Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

HOTAIR Contributes to Stemness Acquisition of Cervical Cancer through Regulating miR-203 Interaction with ZEB1 on Epithelial-Mesenchymal Transition

HOTAIR Contributes to Stemness Acquisition of Cervical Cancer through Regulating miR-203... Hindawi Journal of Oncology Volume 2021, Article ID 4190764, 11 pages https://doi.org/10.1155/2021/4190764 Research Article HOTAIR Contributes to Stemness Acquisition of Cervical Cancer through Regulating miR-203 Interaction with ZEB1 on Epithelial-Mesenchymal Transition Wenying Zhang , Jing Liu , Qiongwei Wu, Yu Liu, and Chengbin Ma Department of Gynecology, Shanghai Changning Maternity and Infant Health Hospital, Shanghai 200051, China Correspondence should be addressed to Chengbin Ma; macb66@126.com Received 7 June 2021; Accepted 10 August 2021; Published 10 September 2021 Academic Editor: Prasanna Kumar Santhekadur Copyright © 2021 Wenying Zhang et al. *is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Cervical cancer stem cells contribute respond to considerable recurrence and metastasis of patients with cervical cancer. *e stemness properties were partly regulated by the interaction of lncRNAs and miRNAs. HOTAIR functions as an oncogenic lncRNA. Previous research studies revealed its role in regulating stemness properties in various cancers. However, the role of HOTAIR in cervical cancer stem cells is still unknown. Here, cisplatin-resistant and serum-free cultured cells exhibited stem cells properties. Cervical cancer stem cells exhibited greater invasion and migration compared with their parental cells, which was similar to cells over- expressing HOTAIR. HOTAIR was significantly overexpressed in cervical cancer stem cells, and knockdown of HOTAIR generated statistical downregulation of stemness markers. Additionally, HOTAIR expression was negatively correlated with the level of miR- 203, which was found to be an inhibitory miRNA in regulating the expressions of stemness markers. Also, miR-203 expression was negatively correlated with ZEB1. *ese findings suggested that HOTAIR should be a positive contributor in stemness acquisition of cervical cancer cells, and this effect should correlate with the interaction with miR-203, which can be suppressed by ZEB1. HOX transcript antisense intergenic RNA (HOTAIR) is 1. Introduction transcribed from the antisense strand of the homeobox gene Despite considerable advances in screening, diagnosis, C cluster (HOXC) and recognized as an oncogenic lncRNA prevention, and treatment, cervical cancer is still one of the in various types of malignant tumors, including cervix leading causes of cancer-related death in women worldwide cancer. HOTAIR recruited the PRC2 (polycomb repressive [1, 2]. Surgery and chemoradiotherapy offer survival ad- complex 2) complex to induce methylation of H3K27me3 vantage for patients with cervical carcinoma. However, and ultimately provoke gene silencing. Also, HOTAIR can recurrence occurs in∼35% cervical cancer patients and 90% recruit the MLL1 methyltransferase and induce H3K4me3, thereby relaxing chromatin and allowing binding of tran- were found within three years after the initial management. Burgeoning evidence indicated that current cancer treat- scription machinery [6, 7]. Besides, HOTAIR is capable to ments failed to eradicate a subset of cells within tumor sponge definite miRNAs to avoid their effect on mRNA known as cancer stem cells (CSCs); therefore, this failure targets. *rough aforementioned approaches, HOTAIR allows CSCs to self-renew and provoke tumor relapse [3]. exerts its crucial effects on proliferation, migration, and Recently, various long noncoding RNAs (lncRNAs) have invasion in cervical cancer. Recently, HOTAIR has been been recognized crucial players in regulating CSC properties reported to be elevated in CSCs derived from various ma- and allowing them to self-renew and promote tumor growth lignant tumors [8]. HOTAIR overexpression is believed to [4, 5]. *us, these lncRNAs hold potential as specific targets be associated with the acquisition of stem cell properties, to eliminate the CSC fraction, thereby, to eradicate cancer. which resulted in an increased tumor growth and metastatic 