Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder

Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and... Hindawi Publishing Corporation Autism Research and Treatment Volume 2012, Article ID 724072, 5 pages doi:10.1155/2012/724072 Research Article Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder 1 1 2 3 Kumiko Yanagi, Tadashi Kaname, Keiko Wakui, Ohiko Hashimoto, 2 1 Yoshimitsu Fukushima, and Kenji Naritomi Department of Medical Genetics, Graduate School of Medicine, University of The Ryukyus, 207 Uehara, Nishihara, Okinawa 903-0215, Japan Department of Medical Genetics, School of Medicine, Shinshu University, 3-1-1 Asahi, Matsumoto 390-8621, Japan Faculty of Nursing and Rehabilitation, Aino University, 4-5-4 Higashi-Ohta, Ibaraki 567-0012, Japan Correspondence should be addressed to Tadashi Kaname, tkaname@med.u-ryukyu.ac.jp Received 22 January 2012; Revised 6 April 2012; Accepted 23 May 2012 Academic Editor: Bennett L. Leventhal Copyright © 2012 Kumiko Yanagi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X- linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered. 1. Introduction [8], have been identified in ASD patients (Table 1). In vitro experiments using NLGN3 and NLGN4X proteins carrying Neuroligin 3 (NLGN3)and Neuroligin 4X (NLGN4X)are amino acid changes that were identified in ASD patients members of neuroligins expressed in the postsynaptic neu- indicated that the gene mutations could cause ASD by a loss- rons and mediate transsynaptic signaling by interacting of-function mechanism [5, 9]. Neuroligin 3 p.R451C knock- their ligand, neurexins [1]. Mutations in the X-linked in mice and neuroligin 4X-deficient mice exhibited autism- genes NLGN3 and NLGN4X (GenBank accession numbers related behaviors [10, 11]. In addition, recent mutation NM 181303.1 and NM 020742.2, resp.) were first reported as screening studies revealed that the p.K378R substitution in being involved in X-linked autistic spectrum disorder (ASD; the NLGN4X gene was common in individuals of different MIM#300425 and MIM#300495) in Swedish families [2]. ethnicities, such as Portuguese and Greek [3, 4]. A recent Some reports have also indicated that NLGN3 and NLGN4X association study regarding rare variants in NLGN3 and are responsible for ASD. Mutations in these genes including NLGN4X also supported the relationship between a specific 5 missense mutations [2–5], two small in-del mutations, NLGN3 haplotype and the etiology of ASD in Chinese Han which lead to a premature stop codon in the transcript male population [12]. Moreover, two synonymous variants [2, 6], an exon skipping mutation [7], and a large deletion are specifically found in ASD patients [13, 14]. 2 Autism Research and Treatment Table 1: Previously identified sequence variations in coding regions in ASD patients. 1 2 3 Gene NT change A-A change Mutation type Ethnic background Ref. NCBI c.222C>T p.Y74Y Synonymous Finnish [13]NM 181303.1 NLGN3 c.1351C>T p.R451C Missense Swedish [2]NM 018977.3 c.259C>T p.R87W Missense Irish and Scottish [5]NM 020742.2 c.759G>A p.G99S Missense Portuguese [3]NM 020742.2 c.1186 insT p.D396X Frameshift Swedish [2]NM 020742.2 c.1253delAG p.D429X Frameshift French [6]NM 020742.2 NLGN4X c.1597A>G p.K378R Missense Portuguese and Greek [3, 4]NM 020742.2 Not described p.A558A Synonymous German [14]NM 020742.2 c.2574C>T p.R704C Missense Portuguese [3]NM 020742.2 5 6 del exon 4 In-frame Skipping AGRE [7]NM 020742.2 del exon 4–6 Truncated Large deletion Irish and English [8]NM 020742.2 NT: nucleotide. A-A: amino acid. Ref.: reference number. The number of substituted nucleotides was not mentioned in the reference. Exon 4 skipping mutation was predicted to result in an in-frame exclusion of 62 amino acids. Autism genetics resource exchange. The translated protein was predicted to be entirely truncated between exon 3 and exon 6. In contrast, some data indicate that these two genes (30 males, 30 females) was isolated from successfully trans- do not have a significant effect on ASD development. The formed B cells by Epstein-Barr virus using a standard frequency of mutation in the coding region was not high protocol involving proteinase K digestion. In addition, (<2%) among ASD patients [2–6]. It has been reported control genomic DNA was isolated from blood of 198 healthy that mutations in these genes were not observed in ASD Japanese individuals (118 males, 80 females) using a QIA patients in the United Kingdom, Canada, the Autism Genetic amp column (Qiagen, Hiden, Germany). Resource Exchange (AGRE) and the International Molecular 2.3. Mutation Screening. Initially, mutation screening was Genetic Study of Autism Consortium (IMGSAC) [15–17]. performed in the 62 ASD subjects by PCR-HRM analysis. Such contradictory results could possibly be due to genetic heterogeneity, regional characteristics, or differences HRM analysis is used to scan gene variations in a PCR ampli- con, for example, mutations and single-nucleotide polymor- in the ethnic background of ASD patients. It is, therefore, phisms (SNPs), prior to sequencing by detecting differences important to investigate the NLGN3 and NLGN4X sequences in ASD patients from various ethnic backgrounds. in the thermal denaturation of double-stranded DNA [19, 20]. We set up optimal conditions for PCR-HRM