Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

KIF20B Promotes Cell Proliferation and May Be a Potential Therapeutic Target in Pancreatic Cancer

KIF20B Promotes Cell Proliferation and May Be a Potential Therapeutic Target in Pancreatic Cancer Hindawi Journal of Oncology Volume 2021, Article ID 5572402, 11 pages https://doi.org/10.1155/2021/5572402 Research Article KIF20B Promotes Cell Proliferation and May Be a Potential Therapeutic Target in Pancreatic Cancer 1 2 3 3 4 5 Jing Chen, Cui-Cui Zhao, Fei-Ran Chen, Guo-Wei Feng, Fei Luo, and Tao Jiang Department of Pancreatic Cancer, Tianjin Medical University Cancer Institute and Hospital, Key Laboratory of Cancer Prevention and #erapy, National Clinical Research Center for Cancer, No. 24, Binshui Street, Hexi District, Tianjin 300060, China Department of VIP Ward, Key Laboratory of Cancer Prevention and #erapy, National Clinical Research Center for Cancer, Tianjin Medical University Cancer Institute and Hospital, No. 24, Binshui Street, Hexi District, Tianjin 300060, China Department of Genitourinary Oncology, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Tianjin Key Laboratory of Cancer Prevention and #erapy, Tianjin’s Clinical Research Center for Cancer, No. 24, Binshui Street, Hexi District, Tianjin 300060, China Department of Urology, Tianjin People’s Hospital, No. 190, Jieyuan Road, Hongqiao District, Tianjin 300121, China Department of General Surgery, Dongzhimen Hospital, Beijing University of Chinese Medicine, No. 5 Haiyuncang, Dongcheng District, Beijing 100700, China Correspondence should be addressed to Tao Jiang; jiangtao800213@126.com Received 10 January 2021; Revised 2 June 2021; Accepted 11 August 2021; Published 9 September 2021 Academic Editor: Sakthivel Muniyan Copyright © 2021 Jing Chen et al. )is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. KIFs have been reported to play a critical role in a variety of tumors, and KIF20B is a protein in KFIs. In this research, KIF20B was highly expressed in the GEO database and our hospital’s data, and high expression of KIF20B suggested poor prognosis. We detect the expression of KIF20B in pancreatic cancer and adjacent normal tissues using immunohistochemistry. Knockdown of KIF20B in pancreatic cancer cell lines, PANC-1 and BxPC-3 cells, inhibited cell proliferation which are detected by colony formation assays, CCK8, and western bolt of Ki-67 and PCNA. Xenograft assay showed a similar result in vivo. KIF20B is a potential therapeutic target in pancreatic cancer. 2012 [2] but ranked 4th in 2018 of cancer statistics [5]. )e 1. Introduction five-year survival rate of pancreatic cancer is less than 5% Pancreatic cancer is a highly fatal disease in which mortality [3]. In the last decades, the number of pancreatic cancer has is closely related to the incidence [1]. Most pancreatic cancer been increased in both genders [7–9]. Early diagnosis is the patients remain asymptomatic until the disease is advanced. key for improving survival. So, pancreatic cancer is one of the leading causes of fatal )e kinesin superfamily (KIF) proteins are highly disease in cancer across the world [2]. )e 5-year survival of conserved proteins with the motor domain, some of which patients with complete resection is only 25% [1]. )e main move to the plus end of the microtubule in ATP, which types of pancreatic cancer are adenocarcinoma (85%) and depends on the adenosine triphosphatase activity [10–12]. endocrine carcinoma (less than 5%) [2–4]. According to the KIF family plays an important role in many essential bio- cancer statistics in 2018, about 55,440 people suffered from logical processes, including mitosis, meiosis, and the pancreatic cancer, and pancreatic cancer causes 44,330 transport of macromolecules [13]. deaths [5]. In 2017, there were 53,670 patients with pan- Among these KIFs, KIF20B was a subset of protein creatic cancer and 43,090 patients died because of pancreatic specifically phosphorylated at G2/M transition. KIF20B th cancer [6]. Pancreatic cancer was 11 common cancer in (previously called Mphosph1 or Mpp1) is a microtubule- 2 Journal of Oncology associated protein at M-phase which plays a critical role in 2.4. Cell Lines and Cell Culture. )e human pancreatic cytokinesis. Furthermore, KIF20B has been found to play cancer cell lines, PANC-1 [17] and BxPC-3 [18], were roles in some tumors such as hepatocellular carcinoma purchased from Cell Center of Chinese Academy of Medical [14, 15], bladder cancer [16], colorectal cancer [17], and Sciences (Shanghai, China). All cell lines were authenticated breast cancer [18]. However, no study has reported the role by STR profiling and checked for the absence of myco- of KIF20B in pancreatic cancer. plasma. Both cell lines were grew in PRMI 1640 (61870-036, In GEO database and our hospital data, the conclusion Gibco, Waltham, Massachusetts, USA) supplemented with was found that the patients with high expression of KIF20B 10% fetal bovine serum (10099-141–FBS, Gibco, Waltham, had a poor prognosis. Motivated by a desire to understand Massachusetts, USA) and 1% penicillin-streptomycin so- the effect of KIF20B in pancreatic cancer, KIF20B was lution (P1410, Solarbio, Beijing, China) in 5% CO at 37 C. knockdown in pancreatic cancer cell lines. Cell proliferation was decreased during the knockdown of KIF20B in vitro and 2.5. KIF20B Knockdown and Stable Cell Lines. A lentivirus in vivo. plasmid, pll3.7, with insertion of shRNA for human KIF20B knockdown was constructed. An empty pll3.7 plasmid was 2. Materials and Methods used as a control plasmid. )e lentivirus was generated by 293T after transfection corresponding lentivirus plasmids by 2.1. Patients and Samples. Pancreatic tumor samples and lipofectamine 3000 (L3000015, )ermo, Waltham, Massa- adjacent normal tissues were collected from 90 patients in chusetts, USA). PANC-1 and BxPC-3 cells were infected Tianjin Medical University Cancer Institute and Hospital with shKIF20B lentivirus in the presence of Polybrene (5 μg/ between 2014 and 2017. )e adjacent normal tissues were ml, TR-1003, Sigma, St. Louis, Missouri, USA) for 36 hours. obtained from the margin of pancreatic tumor, >2 cm. All After that, cells were cultured with puromycin (5 μg/ml, samples were checked by pathologists as pancreatic tumors P8230, Solarbio, Beijing, China) to select positive cells until or normal tissues. )e information of patients was approved stable cell lines are formed. )e shRNA for KIF20B, by patients. )e size of the original (primary) tumor (T), AATCAGATTCATTGATTCAAGAG (Cat# SH836784, nearby (regional) lymph nodes (N), and distant metastasis Vigene Biosciences Inc, Maryland, USA), was purchased (M) was classified according to UICC TNM Classification from Vigene. (8th ed.) 2016. After surgery, samples were immediately were fixed in 10% buffered formalin or stored at −80 C until used. )is research was approved by our hospital. 2.6. Western Blot. For protein from cells, cells were washed with cold PBS three times and subsequently 200 μl RIPR containing 2 μl protease inhibitors was added into 6 wells for 2.2. Antibodies. Antibodies against KIF20B (western blot 1 : 30 min at 4 C. For protein from tissues, fresh tissues were 1000 dilution, immunohistochemistry 1 : 200 dilution, washed with cold PBS and RIPR was added to tissues in EP ab122165, Abcam, Cambridge, UK), Ki-67 (1 :1000 dilution, tubes. )en, EP tubes were moved to high throughput ab15580, Abcam, Cambridge, UK), PCNA (1 :1000 dilution, homogenization (Scientz, Ningbo, Zhejiang, China) for # 13-3900, Invitrogen, Carlsbad,USA), GAPDH (1 : 2000 1 min in 60 Hz. Lysates were centrifuged at 12000 rpm/min dilution, KM9001T, Sungen Biotech, Tianjin, China), HRP for 30 min at 4 C, and then the supernatant was moved to AffiniPure Goat Anti-Rabbit IgG (1 :10000 dilution, A21020, new Eppendorf tubes and stored at −20 C until used. 5μg AmyJet Scientific, Wuhan, China), HRP AffiniPure Goat protein and 5x SDS-PAGE loading buffer (93-2108-10, Anti-Mouse IgG (1 :10000 dilution, A0216, AmyJet Scien- MultiSciences, Hangzhou, Zhajiang, China) were added into tific, Wuhan, China). each EP tubes to 1x, heated for 5 min at 95 C. Protein was separated on 10% SDS-PAGE (P1200, Solarbio, Beijing, 2.3. Immunohistochemistry. )e antigen of sections was China) gels and then transferred into PVDF membranes retrieved by citric acid buffer in a microwave for 20 minutes (FFP19, Beyotime, Shanghai, China). Membranes were and cool down to temperature. )en, immunohistochem- washed with TBST for 15 minutes at room temperature. istry was detected according to the instructions of kit PVDF membranes were blocked with 10% milk for 1 hour at (ZsBiO, SPN-9002, Beijing, China). )e sections were room temperature. After washed, PVDF was incubated with blocked by hydrogen peroxide and serum and then incu- primary antibody overnight at 4 C in shaking table. )en, bated with primary antibodies for one night at 4 C. Sections membranes were washed for 30 minutes with TBST and were washed three times using PBS, then incubated with the incubated appropriate HRP-conjugated secondary antibody second antibody, and stained with DAB. )e results were for 1 hour at room temperature. Proteins were detected with collected under a microscope (Olympus, Tokyo, Japan). )e )ermo Scientific Pierce ECL (32106, )ermo, Waltham, scores were marked as follows: no staining, 0; slight, 1; Massachusetts, USA) after washing three times for 10 moderate, 2; and strong, 3. )e distribution of positive minutes. staining was scored for five groups: no staining, 0; <25%, 1; 26–50%, 2; 51–75%, 3; and 75–100%, 4. )e final scores were calculated by multiplying the proportion and intensity. 