Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/hindawi-publishing-corporation/lncrna-sbf2-as1-facilitates-nonsmall-cell-lung-cancer-progression-by-wtAiO4NQzi
- Publisher
- Hindawi Publishing Corporation
- Copyright
- Copyright © 2022 Yi Wang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
- ISSN
- 2040-2295
- eISSN
- 2040-2309
- DOI
- 10.1155/2022/2223149
- Publisher site
- See Article on Publisher Site
Abstract
Hindawi Journal of Healthcare Engineering Volume 2022, Article ID 2223149, 9 pages https://doi.org/10.1155/2022/2223149 Research Article LncRNA SBF2-AS1 Facilitates Nonsmall Cell Lung Cancer Progression by Targeting miR-520a-3p 1 2 3 4 5 Yi Wang , Yanzhi Zou , Qingmei Zhang , Defu Chen , and Lin Lin Department of Respiration, e People’s Hospital of Zhangqiu Area, Jinan 250200, China Occupational Disease Department, e Second Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan 250001, China Emergency Ward, Qingdao Hospital of Traditional Chinese Medicine, Hiser Medical Group of Qingdao, Qingdao 266033, China Department of Cardio-oracic Surgery, Zhangqiu District People’s Hospital, Jinan 250200, China No. 1 Department of Respiratory and Critical Care Medicine, Shengjing Hospital of China Medical University, Shenyang 110004, China Correspondence should be addressed to Lin Lin; linlin@sj-hospital.net.cn Received 18 February 2022; Revised 4 March 2022; Accepted 23 March 2022; Published 11 April 2022 Academic Editor: M. A. Bhagyaveni Copyright©2022YiWangetal.+isisanopenaccessarticledistributedundertheCreativeCommonsAttributionLicense,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. Long noncoding RNA (lncRNA) SET-binding factor 2 (SBF2) antisense RNA1 (SBF2-AS1), which acts as an oncogene in various cancers, can promote tumors progression. +e study aimed to explore the role and molecular mechanism of SBF2-AS1 in nonsmall cell lung cancer (NSCLC). Methods. qRT-PCR was introduced to detect SBF2-AS1 and miR-520a-3p expression in NSCLC. +e effects of SBF2-AS1 and miR-520a-3p on the proliferation, migration, and invasion of NSCLC cells wereassessedthroughcellcountingkit-8(CCK-8)andtranswellassay.Furthermore,therelationshipofSBF2-AS1andmiR-520a- 3pwasverifiedbytheRNAimmunoprecipitation(RIP)assay,dual-luciferaseassay,andSpearmancorrelationanalysis. Results.In NSCLC tissues, SBF2-AS1 was highly expressed, while miR-520a-3p expression has decreased. +e overall survival of NSCLC patients with high SBF2-AS1 expression was lower. SBF2-AS1 silencing repressed the proliferation, migration, and invasion of NSCLC cells. SBF2-AS1directly interacted with miR-520a-3p, and a negative relationshipwas observedbetween theirexpression levelsinNSCLCtissues.Moreimportantly,thesuppressionofSBF2-AS1silencingontheproliferation,migration,andinvasionin NSCLC cells was counteracted by miR-520a-3p inhibition. Conclusion. SBF2-AS1 accelerated the proliferation, migration, and invasion of NSCLC cells via mediating miR-520a-3p, thus promoting NSCLC progression. immediate priority is to further explore molecular mecha- 1. Introduction nisms of NSCLC progression. Many lncRNAs are found to Lung cancer (LC) is one of the cancers with the highest be associated with various processes of gene regulation, which is related to the occurrence and development of incidence rate in China and will become the main cause for cancer death [1]. According to the type of pathology, it can NSCLC [6]. At present, the research of lncRNA in NSCLC be divided into two main types: small