh quantity of formazan thermo-TRPs expression patterns in human melanoma, four was measured by recording changes in absorbance at 570 melanoma cell lines and primary epidermal melanocytes nm using a plate reader (EnSpire 2300, PerkinElmer). A were chosen for western blot analysis. eTh assessments clearly reference wavelength of 630 nm was used. The experiments showed differential expression profiles of thermo-TRPs, in were repeated at least three times. which TRPV1 was hardly detected in human melanocytes, and very weak expression was found in human melanoma 2.7. Apoptosis Detection with Flow Cytometer. Asinglecell cells (Figure 1(a)(i)). TRPV2 was decreased in G361 and suspension at 1∗10 cells/ml washed in phosphate-bueff red SK-MEL-3 melanoma cells compared to primary epidermal saline (PBS) was prepared, then centrifuged and resuspended melanocytes (Figure 1(a)(ii)). Neither in melanocytes nor in in 10 mM Hepes/NaOH buer ff (pH = 7.4). The cells were melanoma cells TRPV3 protein was found (Figure 1(a)(iii)). added FITC-Annexin V to a final concentration of 1 𝜇g/ml, However, TRPV4 protein was significantly increased in A375 incubated 10 min in the dark at room temperature. en Th and A2058 cells (Figure 1(a)(iv)). Moreover, previous study PI was added to a final concentration of 2 𝜇g/ml, incubated has reported that TRPA1 and TRPM8 were expressed in for a further 5 min. Apoptosis was determined by recording human melanoma [15, 32]; our data showed that TRPA1 right angle and forward light scatter, log green (520 nm) protein increased in all four melanoma cells (Figure 1(a)(v)), andlogredfluorescence( > 650 nm) with flow cytometer and TRPM8 protein level was increased in A375 and A2058 (LSRFortessa, Becton Dickinson). Green uo fl rescence was cells compared to melanocytes (Figure 1(a)(vi)). using the u fl orescein filter and a deep red filter was used for To further confirm the expression profiles of these six red. Care must be taken not to exclude any apoptotic cells. thermo-TRPs in melanoma, digital PCR assessment was then The percentage of apoptotic cells was determined in three conducted and the results showed differential expression pat- independent experiments. tern of thermo-TRPs in human melanocytes and melanoma cells. Specifically, TRPV1 and TRPV3 transcripts showed 2.8. Cell Cycle Analysis by Flow Cytometry. Cells were seeded very weak expression both in human melanocytes and at density of 1∗10 cells/ml and incubated overnight. Then a melanoma cells (Figures 1(b)(i) & 1(b)(iii)) which exhibited stain-detergent solution was made up containing 50𝜇g/ml good concordance with protein distribution, while TRPV2 isotonic propidium iodide (PI) in 0.1% trisodium citrate was markedly decreased in all four melanoma cell lines dihydride with 0.3𝜇l/ml of Nonidet P-40. Culture medium compared to melanocytes (Figure 1(b)(ii)), which was discor- was removed and cells were rinsed with PBS once, then stain- dant with our protein expression results. TRPV4 mRNA was detergent solution was added and cells were scraped by a increased significantly in A375 cells compared to melanocytes rubber policeman, shook vigorously, and dislodged by a ne fi (Figure 1(b)(iv)). Moreover, TRPA1 showed apparent increase tipped pipette. Harvested cells were then centrifuged and in G361 cells other than melanocytes and other melanoma 4 Journal of Oncology Table 1: Primer sequences and reference number of human TRP-specific primers used in digital PCRs. Channel Forward primer Reverse primer NM-number TRPV1 ATCGCCCGTCCTGGTATCA CCTCCTCCGAGTCACCCTT NM 080705.3 TRPV2 TCTTCCTTTTCGGCTTCGC CCCTCGTCCTCCTGTCCCT NM 016113.4 TRPV3 GCTGCGTGGAGGAGTTGG CAGGTCTTCCCCGTGTCG NM 001258205.1 TRPV4 TGGAGTCACATAAGCCAACGC GGCAAATCCCAGACACTACAGA NM 021625.4 TRPA1 GTTTGGCAGTTGGCGACA GGATACACGATGGTGGATTTCT NM 007332.2 TRPM8 GCAATGCCATCTCCTACGC TGAAGGTCAGCAGACTCCCA NM 024080.4 𝛽-actin TGGCATCCACGAAACTACCTT TCGTCATACTCCTGCTTGCTG NM 001101.3 cells (Figure 1(b)(v)). TRPM8 was found increased in A375 suppress proliferation of human melanoma A375 cells but not and A2058 cells which was identical with protein expression for primary epidermal melanocytes. pattern (Figure 1(b)(vi)). Calcium imaging assay also identified that TRPV2 has Because the prior results suggested a discrepancy between functional activation by 2-APB and channel could be blocked protein and mRNA distributions in melanoma, we then by ruthenium red (Figure 2(e)(i), (n = 12, p < 0.01)). By comparing functional TRPV2 and TRPV1 in A2058 cells examined calcium influx during channel activation and aeff cted by its different expression, TRPV1 agonist (capsaicin, blockade. Calcium imaging indicated that TRPV4 ion chan- 10 𝜇M) was applied, but no apparent calcium signal was nel was functionally expressed in A375 cells, while in A2058 detected by calcium imaging approach (Figure 2(e)(ii), (n = and G361 cells, channel functions were observed inconspic- 19)). This may be due to very much low expression of TRPV1 uously (see Figure S1a (i) & (ii)). For TRPV2, both channel ion channel in A2058 cells which could not