2.7. Extraction of Total RNA and QPCR. Total RNA from High-expression was considered as grades ≥4, and 0–3 was cells or xenograft tumor was isolated using TRIzol reagent low-expression [16]. (15596026, Invitrogen, Carlsbad, USA). 0.5 ml TRIzol was Journal of Oncology 3 5 7 4 added per 10 –10 cells to lyse the cells, and then 0.5 ml 2.12. Wound Healing Assay. 20 ×10 cells were seeded into 6 isopropanol was added to the aqueous phase, incubated for wells and incubated for 24 h. )en, the cells were scratched 10 minutes, and centrifuged for 10 minutes at 12,000g at 4 C. with 100 μl pipette tip, and dead cells were removed with )e supernatant was discarded, and 1ml 75% ethanol was PBS. After 48 h, cells were fixed and stained with crystal added to wash pellet and centrifuged for 5 minutes at 7500 g violet. at 4 C. Resuspend the RNA in 30 μl RNase-free water after drying the RNA pellet for 5 minutes. For cDNA reverse 2.13. In Vivo Experiments. All mouse research studies were transcription using RevertAid First Strand cDNA Synthesis approved by our hospital. Nude BalB/c mice (6–8 weeks, Kit (K1621, )ermo, Waltham, Massachusetts, USA), qRT- 18–22 g) were purchased from Beijing Vital River Labora- PCR was analyzed using GoTaq qPCR Master Mix (A6001, tory Animal Technology Co., Ltd. (Beijing, China). For Promega, Madison, Wisconsin, USA). Data were calculated xenografted tumor model, 5 × 10 PANC-1 cells or knock- using CT values of all samples and standards based on down KIF20B were collected in 150 μl PBS and injected into housekeeping gene GAPDH. )e relative expression of −ΔΔCT BABL/c nude mice. After tumor formation (day 14), the KIF20B was analyzed using the 2 method [19]. Primers tumor length and width were measured every 3 days, and the for KIF20B and GAPDH are listed as follows. volume of tumor was calculated using KIF20B, forward primer: 5′TGCTGAAAG- V � 0.5 × length × width [22]. All mice were sacrificed 29 ACCCTCAAAGCATCCT-3′, reverse primer: 5′AC- days after injection and removed to photograph. Xeno- TGGACTGGTCACAACTGTTCACG [20]-3′ grafted tumors were fixed using 4% formaldehyde for im- munohistochemistry assays. GAPDH, forward primer: 5′-GGT GGT CTC CTC TGA CTT CAA CA-3′, reverse primer: 5′-GTT GCT GTA GCC AAA TTC GTT GT-3′ [21] 2.14. Statistical Analysis. Data were analyzed with SPSS 22.0 software (SPSS Inc, IBM Corp, Armonk, NY). For the 2.8. Cell Colony Formation Assay. 1,000 cells were seeded immunohistochemistry experiments, associations between into 6 wells with PRMI 1640 + 10% FBS and incubated in 5% KIF20B expression and the clinicopathological features were CO at 37 C for 14 days. )e complete culture medium was evaluated using chi tests. Associations of survival and tu- changed every 3 days. Cells were fixed with 4% parafor- mor progression and KIF20B expression were estimated by maldehyde for 30 minutes and stained with methylene blue Kaplan–Meier method and log-rank tests. Data are shown as after washing three times using PBS. )e results were the mean± standard deviation (SD) in vitro and in vivo photographed and counted using ImageJ software. experiments on PANC-1 and BxPC-3 cells, and student’s t- test was used for statistical comparisons. A value of P< 0.05 was set to be statistically significant. 2.9.CCK8AssayforCellProliferation. PANC-1, BxPC-3, and knockdown KIF20B cells were collected at log-growth phase 3. Results and seeded into 96 wells, 3000 cells/well, with 100 μl PRMI 1640 containing 10% FBS, 1% penicillin-streptomycin so- 3.1. High Expression of KIF20B Suggests Poor Prognosis in lution in 5% CO at 37 C. After 48 h, 10 μl CCK8 solution Pancreatic Cancer. In previous research studies, KIF20B has (96002, Sigma, St. Louis, Missouri, USA) was added into been found to play an important role in multiple tumors, such each well and incubated 4 hours with cells in 5% CO at 37 C. as breast cancer, bladder cancer [23, 24], and hepatocellular )en, absorbance values (OD) were collected using a carcinoma [15]. However, there was not a report of KIF20B microplate reader. All experiments were repeated three expression between pancreatic cancer and adjacent normal times. tissue. Firstly, the expression of KIF20B and prognosis in pancreatic cancer was analyzed in GEO database. Obviously, high expression of KIF20B was found in pancreatic cancer 2.10. Flow Cytometry. Cell cycle assay was performed (n � 179) contrasted with adjacent normal tissues (n � 171, according the manufacturer’s instructions. In brief, cells Figure 1(a)). 178 patients with pancreatic adenocarcinoma were fixed with 70% ethanol overnight, and then cells were were divided into two groups (89 patients with high ex- resuspended in 500 μl FACS buffer with 100 μg/ml RNase A, pression of KIF20B and 89 patients with low expression of 50 μg/ml PI. )en, the data were analyzed by ModFit KIF20B ) in this database. According to this cohort, patients software. For cell apoptosis, 10 living cells were stained by with a high expression of KIF20B suffered low overall survival FITC Annexin V Apoptosis Detection Kit with PI (640914, (OS) and disease-free survival (DFS) (Figures 1(b) and 1(c)). Biolegend, San Diego, California, USA) in 500 μl FACS )ese GEO data suggested that KIF20B had high expression buffer and analyzed by BD FC500 flow cytometry. and correlated with poor prognosis. 2.11. Migration Assay. 5 × 10 cells were seeded into the top chambers of transwell plates with FBS-free PRMI-1640, and 3.2. High KIF20B Is Positively Correlated with Poor Prognosis 600 μl complete medium was added into the lower cham- in Samples from Our Hospital. To clarify pancreatic cancer in bers. Cells were incubated for 36h, fixed with 75% ethanol, which KIF20B was highly expressed, we assessed the ex- and stained with crystal violet. pression of KIF20B in primary pancreatic cancer in our own 4 Journal of Oncology * Overall Survival Disease Free Survival 3.0 1.0 1.0 Logrank p=0.0058 Logrank p=0.02 2.5 HR (high)=1.8 HR (high)=1.7 0.8 0.8 p (HR)=0.0066 p (HR)=0.022 n (high)=89 n (high)=89 2.0 n (low)=89 n (low)=89 0.6 0.6 1.5 0.4 0.4 1.0 0.2 0.2 0.5 0.0 0.0 0.0 020 40 60 80 0 20406080 Months Months PAAD Low KIF20B TPM Low KIF20B TPM High KIF20B TPM High KIF20B TPM (a) (b) (c) Figure 1: High expression of KIF20B is negatively correlated with prognosis in pancreatic cancer. (a) KIF20B overexpression in pancreatic cancer in GEO database. (b) Disease-free survival from GEO database with different expression levels of KIF20B. (c) Overall survival from GEO database. Student’s t test ( P< 0.05). Table 1: Relationships of KIF20B and clinicopathological char- specimens using immunohistochemistry and collected pa- acteristics in 90 patients with pancreatic ductal adenocarcinoma. tient’s information such as, KIF20B expression, age, gender, TNM stage, tumor grade and size, lymph node metastasis, and KIF20B vascular invasion (Table 1). KIF20B has different expression expression Feature All, n � 90 χ P levels in different pancreatic ductal adenocarcinoma speci- Low High mens (N � 90). We further examined the expression of n � 46 n � 44 KIF20B in adjacent normal tissues and found that KIF20B has Age (year) 2.401 0.121 low expression in normal tissues compared with pancreatic <55 54 24 30 cancer (Figures 2(a) and 2(b)). Combined with patient in- ≥55 36 22 14 formation, the expression level of KIF20B was higher in high Gender 1.076 0.300 TNM stage, lymph node metastasis, or vascular invasion. Male 50 28 22 KFI20B expression was not correlated with age, gender, tu- Female 40 18 22 pTNM stage 4.804 0.028 mor grade, and tumor size in our specimens. I 26 18 8 II-III 64 28 36 Tumor grade 2.277 0.131 3.3. KIF20B Knockdown via Lentivirus-Mediated shRNA in Low 40 24 16 Different Human Pancreatic Cancer Cell Lines. To further High 50 22 28 investigate the effect of KIF20B in pancreatic cancer, we Tumor size 2.823 0.093 knockdown KIF20B via lentivirus-mediated shRNA in hu- <5 28 18 10 man pancreatic cancer cell lines, PANC-1 and BxPC-3. ≥5 62 28 34 Firstly, we constructed lentivirus shRNA plasmids, PLL3.7- Lymph node 5.359 0.021 shKIF20B, and then packed lentivirus using 293T cells. metastasis KIF20B mRNA expression was detected using QPCR in Yes 38 14 24 PANC-1 cells after KIF20B knockdown via lentivirus-me- No 52 32 20 Vascular invasion 5.471 0.019 diated shRNA, and the expression level was obviously lower Yes 34 12 22 than the control cell. BxPC-3 cell had a similar result No 56 34 22 (Figure 3(a)). Additionally, protein expression level of KIF20B was detected in PANC-1 and BxPC-3 cell lines using western blotting. Consistent with mRNA expression, the significantly decreased compared with control cells protein of KIF20B was decreased (Figure 3(b)). (Figure 4(a)). )e result was repeated in PANC-1 cell and BxPC-3 cell. In CCK8 cell proliferation assay, cell prolif- 3.4. KIF20B Knockdown Inhibited Proliferation in Human eration in PANC-1 with KIF20B knockdown was lower than Pancreatic Cancer Cell Lines. Considering that high ex- sh-control cell in PANC-1 cells. Similar results were ob- pression level of KIF20B was associated with lymph node tained from BxPC-3 cells (Figure 4(b)). Ki-67 [26, 27] and metastasis and vascular invasion, the effects of KIF20B were PCNA [28, 29] were protein markers for cell proliferation, so reported in other research studies [14, 23, 25]. )rough cell we detected the expression level of Ki-67 and PCNA by