cell lung cancer has only uncovered a small part of the mystery, and more (SCLC) and NSCLC [2, 3]. +e 5-year survival rate of biological functions and specific molecular mechanisms are NSCLC is low, and the pathogenesis of NSCLC is complex still unknown. [2, 3]. Many patients are already at the advanced stage when SBF2-AS1 is located on chromosome 11p15.4 and is a diagnosed and missed the opportunity of surgery because of member of a novel lncRNA family [7]. SBF2-AS1 is upre- metastasis occurring. Currently, the comprehensive appli- gulated in esophageal squamous cell carcinoma (ESCC), cation of surgical, chemotherapy, radiotherapy, and other cervical cancer (CC), hepatocellular carcinoma (HCC), and treatment methods has obtained remarkable achievements, osteosarcoma (OS) to promote the development of cancer, but their long-term benefits are limited [4, 5]. +erefore, the and its expression is associated with poor prognosis [7–10]. 2 Journal of Healthcare Engineering SBF2-AS1expressionisdistinctlyincreased,anditssilencing 2.4. CCK-8Assay. +etransfected cells wereinoculatedon a represses proliferation and invasion of ESCC [8]. In CC, 96-well plate with 2 ×10 cells/well. At 24, 48, 72, and 96h abnormal expression of SBF2-AS1 promotes its progression after cell inoculation, CCK-8 solution (Dojindo, Japan) was through the regulation of miR-361-5p/FOXM1 axis [9]. addedandmixedgently.Culturewascontinuedfor2hinan Moreover, SBF2-AS1 regulates TGF-BR1 through sponging incubator at 37 C. +e 450nm absorbance was detected by miR-140-5p to participate in the progression of HCC [7]. the microplate reader (Bio-Rad, Carlsbad, CA). Besides, the expression of miR-30a and FOXA1 is regulated by SBF2-AS1 silencing to suppress the malignant biological 2.5. Transwell Assay. +e cell density of each group was behavior of OC cells [10]. Similarly, SBF2-AS1 acts as an adjusted into 1 ×10 cells/ml. +e upper chamber was oncogene in LC, and its upregulation can promote cell inserted with 100 μl cell suspension, and 600 μl serum- proliferation and metastasis, reduce the sensitivity of ra- containing medium was filled with lower chamber. +e cells diotherapy, inhibit apoptosis, and is closely related to un- were routinely cultured overnight. Subsequently, the moved favorable prognosis [11–13]. +e discovery and elucidation cells were fixed with 4% paraformaldehyde and stained with of SBF2-AS1 function provides a new molecular marker for 0.1% crystal violet. +e migrated cells were observed under the diagnosis and prognosisof NSCLC, as well as a potential the microscope. therapeutic target. Nevertheless, the specific regulation In the cell invasion experiment, upper chamber was mechanism still needs to be further clarified. precoated with Matrigel (BD Biosciences, USA). +e fol- +us, we investigated SBF2-AS1’s functions in NSCLC. lowing procedures were the same as above. Finally, 5 ran- It further proved whether SBF2-AS1 could regulate miR- domly fields were selected to count the number of invaded 520a-3p expression to mediate the NSCLC cells malignant cells. biological behavior, thereby revealing the mechanism of NSCLC progression and providing new targets for NSCLC- targeted therapy and research directions. 