analysis of Molecular screening of NLGN3 and NLGN4X in Japanese the entire coding regions of NLGN3 and NLGN4X.Primers patients with ASD has not yet been reported. We, therefore, for all exons were carefully designed in flanking introns of performed a mutation screening study of these genes in the genes taking into account the high sequence homology 62 unrelated Japanese patients with ASD and 278 control X- chromosomes using polymerase-chain-reaction (PCR) high- between neuroligins (Table 2). Exons 2, 7, and 8 of NLGN3 and exons 2, 5, and 6 of NLGN4X were amplified in two or resolution melting (HRM) and direct sequencing analyses. three segments to obtain a fine resolution of the HRM curves. Only an upstream part of exon 2 (exon 2.1 in Table 2)of 2. Materials and Methods NLGN4X was sequenced in all ASD patients because we 2.1. Patients. The Japanese ASD patients analyzed in this failed to distinguish between the complicated SNPs located study were described previously [18]. All the patients were in the region. diagnosed with ASD according to the Diagnostic and Statisti- cal Manual of Mental Disorders (Fourth Edition criteria), the 2.4. Condition of PCR-HRM Analysis. PCR was performed Autism Diagnostic Interview-Revised, and the Childhood under optimized conditions using Ex-Taq DNA polymerase (TAKARA Bio Inc., Japan) as follows: 20 µL reaction mix- Autism Rating Scale by at least two trained psychiatrists. No 2+ chromosomal aberration was found in all patients. The study ture containing Mg -free 1 × PCR buffer (TAKARA Bio Inc., Japan), 0.25 mM dNTPs (TAKARA Bio Inc., Japan), was approved by the ethics committee of the University of the Ryukyus, and written informed consent was obtained from 0.25 units Ex-Taq DNA polymerase, 1 µMofeachprimer, all subjects. and the optimal concentration of MgCl was loaded per well in a 96-well PCR plate (Roche, Basel, Switzerland). 2.2. Source of Genomic DNA. Genomic DNA in patients Theamountofgenomic DNAusedineachreactionwas (51 males, 11 females) and control Japanese individuals 40 ng for males and 20 ng for females. Fluorescent DNA Autism Research and Treatment 3 Table 2: Primer sets used to screen for variants by PCR-HRM analysis. Gene Exon Forward Reverse 2.1 GCTCAGTTTTGAGGTTCAAGTC TCACTGGGCAGTGGTACTCG 2.2 CACAGTCAACACTCACTTTGG GATGGTTAGAAGCATTTTCACAG 3 GGCAGAGGCCTCCTGTTATT CAAATCCTCCCTGCAAGGCA 4 TGGCTTGCTGGGCCACACTG GCCAAAGACAGATGAACAGCC 5 AGGTTGAGCAACCCCATGAGT GGGCCAGAGGATAACACCATT NLGN3 6 CATCCCTCTGCCTTCATTGTC TAGAAGAGAGCTGGCCGATTC 7.1 CAGCCTCAGTGACAAAGGAAT CAGGGTGTCCTTACCCTCAG 7.2 GTAAGGACACCCTGCGAGAG TGGGGTCTCAAAGAGGAAAA 8.1 GTGACCCCAGATTTCCATGT GGCCAGAACGTTAAGGAACA 8.2 ATCACCCGCAGGCCCAATGG CCTCACACTCGTGGTGGGTG 8.3 GGAGGAGCTGGCAGCATTAC CTGGAGATTGGCTGTGCTCT 2.1 AAAGCCCTATCTCTCTGCAGG TGAGTAGTATTTCGGATGCCAG 2.2 AAGAACACCGTTACCCAATGAG GAGACATTATAAAACCCTCCTAG 3 TTAGCATTGGTGAGTCAGTGTG CCGTCAAAACGAGAAGTGGACT 4 CTTTTTCTATTTGGCCACCA TTCTTGGTTCAGGGTATTTGC NLGN4X 5.1 AGCTGCATTTCTGTCCTGTG TCTCCCGCAAAGTGTCTTTC 5.2 CCAACTTCGTGGACAACCTT ACCCCAACACGAAGATGAAC 6.1 CACGTCACATGTGGAAGAGT GACGGCAATGGTGACACTTA 6.2 TCCTCATTGAAACCAAACGA AACATTCCTGGTCTGGAGAC dye, SYTO 9 (0.5 µM; Life Technologies, Carlsbad, CA), observed in two different male patients. The variants iden- was added before amplification. Genotype analysis of each tified in this study are summarized in Table 3. Nonsynony- sample was performed in duplicate. The melting curves were mous substitutions, including seven substitutions reported sequentially analyzed using LightCycler 480 Gene Scanning previously, were not identified in the Japanese patients by Software (Roche, Basel, Switzerland) to detect sequence PCR-HRM analysis (Tables 1 and 3). The four synonymous variants. Evaluation of the HRM curves was sequentially and an intronic substitution were not found in the control X- confirmed by direct sequencing (Life Technologies, Carlsbad, chromosomes from unrelated healthy Japanese individuals, CA). without any neuropsychiatric disorder (Table 3). 2.5. Screening in Controls. Variants identified in ASD patients 4. Discussion were then investigated for detecting the common variants by By using PCR-HRM analysis we identified an intronic searching the database of Single Nucleotide Polymorphisms (dbSNP) build 132 and the Japanese Single Nucleotide and four exonic substitutions only in 62 Japanese patients Polymorphism database (JSNP). All variants found in ASD with ASD, two out of 62 patients (3.2%) in NLGN3 and three out of 62 patients (4.8%) in NLGN4X. The exonic patients were scanned in genomic DNAs isolated from EBV transformed cells or blood cells in control Japanese substitutions comprised one synonymous substitution in NLGN3 and three synonymous substitutions in NLGN4X individuals. (Table 3). The PCR-HRM analysis could detect 90% of the 2.6. Assessment of the Substitutions. The effect of the substi- sequence variations with 100% accuracy [19, 20]; therefore; we were able to identify almost all the changes in NLGN3 and tutions was evaluated using Mutation Taster software (http:// www.mutationtaster.org/). NLGN4X in these patients. In this study, we analyzed genomic DNAs from EBV- transformed cells in patients with ASD. The source of 3. Results genomic DNA, especially extracted from EBV-transformed We identified four variants, a synonymous