clonal formation, the growth rate of knockdown KIF20B western blotting to evaluate cell proliferation. Proliferation Percent survival Percent survival Journal of Oncology 5 Low High (a) (b) 100 100 80 80 60 60 40 40 20 20 0 0 0 10 20 30 0 10 20 Survival time aer surgery (months) Survival time aer surgery (months) KIF20B high KIF20B high KIF20B low KIF20B low (c) (d) Figure 2: KIF20B is highly expressed in samples from hospital. (a) Representative pictures in immunohistochemical staining of KIF20B in pancreatic cancer. (b) Representative pictures in immunohistochemistry of KIF20B in adjacent normal tissues. (c, d) Overall survival rate and relapse-free survival rate in pancreatic cancer patients with high/low KIF20B. Student’s t-test ( P< 0.05). markers, KI67 and PCNA, were decreased in knockdown expression level of KIF20B in xenograft, wester blotting was KIF20B cell lines (Figures 4(c) and 4(d)). From those data, a used to detect KIF20B. Xenograft with shKIF20B had low expression level (Figure 5(b)), and the result was similar with conclusion can be obtained that KIF20B promotes cell proliferation in human pancreatic cancer cell lines. To ex- immunohistochemistry assay (Figure 5(c)). tend our findings that depletion of KIF20B inhibited cell proliferation, cell cycle assay was performed with scramble 4. Discussion cells and shKIF20B cells, and the results showed that de- pletion of KIF20B induced cell cycle arrest in S/G2 Pancreatic cancer is a poor prognosis disease, and five-year (Figure 4(e)). However, knockdown KIF20B does not impair survival of which is as low as 2% in some countries, despite cell migration and cell apoptosis (Supplement Figure 1). the surgical technique is improving [30]. Pancreatic cancer has increased by 1.03% per year in 1973 to 2014 [31], and it is 3.5.KIF20BKnockdownInhibitsPancreaticXenograftGrowth predicted that pancreatic cancer will become the 2nd leading In Vivo. In in vitro research studies, we observed that cause of cancer-related deaths in America by 2030 [6, 32]. knockdown KIF20B reduced cell proliferation via cell clonal Pancreatic cancer has caused a serious financial burden on formation and proliferation protein markers. To further society. evaluate the effects of KIF20B against pancreatic cancer, In recent years, kinesin as a potential new target for subcutaneous PANC-1 cell xenograft model was used. cancer has caused great concern [11, 33]. KIF family was 5 × 10 cells were injected subcutaneously into the armpit of reported to play a critical role in many solid cancers, such as mice, and tumor volume was calculated every 3 days after 14 prostate cancer [34], breast cancer [35], and esophageal days. )ese mice were sacrificed in 29 days. As shown in squamous cell carcinoma [36]. It has been reported that Figure 5(a), the growth of xenograft with KIF20B knockdown KIF20B was upregulated in human cancer and promoted cell is slower than control xenograft. In order to identify the proliferation, but there was no research in pancreatic cancer. Overall survival rate (%) Relapse-free survival rate (%) 6 Journal of Oncology PANC-1 BxPC-3 1.5 1.5 * * 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (a) KIF20B KIF20B β-actin β-actin PANC-1 BxPC-3 1.5 1.5 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (b) Figure 3: KIF20B knockdown via lentivirus-mediated shRNA in different human pancreatic cancer cell lines. (a) QPCR was conducted on control cell and knockdown cell for KIF20B mRNA expression in PANC-1 and BxPC-3 cell lines. (b) Protein expression was detected using western blotting in control cell and KIF20B knockdown cell (up: representative image of western blotting; down: quantification of KIF20B). Student’s t-test ( P< 0.05). PANC-1 BxPC-3 250 * * control shRNA PANC-1 BxPC-3 control shRNA (a) Figure 4: Continued. Relative expression Relative expression Colony number Relative expression Relative expression Journal of Oncology 7 PANC-1 BxPC-3 1.5 1.5 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (b) Ki67 Ki67 β-actin β-actin PANC-1 BxPC-3 1.5 1.5 * * 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (c) PCNA PCNA β-actin β-actin PANC-1 BxPC-3 1.5 1.5 * * 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (d) Figure 4: Continued. Cell proliferation PCNA relative expression Ki67 relative expression PCNA relative expression Ki67 relative expression Cell proliferation 8 Journal of Oncology PANC-1 BxPC-3 80 * Diploid: 100.00 % 60 Diploid: 100.00 % Dip G1: 42.77 % at 73.34 Dip G1: 41.75% at 69.92 270 Dip G2: 0.85 % at 146.67 Dip G2: 2.58% at 139.84 400 Dip S: 56.38% G2/G1: 2.00 Control Dip S: 55.67% G2/G1: 2.00 40 200 20 0 0 0 40 80 120 180 200 0 40 80 120 180 200 G1 S/G2 Channel (FL3 Lin-FL3 Lin) Channel (FL3 Lin-FL3 Lin) PANC-1 Debris Dip G2 Debris Dip G2 Control Aggregates Aggregates Dip S Dip S shRNA Dip G1 Dip G1 320 Diploid: 100.00 % Diploid: 100.00 % Dip G1: 29.73 % at 68.50 Dip G1: 28.42 % at 68.02 Dip G2: 12.51% at 137.00 Dip G2: 15.01 % at 136.03 Dip S: 57.76% G2/G1: 2.00 Dip S: 56.57% G2/G1: 2.00 shRNA 0 0 0 0 40 80 120 180 200 0 40 80 120 180 200 G1 S/G2 Channel (FL3 Lin-FL3 Lin) Channel (FL3 Lin-FL3 Lin) BxPC-3 Debris Dip G2 Debris Dip G2 Control Aggregates Aggregates Dip S Dip S shRNA Dip G1 Dip G1 (e) Figure 4: )e KIF20B knockdown decreased proliferation in human pancreatic cancer cell lines. (a) Representative picture and quan- tification of clonal formation in control and knockdown cell lines. (b) Cell proliferation was detected using CCK8. (c, d) Cell proliferation markers, Ki-67 and PCNA, and expression level in control cell and KIF20B knockdown cell. (e) Cell cycle in control cell and KIF20B knockdown cell. Student’s t-test ( P< 0.05). control shRNA 14 17 21 23 26 29 days control shRNA (a) Figure 5: Continued. Number Number Tumor volume (mm ) Number Number Cell cycle (%) Cell cycle (%) Journal of Oncology 9 1.5 1.5 PCNA * * 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (b) (c) Figure 5: )e KIF20B knockdown inhibits pancreatic xenograft growth in vivo. (a) )e tumor growth-curve of tumor volume according to time in control or knockdown groups (left). Representative picture of tumor in 29 days (right). n � 5. (b) KIF20B protein expression in xenograft tumor. (c) KIF20B protein expression was detected using immunohistochemistry. Representative pictures of immunohisto- chemistry in xenograft tumor (up). Quantification of expression in xenograft tumor (down). Student’s t-test ( P< 0.05). Firstly, the GEO database and our data were analyzed, and carcinoma cells by stabilizing P53, blocked STAT3 phos- phorylation, and prolonged mitotic arrest. In addition, we found that the expression of KIF20B was negatively correlated with overall survival. In our data, patients with antitumor effect-combined knockdown of KIF20B and taxol was better than taxol alone [14, 15, 25]. high expression of KIF20B had a higher pTNM state, lymph node metastasis, and vascular invasion (P< 0.05). )is was Totally, this was the first research to demonstrate that similar with Liu et al.’s research that KIF20B was overex- KIF20B was upregulated in pancreatic cancer and connected pressed in hepatocellular carcinoma and it is essential for with poor prognosis. KIF20B knockdown inhibited cell proliferation [14]. Similarly, KIF20B was overexpressed in proliferation in vitro and in vivo. KIF20B may be a new human colorectal cancer and promoted epithelia-mesen- potential therapeutic target in pancreatic cancer. chymal transition (EMT) [25]. To investigate the role of KIF20B in pancreatic cancer, Data Availability KIF20B was knockdown in pancreatic cancer cell lines, )e dataset supporting the conclusions of this article are PANC-1 and BxPC-3 cells. QPCR and western blotting were included within the article. used for detecting mRNA and protein expression after adding lentivirus-shKIF20B to cells. )en, cell colony for- Ethical Approval mation assay and CCK8 assay detected cell proliferation. Results showed that cell proliferation has a positive corre- All applicable international, national, and/or institutional lation with KIF20B expression level. KI67 and PCNA, a guidelines for the care and use of human specimens and protein proliferation marker, assays showed similar results. animals were followed. )e animal study was carried out in However, Supplement Figure 1 showed that shKIF20B in accordance with the guidelines approved by the Animal PANC-1 and BxPC-3 had no effect on cell migration, wound Experimentation Ethics Committee of Tianjin Medical healing, and cell apoptosis. University Cancer Institute and Hospital. )e protocol was KIFs, including 45 KIFs with varying functions and 14 approved by the Committee, all surgery was performed subfamilies, were discovered in human [37–39]. However, all under sodium pentobarbital anesthesia, and all efforts were of them have a highly conserved motor domain that binds to made to minimize suffering. microtubules. KIFs have a common function in chromosomes transport during mitosis [10]. So, misregulation of KIF20B Conflicts of Interest may contribute to tumorigenesis. Knockdown of KIF20B leaded to mitotic arrest, which decreased cell proliferation )e authors declare that they have no conflicts of interest. [24, 40]. Similarly, tumor growth was slower in xenograft with knocking down KIF20B in PANC-1 cells in vivo. Authors’ Contributions In previous research studies, KIF20B can be used as a potential therapeutic target for a variety of tumors and JC and CZ carried out the experiment of molecular biology return the sensitivity of microtubule-targeting agents after and drafted the manuscript. FC carried out the animal inhibiting the expression of KIF20B. Liu et al. showed that experiment. JC, GF, and FL participated in the design of the KIF20B knockdown inhibited proliferation of hepatocellular study and performed the statistical analysis. TJ conceived of KIF20B relative expression PCNA relative expression 10 Journal of Oncology [12] Y. Yu and Y.