dominate calcium common activator of 2-APB (2-aminoethoxydiphenyl borate) inu fl x aeft r channel activation. and specific agonist of probenecid were inducing similar To further prove that TRPV2 ion channel was modulated calcium influx in A2058 cells (Figure S1b (i)), while 2-APB by 2-APB in melanoma cells, TRPV2 was knockdown by elicited very small calcium influx in G361 cells (Figure S1b using shRNA to produce RNA interference in A2058 cells (ii)). Our data indicated that both TRPV4 in A375 cells and (Figure S2a). As shown in Figure S2, apparent change was TRPV2 in A2058 cells might dominate calcium influx during hardly observed by treatment of 2-APB in cell viability (Fig- channel activation. But how these two channels function in ure S2b). These data suggested that 2-APB targeted TRPV2 melanoma remains to be elucidated. ion channel in melanoma A2058 cells and may be implicated in cell fate. 3.2. Inhibition of Melanoma Cells Proliferation Modulated by Activation of eTh rmo-TRPVs. Due to the signica fi nt upreg- 3.3. Activation of TRPV2 Channel Promoted Necrosis for ulation of TRPV4 which has been detected in melanoma A2058 Melanoma Cells. As activation of TRPV2 could inhibit A375 cells, GSK1016790A, a selective activator of TRPV4, cell viability of A2058 melanoma cells, the function of TRPV2 hasbeenappliedto A375cellsaswellasmelanocytes. in A2058 cells requires further investigation. Flow cytometry Microscopic imaging showed that the proliferation of A375 analysisforeithercellcycle orcell apoptosishasbeen cells was inhibited aeft r GSK1016790A application but not assessed, respectively. After treatment with 2-APB (100 𝜇M for melanocytes (Figures 2(a)(i) & 2(a)(ii)). In addition, -400𝜇M) for 24 h, cell cycle changed negligibly (data not proliferation was quantified with MTT assay of GSK1016790A shown), while there was significant increase from 3.9% to (1 nM-50 nM) for 24 h, and GSK1016790A prominently 56.4% in the necrotic and late apoptotic cells. Meanwhile, the inhibited cell proliferation of A375 cells but with no effect on number of early apoptotic cells was also increased from 7.1% = 10 nM). Meanwhile, 2-APB, melanocytes (Figure 2(b), IC to 15.1% (Figures 3(a)(i) & 3(a)(ii)). an activator of TRPV2 (also activates TRPV1 and TRPV3 but Moreover, microscopic imaging clearly showed that 2- does not aeff ct TRPV4), clearly attenuated the proliferation APB could inhibit proliferation of A2058 melanoma cells, of A2058 melanoma cells (Figure 2(c), IC =150𝜇M). and cell swelling and loss of plasma membrane integrity To determine whether TRPV4 ion channel functionally were observed (Figure 3(b)). Taken together, these results mediates the viability of melanoma A375 cells, the activities indicated that activation of TRPV2 by 2-APB could induce of TRPV4 then have been investigated. Calcium influx via necrosis and apoptosis but does not affect cell cycle for A2058 GSK1016790A application to melanoma A375 cell line was melanoma cells. observed by using calcium imaging approach. Assessment by intracellular calcium signals with addition of 2 nM GSK1016790A clearly showed significant increase of calcium 3.4. Repression of TRPV4 Abolished Agonist Mediated Sig- signal compared with negative control one by DMSO appli- naling Pathway. To further prove that functional TRPV4 cation, and this calcium influx was clearly attenuated when ion channel mediated melanoma A375 cell viability, TRPV4 a TRP channel blocker, ruthenium red was applied (Figures was knockdown by using shRNA to produce RNA interfer- 2(d)(i), 2(d)(ii), and 2(d)(iii), (n = 12, p < 0.01)). These ence in A375 cells (Figure 4(a)). With TRPV4 knockdown, data demonstrated that functional TRPV4 expression could no significant change was observed in cell viability aer ft Journal of Oncology 5 TRPV1 TRPV2 94KD IB: TRPV1 95KD IB: TRPV2 IB: -actin IB: -actin 42KD 42KD (i) (ii) TRPV3 TRPV4 90KD IB: TRPV3 100KD IB: TRPV4 IB: -actin IB: -actin 42KD 42KD (iii) (iv) TRPA1 TRPM8 120KD IB: TRPA1 IB: TRPM8 130KD 42KD 42KD IB: -actin IB: -actin (v) (vi) (a) TRPV1 TRPV2 0 0 (i) (ii) TRPV3 TRPV4 (iii) (iv) TRPA1 TRPM8 12 120 6 60 (v) (vi) (b) Figure 1: The distribution profiles of six thermo-TRPs in human melanoma cells and melanocytes. (a) Western blot analysis of TRPV1 (i), TRPV2 (ii), TRPV3 (iii), TRPV4 (iv), TRPA1 (v), and TRPM8 (vi) ion channels expression level in protein samples collected from primary epidermal melanocytes, and melanoma cells of A375, G361, A2058, and SK-MEL-3. (b) Droplet digital PCR detection of six thermo-TRPs for TRPV1 (i), TRPV2 (ii), TRPV3 (iii), TRPV4 (iv), TRPA1 (v), and TRPM8 (vi) in primary epidermal melanocytes, and melanoma cells of A375, G361, A2058, and SK-MEL-3. Total mRNA from human primary epidermal melanocytes and melanoma cells of A375, G361, A2058, and SK-MEL-3 were isolated, and digital PCR screening analysis for the indicated genes was performed. Determination of copy numbers per genome of six samples. Concentration values for indicated genes (◻). Error bars represented 95% confidence intervals, NTC represented nontemplate control.