substitu- cells, should be considerable in each experiment, because tion and three intronic substitutions, in NLGN3 in the there is a possibility that unexpected substitutions occur 62 ASD patients. The synonymous substitution (c.1698G>A, during the transformation [21, 22]. Analyses in control p.K566K) was observed in a male ASD patient. We also genomic DNA showed that there was no sequence alteration identified four variants, comprising three synonymous or substitution bias in the exons of NLGN3 and NLGN4X substitutions and a substitution in the 5 UTR region between genomic DNA isolated from blood and EBV- of NLGN4X. One synonymous substitution, c.297C>T transformed cells in this study (Table 3). (p.G99G), was observed in a female patient, and two substi- Our mutation screening study in Japanese ASD patients tutions, c.516C>T (p.I172I) and c.1590C>T (p.F530F), were failed to detect novel nonsynonymous mutations and seven 4 Autism Research and Treatment Table 3: Sequence variants identified in Japanese patients with autistic spectrum disorder. 2 3 ASD Control Gene Exon SNP ID Location Translation Male Female EBV cell line Blood 4 — c.567+22C>T Intronic 0/51 1/11 0/90 3/278 — c.567+52C>T Intronic 10/51 2/11 12/90 32/278 NLGN3 5 — c.727+47G>C Intronic 1/51 0/11 0/90 0/278 7 — c.1698G>A p.K566K 1/51 0/11 0/90 0/278 rs6639602 c.-305-86T>G5 UTR 0/51 1/11 1/90 4/278 2 — c.297C>T p.G99G 0/51 1/11 0/90 0/278 NLGN4X 3 — c.516C>T p.I172I 1/51 0/11 0/90 0/278 5 — c.1590C>T p.F530F 1/51 0/11 0/90 0/278 Reference number of the variant documented in dbSNP build 132 or JSNP. (—) indicates that the variant does not have a reference number. Number of ASD patients (50 males, 11 females) with the variant. Number of control chromosomes with the variant in EBV transformed cell line (30 males, 30 females) and blood (118 males, 80 females). known nonsynonymous mutations that were identified in Conflict of Interests previous studies [2–5]aswellasastudyinaChinese The authors declare that they have no competing interests. Han population [12]. Considering the low frequency of nonsynonymous substitutions in these genes seen in pre- Acknowledgments vious reports [15–17], a larger number of ASD patients should be sampled. Nevertheless, our results suggest that The authors thank all the individuals who participated in this nonsynonymous substitutions in NLGN3 and NLGN4X may study. They also thank Konomi Morita and Akihiro Hanafusa account for only a small proportion of Japanese patients with for expert technical assistance. This work was financially ASD. In addition to ASD, there are some reports indicating supported by a Grant-in-Aid for Scientific Research(C) from that NLGN3 and NLGN4X are also relevant to Asperger the Japan Society for the Promotion of Science (project syndrome [2], X-linked mental retardation [6], and Tourette 21590362). syndrome [8]. Considering the function of NLGN3 and NLGN4X [1], additional mutation screening studies in such References neurobehavioral disorders should be needed in near future. Experimental evidence is increasing that synonymous [1] T.C.Sudhof, ¨ “Neuroligins and neurexins link synaptic func- substitutions could affect the protein function through tion to cognitive disease,” Nature, vol. 455, no. 7215, pp. 903– transcription or translation impairment [23–25]. While 911, 2008. the clinical and physiological importance of the four [2] S. Jamain, H. Quach, C. Betancur et al., “Mutations of the synonymous substitutions and an intronic substitution X-linked genes encoding neuroligins NLGN3 and NLGN4 are are not clear at this moment, Mutation Taster software associated with autism,” Nature Genetics, vol. 34, no. 1, pp. 27– (http://www.mutationtaster.org/)[26] evaluated that the 29, 2003. substitutions might affect protein structure by altering splice [3] J. Yan, G. Oliveira, A. Coutinho et al., “Analysis of the neu- roligin 3 and 4 genes in autism and other neuropsychiatric site. According to previous reports of mutation screening in patients,” Molecular Psychiatry, vol. 10, no. 4, pp. 329–332, NLGN3 and NLGN4X, two synonymous mutations, p.Y74Y in NLGN3 and p.A558A in NLGN4X (Table 1), were also [4] A. Pampanos, K. Volaki, E. Kanavakis et al., “A substitution observed in ASD patients but not in healthy controls [13, 14]. involving the NLGN4 gene associated with autistic behavior A recent study in a Chinese Han population has indicated in the Greek population,” Genetic testing and molecular that a common intronic variation in NLGN3 may influence biomarkers, vol. 13, no. 5, pp. 611–615, 2009. the susceptibility of males to ASD [12]. Although further [5] C. Zhang, J. M. Milunsky, S. Newton et al., “A neuroligin-4 analysis is necessary to demonstrate the biological effects missense mutation associated with autism impairs neuroligin- of synonymous and intronic substitutions on ASD, these 4 folding and endoplasmic reticulum export,” Journal of substitutions as well as nonsynonymous substitutions should Neuroscience, vol. 29, no. 35, pp. 10843–10854, 2009. be taken into account. [6] F. Laumonnier, F. Bonnet-Brilhault, M. Gomot et al., “X- Linked mental retardation and autism are associated with a 5. Conclusion mutation in the NLGN4 gene, a member of the neuroligin family,” American Journal of Human Genetics, vol. 74, no. 