-M. Feng, “)e role of kinesin family proteins in the study and participated in its design and coordination and tumorigenesis and progression,” Cancer, vol. 116, no. 22, helped to draft the manuscript. All authors read and ap- pp. 5150–5160, 2010. proved the final manuscript. Jing Chen, Cui-Cui Zhao, and [13] A. Abaza, J.-M. Soleilhac, J. Westendorf et al., “M phase Fei-Ran Chen contributed equally to this study. phosphoprotein 1 is a human plus-end-directed kinesin-re- lated protein required for cytokinesis,” Journal of Biological Acknowledgments Chemistry, vol. 278, no. 30, pp. 27844–27852, 2003. [14] X. Liu, Y. Zhou, X. Liu et al., “MPHOSPH1: a potential )is work was supported by the National Natural Science therapeutic target for hepatocellular carcinoma,” Cancer Foundation of China (Grant nos. 81401957, 81701840, and Research, vol. 74, no. 22, pp. 6623–6634, 2014. 81702534). )e authors thank the clinician/pathologist and [15] X. Liu, Y. Li, X. Zhang et al., “Inhibition of kinesin family statistician who belonged to Tianjin Medical University member 20B sensitizes hepatocellular carcinoma cell to mi- Cancer Institute and Hospital. crotubule-targeting agents by blocking cytokinesis,” Cancer Science, vol. 109, no. 11, pp. 3450–3460, 2018. [16] F. Varghese, A. B. Bukhari, R. Malhotra, and A. De, “IHC Supplementary Materials Profiler: an open source plugin for the quantitative evaluation and automated scoring of immunohistochemistry images of Supplement Figure 1. sh-KIF20B in PANC-1 and BxPC-3 human tissue samples,” PLoS One, vol. 9, no. 5, Article ID had no effect on cell migration, wound healing, and cell e96801, 2014. apoptosis. (A–C) Migration, wound healing, and cell apo- [17] M.-C. Wu, G. K. Arimura, and A. A. Yunis, “Mechanism of ptosis in control cell and KIF20B knockdown cell. (Sup- sensitivity of cultured pancreatic carcinoma to asparaginase,” plementary Materials) International Journal of Cancer, vol. 22, no. 6, pp. 728–733, [18] M. S. Lan, M. A. Hollingsworth, and R. S. Metzgar, “Poly- References peptide core of a human pancreatic tumor mucin antigen,” [1] R. Siegel, J. Ma, Z. Zou, and A. Jemal, “Cancer statistics, 2014,” Cancer Research, vol. 50, pp. 2997–3001, 1990. CA: A Cancer Journal for Clinicians, vol. 64, no. 1, pp. 9–29, [19] K. J. Livak and T. D. Schmittgen, “Analysis of relative gene expression data using real-time quantitative PCR and the −ΔΔCT [2] J. Ferlay, I. Soerjomataram, R. Dikshit et al., “Cancer inci- 2 method,” Methods, vol. 25, no. 4, pp. 402–408, 2001. dence and mortality worldwide: sources, methods and major [20] K. C. McNeely, T. D. Cupp, J. N. Little, K. M. Janisch, patterns in GLOBOCAN 2012,” International Journal of A. Shrestha, and N. D. Dwyer, “Mutation of Kinesin-6 Kif20b Cancer, vol. 136, no. 5, pp. E359–E386, 2015. causes defects in cortical neuron polarization and morpho- [3] M. Hidalgo, S. Cascinu, J. Kleeff et al., “Addressing the genesis,” Neural Development, vol. 12, no. 1, p. 5, 2017. challenges of pancreatic cancer: future directions for im- [21] X. Wang, X. Ji, J. Chen et al., “SOX2 enhances the migration proving outcomes,” Pancreatology, vol. 15, no. 1, pp. 8–18, and invasion of ovarian cancer cells via Src kinase,” PLoS One, vol. 9, no. 6, Article ID e99594, 2014. [4] A. Vincent, J. Herman, R. Schulick, R. H. Hruban, and [22] S. Naito, A. C. von Eschenbach, R. Giavazzi, and I. J. Fidler, M. Goggins, “Pancreatic cancer,” #e Lancet, vol. 378, “Growth and metastasis of tumor cells isolated from a human no. 9791, pp. 607–620, 2011. renal cell carcinoma implanted into different organs of nude [5] R. L. Siegel, K. D. Miller, and A. Jemal, “Cancer statistics, mice,” Cancer Research, vol. 46, pp. 4109–4115, 1986. 2018,” CA: A Cancer Journal for Clinicians, vol. 68, no. 1, [23] M. Kanehira, T. Katagiri, A. Shimo et al., “Oncogenic role of pp. 7–30, 2018. MPHOSPH1, a cancer-testis antigen specific to human [6] R. L. Siegel, K. D. Miller, and A. Jemal, “Cancer statistics, bladder cancer,” Cancer Research, vol. 67, no. 7, 2017,” CA: A Cancer Journal for Clinicians, vol. 67, no. 1, pp. 3276–3285, 2007. pp. 7–30, 2017. [24] X.-R. Liu, Y. Cai, X. Cao et al., “A new oncolytic adenoviral [7] L. Wang, G. H. Yang, X. H. Lu, Z. J. Huang, and H. Li, vector carrying dual tumour suppressor genes shows potent “Pancreatic cancer mortality in China (1991-2000),” World anti-tumour effect,” Journal of Cellular and Molecular Med- Journal of Gastroenterology, vol. 9, no. 8, pp. 1819–1823, 2003. icine, vol. 16, no. 6, pp. 1298–1309, 2012. [8] D. Qiu, K. Katanoda, T. Marugame, and T. Sobue, “A Join- [25] W.-F. Lin, X.-L. Lin, S.-W. Fu et al., “Pseudopod-associated point regression analysis of long-term trends in cancer protein KIF20B promotes Gli1-induced epithelial-mesen- mortality in Japan (1958–2004),” International Journal of chymal transition modulated by pseudopodial actin dynamic Cancer, vol. 124, no. 2, pp. 443–448, 2009. in human colorectal cancer,” Molecular Carcinogenesis, [9] M. Malvezzi, G. Carioli, P. Bertuccio et al., “European cancer vol. 57, no. 7, pp. 911–925, 2018. mortality predictions for the year 2016 with focus on leu- [26] Z. Darzynkiewicz, H. Zhao, S. Zhang, M. Y. W. T. Lee, kaemias,” Annals of Oncology, vol. 27, no. 4, pp. 725–731, E. Y. C. Lee, and Z. Zhang, “Initiation and termination of DNA replication during S phase in relation to cyclins D1, E [10] R. J. Diefenbach, J. P. Mackay, P. J. Armati, and and A, p21WAF1, Cdt1 and the p12 subunit of DNA poly- A. L. Cunningham, “)e C-terminal region of the stalk do- merase δ revealed in individual cells by cytometry,” Onco- main of ubiquitous human kinesin heavy chain contains the target, vol. 6, no. 14, pp. 11735–11750, 2015. binding site for kinesin light chain,” Biochemistry, vol. 37, [27] K. M. Janisch, K. C. McNeely, J. M. Dardick, S. H. Lim, and no. 47, pp. 16663–16670, 1998. [11] X. Liu, H. Gong, and K. Huang, “Oncogenic role of kinesin N. D. Dwyer, “Kinesin-6 KIF20B is required for efficient cytokinetic furrowing and timely abscission in human cells,” proteins and targeting kinesin therapy,” Cancer Science, vol. 104, no. 6, pp. 651–656, 2013. Molecular Biology of the Cell, vol. 29, no. 2, pp. 166–179, 2018. Journal of Oncology 11 [28] A. Alahmad, K.-D. Preuss, J. Schenk et al., “Desmoplakin and KIF20B as target antigens in patients with paroxysmal noc- turnal haemoglobinuria,” British Journal of Haematology, vol. 151, no. 3, pp. 273–280, 2010. [29] R. Bologna-Molina, A. Mosqueda-Taylor, N. Molina-Fre- chero, A. Mori-Estevez, and G. Sanchez-Acuna, “Comparison of the value of PCNA and Ki-67 as markers of cell prolif- eration in ameloblastic tumors,” Medicina Oral, Patolog´ıa Oral y Cirug´ıa Bucal, vol. 18, pp. e174–e179, 2013. [30] A. McGuigan, P. Kelly, R. C. Turkington, C. Jones, H. G. Coleman, and R. S. McCain, “Pancreatic cancer: a review of clinical diagnosis, epidemiology, treatment and outcomes,” World Journal of Gastroenterology, vol. 24, no. 43, pp. 4846–4861, 2018. [31] A. M. Saad, T. Turk, M. J. Al-Husseini, and O. Abdel-Rahman, “Trends in pancreatic adenocarcinoma incidence and mor- tality in the United States in the last four decades; a SEER- based study,” BMC Cancer, vol. 18, no. 1, p. 688, 2018. [32] L. Rahib, B. D. Smith, R. Aizenberg, A. B. Rosenzweig, J. M. Fleshman, and L. M. Matrisian, “Projecting cancer in- cidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States,” Cancer Research, vol. 74, no. 11, pp. 2913–2921, 2014. [33] O. Rath and F. Kozielski, “Kinesins and cancer,” Nature Reviews Cancer, vol. 12, no. 8, pp. 527–539, 2012. [34] H. Gao, X. Chen, Q. Cai, Z. Shang, and Y. Niu, “Increased KIF4A expression is a potential prognostic factor in prostate cancer,” Oncology Letters, vol. 15, pp. 7941–7947, 2018. [35] A. J. Lucanus and G. W. Yip, “Kinesin superfamily: roles in breast cancer, patient prognosis and therapeutics,” Oncogene, vol. 37, no. 7, pp. 833–838, 2018. [36] H. Duan, X. Zhang, F.-X. Wang et al., “KIF-2C expression is correlated with poor prognosis of operable esophageal squamous cell carcinoma male patients,” Oncotarget, vol. 7, no. 49, pp. 80493–80507, 2016. [37] H. Aizawa, Y. Sekine, R. Takemura, Z. Zhang, M. Nangaku, and N. Hirokawa, “Kinesin family in murine central nervous system,” Journal of Cell Biology, vol. 119, no. 5, pp. 1287–1296, 1992. [38] C. J. Lawrence, R. K. Dawe, K. R. Christie et al., “A stan- dardized kinesin nomenclature,” Journal of Cell Biology, vol. 167, no. 1, pp. 19–22, 2004. [39] H. Miki, M. Setou, K. Kaneshiro, and N. Hirokawa, “All kinesin superfamily protein, KIF, genes in mouse and hu- man,” Proceedings of the National Academy of Sciences, vol. 98, no. 13, pp. 7004–7011, 2001. [40] A. Castillo, H. C. Morse 3rd, V. L. Godfrey, R. Naeem, and M. J. Justice, “Overexpression of Eg5 causes genomic insta- bility and tumor formation in mice,” Cancer Research, vol. 67, no. 21, pp. 10138–10147, 2007. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Oncology Hindawi Publishing Corporation

KIF20B Promotes Cell Proliferation and May Be a Potential Therapeutic Target in Pancreatic Cancer

Download PDF
11 pages

Loading next page...