2.6. Dual-Luciferase Reporter Assay. +e binding sites of SBF2-AS1 and miR-520a-3p were predicted by bio- informatics analysis using ENCORI (+e Encyclopedia of 2. Materials and Methods RNA Interactomes) online (https://starbase.sysu.edu.cn/ 2.1. Clinical Samples. +irty-six cases of NSCLC patients index.php). All parameters were default. +e binding admitted to People’s Hospital of Zhangqiu Area and con- fragment was amplified and inserted into the luciferase firmed by surgery and pathology were selected. Inclusion vector to construct the wild-type plasmid of SBF2-AS1 criteria: patients diagnosed with NSCLC confirmed by (SBF2-AS1-wt); then, the binding site was mutated to surgicalpathology,patientsdidnotreceivechemotherapyor constructthemutant-typeplasmidofSBF2-AS1(SBF2-AS1- molecular targeted therapy before surgery, and case infor- mut). +e transfection was performed as previously men- mation is complete. Exclusion criteria: severe organ dys- tioned.Luciferaseactivitywasdetectedbythedual-luciferase function, patients with other chronic diseases (diabetes and reporter kit (Promega, USA). coronary heart disease), and patients with chronic ob- structivepulmonarydisease,asthma,tuberculosis,andother 2.7. RIP Assay. +e collected cells were lysed by RIP lysate, lung diseases. +e tumor was surgically removed, and the and the supernatant was centrifuged. According to the in- adjacent tissues were removed during the operation. In- TM struction of the RIP kit (Millipore, USA), immunopre- formed consent form was obtained from all patients. +is cipitationbuffer(containingribonucleaseinhibitor,protease study was endorsed by the Ethics Committee of People’s inhibitor,anddeoxyribonuclease)andcelllysatewereadded Hospital of Zhangqiu Area. to EP tubes containing magnetic beads. +en, the mixture was incubated with IgG or Ago2 antibody (Abcam, USA) at 2.2.CellCulture. +enormalhumanbronchialepithelialcell 4 C overnight, and the supernatant was discarded by cen- (16HBE) and four NSCLC cells (A549, Calu-3, HCC827 and trifugation.Finally,theRNAwaspurifiedanddissolved.+e PC9)wereobtainedfromShanghaiCellBankandATCC.All expressions of RNAs were detected by qRT-PCR. +e group cells were cultured in DMEM containing 10% FBS (Invi- without antibody was the positive control group (input), the trogen, USA) at 37 C with 5% CO . group with IgG antibody was the negative control group (IgG), and the group with Ago2 antibody was the experi- mental group (Ago2). 2.3.CellTransfections. Cellsinthelogarithmicgrowthphase were cultured with 3 ×10 cells/well. When the cells were about60–70%fused,si-SBF2-AS1 (smallinterferingRNAof 2.8. qRT-PCR. Total RNA was extracted by the TRIzol kit SBF2-AS1),miR-520a-3pinhibitor(inhibitor),miR-520a-3p (Invitrogen, USA). +e qualified RNA was selected for mimic (mimic), and their control (anti-NC or miR-NC), subsequent experiments. CDNA was synthesized using the obtained from GenePharma in Shanghai, were transfected Super Master Mix synthesis kit (TaKaRa, Japan), with 50 μg with Lipofectamine 2000 (Invitrogen, USA). After trans- total RNA as the template. qRT-PCR was performed on the fected cells were cultured for 24h, the levels of RNA were ABI 7300 System (Applied Biosystems, USA) according to detected to verify the transfection efficiency and continue the SYBR Real-Time PCR kit (TaKaRa, Japan) instructions. −ΔΔCt related experiments. 