3, We identified four substitutions, one in NLGN3 and three pp. 552–557, 2004. in NLGN4X, specific to Japanese patients with ASD. They [7] Z.Talebizadeh,D.Y.Lam,M.F.Theodoro, D. C. Bittel,G. were synonymous but the possibility of the association of H. Lushington, and M. G. Butler, “Novel splice isoforms for both synonymous and nonsynonymous substitutions with NLGN3 and NLGN4 with possible implications in autism,” the etiology of ASD should be considered. Journal of medical genetics, vol. 43, no. 5, p. e21, 2006. Autism Research and Treatment 5 [8] A. Lawson-Yuen, J. S. Saldivar, S. Sommer, and J. Picker, [23] C. Kimchi-Sarfaty, J. M. Oh, I. W. Kim et al., “A “silent” poly- “Familial deletion within NLGN4 associated with autism and morphism in the MDR1 gene changes substrate specificity,” Tourette syndrome,” European Journal of Human Genetics, vol. Science, vol. 315, no. 5811, pp. 525–528, 2007. 16, no. 5, pp. 614–618, 2008. [24] Z. E. Sauna, C. Kimchi-Sarfaty, S. V. Ambudkar, and M. M. [9] B. Chih, S. K. Afridi, L. Clark, and P. Scheiffele, “Disorder- Gottesman, “The sounds of silence: synonymous mutations associated mutations lead to functional inactivation of neu- affect functions,” Pharmacogenomics, vol. 8, no. 6, pp. 527– roligins,” Human Molecular Genetics, vol. 13, no. 14, pp. 1471– 532, 2007. 1477, 2004. [25] K. E. Knobe, E. Sjor ¨ in, and R. C. R. Ljung, “Why does the [10] K. Tabuchi, J. Blundell, M. R. Etherton et al., “A neuroligin- mutation G17736A/Val107Val (silent) in the F9 gene cause 3 mutation implicated in autism increases inhibitory synaptic mild haemophilia B in five Swedish families?” Haemophilia, transmission in mice,” Science, vol. 318, no. 5847, pp. 71–76, vol. 14, no. 4, pp. 723–728, 2008. 2007. [26] J. M. Schwarz, C. Rodelsperger ¨ , M. Schuelke, and D. [11] S. Jamain, K. Radyushkin, K. Hammerschmidt et al., “Reduced Seelow, “MutationTaster evaluates disease-causing potential of social interaction and ultrasonic communication in a mouse sequence alterations,” Nature Methods, vol. 7, no. 8, pp. 575– model of monogenic heritable autism,” Proceedings of the 576, 2010. National Academy of Sciences of the United States of America, vol. 105, no. 5, pp. 1710–1715, 2008. [12] J. Yu, X. He, D. Yao, Z. Li, H. Li, and Z. Zhao, “A sex-specific association of common variants of neuroligin genes (NLGN3 and NLGN4X) with autism spectrum disorders in a Chinese Han cohort,” Behavioral and Brain Functions, vol. 7, p. 13, [13] T. Ylisaukko-oja, K. Rehnstrom, ¨ M. Auranen et al., “Analysis of four neuroligin genes as candidates for autism,” European Journal of Human Genetics, vol. 13, no. 12, pp. 1285–1292, [14] A. K. Wermter, I. Kamp-Becker, K. Strauch, G. Schulte-Kor ¨ ne, and H. Remschmidt, “No evidence for involvement of genetic variants in the x-linked neuroligin genes NLGN3 and NLGN4X in probands with autism spectrum disorder on high functioning level,” American Journal of Medical Genetics B, vol. 147, no. 4, pp. 535–537, 2008. [15] J. B. Vincent, D. Kolozsvari,W.S.Roberts,P.F.Bolton,H. M. D. Gurling, and S. W. Scherer, “Mutation screening of X- chromosomalneuroligingenes:Nomutations in 196 autism probands,” American Journal of Medical Genetics, vol. 129, no. 1, pp. 82–84, 2004. [16] J. Gauthier, A. Bonnel, J. St-Onge et al., “NLGN3/NLGN4 gene mutations are not responsible for autism in the Quebec pop- ulation,” American Journal of Medical Genetics, vol. 132, no. 1, pp. 74–75, 2005. [17] F. Blasi, E. Bacchelli, G. Pesaresi, S. Carone, A. J. Bailey, and E. Maestrini, “Absence of coding mutations in the X-linked genes neuroligin 3 and neuroligin 4 in individuals with autism from the IMGSAC collection,” American Journal of Medical Genetics, vol. 141, no. 3, pp. 220–221, 2006. [18] T. Marui, O. Hashimoto, E. Nanba et al., “Association between the neurofibromatosis-1 (NF1) locus and autism in the Japanese population,” American Journal of Medical Genetics, vol. 131, no. 1, pp. 43–47, 2004. [19] K. M. Ririe, R. P. Rasmussen, and C. T. Wittwer, “Product differentiation by analysis of DNA melting curves during the polymerase chain reaction,” Analytical Biochemistry, vol. 245, no. 2, pp. 154–160, 1997. [20] A. D. Laurie, M. P. Smith, and P. M. George, “Detection of factor VIII gene mutations by high-resolution melting analy- sis,” Clinical Chemistry, vol. 53, no. 12, pp. 2211–2214, 2007. [21] P. Awadalla, J. Gauthier, R. A. Myers et al., “Direct measure of the de novo mutation rate in autism and schizophrenia cohorts,” American Journal of Human Genetics, vol. 87, no. 3, pp. 316–324, 2010. [22] L. Sie, S. Loong, and E. K. Tan, “Utility of lymphoblastoid cell lines,” Journal of Neuroscience Research, vol. 87, no. 9, pp. 1953–1959, 2009. MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 International Journal of Journal of Immunology Research Endocrinology Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Submit your manuscripts at http://www.hindawi.com BioMed PPAR Research Research International Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Research and Treatment Cellular Longevity Neurology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Autism Research and Treatment Hindawi Publishing Corporation

Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder

Download PDF
6 pages

Loading next page...