2 Journal of Oncology potential [9, 10]. Our previous data showed that HOTAIR the SanPrep Column microRNA Extraction Kit (Cat. No: participated in chemoresistance of cervical cancer through B518811; Sangon Biotech (Shanghai) Co., Ltd., China) and triggering epithelial-to-mesenchymal transition (EMT), the first-strand cDNA synthesis was carried out using which was considered the main factor responding for miRNA First-Strand cDNA Synthesis (Tailing Reaction) stemness acquisition by HOTAIR [11]. Actually, HOTAIR (Cat. No: B532451; Sangon Biotech (Shanghai) Co., Ltd., interacted to miR-203, which has been recognized as a China) according to the manufacturer’s protocol. PCR pivotal contributor in EMT and cancer stem cell properties amplification was carried out in a 20 μL reaction system, through suppressing the expressions of various targets. which contained 2 μL cDNA, 10 μL SYBR Premix Ex Taq II However, the role of HOTAIR and miR-203 in acquisition of (TaKaRa, Otsu, Shiga, Japan), and 10 μM of both sense and cervical cancer stem cells is still unknown [12]. antisense primers. *e expressions were calculated using the −ΔΔCT In present study, chemotherapeutics resistance and se- 2 method. Experiments were performed in triplicate. rum-free culture were proven to be effective to enrich cell Primers used here are presented in Table 1. subpopulation with stemness properties from human cer- vical cancer HeLa and SiHa cells. HOTAIR was statistically 2.4. Cell Transfection. Cell transfection was performed using upregulated along with enrichment of cervical cancer stem Lipofectamine 2000 (Invitrogen) according to the manufac- cells, and knockdown of HOTAIR significantly down- turer’s protocol. In brief, the target plasmid (1 μg) and Lip- regulated the expressions of stemness markers. *e ofectamine 2000 (3 μL) were previously diluted by 100 μL HOTAIR level was negatively correlated to the expression of serum-free Opti-MEM medium (Gibco, Grand Island, NY) miR-203, which promoted EMT and regulated by ZEB1. and then mixed up after being placed at room temperature for 5 min. *en, the mixture was added into the medium of cells 2. Materials and Methods that reached to 50% confluence and left for another 20 min. After being incubated for 6–8 hours, the original medium was 2.1. Cell Culture. *e human cervical adenocarcinoma cell replaced with a complete growth medium, and then, the cells lines HeLa (ATCC CRM-CCL-2 ) and the cervical TM were incubated for 24–48 hours. In the present study, squamous carcinoma cell SiHa (ATCC HTB-35 ) ob- recombinant vector pc.DNA3.1-HOTAIR was transfected tained from American Type Culture Collection (ATCC; into cells to overexpress HOTAIR, while cells transfected with Manassas, VA, USA) were cultured in Eagle’s Minimum pc.DNA3.1 were used as controls. Small interference RNA Essential Medium (Catalog No. 30-2003) supplemented with targeting HOTAIR (F: CTCCGCTTCGCAGTGGAATGG; R: 10% fetal bovine serum (FBS) (st30-3302; PAN, Germany) ° TCTCGCCGCCGTCTGTAACTC) was transfected into and were maintained at 37 C in a 5% CO humidified at- cervical cancer cells to knockdown HOTAIR, and cells mosphere. Cell layers that reached 80% confluence were transfected with scramble siRNAs were used as controls. In dispersed by 0.25% (w/v) Trypsin-0.53 mM EDTA solution. order to explore the role of miR-203 in cervical cancer cells, *en, cells were treated with a complete growth medium and miR-203 mimics and miR-203 inhibitor were respectively aspirated by gently pipetting. *e cell suspension was transfected into cells. transmitted to a new culture flask at a ratio of 1 : 3 and incubated at 37 C in a 5% CO humidified atmosphere. During subcultivation, the medium was renewed 3 times per 2.5. Cell Migration and Invasion Assay. Migration and in- week. Cells within 3 to 5 passages were used in this vasion of differently treated cervical cancer cells were de- experiment. termined by using culture inserts of 8 μm pore size (Transwell, Costar) that were placed into the wells of 24-well culture plates. For invasion assay, cell inserts were precoated 2.2. Enrichment of Cervical Cancer Stem Cells. HeLa and with Matrigel Matrix (BD Biosciences) (100 μg/well). *e SiHa cells were trypsinized and