𝛽-actin was used as a positive control, and all tests were performed in at least three independent experiments. -Melanocyte -A375 -G361 -A2058 -SK-MEL-3 -Melanocyte -A375 -G361 -A2058 -SK-MEL-3 -Melanocyte -Melanocyte -A375 -A375 -G361 -G361 -A2058 -A2058 -SK-MEL-3 -SK-MEL-3 -Melanocyte -A375 -G361 -A2058 -SK-MEL-3 -Melanocyte Melanocyte -A375 A375 -G361 G361 -A2058 A2058 -SK-MEL-3 SK-MEL-3 NTC Melanocyte A375 Melanocyte A375 G361 A2058 G361 SK-MEL-3 A2058 NTC SK-MEL-3 NTC Melanocyte Melanocyte A375 A375 G361 G361 A2058 A2058 SK-MEL-3 NTC SK-MEL-3 NTC Melanocyte A375 G361 A2058 SK-MEL-3 NTC Concentration (copies/ul) Concentration (copies/ul) Concentration (copies/ul) Concentration (copies/ul) Concentration (copies/ul) Concentration (copies/ul) 6 Journal of Oncology A375 Control 20nM 50nM Melanocyte Control 20nM 50nM 24h 24h (i) (ii) (a) Melanocyte A375 1.5 1.5 (n=6) (n=6) (n=6) (n=6) (n=6) (n=6) 1.0 1.0 (n=6) 0.5 0.5 (n=6) (n=6) (n=6) 0.0 0.0 DMSO 1nM 10nM 20nM 50nM DMSO 1nM 10nM 20nM 50nM GSK1016790A GSK1016790A (i) (ii) (b) Melanocyte A2058 1.5 1.5 (n=6) (n=6) (n=6) (n=6) (n=6) 1.0 1.0 (n=6) (n=6) (n=6) (n=6) (n=6) 0.5 0.5 (n=6) (n=6) 0.0 0.0 D MSO 50uM 100 uM 150uM 200uM 400uM DMSO 50uM 100uM 150uM 200uM 400uM 2-APB 2-APB (i) (ii) (c) 2+ C； base line 100 M 2-APB 5M RR A2058 025 50 75 100 125 150 Time (sec) (i) (i) 100 100 2+ 2+ C； base line 2 nM GSK 5M RR C； base line 10 M capsaicin A375 A2058 0 25 50 75 100 125 150 025 50 75 100 Time (sec) Time (sec) (ii) (iii) (ii) (d) (e) Figure 2: Functional TRPVs mediated proliferation of melanoma cells. (a) Cells morphologically changed after GSK1016790A (20 nM and 50 nM) application to A375 melanoma cells and melanocytes via microscopy imaging (i) & (ii). (b) Cell viability test by MTT experiment exhibited inhibition of cell proliferation for melanoma A375 cells but not for primary epidermal melanocytes by treatment of either DMSO (control) or TRPV4 specific activator of GSK1016790A (1 nM, 10 nM, 20 nM, 50 nM) (i) & (ii). (c) Cell viability test by MTT experiment exhibited inhibition of cell proliferation for melanoma A2058 cells but not for primary epidermal melanocytes by treatment of either DMSO (control) or 2-APB (50𝜇M, 100 𝜇M, 150 𝜇M, 200 𝜇M, 400 𝜇M) (i) & (ii). (d) Measurement of calcium imaging in GSK1016790A application with 2 nM concentration in A375 melanoma cells was carried out, and intracellular calcium that dramatically enhanced was observed and calcium signal receded aer ft a blocker of ruthenium red was applied (i). A representative single cell (ii) recording by time course showed calcium influx uc fl tuation before and aer ft GSK1016790A application and channel blocker was added (iii), (n = 12, p < 0.01). (e) Measurement of calcium imaging showed 2-APB could induce calcium influx which could be blocked by TRP channel blocker of ruthenium red in A2058 cells(i),(n=12,p< 0.01). When TRPV1 agonist of capsaicin was applied, there was no apparent calcium signal observed in A2058 melanoma cells (ii), (n = 19). Cell Viability Cell Viability GSK1016790A ΔF (Average Intensity) GSK1016790A Cell Viability Cell Viability ΔF (Average Intensity) ΔF (Average Intensity) Journal of Oncology 7 2-APB (100M - 400 M) A2058-Control A2058-2-APB (100uM) A2058-2-APB (200uM) A2058-2-APB (400uM) 5 5 5 10 10 10 4 4 10 10 10 3 3 3 10 10 10 2 2 2 10 10 2 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 FITC-A FITC-A FITC-A FITC-A Annexin V A2058-Control A2058-2-APB (100uM) A2058-2-APB (200uM) A2058-2-APB (400uM) 200 150 32.6% 11% 13.3% 100 50 0 0 0 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5 00 10 10 10 10 10 10 10 00 10 10 10 10 10 10 10 10 −311 −166 −131 −121 PE-A PE-A PE-A PE-A PI (i) A2058 A2058 ∗∗∗ 60 ∗ (n=3) ∗∗∗ (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) 0 0 2-APB 2-APB (ii) (a) A2058 Control 1M 10M 100M 200M 400M 0h 24h 48h 2-APB (b) Figure 3: TRPV2 activation dominated A2058 melanoma cells undergoi ng necrosis. (a) Flow cytometry analysis via FITC-Annexin V and PI staining showed A2058 melanoma cells with 2-APB (100𝜇M, 200 𝜇M, and 400 𝜇M) treatment undergoing necrosis and enhanced apoptosis (i) & (ii). (b) Morphology measurement by microscopic imaging for A2058 melanoma cells with 2-APB (1𝜇M, 10 𝜇M, 100 𝜇M, 200 𝜇M, and 400𝜇M) treatment exhibited prominent necrotic and apoptotic cells. DMSO 100uM 200uM 400uM DMSO 100uM 200uM 400uM PI Necrosis% PE-A Count Count PE-A PE-A Early Apoptosis% Count PE-A Count 8 Journal of Oncology GSK1016790A or alternative TRPV4 agonist of 4𝛼-PDD for permeability of calcium. Activation of TRPV4 ion channel treatment (Figures 4(b) and 4(c)). These results suggested would trigger calcium influx. As an important intracellu- that deficient of TRPV4 could abolish the inhibition of cell lar second messenger, calcium is involved in a bunch of proliferation induced by GSK1016790A and 4𝛼-PDD. physiological and pathological processes via ion channels Moreover, pretreatment of GSK2193874, a selective [33, 34]. Is calcium involved in the regulation of functional inhibitor of TRPV4, clearly abrogated the inhibition induced TRPV4 