2 was used to express the relative expressions of SBF2- Journal of Healthcare Engineering 3 Table1:Primersequencesforreal-timefluorescencequantification AS1 or miR-520a-3p with U6 or GAPDH as the internal PCR. reference. Primers are given in Table 1. Gene Name Primer sequences (5′-3′) F GCACCGTCAAGGCTGAGAAC 2.9. Statistical Analysis. Data were expressed as mean±SD. GAPDH R TGGTGAAGACGCCAGTGGA Statisticalanalysisbetweentwogroupswasperformedbythe F CTCGCTTCGGCAGCACA GraphPad Prism 5.0 software. P<0.05 was indicated a U6 R AACGCTTCACGAATTTGCGT statistically significant. F CACGACCCAGAAGGAGTCTAC SBF2-AS1 R CCCGGTACCTTCCTGTCATA 3. Results F ACACTCCAGCTGGGAAAGTGCTTCCC miR-520a-3p R CTCAACTGGTGTCGT GGA 3.1. Abnormal Expression of SBF2-AS1 in NSCLC Tissues and Cells. SBF2-AS1 expression in 36 cases NSCLC tissues was detected, and its expression in NSCLC tissues was obviously groups (Figure 3(b)). Similarly results were observed in the enhanced (Figure 1(a)). At the same time, SBF2-AS1 ex- RIP experiment. Compared with the IgG group, SBF2-AS1 pression in four NSCLC lines A549, Calu-3, HCC827, and and miR-520a-3p were enriched in the Ago2 group and PC9 was increased versus 16HBE cells (Figure 1(b)). input group, and the expression of the input group was Moreover, SBF2-AS1 expression in A549 and Calu-3 cells higher than that in the Ago2 group (Figure 3(c)). It was washigherthanthatinHCC827andPC9cells(Figure1(b)). confirmed that SBF2-AS1 could interact with miR-520a-3p On the basis of above results, A549 and Calu-3 cells were through complementary binding sites. +e regulatory selected to conduct the functional experiments. relationship between SBF2-AS1 and miR-520a-3p was Based on the average expression of SBF2-AS1 (2.275) in further examined. It was found that miR-520a-3p ex- patients, they were assigned into the high SBF2-AS1 level pression was increased by SBF2-AS1 silencing, but de- groupandlow SBF2-AS1level group.+ere were18 casesin creased in the presence of SBF2-AS1 overexpressing the high expression group with average expression level of (Figure 3(d)). It proposed that SBF2-AS1 could negative SBF2-AS1 as (3.10±0.66). Eighteen cases of the low ex- regulate miR-520a-3p. pression group are with the average of (1.45±0.47). More importantly,therewasasignificantlyshorteroverallsurvival of patients who had high SBF2-AS1 expression compared to 3.4. MiR-520a-3p Was Downexpressed and Negatively Cor- low SBF2-AS1 expression (Figure 1(c)). related withSBF2-AS1 ExpressioninNSCLC. Afterclarifying the regulatory relationship between SBF2-AS1 and miR- 520a-3p, we detected miR-520a-3p expression levels in 3.2. SBF2-AS1 Knockdown Inhibits Cellular Malignancy. NSCLCtissuesandcells,respectively.ItwasfoundthatmiR- A549andCalu-3cellswereselectedforthetransfectionwith 520a-3p expression was decreased in NSCLC tissues si-SBF2-AS1 to investigate the role of SBF2-AS1 in NSCLC (Figure 4(a)). +e same expression trend was also exhibited progression. After transfection, the relative expression of in NSCLC cells (Figure 4(b)). More importantly, miR-520a- SBF2-AS1 was decreased by si-SBF2-AS1 (Figures 2(a) and 3p expression showed a significant negative correlation with 2(b)), indicating that transfection had been successful and SBF2-AS1 expression in tissues (Figure 4(c)). subsequent experiments could be performed. Cell prolif- eration was detected by CCK-8 assay. +e proliferation of A549 and Calu-3 cells was decreased after transfection with 3.5. SBF2-AS1 May Regulate NSCLC Cellular Malignancy si-SBF2-AS1, indicating that SBF2-AS1 knockdown could through miR-520a-3p. To explore whether SBF2-AS1 reg- inhibit the proliferation of NSCLC cells (Figures 2(c) and ulatedcellbiologicalbehaviorbymiR-520a-3p,si-SBF2-AS1 2(d)). Transwell experiment results are shown in and miR-520a-3pinhibitors were cotransfected into NSCLC Figures 2(e)–2(h). +e number of invaded and migrated cell. On the