washed twice with PBS. After 1 × 10 cells in serum-free medium were seeded into the that, the cells were resuspended with serum-free DMEM/ upper chamber, while the lower chamber was added with F12 medium containing 2% B27, 20 ng/mL bFGF, and 20 ng/ 500 μL of DMEM medium supplemented with 10% FBS. mL EGF. *e cells were incubated at 37 C with 5% CO . After being incubated at 37 C with 5% CO for 48–72 h, the Subculture was performed every 2–4 days. cells migrated or invaded through the pores were fixed with 4% paraformaldehyde (Beyotime Biotechnology, Shanghai, 2.3. qPCR Assay. Total RNA was extracted with TRIzol China) and stained with 0.1% crystal violet (Beyotime Reagent (Cat. No: 15596018; Invitrogen, *ermo Fisher Biotechnology, Shanghai, China) for 30 min. Images were Scientific, Wilmington, DE, USA), and its purity was de- captured, and the cells were calculated on five random fields termined using the NanoDrop spectrophotometer (ND- of each insert. 2000; *ermo Fisher Scientific, Waltham, MA, USA). *e RNA samples with high purity were reversely transcribed into complementary DNAs (cDNAs) using the TAKARA 2.6. Migration Assay. *e differently treated cervical cancer PrimeScript RTreagent kit with gDNA Eraser (Perfect Real cells were harvested and seeded into 6-well plates at a Time) (Cat. No: RR047A; Takara, Dalian, China) according concentration of 1500 cells/well. *en, the cells were grown to the manufacturer’s instruction. In order to determine in Eagle’s Minimum Essential Medium supplemented with miRNA-203 expression, the microRNAs were purified using 10% FBS until confluence. *ereafter, a vertical line was Journal of Oncology 3 Table 1: Primer sequences in qPCR assay. 3. Results Primer Sequence (5′–3′) 3.1. Cisplatin-Resistant Cells and Serum-Free Cultured Cells HOTAIR-F CTCCGCTTCGCAGTGGAATGG from Cervical Cancer Cell Lines Exhibit Stem-Like Properties. HOTAIR-R TCTCGCCGCCGTCTGTAACTC In this study, stem-like cells were enriched from two human CD133-F ACCGACTGAGACCCAACATC cervical cancer cell lines, HeLa and SiHa, in presence of CD133-R GACCGCAGGCTAGTTTTCAC cisplatin and in a serum-free medium. *en, enriched cis- NANOG-F CTCGCTTCGGCAGCACA platin-resistant cells and serum-free cultured cells were NANOG-R TGCTGGAGGCTGAGGTATTT submitted to detect the expressions of stem cell markers, SOX2-F TTTTGTCGGAGACGGAGAAG including NANOG, OCT4, CD44, ALDH1, CD133, and SOX2-R TTCATGTGCGCGTAACTGTC SOX2. Data showed that the expression level of these six CD44-F TGGAGCAAACACAACCTCTG CD44-R TGAGTCCACTTGGCTTTCTG marker genes in serum-free cultured HeLa cells revealed a OCT4-F GAAGGATGTGGTCCGAGTGT similar higher expression level of stem cell biomarkers than OCT4-R TGAAGTGAGGGCTCCCATAG their parental cells (Figure 1(a)–1(f)). And, the expression ALDH1-F TCCTGGTTATGGGCCTACAG level in cisplatin-resistant HeLa cells was significantly higher ALDH1-R CAAGTCGGCATCAGCTAACA than that in their parental cells (Figure 1(g)–1(l)). *e same HS-ACTB-F CCTGGCACCCAGCACAAT results were also found in SiHa cells (data not shown). *ese HS-ACTB-R GGGCCGGACTCGTCATAC findings suggested both cisplatin-resistant cells and serum- U6-F CTCGCTTCGGCAGCACA free cultured cells from cervical cancer cell lines exhibited miR-203-F GCCGCAGTGGTTCTTAACAGTTCA stem-like properties. General reverse primer AACGCTTCACGAATTTGC for amplifying miRNAs 3.2. Cervical Cancer Stem-Like Cells Hold Superior Migration drawn at the bottom of a six-well plate, which went through and Invasion Capability. In this study, HeLa and SiHa cells the center of the plate before seeding cells. *e cells were were treated with cisplatin or cultured in a serum-free photographed, and the wound width was quantified at 0 and medium to enrich cervical cancer stem cells. And then, 48 hours. cervical cancer stem-like cells and their parental cells were submitted to analyze invasion and migration. Compared with parental HeLa and SiHa cervical cancer cells, cancer 2.7. Western Blotting. *e proteins of differently treated stem cells resistant against cisplatin revealed significantly cervical cancer cells were extracted with RIPA Lysis Buffer more invaded cells through the pore (Figure 2(a) and 2(b)) (PP110; Protein Biotechnology Co., Ltd, China) according to and narrow