 
/lp/hindawi-publishing-corporation/identification-of-four-novel-synonymous-substitutions-in-the-x-linked-OKUC6FETOn

References (28)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2012 Kumiko Yanagi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
2090-1925
eISSN
2090-1933
DOI
10.1155/2012/724072
Publisher site
See Article on Publisher Site

Abstract

Hindawi Publishing Corporation Autism Research and Treatment Volume 2012, Article ID 724072, 5 pages doi:10.1155/2012/724072 Research Article Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder 1 1 2 3 Kumiko Yanagi, Tadashi Kaname, Keiko Wakui, Ohiko Hashimoto, 2 1 Yoshimitsu Fukushima, and Kenji Naritomi Department of Medical Genetics, Graduate School of Medicine, University of The Ryukyus, 207 Uehara, Nishihara, Okinawa 903-0215, Japan Department of Medical Genetics, School of Medicine, Shinshu University, 3-1-1 Asahi, Matsumoto 390-8621, Japan Faculty of Nursing and Rehabilitation, Aino University, 4-5-4 Higashi-Ohta, Ibaraki 567-0012, Japan Correspondence should be addressed to Tadashi Kaname, tkaname@med.u-ryukyu.ac.jp Received 22 January 2012; Revised 6 April 2012; Accepted 23 May 2012 Academic Editor: Bennett L. Leventhal Copyright © 2012 Kumiko Yanagi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X- linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered. 1. Introduction [8], have been identified in ASD patients (Table 1). In vitro experiments using NLGN3 and NLGN4X proteins carrying Neuroligin 3 (NLGN3)and Neuroligin 4X (NLGN4X)are amino acid changes that were identified in ASD patients members of neuroligins expressed in the postsynaptic neu- indicated that the gene mutations could cause ASD by a loss- rons and mediate transsynaptic signaling by interacting of-function mechanism [5, 9]. Neuroligin 3 p.R451C knock- their ligand, neurexins [1]. Mutations in the X-linked in mice and neuroligin 4X-deficient mice exhibited autism- genes NLGN3 and NLGN4X (GenBank accession numbers related behaviors [10, 11]. In addition, recent mutation NM 181303.1 and NM 020742.2, resp.) were first reported as screening studies revealed that the p.K378R substitution in being involved in X-linked autistic spectrum disorder (ASD; the NLGN4X gene was common in individuals of different MIM#300425 and MIM#300495) in Swedish families [2]. ethnicities, such as Portuguese and Greek [3, 4]. A recent Some reports have also indicated that NLGN3 and NLGN4X association study regarding rare variants in NLGN3 and are responsible for ASD. Mutations in these genes including NLGN4X also supported the relationship between a specific 5 missense mutations [2–5], two small in-del mutations, NLGN3 haplotype and the etiology of ASD in Chinese Han which lead to a premature stop codon in the transcript male population [12]. Moreover, two synonymous variants [2, 6], an exon skipping mutation [7], and a large deletion are specifically found in ASD patients [13, 14]. 2 Autism Research and Treatment Table 1: Previously identified sequence variations in coding regions in ASD patients. 1 2 3 Gene NT change A-A change Mutation type Ethnic background Ref. NCBI c.222C>T p.Y74Y Synonymous Finnish [13]NM 181303.1 NLGN3 c.1351C>T p.R451C Missense Swedish [2]NM 018977.3 c.259C>T p.R87W Missense Irish and Scottish [5]NM 020742.2 c.759G>A p.G99S Missense Portuguese [3]NM 020742.2 c.1186 insT p.D396X Frameshift Swedish [2]NM 020742.2 c.1253delAG p.D429X Frameshift French [6]NM 020742.2 NLGN4X c.1597A>G p.K378R Missense Portuguese and Greek [3, 4]NM 020742.2 Not described p.A558A Synonymous German [14]NM 020742.2 c.2574C>T p.R704C Missense Portuguese [3]NM 020742.2 5 6 del exon 4 In-frame Skipping AGRE [7]NM 020742.2 del exon 4–6 Truncated Large deletion Irish and English [8]NM 020742.2 NT: nucleotide. A-A: amino acid. Ref.: reference number. The number of substituted nucleotides was not mentioned in the reference. Exon 4 skipping mutation was predicted to result in an in-frame exclusion of 62 amino acids. Autism genetics resource exchange. The translated protein was predicted to be entirely truncated between exon 3 and exon 6. In contrast, some data indicate that these two genes (30 males, 30 females) was isolated from successfully trans- do not have a significant effect on ASD development. The formed B cells by Epstein-Barr virus using a standard frequency of mutation in the coding region was not high protocol involving proteinase K digestion. In addition, (<2%) among ASD patients [2–6]. It has been reported control genomic DNA was isolated from blood of 198 healthy that mutations in these genes were not observed in ASD Japanese individuals (118 males, 80 females) using a QIA patients in the United Kingdom, Canada, the Autism Genetic amp column (Qiagen, Hiden, Germany). Resource Exchange (AGRE) and the International Molecular 2.3. Mutation Screening. Initially, mutation screening was Genetic Study of Autism Consortium (IMGSAC) [15–17]. performed in the 62 ASD subjects by PCR-HRM analysis. Such contradictory results could possibly be due to genetic heterogeneity, regional characteristics, or differences HRM analysis is used to scan gene variations in a PCR ampli- con, for example, mutations and single-nucleotide polymor- in the ethnic background of ASD patients. It is, therefore, phisms (SNPs), prior to sequencing by detecting differences important to