basis of above experiments, the miR-520a-3p A549andCalu-3cellstransfectedwithsi-SBF2-AS1wasalso inhibitor was transfected into NSCLC cells to decrease its decreased. Collectively, SBF2-AS1 silencing inhibited expression (Figure 5(a)). +en, the rescue experiment in- NSCLC cell proliferation, invasion, and migration and cluding CCK-8 and transwell assay was introduced. CCK-8 further proved that SBF2-AS1 could promote NSCLC assay revealed that the inhibition of si-SBF2-AS1 on NSCLC progression. cells proliferation was relieved by the cotransfection of the miR-520a-3p inhibitor (Figure 5(b)). In transwell assays, we 3.3. MiR-520a-3p Directly Binds to SBF2-AS1. foundthatsuppressionofmiR-520a-3pcouldreversethecell Bioinformatics analysis found that miR-520a-3p could bind migration and invasion capacities hampered by SBF2-AS1 to the complementary sequence of SBF2-AS1 (Figure 3(a)). silencing (Figures 5(c) and 5(d)). Collectively, we foundthat Later, dual-luciferase reporter experiments were used to suppression of miR-520a-3p weakened the inhibition of NSCLC cells proliferation, invasion, and migration abilities furtherexplorethetargetingrelationshipbetweenSBF2-AS1 and miR-520a-3p.+e results showed that luciferase activity caused by SBF2-AS1 knockdown, suggesting SBF2-AS1 might play a promoting role in NSCLC by targeting miR- was significantly inhibited in the presence of miR-520a-3p mimic and SBF2-AS1-wt, but there was no change of other 520a-3p. 4 Journal of Healthcare Engineering 5 2.5 P < 0.0001 ** 4 2.0 *** ** ** 3 1.5 2 1.0 1 0.5 0 0.0 Adjacent Tumor 16HBE A549 Calu-3 HCC827 PC9 (a) (b) 0 10 20 30 40 50 60 70 Months Low expression group High expression group (c) Figure 1: SBF2-AS1’s expression in NSCLC was measured by qRT-PCR. (a) SBF2-AS1 expression increased in NSCLC tissues. (b) SBF2- AS1expressionelevatedinNSCLCcells.(c)+ecorrelationbetweenSBF2-AS1expressionandoverallsurvivalofNSCLCpatientsanalyzed ∗∗ ∗∗∗ by Kaplan–Meier analysis. P<0.01, P<0.001. upregulationinhibitsproliferationandmetastasisofBCcells 4. Discussion by the regulation of CCND1 and CD44 [14]. Besides, miR- Numerous lncRNAs are dysregulated in NSCLC and reg- 520a-3p overexpression suppresses malignant biological ulated multiple biological processes through various behavior of gastric cancer cells by targeting SKA2 [15]. miRNAs and genes [6]. +erefore, the construction of Similar results have been confirmed in papillary thyroid lncRNA-mediated regulatory networks and signal pathway carcinoma (PTC); miR-520a-3p achieves the purpose of networkswillrevealthemolecularmechanismoflncRNAin suppressing tumor progression through resisting EMT and reducing cell migration and invasion capabilities by regu- NSCLC progression. Now, SBF2-AS1’s role in NSCLC was explored. lating the JAK/STAT pathway [16]. However, interactions between lncRNAs and miR-520a-3p are rarely reported in SBF2-AS1 was upregulated in multiple cancers. SBF2- AS1 overexpression accelerated cell proliferation ability in cancers. NSCLC [11]. Additionally, Zhao et al. found that SBF2-AS1 In NSCLC, miR-520a-3p as a tumor suppressor was upregulation has close relationship to NSCLC progression downregulated, and its upregulation impeded tumor pro- and poor prognosis [12]. Similarly, SBF2-AS1 was also gression by regulating MAP3K2, HOXD8, and PI3K/AKT/ upregulated in NSCLC, and its high expression brought a mTOR pathways [17–19]. What is more, HOXA-AS2, one low overall survival in this study. NSCLC cells