in melanoma? Calcium chelator of EGTA (ethylene by GSK1016790A (Figures 4(d) and 4(e)). Meanwhile, ruthe- glycol tetra-acetic acid) and BAPTA-AM were applied, and nium red was also used for pretreatment to suppress TRPV4 the AKT signals were collected from calcium/calcium free function, and similar results were obtained in A375 cells medium incubation cells of GSK1016790A addition. In the treated with 20 nM and 50 nM GSK1016790A for 24 h absenceofextracellularcalciumchelatorofEGTAorintracel- (Figure 4(f)). Together, our data demonstrated that TRPV4 lular calcium chelator of BAPTA-AM, 20 nM GSK1016790A channel was functionally involved in cell viability for A375 addition could enhance the phosphorylation of AKT, while melanoma cells. depletion of extracellular calcium by EGTA, GSK1016790A even potentiated the phosphorylation of AKT signal greater in A375 cells. Meanwhile, in the presence of intracellular 3.5. Pharmacological Activation of TRPV4 Induced Apoptosis calcium chelator of BAPTA-AM, GSK1016790A seemed to of A375 Melanoma Cells. Given that pharmacological acti- have similar effects as EGTA application on the phosphory- vation of TRPV4 could inhibit cell viability, to assess the lation of AKT pathway. Indeed, when there was depletion of lethality of GSK1016790A to melanoma cell lines, A375 cells both extra- and intracellular calcium, AKT phosphorylation were treated with GSK1016790A at various concentrations inducedbyGSK1016790A wasattenuatedinA375cells. for24handthenanalysedbyflow cytometrywithFITC These data indicated that calcium was involved in regulation conjugated Annexin V and PI. As illustrated in Figure 5, of AKT phosphorylation following GSK1016790A treatment 50 nM GSK1016790A prominently increased the number of since EGTA or BAPTA-AM pretreatment clearly enhanced apoptotic cells from 8.9% to 23.3% (Figure 5(a)). This data GSK1016790A induced rise in AKT phosphorylation via implied that pharmacological application of GSK1017690A TRPV4 ion channel (Figure 6(c)). u Th s, AKT functioned could induce apoptosis of A375 cells by activation of TRPV4 as downstream eeff ctors for calcium signaling mediated by channel. Meanwhile, 4𝛼-PDD, an agonist of TRPV4 channel, TRPV4 in human A375 melanoma cells. was also applied (500 nM, 2 𝜇M) and the data exhibited similar apoptosis induction from 7.5% to 20.6% in A375 cells 4. Discussion (Figure 5(b)). We also examined cell apoptosis by using microscopy Thermo-TRPs are not only localized in sensory neurons as imaging with Hochest33342 and PI staining. Treatment with polymodal cellular sensors but also functionally expressed GSK1016790A clearly enhanced the chromatin condenses in in a plethora of nonneuronal cell types involved in reg- A375 cells. Consistently, after application of channel blocker ulating various physiological and pathophysiological func- of ruthenium red, cell viability and chromatin have been tions [35–40]. In TRPM subfamily, TRPM2 and TRPM8 observed protected from GSK1016790A addition (20 nM and were implicated in the regulation of melanocytic behaviors. 50 nM) for 24 h in A375 cells (Figure 5(c)). Together, our TRPM2 was capable of inducing melanoma apoptosis and data indicated that pharmacological activation of TRPV4 ion necrosis. TRPM8 could mediate agonist-induced melanoma channel could induce cell apoptosis of human melanoma. cell death [41]. In the present study, six thermo-TRPs such as TRPV1/2/3/4, TRPA1, and TRPM8 were examined. Our 3.6. Functional TRPV4 Channel Involved in Mediating AKT data showed that there was discordance between protein Signaling Pathway via Enhancing AKT Phosphorylation. How and gene expression, such as TRPV2 in human melanoma TRPV4 mediated apoptosis of A375 cells by its activation cells. Previous studies have revealed that discrepancy between is unclear. Since AKT and MAPK signaling pathways are protein and mRNA expression levels was widely variable. For commonly associated with cell apoptosis, we hypothesized example, mRNA and protein discordance has been reported that TRPV4 may mediate cell apoptosis of melanoma via tovary from 32%[42]to83.5%[43]intheLNCaPprostate AKT or MAPK signaling pathway. Phosphorylation of AKT cancer cell line. er Th e are several factors that could result was significantly greater in GSK1016790A application in A375 in the discordance. According to our results, thermo-TRPs cells compared to control one (Figures 6(a) and 6(b)), while are low abundant membrane proteins, and actual biological ErK/JNK/P38 of MAPK signal pathways were not influenced differences between transcript and protein abundance may in application of GSK1016790A (Figure 6(a)). These data sug- aeff ct the correlation between gene and protein expression gested that the increased phosphorylation and activation of levels just as previous studies indicated [44]. AKT pathway (Figure 6(b)) may be involved in GSK1016790A Recent studies have tried to elucidate the distributions inducing cell apoptosis of melanoma via functional TRPV4 and roles of several thermo-TRPs in cancer. Fusi and col- ion channel. leagues investigated