investigate the NLGN3 and NLGN4X sequences in ASD patients from various ethnic backgrounds. in the thermal denaturation of double-stranded DNA [19, 20]. We set up optimal conditions for PCR-HRM analysis of Molecular screening of NLGN3 and NLGN4X in Japanese the entire coding regions of NLGN3 and NLGN4X.Primers patients with ASD has not yet been reported. We, therefore, for all exons were carefully designed in flanking introns of performed a mutation screening study of these genes in the genes taking into account the high sequence homology 62 unrelated Japanese patients with ASD and 278 control X- chromosomes using polymerase-chain-reaction (PCR) high- between neuroligins (Table 2). Exons 2, 7, and 8 of NLGN3 and exons 2, 5, and 6 of NLGN4X were amplified in two or resolution melting (HRM) and direct sequencing analyses. three segments to obtain a fine resolution of the HRM curves. Only an upstream part of exon 2 (exon 2.1 in Table 2)of 2. Materials and Methods NLGN4X was sequenced in all ASD patients because we 2.1. Patients. The Japanese ASD patients analyzed in this failed to distinguish between the complicated SNPs located study were described previously [18]. All the patients were in the region. diagnosed with ASD according to the Diagnostic and Statisti- cal Manual of Mental Disorders (Fourth Edition criteria), the 2.4. Condition of PCR-HRM Analysis. PCR was performed Autism Diagnostic Interview-Revised, and the Childhood under optimized conditions using Ex-Taq DNA polymerase (TAKARA Bio Inc., Japan) as follows: 20 µL reaction mix- Autism Rating Scale by at least two trained psychiatrists. No 2+ chromosomal aberration was found in all patients. The study ture containing Mg -free 1 × PCR buffer (TAKARA Bio Inc., Japan), 0.25 mM dNTPs (TAKARA Bio Inc., Japan), was approved by the ethics committee of the University of the Ryukyus, and written informed consent was obtained from 0.25 units Ex-Taq DNA polymerase, 1 µMofeachprimer, all subjects. and the optimal concentration of MgCl was loaded per well in a 96-well PCR plate (Roche, Basel, Switzerland). 2.2. Source of Genomic DNA. Genomic DNA in patients Theamountofgenomic DNAusedineachreactionwas (51 males, 11 females) and control Japanese individuals 40 ng for males and 20 ng for females. Fluorescent DNA Autism Research and Treatment 3 Table 2: Primer sets used to screen for variants by PCR-HRM analysis. Gene Exon Forward Reverse 2.1 GCTCAGTTTTGAGGTTCAAGTC TCACTGGGCAGTGGTACTCG 2.2 CACAGTCAACACTCACTTTGG GATGGTTAGAAGCATTTTCACAG 3 GGCAGAGGCCTCCTGTTATT CAAATCCTCCCTGCAAGGCA 4 TGGCTTGCTGGGCCACACTG GCCAAAGACAGATGAACAGCC 5 AGGTTGAGCAACCCCATGAGT GGGCCAGAGGATAACACCATT NLGN3 6 CATCCCTCTGCCTTCATTGTC TAGAAGAGAGCTGGCCGATTC 7.1 CAGCCTCAGTGACAAAGGAAT CAGGGTGTCCTTACCCTCAG 7.2 GTAAGGACACCCTGCGAGAG TGGGGTCTCAAAGAGGAAAA 8.1 GTGACCCCAGATTTCCATGT GGCCAGAACGTTAAGGAACA 8.2 ATCACCCGCAGGCCCAATGG CCTCACACTCGTGGTGGGTG 8.3 GGAGGAGCTGGCAGCATTAC CTGGAGATTGGCTGTGCTCT 2.1 AAAGCCCTATCTCTCTGCAGG TGAGTAGTATTTCGGATGCCAG 2.2 AAGAACACCGTTACCCAATGAG GAGACATTATAAAACCCTCCTAG 3 TTAGCATTGGTGAGTCAGTGTG CCGTCAAAACGAGAAGTGGACT 4 CTTTTTCTATTTGGCCACCA TTCTTGGTTCAGGGTATTTGC NLGN4X 5.1 AGCTGCATTTCTGTCCTGTG TCTCCCGCAAAGTGTCTTTC 5.2 CCAACTTCGTGGACAACCTT ACCCCAACACGAAGATGAAC 6.1 CACGTCACATGTGGAAGAGT GACGGCAATGGTGACACTTA 6.2 TCCTCATTGAAACCAAACGA AACATTCCTGGTCTGGAGAC dye, SYTO 9 (0.5 µM; Life Technologies, Carlsbad, CA), observed in two different male patients. The variants iden- was added before amplification. Genotype analysis of each tified in this study are summarized in Table 3. Nonsynony- sample was performed in duplicate. The melting curves were mous substitutions, including seven substitutions reported sequentially analyzed using LightCycler 480 Gene Scanning previously, were not identified in the Japanese patients by Software (Roche, Basel, Switzerland) to detect sequence PCR-HRM analysis (Tables 1 and 3). The four synonymous variants. Evaluation of the HRM curves was sequentially and an intronic substitution were not found in the control X- confirmed by direct sequencing (Life Technologies, Carlsbad, chromosomes from unrelated healthy Japanese individuals, CA). without any neuropsychiatric disorder (Table 3). 2.5. Screening in Controls. Variants identified in ASD patients 4. Discussion were then investigated for detecting the common variants by By using PCR-HRM analysis we identified an intronic searching the database of Single Nucleotide Polymorphisms (dbSNP) build 132 and the Japanese Single Nucleotide and four exonic substitutions only in 62 Japanese patients Polymorphism database (JSNP). All variants found in ASD with ASD, two out of 62 patients (3.2%) in NLGN3 and three out of 62 patients (4.8%) in NLGN4X. The exonic patients were scanned in genomic DNAs isolated from EBV transformed cells or blood cells in control Japanese substitutions comprised one synonymous substitution in NLGN3 and three synonymous substitutions in NLGN4X individuals. (Table 3). The PCR-HRM analysis could detect 90% of the 2.6. Assessment of the Substitutions. The effect of the substi- sequence variations with 100% accuracy [19, 20]; therefore; we were able to identify almost all the changes in NLGN3 and tutions was evaluated using Mutation Taster software (http:// www.mutationtaster.org/). NLGN4X in these patients. In this study, we analyzed genomic DNAs from EBV- transformed cells in