 
/lp/hindawi-publishing-corporation/kif20b-promotes-cell-proliferation-and-may-be-a-potential-therapeutic-B3pFHz0OJ0

References (44)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2021 Jing Chen et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8450
eISSN
1687-8469
DOI
10.1155/2021/5572402
Publisher site
See Article on Publisher Site

Abstract

Hindawi Journal of Oncology Volume 2021, Article ID 5572402, 11 pages https://doi.org/10.1155/2021/5572402 Research Article KIF20B Promotes Cell Proliferation and May Be a Potential Therapeutic Target in Pancreatic Cancer 1 2 3 3 4 5 Jing Chen, Cui-Cui Zhao, Fei-Ran Chen, Guo-Wei Feng, Fei Luo, and Tao Jiang Department of Pancreatic Cancer, Tianjin Medical University Cancer Institute and Hospital, Key Laboratory of Cancer Prevention and #erapy, National Clinical Research Center for Cancer, No. 24, Binshui Street, Hexi District, Tianjin 300060, China Department of VIP Ward, Key Laboratory of Cancer Prevention and #erapy, National Clinical Research Center for Cancer, Tianjin Medical University Cancer Institute and Hospital, No. 24, Binshui Street, Hexi District, Tianjin 300060, China Department of Genitourinary Oncology, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Tianjin Key Laboratory of Cancer Prevention and #erapy, Tianjin’s Clinical Research Center for Cancer, No. 24, Binshui Street, Hexi District, Tianjin 300060, China Department of Urology, Tianjin People’s Hospital, No. 190, Jieyuan Road, Hongqiao District, Tianjin 300121, China Department of General Surgery, Dongzhimen Hospital, Beijing University of Chinese Medicine, No. 5 Haiyuncang, Dongcheng District, Beijing 100700, China Correspondence should be addressed to Tao Jiang; jiangtao800213@126.com Received 10 January 2021; Revised 2 June 2021; Accepted 11 August 2021; Published 9 September 2021 Academic Editor: Sakthivel Muniyan Copyright © 2021 Jing Chen et al. )is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. KIFs have been reported to play a critical role in a variety of tumors, and KIF20B is a protein in KFIs. In this research, KIF20B was highly expressed in the GEO database and our hospital’s data, and high expression of KIF20B suggested poor prognosis. We detect the expression of KIF20B in pancreatic cancer and adjacent normal tissues using immunohistochemistry. Knockdown of KIF20B in pancreatic cancer cell lines, PANC-1 and BxPC-3 cells, inhibited cell proliferation which are detected by colony formation assays, CCK8, and western bolt of Ki-67 and PCNA. Xenograft assay showed a similar result in vivo. KIF20B is a potential therapeutic target in pancreatic cancer. 2012 [2] but ranked 4th in 2018 of cancer statistics [5]. )e 1. Introduction five-year survival rate of pancreatic cancer is less than 5% Pancreatic cancer is a highly fatal disease in which mortality [3]. In the last decades, the number of pancreatic cancer has is closely related to the incidence [1]. Most pancreatic cancer been increased in both genders [7–9]. Early diagnosis is the patients remain asymptomatic until the disease is advanced. key for improving survival. So, pancreatic cancer is one of the leading causes of fatal )e kinesin superfamily (KIF) proteins are highly disease in cancer across the world [2]. )e 5-year survival of conserved proteins with the motor domain, some of which patients with complete resection is only 25% [1]. )e main move to the plus end of the microtubule in ATP, which types of pancreatic cancer are adenocarcinoma (85%) and depends on the adenosine triphosphatase activity [10–12]. endocrine carcinoma (less than 5%) [2–4]. According to the KIF family plays an important role in many essential bio- cancer statistics in 2018, about 55,440 people suffered from logical processes, including mitosis, meiosis, and the pancreatic cancer, and pancreatic cancer causes 44,330 transport of macromolecules [13]. deaths [5]. In 2017, there were 53,670 patients with pan- Among these KIFs, KIF20B was a subset of protein creatic cancer and 43,090 patients died because of pancreatic specifically phosphorylated at G2/M transition. KIF20B th cancer [6]. Pancreatic cancer was 11 common cancer in (previously called Mphosph1 or Mpp1) is a microtubule- 2 Journal of Oncology associated protein at M-phase which plays a critical role in 2.4. Cell Lines and Cell Culture. )e human pancreatic cytokinesis. Furthermore, KIF20B has been found to play cancer cell lines, PANC-1 [17] and BxPC-3 [18], were roles in some tumors such as hepatocellular carcinoma purchased from Cell Center of Chinese Academy of Medical [14, 15], bladder cancer [16], colorectal cancer [17], and Sciences (Shanghai, China). All cell lines were authenticated breast cancer [18]. However, no study has reported the role by STR profiling and checked for the absence of myco- of KIF20B in pancreatic cancer. plasma. Both cell lines were grew in PRMI 1640 (61870-036, In GEO database and our hospital data, the conclusion Gibco, Waltham, Massachusetts, USA) supplemented with was found that the patients with high expression of KIF20B 10% fetal bovine serum (10099-141–FBS, Gibco, Waltham, had a poor prognosis. Motivated by a desire to understand Massachusetts, USA) and 1% penicillin-streptomycin so- the effect of KIF20B in pancreatic cancer, KIF20B was lution (P1410, Solarbio, Beijing, China) in 5% CO at 37 C. knockdown in pancreatic cancer cell lines. Cell proliferation was decreased during the knockdown of KIF20B in vitro and 2.5. KIF20B Knockdown and Stable Cell Lines. A lentivirus in vivo. plasmid, pll3.7, with insertion of shRNA for human KIF20B knockdown was constructed. An empty pll3.7 plasmid was 2. Materials and Methods used as a control plasmid. )e lentivirus was generated by 293T after transfection corresponding lentivirus plasmids by 2.1. Patients and Samples. Pancreatic tumor samples and lipofectamine 3000 (L3000015, )ermo, Waltham, Massa- adjacent normal tissues were collected from 90 patients in chusetts, USA). PANC-1 and BxPC-3 cells were infected Tianjin Medical University Cancer Institute and Hospital with shKIF20B lentivirus in the presence of Polybrene (5 μg/ between 2014 and 2017. )e adjacent normal tissues were ml, TR-1003, Sigma, St. Louis, Missouri, USA) for 36 hours. obtained from the margin of pancreatic tumor, >2 cm. All After that, cells were cultured with puromycin (5 μg/ml, samples were checked by pathologists as pancreatic tumors P8230, Solarbio, Beijing, China) to select positive cells until or normal tissues. )e information of patients was approved stable cell lines are formed. )e shRNA for KIF20B, by patients. )e size of the original (primary) tumor (T), AATCAGATTCATTGATTCAAGAG (Cat# SH836784, nearby (regional) lymph nodes (N), and distant metastasis Vigene Biosciences Inc, Maryland, USA), was purchased (M) was classified according to UICC TNM Classification from Vigene. (8th ed.) 2016. After surgery, samples were immediately were fixed in 10% buffered formalin or stored at −80 C until used. )is research was approved by our hospital. 2.6. Western Blot. For protein from cells, cells were washed with cold PBS three times and subsequently 200 μl RIPR containing 2 μl protease inhibitors was added into 6 wells for 2.2. Antibodies. Antibodies against KIF20B (western blot 1 : 30 min at 4 C. For protein from tissues, fresh tissues were 1000 dilution, immunohistochemistry 1 : 200 dilution, washed with cold PBS and RIPR was added to tissues in EP ab122165, Abcam, Cambridge, UK), Ki-67 (1 :1000 dilution, tubes. )en, EP tubes were moved to high throughput ab15580, Abcam, Cambridge, UK), PCNA (1 :1000 dilution, homogenization (Scientz, Ningbo, Zhejiang, China) for # 13-3900, Invitrogen, Carlsbad,USA), GAPDH (1 : 2000 1 min in 60 Hz. Lysates were centrifuged at 12000 rpm/min dilution, KM9001T, Sungen Biotech, Tianjin, China), HRP for 30 min at 4 C, and then the supernatant was moved to AffiniPure Goat Anti-Rabbit IgG (1 :10000 dilution, A21020, new Eppendorf tubes and stored at −20 C until used. 5μg AmyJet Scientific, Wuhan, China), HRP AffiniPure Goat protein and 5x SDS-PAGE loading buffer (93-2108-10, Anti-Mouse IgG (1 :10000 dilution, A0216, AmyJet Scien- MultiSciences, Hangzhou, Zhajiang, China) were added into tific, Wuhan, China). each EP tubes to 1x, heated for 5 min at 95 C. Protein was separated on 10% SDS-PAGE (P1200, Solarbio, Beijing, 2.3. Immunohistochemistry. )e antigen of sections was China) gels and then transferred into PVDF membranes retrieved by citric acid buffer in a microwave for 20 minutes (FFP19, Beyotime, Shanghai, China). Membranes were and cool down to temperature. )en, immunohistochem- washed with TBST for 15 minutes at room temperature. istry was detected according to the instructions of kit PVDF membranes were blocked with 10% milk for 1 hour at (ZsBiO, SPN-9002, Beijing, China). )e sections were room temperature. After washed, PVDF was incubated with blocked by hydrogen peroxide and serum and then incu- primary antibody overnight at 4 C in shaking table. )en, bated with primary antibodies for one night at 4 C. Sections membranes were washed for 30 minutes with TBST and were washed three times using PBS, then incubated with the incubated appropriate HRP-conjugated secondary antibody second antibody, and stained with DAB. )e results were for 1 hour at room temperature. Proteins were detected with collected under a microscope (Olympus, Tokyo, Japan). )e )ermo Scientific Pierce ECL (32106, )ermo, Waltham, scores were marked as follows: no staining, 0; slight, 1; Massachusetts, USA) after washing three times for 10 moderate, 2; and strong, 3. )e distribution of positive minutes. staining was scored for five groups: no staining, 0; <25%, 1; 26–50%, 2; 51–75%, 3; and 75–100%, 4. )e final scores were calculated by multiplying the proportion and intensity. 