proliferation, lncRNA,couldtargetmiR-520a-3p,thusregulatingHOXD8 migration, and invasion abilities were markedly repressed and MAP3K2 expressions to accelerate NSCLC progression after SBF2-AS1 silencing. +erefore, SBF2-AS1 may play a [20]. Bioinformatics analysis predicted that SBF2-AS1 and miR-520a-3p had binding sequence sites, and there was a carcinogenic role in NSCLC. miR-520a-3p is involved in many normal or abnormal regulatory relationship between them. Functional res- pathophysiological processes, such as cell proliferation, cue experiments indicated that SBF2-AS1 could target migration, and invasion. miR-520a-3p, as tumor suppressor miR-520a-3p and promote the proliferation, migration, of many malignant tumors, participates in the occurrence and invasion behavior of NSCLC cells, while inhibiting and development of different tumors through targeting the miR-520a-3p expression attenuated the suppression of corresponding genes. In breast cancer (BC), miR-520a-3p SBF2-AS1 silencing on NSCLC cells. Relative SBF2-AS1 expression Percent survival Relative SBF2-AS1 expression Journal of Healthcare Engineering 5 1.5 A549 1.5 Galu-3 1.0 1.0 ** ** 0.5 0.5 0.0 0.0 si-NC si-SBF2-AS1 si-NC si-SBF2-AS1 (a) (b) 1.5 A549 1.5 Galu-3 1.0 1.0 0.5 0.5 ** ** ** 0.0 0.0 0 1425 3 0 1425 3 Time (days) Time (days) si-NC si-NC si-SBF2-AS1 si-SBF2-AS1 (c) (d) 150 A549 150 Galu-3 100 100 ** ** 50 50 si-NC si-SBF2-AS1 si-NC si-SBF2-AS1 (e) (f) Figure 2: Continued. OD value Migrated cell numbers 450 Relative SBF2-AS1 expression OD value Migrated cell numbers 450 Relative SBF2-AS1 expression 6 Journal of Healthcare Engineering 150 A549 150 Galu-3 100 100 ** ** 50 50 si-NC si-SBF2-AS1 si-NC si-SBF2-AS1 (g) (h) Figure2:SBF2-AS1knockdownrepressedcellproliferation,invasion,andmigration.((a),(b))SBF2-AS1expressionmeasuredinA549and Calu-3 cells with si-SBF2-AS1 transfection. ((c), (d)) Cells proliferation detected in NSCLC cells with si-SBF2-AS1 transfection by CCK-8 assay. ((e), (f)) Transwell migration assays showed that SBF2-AS1 knockdown reduced the migration of NSCLC cells. ((g), (h)) Transwell ∗ ∗∗ invasion assays revealed that inhibition of SBF2-AS1 reduced the invasion of NSCLC cells. P<0.05, P<0.01. miR-520a-3p 3' UGUCAGGUU-UCCCUUCGUGAAA 5' 1.5 SBF2-AS1-wt 5' UAUUACUAAGAUAAAAGCACUUC 3' 1.0 SBF2-AS1-mut 5' UAUUACUAAGAUAAUUCGUGAAC 3' ** 0.5 0.0 SBF2-AS1-wt SBF2-AS1-mut miR-NC mimic (a) (b) 4 2.5 ** 2.0 ** ** 1.5 1.0 ** 0.5 0 0.0 SBF2-AS1 miR-520a-3p NC si-SBF2-AS1 pc-SBF2-AS1 IgG Ago2 Input (c) (d) Figure 3: miR-520a-3p directly binds to SBF2-AS1. (a) Binding sites of miR-520a-3p and SBF2-AS1 are presented. (b) Luciferase activity detected in NSCLC cells. (c) SBF2-AS1 and miR-520a-3p enriched by RIP assay determination. (d) +e expression of miR-520a-3p in ∗ ∗∗ NSCLC cells after transfecting si-SBF2-AS1. P<0.05, P<0.01. Relative expression Invased cell numbers Relative miR-520a-3p expression Relative luciferase activity Invased cell numbers Journal of Healthcare Engineering 7 4 1.5 P < 0.0001 1.0 ** ** ** ** 0.5 0 0.0 Adjacent Tumor 16HBE A549 Calu-3 HCC827 PC9 (a) (b) 2.5 Spearman r = -0.5395 P < 0.0001 2.0 1.5 1.0 0.5 0.0 0 1 2 345 Relative SBF2-AS1 expression (c) Figure 4: miR-520a-3p expression was reduced and negatively correlated with SBF2-AS1 expression in NSCLC. (a) miR-520a-3p was low expressed in NSCLC tissues. (b) miR-520a-3p expression reduced in NSCLC cells. (c) +e relevance of SBF2-AS1 and miR-520a-3p ∗∗ expression. P<0.01. 