patients with ASD. The source of 3. Results genomic DNA, especially extracted from EBV-transformed We identified four variants, a synonymous substitu- cells, should be considerable in each experiment, because tion and three intronic substitutions, in NLGN3 in the there is a possibility that unexpected substitutions occur 62 ASD patients. The synonymous substitution (c.1698G>A, during the transformation [21, 22]. Analyses in control p.K566K) was observed in a male ASD patient. We also genomic DNA showed that there was no sequence alteration identified four variants, comprising three synonymous or substitution bias in the exons of NLGN3 and NLGN4X substitutions and a substitution in the 5 UTR region between genomic DNA isolated from blood and EBV- of NLGN4X. One synonymous substitution, c.297C>T transformed cells in this study (Table 3). (p.G99G), was observed in a female patient, and two substi- Our mutation screening study in Japanese ASD patients tutions, c.516C>T (p.I172I) and c.1590C>T (p.F530F), were failed to detect novel nonsynonymous mutations and seven 4 Autism Research and Treatment Table 3: Sequence variants identified in Japanese patients with autistic spectrum disorder. 2 3 ASD Control Gene Exon SNP ID Location Translation Male Female EBV cell line Blood 4 — c.567+22C>T Intronic 0/51 1/11 0/90 3/278 — c.567+52C>T Intronic 10/51 2/11 12/90 32/278 NLGN3 5 — c.727+47G>C Intronic 1/51 0/11 0/90 0/278 7 — c.1698G>A p.K566K 1/51 0/11 0/90 0/278 rs6639602 c.-305-86T>G5 UTR 0/51 1/11 1/90 4/278 2 — c.297C>T p.G99G 0/51 1/11 0/90 0/278 NLGN4X 3 — c.516C>T p.I172I 1/51 0/11 0/90 0/278 5 — c.1590C>T p.F530F 1/51 0/11 0/90 0/278 Reference number of the variant documented in dbSNP build 132 or JSNP. (—) indicates that the variant does not have a reference number. Number of ASD patients (50 males, 11 females) with the variant. Number of control chromosomes with the variant in EBV transformed cell line (30 males, 30 females) and blood (118 males, 80 females). known nonsynonymous mutations that were identified in Conflict of Interests previous studies [2–5]aswellasastudyinaChinese The authors declare that they have no competing interests. Han population [12]. Considering the low frequency of nonsynonymous substitutions in these genes seen in pre- Acknowledgments vious reports [15–17], a larger number of ASD patients should be sampled. Nevertheless, our results suggest that The authors thank all the individuals who participated in this nonsynonymous substitutions in NLGN3 and NLGN4X may study. They also thank Konomi Morita and Akihiro Hanafusa account for only a small proportion of Japanese patients with for expert technical assistance. This work was financially ASD. In addition to ASD, there are some reports indicating supported by a Grant-in-Aid for Scientific Research(C) from that NLGN3 and NLGN4X are also relevant to Asperger the Japan Society for the Promotion of Science (project syndrome [2], X-linked mental retardation [6], and Tourette 21590362). syndrome [8]. Considering the function of NLGN3 and NLGN4X [1], additional mutation screening studies in such References neurobehavioral disorders should be needed in near future. Experimental evidence is increasing that synonymous [1] T.C.Sudhof, ¨ “Neuroligins and neurexins link synaptic func- substitutions could affect the protein function through tion to cognitive disease,” Nature, vol. 455, no. 7215, pp. 903– transcription or translation impairment [23–25]. While 911, 2008. the clinical and physiological importance of the four [2] S. Jamain, H. Quach, C. Betancur et al., “Mutations of the synonymous substitutions and an intronic substitution X-linked genes encoding neuroligins NLGN3 and NLGN4 are are not clear at this moment, Mutation Taster software associated with autism,” Nature Genetics, vol. 34, no. 1, pp. 27– (http://www.mutationtaster.org/)[26] evaluated that the 29, 2003. substitutions might affect protein structure by altering splice [3] J. Yan, G. Oliveira, A. Coutinho et al., “Analysis of the neu- roligin 3 and 4 genes in autism and other neuropsychiatric site. According to previous reports of mutation screening in patients,” Molecular Psychiatry, vol. 10, no. 4, pp. 329–332, NLGN3 and NLGN4X, two synonymous mutations, p.Y74Y in NLGN3 and p.A558A in NLGN4X (Table 1), were also [4] A. Pampanos, K. Volaki, E. Kanavakis et al., “A substitution observed in ASD patients but not in healthy controls [13, 14]. involving the NLGN4 gene associated with autistic behavior A recent study in a Chinese Han population has indicated in the Greek population,” Genetic testing and molecular that a common intronic variation in NLGN3 may influence biomarkers, vol. 13, no. 5, pp. 611–615, 2009. the susceptibility of males to ASD [12]. Although further [5] C. Zhang, J. M. Milunsky, S. Newton et al., “A neuroligin-4 analysis is necessary to demonstrate the biological effects missense mutation associated with autism impairs neuroligin- of synonymous and intronic substitutions on ASD, these 4 folding and endoplasmic reticulum export,” Journal of substitutions as well as nonsynonymous substitutions should Neuroscience, vol. 29, no. 35, pp. 10843–10854, 2009. be taken into account. [6] F. Laumonnier, F. Bonnet-Brilhault, M. Gomot et al., “X- Linked mental retardation and autism are associated with a 5. Conclusion mutation in the NLGN4 gene, a