2.7. Extraction of Total RNA and QPCR. Total RNA from High-expression was considered as grades ≥4, and 0–3 was cells or xenograft tumor was isolated using TRIzol reagent low-expression [16]. (15596026, Invitrogen, Carlsbad, USA). 0.5 ml TRIzol was Journal of Oncology 3 5 7 4 added per 10 –10 cells to lyse the cells, and then 0.5 ml 2.12. Wound Healing Assay. 20 ×10 cells were seeded into 6 isopropanol was added to the aqueous phase, incubated for wells and incubated for 24 h. )en, the cells were scratched 10 minutes, and centrifuged for 10 minutes at 12,000g at 4 C. with 100 μl pipette tip, and dead cells were removed with )e supernatant was discarded, and 1ml 75% ethanol was PBS. After 48 h, cells were fixed and stained with crystal added to wash pellet and centrifuged for 5 minutes at 7500 g violet. at 4 C. Resuspend the RNA in 30 μl RNase-free water after drying the RNA pellet for 5 minutes. For cDNA reverse 2.13. In Vivo Experiments. All mouse research studies were transcription using RevertAid First Strand cDNA Synthesis approved by our hospital. Nude BalB/c mice (6–8 weeks, Kit (K1621, )ermo, Waltham, Massachusetts, USA), qRT- 18–22 g) were purchased from Beijing Vital River Labora- PCR was analyzed using GoTaq qPCR Master Mix (A6001, tory Animal Technology Co., Ltd. (Beijing, China). For Promega, Madison, Wisconsin, USA). Data were calculated xenografted tumor model, 5 × 10 PANC-1 cells or knock- using CT values of all samples and standards based on down KIF20B were collected in 150 μl PBS and injected into housekeeping gene GAPDH. )e relative expression of −ΔΔCT BABL/c nude mice. After tumor formation (day 14), the KIF20B was analyzed using the 2 method [19]. Primers tumor length and width were measured every 3 days, and the for KIF20B and GAPDH are listed as follows. volume of tumor was calculated using KIF20B, forward primer: 5′TGCTGAAAG- V � 0.5 × length × width [22]. All mice were sacrificed 29 ACCCTCAAAGCATCCT-3′, reverse primer: 5′AC- days after injection and removed to photograph. Xeno- TGGACTGGTCACAACTGTTCACG [20]-3′ grafted tumors were fixed using 4% formaldehyde for im- munohistochemistry assays. GAPDH, forward primer: 5′-GGT GGT CTC CTC TGA CTT CAA CA-3′, reverse primer: 5′-GTT GCT GTA GCC AAA TTC GTT GT-3′ [21] 2.14. Statistical Analysis. Data were analyzed with SPSS 22.0 software (SPSS Inc, IBM Corp, Armonk, NY). For the 2.8. Cell Colony Formation Assay. 1,000 cells were seeded immunohistochemistry experiments, associations between into 6 wells with PRMI 1640 + 10% FBS and incubated in 5% KIF20B expression and the clinicopathological features were CO at 37 C for 14 days. )e complete culture medium was evaluated using chi tests. Associations of survival and tu- changed every 3 days. Cells were fixed with 4% parafor- mor progression and KIF20B expression were estimated by maldehyde for 30 minutes and stained with methylene blue Kaplan–Meier method and log-rank tests. Data are shown as after washing three times using PBS. )e results were the mean± standard deviation (SD) in vitro and in vivo photographed and counted using ImageJ software. experiments on PANC-1 and BxPC-3 cells, and student’s t- test was used for statistical comparisons. A value of P< 0.05 was set to be statistically significant. 2.9.CCK8AssayforCellProliferation. PANC-1, BxPC-3, and knockdown KIF20B cells were collected at log-growth phase 3. Results and seeded into 96 wells, 3000 cells/well, with 100 μl PRMI 1640 containing 10% FBS, 1% penicillin-streptomycin so- 3.1. High Expression of KIF20B Suggests Poor Prognosis in lution in 5% CO at 37 C. After 48 h, 10 μl CCK8 solution Pancreatic Cancer. In previous research studies, KIF20B has (96002, Sigma, St. Louis, Missouri, USA) was added into been found to play an important role in multiple tumors, such each well and incubated 4 hours with cells in 5% CO at 37 C. as breast cancer, bladder cancer [23, 24], and hepatocellular )en, absorbance values (OD) were collected using a carcinoma [15]. However, there was not a report of KIF20B microplate reader. All experiments were repeated three expression between pancreatic cancer and adjacent normal times. tissue. Firstly, the expression of KIF20B and prognosis in pancreatic cancer was analyzed in GEO database. Obviously, high expression of KIF20B was found in pancreatic cancer 2.10. Flow Cytometry. Cell cycle assay was performed (n � 179) contrasted with adjacent normal tissues (n � 171, according the manufacturer’s instructions. In brief, cells Figure 1(a)). 178 patients with pancreatic adenocarcinoma were fixed with 70% ethanol overnight, and then cells were were divided into two groups (89 patients with high ex- resuspended in 500 μl FACS buffer with 100 μg/ml RNase A, pression of KIF20B and 89 patients with low expression of 50 μg/ml PI. )en, the data were analyzed by ModFit KIF20B ) in this database. According to this cohort, patients software. For cell apoptosis, 10 living cells were stained by with a high expression of KIF20B suffered low overall survival FITC Annexin V Apoptosis Detection Kit with PI (640914, (OS) and disease-free survival (DFS) (Figures 1(b) and 1(c)). Biolegend, San Diego, California, USA) in 500 μl FACS )ese GEO data suggested that KIF20B had high expression buffer and analyzed by BD FC500 flow cytometry. and correlated with poor prognosis. 2.11. Migration Assay. 5 × 10 cells were seeded into the top chambers of transwell plates with FBS-free PRMI-1640, and 3.2. High KIF20B Is Positively Correlated with Poor Prognosis 600 μl complete medium was added into the lower cham- in Samples from Our Hospital. To clarify pancreatic cancer in bers. Cells were incubated for 36h, fixed with 75% ethanol, which KIF20B was highly expressed, we assessed the ex- and stained with crystal violet. pression of KIF20B in primary pancreatic cancer in our own 4 Journal of Oncology * Overall Survival Disease Free Survival 3.0 1.0 1.0 Logrank p=0.0058 Logrank p=0.02 2.5 HR (high)=1.8 HR (high)=1.7 0.8 0.8 p (HR)=0.0066 p (HR)=0.022 n (high)=89 n (high)=89 2.0 n (low)=89 n (low)=89 0.6 0.6 1.5 0.4 0.4 1.0 0.2 0.2 0.5 0.0 0.0 0.0 020 40 60 80 0 20406080 Months Months PAAD Low KIF20B TPM Low KIF20B TPM High KIF20B TPM High KIF20B TPM (a) (b) (c) Figure 1: High expression of KIF20B is negatively correlated with prognosis in pancreatic cancer. (a) KIF20B overexpression in pancreatic cancer in GEO database. (b) Disease-free survival from GEO database with different expression levels of KIF20B. (c) Overall survival from GEO database. Student’s t test ( P< 0.05). Table 1: Relationships of KIF20B and clinicopathological char- specimens using immunohistochemistry and collected pa- acteristics in 90 patients with pancreatic ductal adenocarcinoma. tient’s information such as, KIF20B expression, age, gender, TNM stage, tumor grade and size, lymph node metastasis, and KIF20B vascular invasion (Table 1). KIF20B has different expression expression Feature All, n � 90 χ P levels in different pancreatic ductal adenocarcinoma speci- Low High mens (N � 90). We further examined the expression of n � 46 n � 44 KIF20B in adjacent normal tissues and found that KIF20B has Age (year) 2.401 0.121 low expression in normal tissues compared with pancreatic <55 54 24 30 cancer (Figures 2(a) and 2(b)). Combined with patient in- ≥55 36 22 14 formation, the expression level of KIF20B was higher in high Gender 1.076 0.300 TNM stage, lymph node metastasis, or vascular invasion. Male 50 28 22 KFI20B expression was not correlated with age, gender, tu- Female 40 18 22 pTNM stage 4.804 0.028 mor grade, and tumor size in our specimens. I 26 18 8 II-III 64 28 36 Tumor grade 2.277 0.131 3.3. KIF20B Knockdown via Lentivirus-Mediated shRNA in Low 40 24 16 Different Human Pancreatic Cancer Cell Lines. To further High 50 22 28 investigate the effect of KIF20B in pancreatic cancer, we Tumor size 2.823 0.093 knockdown KIF20B via lentivirus-mediated shRNA in hu- <5 28 18 10 man pancreatic cancer cell lines, PANC-1 and BxPC-3. ≥5 62 28 34 Firstly, we constructed lentivirus shRNA plasmids, PLL3.7- Lymph node 5.359 0.021 shKIF20B, and then packed lentivirus using 293T cells. metastasis KIF20B mRNA expression was detected using QPCR in Yes 38 14 24 PANC-1 cells after KIF20B knockdown via lentivirus-me- No 52 32 20 Vascular invasion 5.471 0.019 diated shRNA, and the expression level was obviously lower Yes 34 12 22 than the control cell. BxPC-3 cell had a similar result No 56 34 22 (Figure 3(a)). Additionally, protein expression level of KIF20B was detected in PANC-1 and BxPC-3 cell lines using western blotting. Consistent with mRNA expression, the significantly decreased compared with control cells protein of KIF20B was decreased (Figure 3(b)). (Figure 4(a)). )e result was repeated in PANC-1 cell and BxPC-3 cell. In CCK8 cell proliferation assay, cell prolif- 3.4. KIF20B Knockdown Inhibited Proliferation in Human eration in PANC-1 with KIF20B knockdown was lower than Pancreatic Cancer Cell Lines. Considering that high ex- sh-control cell in PANC-1 cells. Similar results were ob- pression level of KIF20B was associated with lymph node tained from BxPC-3 cells (Figure 4(b)). Ki-67 [26, 27] and metastasis and vascular invasion, the effects of KIF20B were PCNA [28, 29] were protein markers for cell proliferation, so reported in