1.5 1.0 0.8 1.0 0.6 ** 0.4 0.5 0.2 0.0 0.0 anti-NC inhibitor 0 1423 5 Time (days) si-SBF2-AS1+anti-NC si-SBF2-AS1+inhibitor (a) (b) Figure 5: Continued. Relative miR-520a-3p expression Relative miR-520a-3p expresion Relative miR-520a-3p expression Relative miR-520a-3p expression OD value 450 8 Journal of Healthcare Engineering 100 100 80 80 60 60 40 40 20 20 0 0 si-SBF2-AS1+ si-SBF2-AS1 si-SBF2-AS1+ si-SBF2-AS1+ anti-NC +inhibitor anti-NC inhibitor (c) (d) Figure 5: miR-520a-3p reversed the SBF2-AS1 suppressive effect on cellular malignancy in NSCLC. (a) miR-520a-3p expression decreased inNSCLCcellswithmiR-520a-3pinhibitortransfection.(b)CellproliferationmeasuredinNSCLCcellsafterinhibitingbothSBF2-AS1and miR-520a-3p.(c)+e effectof SBF2-AS1knockdownonmigrationofNSCLCcellscouldbe reversedbythemiR-520a-3pinhibitor.(d)+e ∗ ∗∗ suppressing effects of si-SBF2-AS1 on the invasion of NSCLC cells rescued by the miR-520a-3p inhibitor. P<0.05, P<0.01. In summary, SBF2-AS1 regulated miR-520a-3p ex- Conflicts of Interest pression to affect the cell proliferation, invasion, and mi- +e authors declare that they have no conflicts of interest. gration ability of NSCLC. +is research confirmed a new regulatory network of NSCLC cell proliferation, migration, References and invasion and will provide corresponding theoretical for understanding the molecular mechanism of NSCLC and [1] Y. Mao, D. Yang, J. He, and M. J. Krasna, “Epidemiology of exploring new potential treatment strategies. However, the lung cancer,” Surgical Oncology Clinics, vol. 25, no. 3, collected clinical cases were not rich enough to fully dem- pp. 439–445, 2016. onstrate the close relationship between SBF2-AS1 and [2] C. Zappa and S. A. Mousa, “Non-small cell lung cancer: clinicopathological features. Moreover, we have not ex- current treatment and future advances,” Translational Lung plored the regulatory mechanism of the downstream target Cancer Research, vol. 5, no. 3, p. 288, 2016. genes or signaling pathway in SBF2-AS1. +erefore, more [3] M. Reck and K. F. Rabe, “Precision diagnosis and treatment clinical cases and experiment results (such as animal ex- for advanced non–small-cell lung cancer,” New England Journal of Medicine, vol. 377, no. 9, pp. 849–861, 2017. periments,targetgenes,andpathologicaldata)areneededto [4] K. Zarogoulidis, P. Zarogoulidis, K. Darwiche et al., “Treat- improvetheresearchandclarifythenetworkcompositionof ment of non-small cell lung cancer (NSCLC),” Journal of SBF2-AS1. oracic Disease, vol. 5, no. Suppl 4, p. S389, 2013. [5] R. S. Herbst, D. Morgensztern, and C. Boshoff, “+e biology 5. Conclusion and management of non-small cell lung cancer,” Nature, vol. 553, no. 7689, p. 446, 2018. In this study, the differential expression of SBF2-AS1 in [6] B. Ricciuti, C. Mencaroni, L. Paglialunga et al., “Long non- NSCLC tissues and cells was identified. Subsequently, it was coding RNAs: new insights into non-small cell lung cancer proved that SBF2-AS1 knockdown had a certain inhibitory biology, diagnosis and therapy,” Medical Oncology, vol. 33, effect on NSCLC cell proliferation, invasion, and migration no. 2, p. 18, 2016. [7] Y. Li, G. Liu, X. Li, H. Dong, W. Xiao, and S. Lu, “Long non- ability. +e existence of the SBF2-AS1/miR-520a-3p regu- coding RNA SBF2-AS1 promotes hepatocellular carcinoma latory pathway was identified in NSCLC. +erefore, it may progression through regulation of miR-140-5p-TGFBR1 have the potential to be a molecular targeted therapy and a pathway,” Biochemical and Biophysical Research Communi- marker to judge the