a subset of TRP ion channels including TRPV1/2/3/4 and TRPA1 in human nonmelanoma skin 3.7. Calcium Signaling Mediated by TRPV4 Facilitated cancer.TheyfounddownregulationofTRPV4 couldact Apoptosis via Phosphorylation of AKT in A375 Melanoma as an early biomarker of skin carcinogenesis [12]. Tsavaler Cells. TRPV4 is a nonselective cationic channel with high et al. reported that TRPM8 was upregulated in prostate Journal of Oncology 9 100KD IB: TRPV4 IB: -actin 42KD 1.5 (i) 1.5 ∗∗ 1.0 (n=3) 1.0 0.5 (n=3) 0.5 0.0 0.0 GSK1016790A A375 (n=6) (ii) A375+shTRPV4 (n=6) (a) (b) 1.5 A375 1.5 1.0 1.0 (n=6) 0.5 0.5 0.0 0.0 4-PDD GSK2193874 A375 (n=6) A375+shTRPV4 (n=6) (c) (d) A375 1.5 A375 Control 20nM 50nM 1.0 (n=6) RR- 0.5 0.0 RR+ GSK2193874+GSK1016790A (e) (f) Figure 4: Silencing TRPV4 ion channel suppressed GSK1016790A mediating signals. (a) A representative western blot indicated the successful knockdown of TRPV4 protein by shRNA (i) & (ii). (b) Loss of TRPV4 fully suppressed the inhibition of proliferation for the treatment of GSK1016790A (1 nM, 10 nM, 20 nM, and 50 nM) to A375 melanoma cells. (c) Suppression of TRPV4 attenuated the inhibition of proliferation for the treatment of 4𝛼-PDD (100 nM, 200 nM, 400 nM, and 1 𝜇M) in A375 melanoma cells. (d) Inhibition of TRPV4 by GSK2193874 (10 nM, 50 nM, 100 nM and 200 nM) did not aeff ct melanoma cell proliferation. (e) Treatment with GSK1016790A (1 nM, 10 nM, 20 nM and 50 nM) and GSK2193874 (100 nM) did not aeff ct cell viability of melanoma. (f) Pretreatment of ruthenium red fully suppressed the inhibition of proliferation for the application of GSK1016790A with 20 nM and 50 nM to A375 melanoma cells. All tests were performed in at least three independent experiments. -A375 -A375+ shTRPV4 A375 A375+ shTRPV4 DMSO DMSO 100nM 1nM 200nM 10nM 400nM 20nM 1uM 50nM DMSO DMSO 1nM 10nM 10nM 50nM 20nM 100nM 50nM 200nM Percent% Cell Viability Cell Viability GSK1016790A Cell Viability Cell Viability 10 Journal of Oncology GSK1016790A (20 nM - 50nM) A375-DMSO A375-GSK (20nM) A375-GSK (50nM) A375 ∗∗∗ (n=3) 10 4 ∗∗∗ (n=3) (n=3) 10 3 3 10 2 −69 −78 −55 2 3 4 5 2 3 4 5 2 3 4 5 0 10 10 10 10 0 10 10 10 10 0 10 10 10 10 −65 −111 −74 GSK1016790A Annexin V FITC-A Annexin V FITC-A Annexin-V FITC-A Annexin V (i) (ii) (a) 4-PDD (500 nM - 2 M) A375 A375-DMSO A375-4a-PDD (500nM) A375-4a-PDD (2uM) 5 5 10 ∗ (n=3) (n=3) 4 4 10 10 (n=3) 3 5 3 3 10 10 10 10 2 3 4 5 4-PDD 2 3 4 5 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 FITC-A FITC-A FITC-A Annexin V (i) (ii) (b) GSK1016790A Control 20nM 50nM A375 RR- RR+ (c) Figure 5: GSK1016790A application induced apoptosis of human A375 melanoma cells. (a) Flow cytometry test via FITC-Annexin V and PI staining showed increasing apoptotic signals by treatment with GSK1016790A to A375 melanoma cells (i) & (ii). (b) Flow cytometry analysis via FITC-Annexin V and PI staining for 4𝛼-PDD treatment exhibited enhancing apoptotic cells in melanoma A375 cells (i) & (ii). (c) Pretreatment of ruthenium red prominently attenuated apoptotic cells for the application of GSK1016790A with 20 nM and 50 nM to A375 melanoma cells; cells were stained with Hochest33342 and PI. All tests were performed in at least three independent experiments. DMSO 20nM 50nM DMSO 500nM 2uM PI PI PE-A PIPE-A PE-A PIPE-A PE-A PIPE-A Early Apoptosis% Early Apoptosis% Journal of Oncology 11 GSK1016790A 0nM 20nM 50nM 44KD IB: ErK1/2 42KD 44KD IB: pErK1/2 42KD 54KD IB: JNK 46KD 54KD IB: pJNK 46KD 38KD IB: P38 38KD IB: pP38 60KD IB: AKT 60KD IB: pAKT (a) GSK1016790A 0nM 20nM 50nM A375 ---- ++++ -0.5mM EGTA -- + + - - + + -8M BAPTA-AM -+ +- + - + - -20nM GSK1016790A IB: AKT 60KD 60KD IB: AKT IB: pAKT 60KD 60KD IB: pAKT 42KD IB: -actin (b) (c) Figure 6: TRPV4 functionally mediated melanoma cells apoptosis via AKT pathway and was influenced by calcium. (a) Western blot analysis of MAPK as well as AKT signals was collected for activation of TRPV4 in A375 melanoma cells. Cells were treated by GSK1016790A with 20 nM and 50 nM for 24 h and lysates were then probed with the indicated antibodies,𝛽-actin was used as a loading control, and pAKT was observed upregulated. (b) Assessments of pAKT changes triggered by GSK1016790A with 20 nM and 50 nM within 10 min as well as 24 h in melanoma A375 cells. (c) Influences of calcium ion on GSK1016790 A-induced, TRPV4-mediated signal transduction. A375 cells were untreated or pretreated with EGTA or BAPTA-AM for 1 h before being stimulated with GSK1016790A. All tests were performed in at least three independent experiments. cancer when compared with normal prostate epithelial cells. mediated through EGFR/AKT/ mTOR signaling pathway [46]. Based on our examination, it is not the case for this In addition, TRPM8 also can be detected in tumors of study. Independent study reported that treatment of a TRPV1 breast,colon,lung,andskinbutnotinthe corresponding agonist of capsaicin could efficiently reduce proliferation and normal human tissues [45]. Our present study identified induce obvious apoptosis of renal carcinoma cells through upregulation of TRPV4 and activation