other research studies [14, 23, 25]. )rough cell we detected the expression level of Ki-67 and PCNA by clonal formation, the growth rate of knockdown KIF20B western blotting to evaluate cell proliferation. Proliferation Percent survival Percent survival Journal of Oncology 5 Low High (a) (b) 100 100 80 80 60 60 40 40 20 20 0 0 0 10 20 30 0 10 20 Survival time aer surgery (months) Survival time aer surgery (months) KIF20B high KIF20B high KIF20B low KIF20B low (c) (d) Figure 2: KIF20B is highly expressed in samples from hospital. (a) Representative pictures in immunohistochemical staining of KIF20B in pancreatic cancer. (b) Representative pictures in immunohistochemistry of KIF20B in adjacent normal tissues. (c, d) Overall survival rate and relapse-free survival rate in pancreatic cancer patients with high/low KIF20B. Student’s t-test ( P< 0.05). markers, KI67 and PCNA, were decreased in knockdown expression level of KIF20B in xenograft, wester blotting was KIF20B cell lines (Figures 4(c) and 4(d)). From those data, a used to detect KIF20B. Xenograft with shKIF20B had low expression level (Figure 5(b)), and the result was similar with conclusion can be obtained that KIF20B promotes cell proliferation in human pancreatic cancer cell lines. To ex- immunohistochemistry assay (Figure 5(c)). tend our findings that depletion of KIF20B inhibited cell proliferation, cell cycle assay was performed with scramble 4. Discussion cells and shKIF20B cells, and the results showed that de- pletion of KIF20B induced cell cycle arrest in S/G2 Pancreatic cancer is a poor prognosis disease, and five-year (Figure 4(e)). However, knockdown KIF20B does not impair survival of which is as low as 2% in some countries, despite cell migration and cell apoptosis (Supplement Figure 1). the surgical technique is improving [30]. Pancreatic cancer has increased by 1.03% per year in 1973 to 2014 [31], and it is 3.5.KIF20BKnockdownInhibitsPancreaticXenograftGrowth predicted that pancreatic cancer will become the 2nd leading In Vivo. In in vitro research studies, we observed that cause of cancer-related deaths in America by 2030 [6, 32]. knockdown KIF20B reduced cell proliferation via cell clonal Pancreatic cancer has caused a serious financial burden on formation and proliferation protein markers. To further society. evaluate the effects of KIF20B against pancreatic cancer, In recent years, kinesin as a potential new target for subcutaneous PANC-1 cell xenograft model was used. cancer has caused great concern [11, 33]. KIF family was 5 × 10 cells were injected subcutaneously into the armpit of reported to play a critical role in many solid cancers, such as mice, and tumor volume was calculated every 3 days after 14 prostate cancer [34], breast cancer [35], and esophageal days. )ese mice were sacrificed in 29 days. As shown in squamous cell carcinoma [36]. It has been reported that Figure 5(a), the growth of xenograft with KIF20B knockdown KIF20B was upregulated in human cancer and promoted cell is slower than control xenograft. In order to identify the proliferation, but there was no research in pancreatic cancer. Overall survival rate (%) Relapse-free survival rate (%) 6 Journal of Oncology PANC-1 BxPC-3 1.5 1.5 * * 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (a) KIF20B KIF20B β-actin β-actin PANC-1 BxPC-3 1.5 1.5 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (b) Figure 3: KIF20B knockdown via lentivirus-mediated shRNA in different human pancreatic cancer cell lines. (a) QPCR was conducted on control cell and knockdown cell for KIF20B mRNA expression in PANC-1 and BxPC-3 cell lines. (b) Protein expression was detected using western blotting in control cell and KIF20B knockdown cell (up: representative image of western blotting; down: quantification of KIF20B). Student’s t-test ( P< 0.05). PANC-1 BxPC-3 250 * * control shRNA PANC-1 BxPC-3 control shRNA (a) Figure 4: Continued. Relative expression Relative expression Colony number Relative expression Relative expression Journal of Oncology 7 PANC-1 BxPC-3 1.5 1.5 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (b) Ki67 Ki67 β-actin β-actin PANC-1 BxPC-3 1.5 1.5 * * 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (c) PCNA PCNA β-actin β-actin PANC-1 BxPC-3 1.5 1.5 * * 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (d) Figure 4: Continued. Cell proliferation PCNA relative expression Ki67 relative expression PCNA relative expression Ki67 relative expression Cell proliferation 8 Journal of Oncology PANC-1 BxPC-3 80 * Diploid: 100.00 % 60 Diploid: 100.00 % Dip G1: 42.77 % at 73.34 Dip G1: 41.75% at 69.92 270 Dip G2: 0.85 % at 146.67 Dip G2: 2.58% at 139.84 400 Dip S: 56.38% G2/G1: 2.00 Control Dip S: 55.67% G2/G1: 2.00 40 200 20 0 0 0 40 80 120 180 200 0 40 80 120 180 200 G1 S/G2 Channel (FL3 Lin-FL3 Lin) Channel (FL3 Lin-FL3 Lin) PANC-1 Debris Dip G2 Debris Dip G2 Control Aggregates Aggregates Dip S Dip S shRNA Dip G1 Dip G1 320 Diploid: 100.00 % Diploid: 100.00 % Dip G1: 29.73 % at 68.50 Dip G1: 28.42 % at 68.02 Dip G2: 12.51% at 137.00 Dip G2: 15.01 % at 136.03 Dip S: 57.76% G2/G1: 2.00 Dip S: 56.57% G2/G1: 2.00 shRNA 0 0 0 0 40 80 120 180 200 0 40 80 120 180 200 G1 S/G2 Channel (FL3 Lin-FL3 Lin) Channel (FL3 Lin-FL3 Lin) BxPC-3 Debris Dip G2 Debris Dip G2 Control Aggregates Aggregates Dip S Dip S shRNA Dip G1 Dip G1 (e) Figure 4: )e KIF20B knockdown decreased proliferation in human pancreatic cancer cell lines. (a) Representative picture and quan- tification of clonal formation in control and knockdown cell lines. (b) Cell proliferation was detected using CCK8. (c, d) Cell proliferation markers, Ki-67 and PCNA, and expression level in control cell and KIF20B knockdown cell. (e) Cell cycle in control cell and KIF20B knockdown cell. Student’s t-test ( P< 0.05). control shRNA 14 17 21 23 26 29 days control shRNA (a) Figure 5: Continued. Number Number Tumor volume (mm ) Number Number Cell cycle (%) Cell cycle (%) Journal of Oncology 9 1.5 1.5 PCNA * * 1.0 1.0 0.5 0.5 0.0 0.0 control shRNA control shRNA (b) (c) Figure 5: )e KIF20B knockdown inhibits pancreatic xenograft growth in vivo. (a) )e tumor growth-curve of tumor volume according to time in control or knockdown groups (left). Representative picture of tumor in 29 days (right). n � 5. (b) KIF20B protein expression in xenograft tumor. (c) KIF20B protein expression was detected using immunohistochemistry. Representative pictures of immunohisto- chemistry in xenograft tumor (up). Quantification of expression in xenograft tumor (down). Student’s t-test ( P< 0.05). Firstly, the GEO database and our data were analyzed, and carcinoma cells by stabilizing P53, blocked STAT3 phos- phorylation, and prolonged mitotic arrest. In addition, we found that the expression of KIF20B was negatively correlated with overall survival. In our data, patients with antitumor effect-combined knockdown of KIF20B and taxol was better than taxol alone [14, 15, 25]. high expression of KIF20B had a higher pTNM state, lymph node metastasis, and vascular invasion (P< 0.05). )is was Totally, this was the first research to demonstrate that similar with Liu et al.’s research that KIF20B was overex- KIF20B was upregulated in pancreatic cancer and connected pressed in hepatocellular carcinoma and it is essential for with poor prognosis. KIF20B knockdown inhibited cell proliferation [14]. Similarly, KIF20B was overexpressed in proliferation in vitro and in vivo. KIF20B may be a new human colorectal cancer and promoted epithelia-mesen- potential therapeutic target in pancreatic cancer. chymal transition (EMT) [25]. To investigate the role of KIF20B in pancreatic cancer, Data Availability KIF20B was knockdown in pancreatic cancer cell lines, )e dataset supporting the conclusions of this article are PANC-1 and BxPC-3 cells. QPCR and western blotting were included within the article. used for detecting mRNA and protein expression after adding lentivirus-shKIF20B to cells. )en, cell colony for- Ethical Approval mation assay and CCK8 assay detected cell proliferation. Results showed that cell proliferation has a positive corre- All applicable international, national, and/or institutional lation with KIF20B expression level. KI67 and PCNA, a guidelines for the care and use of human specimens and protein proliferation marker, assays showed similar results. animals were followed. )e animal study was carried out in However, Supplement Figure 1 showed that shKIF20B in accordance with the guidelines approved by the Animal PANC-1 and BxPC-3 had no effect on cell migration, wound Experimentation Ethics Committee of Tianjin Medical healing, and cell apoptosis. University Cancer Institute and Hospital. )e protocol was KIFs, including 45 KIFs with varying functions and 14 approved by the Committee, all surgery was performed subfamilies, were discovered in human [37–39]. However, all under sodium pentobarbital anesthesia, and all efforts were of them have a highly conserved motor domain that binds to made to minimize suffering. microtubules. KIFs have a common function in chromosomes transport during mitosis [10]. So, misregulation of KIF20B Conflicts of Interest may contribute to tumorigenesis. Knockdown of KIF20B leaded to mitotic arrest, which decreased cell proliferation )e authors declare that they have no conflicts of interest. [24, 40]. Similarly, tumor growth was slower in xenograft with knocking down KIF20B in PANC-1 cells in vivo. Authors’ Contributions In previous research studies, KIF20B can be used as a potential therapeutic target for a variety of tumors and JC and CZ carried out the experiment of molecular biology return the sensitivity of microtubule-targeting agents after and drafted the manuscript. FC carried out the animal inhibiting the expression of KIF20B. Liu et al. showed that experiment. JC, GF, and FL participated in the design of the KIF20B knockdown inhibited proliferation of hepatocellular study and performed the statistical analysis. TJ conceived of KIF20B relative expression PCNA relative expression 10 Journal of Oncology [12] Y. Yu and Y.