prognosis of NSCLC patients, which cations, vol. 503, no. 4, pp. 2826–2832, 2018. provides a new idea for NSCLC treatment in the future. [8] R. Chen, W. Xia, X. Wang et al., “Upregulated long non- coding RNA SBF2-AS1 promotes proliferation in esophageal Data Availability squamous cell carcinoma,” Oncology Letters, vol. 15, no. 4, pp. 5071–5080, 2018. +e data used to support the findings of this study are [9] F. Gao, J. Feng, H. Yao, Y. Li, J. Xi, and J. Yang, “LncRNA available from the corresponding author upon request. SBF2-AS1 promotes the progression of cervical cancer by Migrated cell numbers Invased cell numbers Journal of Healthcare Engineering 9 regulating miR-361-5p/FOXM1 axis,” Artificial Cells, Nano- medicine, and Biotechnology, vol. 47, no.1,pp. 776–782,2019. [10] J.-H. Dai, W.-Z. Huang, C. Li, J. Deng, S.-J. Lin, and J. Luo, “Silencing of long noncoding RNA SBF2-AS1 inhibits pro- liferation, migration and invasion and contributes to apo- ptosis in osteosarcoma cells by upregulating microRNA-30a to suppress FOXA1 expression,” Cell Cycle, vol. 18, no. 20, pp. 2727–2741, 2019. [11] J. Lv, M. Qiu, W. Xia et al., “High expression of long non- coding RNA SBF2-AS1 promotes proliferation in non-small cell lung cancer,” Journal of Experimental & Clinical Cancer Research, vol. 35, no. 1, p. 75, 2016. [12] Q. Zhao, L. Li, L. Zhang et al., “Over-expression of lncRNA SBF2-AS1isassociatedwithadvancedtumorprogression and poor prognosis in patients with non-small cell lung cancer,” European Review for Medical and Pharmacological Sciences, vol. 20, no. 14, pp. 3031–3034, 2016. [13] Y. Zhang, Y. Li, L. Han, P. Zhang, and S. Sun, “SBF2-AS1: An oncogenic lncRNA in small-cell lung cancer,” Journal of Cellular Biochemistry, vol. 120, no. 9, pp. 15422–15428, 2019. [14] J.Li,J.Wei,Z.Meietal.,“SuppressingroleofmiR-520a-3pin breast cancer through CCND1 and CD44,” American Journal of Tourism Research, vol. 9, no. 1, p. 146, 2017. [15] H.Su,F.Ren,H.Jiang,Y.Chen,andX.Fan,“Upregulationof microRNA-520a-3p inhibits the proliferation, migration and invasion via spindle and kinetochore associated 2 in gastric cancer,” Oncology Letters, vol.18, no. 3, pp. 3323–3330, 2019. [16] C.L.Bi,Y.Q.Zhang,B.Li,M.Guo,andY.L.Fu,“MicroRNA- 520a-3p suppresses epithelial–mesenchymal transition, in- vasion, and migration of papillary thyroid carcinoma cells via the JAK1-mediated JAK/STATsignaling pathway,” Journal of Cellular Physiology, vol. 234, no. 4, pp. 4054–4067, 2019. [17] J. Yu, Q. Tan, B. Deng, C. Fang, D. Qi, and R. Wang, “+e microRNA-520a-3p inhibits proliferation, apoptosis and metastasis by targeting MAP3K2 in non-small cell lung cancer,” American Journal of Cancer Research, vol. 5, no. 2, p. 802, 2015. [18] Y. Liu, L. Miao, R. Ni et al., “microRNA-520a-3p inhibits proliferation and cancer stem cell phenotype by targeting HOXD8 in non-small cell lung cancer,” Oncology Reports, vol. 36, no. 6, pp. 3529–3535, 2016. [19] X. Lv, C. Li, P. Han, and X. Xu, “MicroRNA-520a-3p inhibits cell growth and metastasis of non-small cell lung cancer through PI3K/AKT/mTOR signaling pathway,” European Review for Medical and Pharmacological Sciences, vol. 22, no. 8, pp. 2321–2327, 2018. [20] Y.Liu,X.Lin,S.Zhou,P.Zhang,G.Shao,andZ.Yang,“Long noncoding RNA HOXA-AS2 promotes non-small cell lung cancer progression by regulating miR-520a-3p,” Bioscience Reports, vol. 39, no. 5, Article ID BSR20190283, 2019.
Journal
Journal of Healthcare Engineering – Hindawi Publishing Corporation
Published: Apr 11, 2022