of this ion chan- mediating caspases activation via P38 and JNK within MAPK nel could induce apparent intracellular calcium signaling pathway [47]. Other independent study revealed that TRPV6 in regulation of cell viability and apoptosis. Notably, cells might mediate growth factor signaling to induce PI3K-PKD1- underwent early apoptosis aer ft TRPV4 activation by 4 𝛼- AKTcascade viacalciuminhumancolon cancer [48].Inthis PDD (Figure 7(a)) as well as GSK1016790A. Meanwhile, in regard, AKT and MAPK signaling pathways were examined melanoma A2058 cells, pharmacological activation of TRPV2 in the present study. And our data highlighted that AKT with 2-APB could inhibit cell proliferation and promote cell signaling regulated cell fate of A375 melanoma cells during apoptosis as well. Interestingly, 2-APB application dominated TRPV4 activation via enhancing AKT phosphorylation. A2058 cells undergoing necrosis and late apoptosis other than Characteristics of cells including neoplastic human early apoptosis both via FITC-Annexin V/PI staining and 2+ Hochest33342/PI staining (Figure 7(b)), which was clearly melanoma cells are determined by Ca dependent cellular different from the activation of TRPV4 in melanoma A375 process. Intracellular calcium is predominantly regulated cells. Our data further indicated that activation of thermo- by TRPs [33]. us, Th calcium involvement was assessed in TRPV2/4 modulated distinct cellular behaviors in human the present study. Our results demonstrated that calcium melanoma cells. involved in TRPV4 mediation of AKT phosphorylation. Early studies suggested that TRPV1 was involved in Notably, depletion of either extracellular or intracellular cal- skin cancer [13, 46]. Inhibition of TRPV1 by antagonist cium could clearly potentiate AKT phosphorylation induced of AMG9810 could promote mouse skin tumorigenesis by GSK1016790A. These observations indicated that TRPV4 10min 24h 10min 24h 10min 24h 25 12 Journal of Oncology 4-PDD (500 nM - 2 M) A375-Control A375-4a-PDD (500nM) A375-4a-PDD (1uM) A375-4a-PDD (2uM) 5 5 5 5 10 10 10 10 4 4 4 4 10 10 10 10 3 3 10 10 10 10 2 2 10 10 10 10 2 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 FITC-A FITC-A FITC-A FITC-A Annexin V (i) A375 A375 ∗∗∗ ∗∗∗ 20 ∗∗∗ (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) DMSO 500nM 1uM 2uM DMSO 500nM 1uM 2uM 4-PDD 4-PDD (iii) (ii) (a) 2-APB (200 M - 400 M) A2058-DMSO A2058-2-APB (200uM) A2058-2-APB (300uM) A2058-2-APB (400uM) 5 5 5 5 10 10 10 4 4 4 4 10 10 10 3 3 3 3 10 10 10 10 2 2 2 10 10 10 2 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 Pacific Blue-A Pacific Blue-A Pacific Blue-A Pacific Blue-A Hochest33342 (i) A2058 A2058 ∗∗∗ (n=3) ∗∗∗ ∗∗∗ (n=3) ∗∗∗ 20 20 (n=3) (n=3) (n=3) (n=3) (n=3) (n=3) DMSO 200uM 300uM 400uM DMSO 200uM 300uM 400uM 2-APB 2-APB (ii) (iii) (b) Figure 7: Functional TRPVs influenced melanoma cell fate in different profiles. (a) Flow cytometry assessment of 4 𝛼-PDD triggered apoptosis (i) of melanoma A375 cells via staining with FITC - Annexin V and PI. Activation of TRPV4 by 4𝛼-PDD induced human melanoma A375 cells undergoing early apoptosis (ii). A slight degree of necrotic cells was observed as well (iii). (b) Flow cytometry assessment of 2-APB triggered cell death of melanoma A2058 cells via staining with Hochest33342 and PI. Activation of TRPV2 by 2-APB in melanoma A2058 cells underwent late apoptosis as well as necrosis (i). 2-APB application induced a slight degree of early apoptotic cells (ii) and dominated cells undergoing necrosis and late apoptosis (iii). Early Apoptosis% PI PI PE-A Early Apoptosis% PE-A PE-A PE-A PE-A PE-A Necrosis% Necrosis% PE-A PE-A Journal of Oncology 13 served as distinct cellular linker between calcium ions Supplementary Materials and calcium signaling pathway and thus was expected to See Figures S1 and S2 in the Supplementary Materials for dynamically modulate AKT phosphorylation process. Fur- comprehensive image analysis. (Supplementary Materials) ther studies are needed to fully understand the cooperative modulation among calcium changes and related downstream signaling of AKT. References [1] Z.H. Zhou,J.W.Song, W.Liet al., “ea Th cid-sensingion channel, ASIC2, promotes invasion and metastasis of colorectal 5. Conclusions cancer under acidosis by activating the calcineurin/NFAT1 axis,” Journal of Experimental & Clinical Cancer Research,vol. Taken together, here we have demonstrated that TRPV2 and 36,no.130, pp.1–12, 2017. TRPV4 were distributed in human melanoma A2058 and [2] A. A. Peters, S. Y. N. Jamaludin, K. T. D. S. Yapa et al., “Oncosis A375 cells as well as melanocytes. Pharmacological activa- and apoptosis induction by activation of an overexpressed ion tion of TRPV4 could inhibit cell proliferation and induce channel in breast cancer cells,” Oncogene,vol.36, no.46, pp. cell apoptosis of A375 cells. Furthermore, the activation of 6490–6500, 2017. TRPV4-AKT pathway with calcium signaling involvement [3] R.K.Adapala,R.J.Thoppil,K.Ghosh et al.,“Activation drove antitumor effect in A375 cells. Our data suggested that of mechanosensitive ion channel TRPV4 normalizes tumor TRPV4 ion channel therefore may serve as a potential clinical vasculature and improves cancer therapy,” Oncogene,vol.35,no. therapeutic strategy in human melanoma. 