-M. Feng, “)e role of kinesin family proteins in the study and participated in its design and coordination and tumorigenesis and progression,” Cancer, vol. 116, no. 22, helped to draft the manuscript. All authors read and ap- pp. 5150–5160, 2010. proved the final manuscript. Jing Chen, Cui-Cui Zhao, and [13] A. Abaza, J.-M. Soleilhac, J. Westendorf et al., “M phase Fei-Ran Chen contributed equally to this study. phosphoprotein 1 is a human plus-end-directed kinesin-re- lated protein required for cytokinesis,” Journal of Biological Acknowledgments Chemistry, vol. 278, no. 30, pp. 27844–27852, 2003. [14] X. Liu, Y. Zhou, X. Liu et al., “MPHOSPH1: a potential )is work was supported by the National Natural Science therapeutic target for hepatocellular carcinoma,” Cancer Foundation of China (Grant nos. 81401957, 81701840, and Research, vol. 74, no. 22, pp. 6623–6634, 2014. 81702534). )e authors thank the clinician/pathologist and [15] X. Liu, Y. Li, X. Zhang et al., “Inhibition of kinesin family statistician who belonged to Tianjin Medical University member 20B sensitizes hepatocellular carcinoma cell to mi- Cancer Institute and Hospital. crotubule-targeting agents by blocking cytokinesis,” Cancer Science, vol. 109, no. 11, pp. 3450–3460, 2018. [16] F. Varghese, A. B. Bukhari, R. Malhotra, and A. De, “IHC Supplementary Materials Profiler: an open source plugin for the quantitative evaluation and automated scoring of immunohistochemistry images of Supplement Figure 1. sh-KIF20B in PANC-1 and BxPC-3 human tissue samples,” PLoS One, vol. 9, no. 5, Article ID had no effect on cell migration, wound healing, and cell e96801, 2014. apoptosis. (A–C) Migration, wound healing, and cell apo- [17] M.-C. Wu, G. K. Arimura, and A. A. Yunis, “Mechanism of ptosis in control cell and KIF20B knockdown cell. (Sup- sensitivity of cultured pancreatic carcinoma to asparaginase,” plementary Materials) International Journal of Cancer, vol. 22, no. 6, pp. 728–733, [18] M. S. Lan, M. A. Hollingsworth, and R. S. Metzgar, “Poly- References peptide core of a human pancreatic tumor mucin antigen,” [1] R. Siegel, J. Ma, Z. Zou, and A. Jemal, “Cancer statistics, 2014,” Cancer Research, vol. 50, pp. 2997–3001, 1990. CA: A Cancer Journal for Clinicians, vol. 64, no. 1, pp. 9–29, [19] K. J. Livak and T. D. Schmittgen, “Analysis of relative gene expression data using real-time quantitative PCR and the −ΔΔCT [2] J. Ferlay, I. Soerjomataram, R. Dikshit et al., “Cancer inci- 2 method,” Methods, vol. 25, no. 4, pp. 402–408, 2001. dence and mortality worldwide: sources, methods and major [20] K. C. McNeely, T. D. Cupp, J. N. Little, K. M. Janisch, patterns in GLOBOCAN 2012,” International Journal of A. Shrestha, and N. D. Dwyer, “Mutation of Kinesin-6 Kif20b Cancer, vol. 136, no. 5, pp. E359–E386, 2015. causes defects in cortical neuron polarization and morpho- [3] M. Hidalgo, S. Cascinu, J. Kleeff et al., “Addressing the genesis,” Neural Development, vol. 12, no. 1, p. 5, 2017. challenges of pancreatic cancer: future directions for im- [21] X. Wang, X. Ji, J. Chen et al., “SOX2 enhances the migration proving outcomes,” Pancreatology, vol. 15, no. 1, pp. 8–18, and invasion of ovarian cancer cells via Src kinase,” PLoS One, vol. 9, no. 6, Article ID e99594, 2014. [4] A. Vincent, J. Herman, R. Schulick, R. H. Hruban, and [22] S. Naito, A. C. von Eschenbach, R. Giavazzi, and I. J. Fidler, M. Goggins, “Pancreatic cancer,” #e Lancet, vol. 378, “Growth and metastasis of tumor cells isolated from a human no. 9791, pp. 607–620, 2011. renal cell carcinoma implanted into different organs of nude [5] R. L. Siegel, K. D. Miller, and A. Jemal, “Cancer statistics, mice,” Cancer Research, vol. 46, pp. 4109–4115, 1986. 2018,” CA: A Cancer Journal for Clinicians, vol. 68, no. 1, [23] M. Kanehira, T. Katagiri, A. Shimo et al., “Oncogenic role of pp. 7–30, 2018. MPHOSPH1, a cancer-testis antigen specific to human [6] R. L. Siegel, K. D. Miller, and A. Jemal, “Cancer statistics, bladder cancer,” Cancer Research, vol. 67, no. 7, 2017,” CA: A Cancer Journal for Clinicians, vol. 67, no. 1, pp. 3276–3285, 2007. pp. 7–30, 2017. [24] X.-R. Liu, Y. Cai, X. Cao et al., “A new oncolytic adenoviral [7] L. Wang, G. H. Yang, X. H. Lu, Z. J. Huang, and H. Li, vector carrying dual tumour suppressor genes shows potent “Pancreatic cancer mortality in China (1991-2000),” World anti-tumour effect,” Journal of Cellular and Molecular Med- Journal of Gastroenterology, vol. 9, no. 8, pp. 1819–1823, 2003. icine, vol. 16, no. 6, pp. 1298–1309, 2012. [8] D. Qiu, K. Katanoda, T. Marugame, and T. Sobue, “A Join- [25] W.-F. Lin, X.-L. Lin, S.-W. Fu et al., “Pseudopod-associated point regression analysis of long-term trends in cancer protein KIF20B promotes Gli1-induced epithelial-mesen- mortality in Japan (1958–2004),” International Journal of chymal transition modulated by pseudopodial actin dynamic Cancer, vol. 124, no. 2, pp. 443–448, 2009. in human colorectal cancer,” Molecular Carcinogenesis, [9] M. Malvezzi, G. Carioli, P. Bertuccio et al., “European cancer vol. 57, no. 7, pp. 911–925, 2018. mortality predictions for the year 2016 with focus on leu- [26] Z. Darzynkiewicz, H. Zhao, S. Zhang, M. Y. W. T. Lee, kaemias,” Annals of Oncology, vol. 27, no. 4, pp. 725–731, E. Y. C. Lee, and Z. Zhang, “Initiation and termination of DNA replication during S phase in relation to cyclins D1, E [10] R. J. Diefenbach, J. P. Mackay, P. J. Armati, and and A, p21WAF1, Cdt1 and the p12 subunit of DNA poly- A. L. Cunningham, “)e C-terminal region of the stalk do- merase δ revealed in individual cells by cytometry,” Onco- main of ubiquitous human kinesin heavy chain contains the target, vol. 6, no. 14, pp. 11735–11750, 2015. binding site for kinesin light chain,” Biochemistry, vol. 37, [27] K. M. Janisch, K. C. McNeely, J. M. Dardick, S. H. Lim, and no. 47, pp. 16663–16670, 1998. [11] X. Liu, H. Gong, and K. Huang, “Oncogenic role of kinesin N. D. Dwyer, “Kinesin-6 KIF20B is required for efficient cytokinetic furrowing and timely abscission in human cells,” proteins and targeting kinesin therapy,” Cancer Science, vol. 104, no. 6, pp. 651–656, 2013. Molecular Biology of the Cell, vol. 29, no. 2, pp. 166–179, 2018. Journal of Oncology 11 [28] A. Alahmad, K.-D. Preuss, J. Schenk et al., “Desmoplakin and KIF20B as target antigens in patients with paroxysmal noc- turnal haemoglobinuria,” British Journal of Haematology, vol. 151, no. 3, pp. 273–280, 2010. [29] R. Bologna-Molina, A. Mosqueda-Taylor, N. Molina-Fre- chero, A. Mori-Estevez, and G. Sanchez-Acuna, “Comparison of the value of PCNA and Ki-67 as markers of cell prolif- eration in ameloblastic tumors,” Medicina Oral, Patolog´ıa Oral y Cirug´ıa Bucal, vol. 18, pp. e174–e179, 2013. [30] A. McGuigan, P. Kelly, R. C. Turkington, C. Jones, H. G. Coleman, and R. S. McCain, “Pancreatic cancer: a review of clinical diagnosis, epidemiology, treatment and outcomes,” World Journal of Gastroenterology, vol. 24, no. 43, pp. 4846–4861, 2018. [31] A. M. Saad, T. Turk, M. J. Al-Husseini, and O. Abdel-Rahman, “Trends in pancreatic adenocarcinoma incidence and mor- tality in the United States in the last four decades; a SEER- based study,” BMC Cancer, vol. 18, no. 1, p. 688, 2018. [32] L. Rahib, B. D. Smith, R. Aizenberg, A. B. Rosenzweig, J. M. Fleshman, and L. M. Matrisian, “Projecting cancer in- cidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States,” Cancer Research, vol. 74, no. 11, pp. 2913–2921, 2014. [33] O. Rath and F. Kozielski, “Kinesins and cancer,” Nature Reviews Cancer, vol. 12, no. 8, pp. 527–539, 2012. [34] H. Gao, X. Chen, Q. Cai, Z. Shang, and Y. Niu, “Increased KIF4A expression is a potential prognostic factor in prostate cancer,” Oncology Letters, vol. 15, pp. 7941–7947, 2018. [35] A. J. Lucanus and G. W. Yip, “Kinesin superfamily: roles in breast cancer, patient prognosis and therapeutics,” Oncogene, vol. 37, no. 7, pp. 833–838, 2018. [36] H. Duan, X. Zhang, F.-X. Wang et al., “KIF-2C expression is correlated with poor prognosis of operable esophageal squamous cell carcinoma male patients,” Oncotarget, vol. 7, no. 49, pp. 80493–80507, 2016. [37] H. Aizawa, Y. Sekine, R. Takemura, Z. Zhang, M. Nangaku, and N. Hirokawa, “Kinesin family in murine central nervous system,” Journal of Cell Biology, vol. 119, no. 5, pp. 1287–1296, 1992. [38] C. J. Lawrence, R. K. Dawe, K. R. Christie et al., “A stan- dardized kinesin nomenclature,” Journal of Cell Biology, vol. 167, no. 1, pp. 19–22, 2004. [39] H. Miki, M. Setou, K. Kaneshiro, and N. Hirokawa, “All kinesin superfamily protein, KIF, genes in mouse and hu- man,” Proceedings of the National Academy of Sciences, vol. 98, no. 13, pp. 7004–7011, 2001. [40] A. Castillo, H. C. Morse 3rd, V. L. Godfrey, R. Naeem, and M. J. Justice, “Overexpression of Eg5 causes genomic insta- bility and tumor formation in mice,” Cancer Research, vol. 67, no. 21, pp. 10138–10147, 2007.

Journal

Journal of Oncology – Hindawi Publishing Corporation

Published: Sep 9, 2021

There are no references for this article.