member of the neuroligin family,” American Journal of Human Genetics, vol. 74, no. 3, We identified four substitutions, one in NLGN3 and three pp. 552–557, 2004. in NLGN4X, specific to Japanese patients with ASD. They [7] Z.Talebizadeh,D.Y.Lam,M.F.Theodoro, D. C. Bittel,G. were synonymous but the possibility of the association of H. Lushington, and M. G. Butler, “Novel splice isoforms for both synonymous and nonsynonymous substitutions with NLGN3 and NLGN4 with possible implications in autism,” the etiology of ASD should be considered. Journal of medical genetics, vol. 43, no. 5, p. e21, 2006. Autism Research and Treatment 5 [8] A. Lawson-Yuen, J. S. Saldivar, S. Sommer, and J. Picker, [23] C. Kimchi-Sarfaty, J. M. Oh, I. W. Kim et al., “A “silent” poly- “Familial deletion within NLGN4 associated with autism and morphism in the MDR1 gene changes substrate specificity,” Tourette syndrome,” European Journal of Human Genetics, vol. Science, vol. 315, no. 5811, pp. 525–528, 2007. 16, no. 5, pp. 614–618, 2008. [24] Z. E. Sauna, C. Kimchi-Sarfaty, S. V. Ambudkar, and M. M. [9] B. Chih, S. K. Afridi, L. Clark, and P. Scheiffele, “Disorder- Gottesman, “The sounds of silence: synonymous mutations associated mutations lead to functional inactivation of neu- affect functions,” Pharmacogenomics, vol. 8, no. 6, pp. 527– roligins,” Human Molecular Genetics, vol. 13, no. 14, pp. 1471– 532, 2007. 1477, 2004. [25] K. E. Knobe, E. Sjor ¨ in, and R. C. R. Ljung, “Why does the [10] K. Tabuchi, J. Blundell, M. R. Etherton et al., “A neuroligin- mutation G17736A/Val107Val (silent) in the F9 gene cause 3 mutation implicated in autism increases inhibitory synaptic mild haemophilia B in five Swedish families?” Haemophilia, transmission in mice,” Science, vol. 318, no. 5847, pp. 71–76, vol. 14, no. 4, pp. 723–728, 2008. 2007. [26] J. M. Schwarz, C. Rodelsperger ¨ , M. Schuelke, and D. [11] S. Jamain, K. Radyushkin, K. Hammerschmidt et al., “Reduced Seelow, “MutationTaster evaluates disease-causing potential of social interaction and ultrasonic communication in a mouse sequence alterations,” Nature Methods, vol. 7, no. 8, pp. 575– model of monogenic heritable autism,” Proceedings of the 576, 2010. National Academy of Sciences of the United States of America, vol. 105, no. 5, pp. 1710–1715, 2008. [12] J. Yu, X. He, D. Yao, Z. Li, H. Li, and Z. Zhao, “A sex-specific association of common variants of neuroligin genes (NLGN3 and NLGN4X) with autism spectrum disorders in a Chinese Han cohort,” Behavioral and Brain Functions, vol. 7, p. 13, [13] T. Ylisaukko-oja, K. Rehnstrom, ¨ M. Auranen et al., “Analysis of four neuroligin genes as candidates for autism,” European Journal of Human Genetics, vol. 13, no. 12, pp. 1285–1292, [14] A. K. Wermter, I. Kamp-Becker, K. Strauch, G. Schulte-Kor ¨ ne, and H. Remschmidt, “No evidence for involvement of genetic variants in the x-linked neuroligin genes NLGN3 and NLGN4X in probands with autism spectrum disorder on high functioning level,” American Journal of Medical Genetics B, vol. 147, no. 4, pp. 535–537, 2008. [15] J. B. Vincent, D. Kolozsvari,W.S.Roberts,P.F.Bolton,H. M. D. Gurling, and S. W. Scherer, “Mutation screening of X- chromosomalneuroligingenes:Nomutations in 196 autism probands,” American Journal of Medical Genetics, vol. 129, no. 1, pp. 82–84, 2004. [16] J. Gauthier, A. Bonnel, J. St-Onge et al., “NLGN3/NLGN4 gene mutations are not responsible for autism in the Quebec pop- ulation,” American Journal of Medical Genetics, vol. 132, no. 1, pp. 74–75, 2005. [17] F. Blasi, E. Bacchelli, G. Pesaresi, S. Carone, A. J. Bailey, and E. Maestrini, “Absence of coding mutations in the X-linked genes neuroligin 3 and neuroligin 4 in individuals with autism from the IMGSAC collection,” American Journal of Medical Genetics, vol. 141, no. 3, pp. 220–221, 2006. [18] T. Marui, O. Hashimoto, E. Nanba et al., “Association between the neurofibromatosis-1 (NF1) locus and autism in the Japanese population,” American Journal of Medical Genetics, vol. 131, no. 1, pp. 43–47, 2004. [19] K. M. Ririe, R. P. Rasmussen, and C. T. Wittwer, “Product differentiation by analysis of DNA melting curves during the polymerase chain reaction,” Analytical Biochemistry, vol. 245, no. 2, pp. 154–160, 1997. [20] A. D. Laurie, M. P. Smith, and P. M. George, “Detection of factor VIII gene mutations by high-resolution melting analy- sis,” Clinical Chemistry, vol. 53, no. 12, pp. 2211–2214, 2007. [21] P. Awadalla, J. Gauthier, R. A. Myers et al., “Direct measure of the de novo mutation rate in autism and schizophrenia cohorts,” American Journal of Human Genetics, vol. 87, no. 3, pp. 316–324, 2010. [22] L. Sie, S. Loong, and E. K. Tan, “Utility of lymphoblastoid cell lines,” Journal of Neuroscience Research, vol. 87, no. 9, pp. 1953–1959, 2009. MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 International Journal of Journal of Immunology Research Endocrinology Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Submit your manuscripts at http://www.hindawi.com BioMed PPAR Research Research International Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Research and Treatment Cellular Longevity Neurology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Journal

Autism Research and Treatment – Hindawi Publishing Corporation

Published: Jul 16, 2012

There are no references for this article.