3,pp.314–322,2016. [4] J.-H.Ko,E.A.Ko,W. Gu,I.Lim,H. Bang,andT. Zhou, “Expression profiling of ion channel genes predicts clinical Abbreviations outcome in breast cancer,” Molecular Cancer,vol.12,no.1,article 106, 2013. GSK: GSK1016790A [5] S. P. Fraser, J. A. Grimes, M. B. A. Djamgoz et al., “Effects PI: Propidium iodide of voltage-gated ion channel modulators on rat prostatic Pro: Probenecid cancer cell proliferation: Comparison of strongly and weakly TRP: Transient Receptor Potential metastatic cell lines,” The Prostate ,vol.44,no.1,pp.61–76,2000. TRPV: Transient Receptor Potential Vanilloid [6] H. F. Cantiello, A. G. Prat, J. V. Bonventre, C. C. Cunningham, RR: Ruthenium red. J. H. Hartwig, and D. A. Ausiello, “Actin-binding protein contributes to cell volume regulatory ion channel activation in melanoma cells,” eJ Th ournalofBiologicalChemistry ,vol.268, no.7,pp. 4596–4599, 1993. Data Availability [7] D. H. Allen, A. Lepple-Wienhues, M. D. Cahalan et al., “Ion channel phenotype of melanoma cell lines,” Journal of Mem- ed Th ata usedtosupportthefindingsofthisstudy are brane Biology,vol.155,no.1, pp.27–34,1997. available from the corresponding author upon request. [8] B. Nilius, T. Bo¨hm, W. Wohlrabetal.,“Properties of a potassium-selective ion channel in human melanoma cells,” Pfl u¨gers Archiv - European Journal of Physiology,vol.417,no.3, Conflicts of Interest pp. 269–277, 1990. [9] P. Facer, M. A. Casula, G. D. Smith et al., “Differential expression eTh authors declare no conflicts of interest regarding the of the capsaicin receptor TRPV1 and related novel receptors publication of this paper. TRPV3, TRPV4 and TRPM8 in normal human tissues and changes in traumatic and diabetic neuropathy,” BMC Neurology, vol. 7, article 11, pp. 1–12, 2007. Authors’ Contributions [10] A. M. Peier, A. J. Reeve, D. A. Andersson et al., “A heat-sensitive TRP channel expressed in keratinocytes,” Science,vol.296,no. Wei Cheng and Xuejing Tan designed the research; Jiao- 5575, pp. 2046–2049, 2002. jiao Zheng and Fangyuan Liu performed most research [11] B. I. Tot ˜ h, A. Ola´h,A.G.Szol ¨ losi ´ , and T. B´ıro, ˜ “TRP channels experiments; Sha Du, Mei Li, and Tian Wu conducted flow in the skin,” British Journal of Pharmacology,vol.171,no.10,pp. cytometry experiments as well as data analysis; and Wei 2568–2581, 2014. Cheng wrote the manuscript. Jiaojiao Zheng and Fangyuan [12] C. Fusi, S. Materazzi, D. Minocci et al., “Transient recep- Liu contributed equally to this work. tor potential vanilloid 4 (TRPV4) is downregulated in ker- atinocytes in human non-melanoma skin cancer,” Journal of Investigative Dermatology,vol.134,no.9, pp.2408–2417,2014. Acknowledgments [13] A. M. Bode, Y.-Y. Cho, D. Zheng et al., “Transient receptor potential type vanilloid 1 suppresses skin carcinogenesis,” Can- We thank Dr. Jie Zheng for his generous gisft of various cer Research,vol.69,no.3,pp. 905–913, 2009. constructs of thermo-TRPs and current laboratory members [14] M. S.McNeill,J.Paulsen,G.Bonde,E.Burnight,M.-Y. Hsu,and for assistance and discussions. This work was supported R. A. Cornell, “Cell death of melanophores in zebrash fi TRPM7 by part of the grant from the National Natural Science of mutant embryos depends on melanin synthesis,” Journal of Foundation in China (81301720 to Wei Cheng). Investigative Dermatology,vol.127,no. 8,pp.2020–2030,2007. 14 Journal of Oncology [15] H. Yamamura, S. Ugawa, T. Ueda, A. Morita, and S. Shimada, cinnamaldehyde,” Naunyn-Schmiedeberg’s Archives of Pharma- “TRPM8 activation suppresses cellular viability in human cology,vol.385,no. 6, pp.555–563,2012. melanoma,” American Journal of Physiology-Cell Physiology,vol. [33] D. E. Clapham, “Calcium Signaling,” Cell,vol.131,no.6,pp. 295, no. 2, pp. C296–C301, 2008. 1047–1058, 2007. [16] M. J. Caterina, M. A. Schumacher, M. Tominaga, T. A. Rosen, [34] C. Montell, “eTh latest waves in calcium signaling,” Cell,vol.122, J. D. Levine, and D. Julius, “The capsaicin receptor: a heat- no. 2, pp. 157–163, 2005. activated ion channel in the pain pathway,” Nature,vol.389,no. [35] X. Cheng, J. Jin, L. Hu et al., “TRP channel regulates EGFR 6653, pp. 816–824, 1997. signaling in hair morphogenesis and skin barrier formation,” [17] A. M. Peier, A. Moqrich, A. C. Hergarden et al., “A TRP channel Cell,vol.141,no. 2,pp.331–343,2010. that senses cold stimuli and menthol,” Cell,vol.108,no. 5,pp. [36] Y.Miao,G.Li,X. Zhang, H. Xu,andS.N.Abraham, “A TRP 705–715, 2002. channel senses lysosome neutralization by pathogens to trigger [18] D. E. Clapham, “TRP channels as cellular sensors,” Nature,vol. their expulsion,” Cell,vol.161,no.6, pp.1306–1319,2015. 426, no. 6966, pp. 517–524, 2003. [37] B.Nilius,T.Voets,J.Petersetal.,“TRP channels in disease,” [19] Y. Zhang, M. A. Hoon, J. Chandrashekar et al., “Coding of sweet, Science’s STKE,” Signal Transduction Knowledge Environment, bitter, and umami tastes: different receptor cells sharing similar vol. 2005, no. 295, 2005. signaling pathways,” Cell,vol.112,no. 3,pp.293–301,2003. [38] A. G. Szol ¨ losi ˝ , N. Vasas, A. Angyal et al., “Activation of [20] K. Talavera, K. Yasumatsu, T. Voets et al., “Heat activation of TRPV3 Regulates Inflammatory Actions of Human Epidermal TRPM5 underlies thermal sensitivity of sweet taste,” Nature,vol. Keratinocytes,” Journal of Investigative Dermatology,vol.138, 438, no. 7070, pp. 1022–1025, 2005. no. 2, pp. 365–374, 2018. [21] C. J. Bohlen,A.Priel,S.Zhou,D.King,J.Siemens,and D.Julius, [39] W. D. Tracey Jr., R. I. Wilson, G. Laurent, and S. Benzer, “A bivalent tarantula toxin activates the capsaicin receptor, “painless, a Drosophila gene essential for nociception,” Cell,vol. TRPV1, by targeting the outer pore domain,” Cell,vol.141,no.5, 113, no. 2, pp. 261–273, 2003. pp.834–845,2010. [40] R.Xiao,B.Zhang,Y.Dongetal.,“Agenetic programpromotes [22] Y. R. Park, J. N. Chun, I. So et al., “Data-driven analysis of C. elegans longevity at cold temperatures via a thermosensitive TRP channels in cancer: linking variation in gene expression TRP channel,” Cell,vol.152,no. 4, pp.806–817,2013. to clinical significance,” Cancer Genomics & Proteomics,vol.13, [41] H. Guo, J. A. Carlson, A. Slominski et al., “Role of TRPM in no. 1, pp. 83–90, 2016. melanocytes and melanoma,” Experimental Dermatology,vol. [23] M. A. Schumacher, “Transient receptor potential channels 21, no. 9, pp. 650–654, 2012. in pain and inflammation: therapeutic opportunities,” Pain [42] A. Waghray, F. Feroze, M. S. Schober et al., “Identification of Practice,vol.10,no.3,pp.185–200, 2010. androgen-regulated genes in the prostate cancer cell line LNCaP [24] N. Prevarskaya, L. Zhang, and G. Barritt, “TRP channels in by serial analysis of gene expression and proteomic analysis,” cancer,” Biochimica et Biophysica Acta (BBA) - Molecular Basis Proteomics,vol.1,no.10,pp. 1327–1338, 2001. of Disease,vol.1772,no.8,pp. 937–946, 2007. [43] B. Lin, J. T. White, W. Lu et al., “Evidence for the presence of [25] D. Gkika and N. Prevarskaya, “Molecular mechanisms of TRP disease-perturbed networks in prostate cancer cells by genomic regulation in tumor growth and metastasis,” Biochimica et and proteomic analyses: A systems approach to disease,” Cancer Biophysica Acta (BBA) - Molecular Cell Research,vol.1793,no. Research,vol.65, no.8,pp. 3081–3091, 2005. 6, pp. 953–958, 2009. [44] L. E. Pascal, L. D. True, D. S. Campbell et al., “Correlation of [26] M. Gautier, I. Dhennin-Duthille, A. S. Ay, P. Rybarczyk, I. mRNA and protein levels: Cell type-specific gene expression of Korichneva, and H. Ouadid-Ahidouch, “New insights into cluster designation antigens in the prostate,” BMC Genomics, pharmacological tools to TR(i)P cancer up,” British Journal of vol. 9, article no. 246, 2008. Pharmacology,vol.171,no.10,pp.2582–2592, 2014. [45] L.Tsavaler,M.H.Shapero,S.Morkowski,andR.Laus,“Trp- [27] M. Boddin ¨ g, “TRP proteins and cancer,” Cellular Signalling,vol. p8, a novel prostate-specific gene, is up-regulated in prostate 19, no. 3, pp. 617–624, 2007. cancer and other malignancies and shares high homology with [28] V. Lehen’Kyi and N. Prevarskaya, “Oncogenic TRP channels,” transient receptor potential calcium channel proteins,” Cancer Advances in Experimental Medicine and Biology,vol.704,pp. Research,vol.61,no.9,pp. 3760–3769, 2001. 929–945, 2011. [46] S. Liy, A. M. Bodey, F. Zhuy et al., “TRPV1-antagonist AMG9810 [29] V. U. Bai, S. Murthy, K. Chinnakannu et al., “Androgen regulated promotes mouse skin tumorigenesis through EGFR/Akt signal- TRPM8 expression: A potential mRNA marker for metastatic ing,” Carcinogenesis,vol.32, no.5,pp. 779–785, 2011. prostate cancer detection in body uids, fl ” International Journal [47] T. Liu, G. Wang, H. Tao et al., “Capsaicin mediates caspases of Oncology,vol.36,no.2,pp. 443–450, 2010. activation andinduces apoptosis throughP38 andJNK MAPK [30] S. Mergler, R. Derckx, P. S. Reinach et al., “Calcium regulation pathways in human renal carcinoma,” BMC Cancer,vol.16,no. by temperature-sensitive transient receptor potential channels 1, article no. 790, 2016. in human uveal melanoma cells,” Cellular Signalling,vol.26, no. [48] W. Dai, Y. Bai, L. Hebda et al., “Calcium deficiency-induced and 1, pp.56–69,2014. TRP channel-regulated IGF1R-PI3K-Akt signaling regulates [31] U. Orfanelli, A.-K. Wenke, C. Doglioni, V. Russo, A. K. abnormal epithelial cell proliferation,” Cell Death & Dier ff entia- Bosserhoff, and G. Lavorgna, “Identification of novel sense and tion,vol.21, no.4,pp. 568–581, 2014. antisense transcription at the TRPM2 locus in cancer,” Cell Research, vol. 18, no. 11, pp. 1128–1140, 2008. [32] B. Oehler, A. Scholze, M. Schaefer, and K. Hill, “TRPA1 is functionally expressed in melanoma cells but is not critical for impaired proliferation caused by allyl isothiocyanate or MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal

Journal of Oncology – Hindawi Publishing Corporation

Published: Feb 7, 2019

There are no references for this article.