wound closure (Figure 2(c) and 2(d)), which the manufacturer’s instruction. *en, the concentration of were inferior to the data from cancer stem cells cultured in the proteins was determined using a BCA protein assay kit the serum-free medium. (PP202; Protein Biotechnology Co., Ltd, China). Subse- quently, 30 µg proteins in each group were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis 3.3. HOTAIR Promoted Migration and Invasion of Cervical (SDS-PAGE). *e gels were then transferred onto a poly- Cancer Cells In Vitro. *e role of HOTAIR in migration and vinylidene fluoride (PVDF) membrane. *e membrane was invasion of cervical cancer cells was determined in vitro incubated in Tris-buffered saline containing 0.1% Tween-20 through both gain-of-function and loss-of-function ap- and 5% nonfat milk for 1 h. *en, the PVDF membrane was proaches. As shown in Figure 3, the overexpression of incubated overnight with primary antibodies against HOTAIR resulted in statistically more invaded either HeLa NANOG (ab203919; Abcam, USA), OCT4 (ab200834; or SiHa cells through the pores, while interference targeting Abcam, USA), CD133 (ab278053; Abcam, USA), SOX2 HOTAIR revealed a significant decrease in invaded cervical (ab92494; Abcam, USA), and β-actin (ab8227; Abcam, cancer cells. In addition, the effect of HOTAIR on migration USA). *en, the membrane was incubated with HRP-con- of both HeLa and SiHa cells were analyzed using wound jugated secondary antibody (ab205718; Abcam, USA) for 2 h closure assay. Data showed that overexpression of HOTAIR at room temperature. *e bands of individual proteins were produced statistically promoted migration of both HeLa and visualized using a chemiluminescence (ECL) kit (PP404; SiHa cells, while knockdown of HOTAIR exhibited signif- Protein Biotechnology Co., Ltd., China). icantly lower migration of either HeLa or SiHa cells. *ese findings suggested that HOTAIR promoted migration and invasion of cervical cancer cells in vitro. 2.8. Statistical Analysis. Data were presented by mean- ± standard deviation and analyzed with SPSS 21.0 (SPSS, IBM Corp, Armonk, NY). *e differences between groups 3.4. Knockdown of HOTAIR Downregulated Expression of were analyzed with one-way analysis of variance (ANOVA) Stem Makers in Cervical Cancer. In order to explore whether or two-tailed Student’s t-test. *e correlation of miR-203 HOTAIR participates in regulating stem properties of cer- expression with HOTAIR was analyzed with Pearson’s vical cancer, the levels of HOTAIR in two stem-like cells and their parental cells were evaluated. Data showed that the correlation analysis. P< 0.05 was considered statistical significance. HOTAIR level in both stem-like cells was higher than that in 4 Journal of Oncology NANOG OCT4 CD44 3 4 5 ** 3.5 2.5 ** 2.5 1.5 2 1.5 0.5 0.5 0 0 Control Control Control Serum-free Serum-free Serum-free (a) (b) (c) ALDH1 CD133 SOX2 6 5 6 ** ** 5 5 ** 4 4 3 3 2 2 1 1 0 0 0 Control Control Control Serum-free Serum-free Serum-free (d) (e) (f) NANOG OCT4 CD44 2.5 2.5 3 ** ** 2.5 2 2 1.5 1.5 1.5 1 1 0.5 0.5 0.5 0 0 0 Control Control Control cisplatin resistant cisplatin resistant cisplatin resistant (g) (h) (i) ALDH1 CD133 SOX2 3 3 4 ** ** 2.5 2.5 ** 2 2 1.5 1.5 2 1 1 0.5 0.5 0 0 0 Control Control Control cisplatin resistant cisplatin resistant cisplatin resistant (j) (k) (l) Figure 1: Continued. Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Journal of Oncology 5 1.6 NANOG ** ** OTC4 1.2 CD133 ** 0.8 SOX2 0.4 β-actin Control cisplatin NANOG OTC4 CD133 SOX2 resistant Control cisplatin resistant (m) (n) Figure 1: Cisplatin-resistant cells and serum-free cultured cells from cervical cancer cell lines exhibit stem-like properties. (a–f) Detection of the stem cell markers NANOG, OCT4, CD44, ALDH1, CD133, and SOX2 in HeLa cells cultured in a serum-free medium by qRT-PCR. (g–l) Detection of the stem cell markers NANOG, OCT4, CD44, ALDH1, CD133, and SOX2 in cisplatin-resistant HeLa cells by qRT-PCR. (m) Western blot analysis of the stem cell markers NANOG, OCT4, CD133, and SOX2 in cisplatin-resistant HeLa cells. (n) Statistic analysis ∗ ∗ ∗∗ relative destiny of (m). P values represent significant difference based on Student’s t-test from three replicates ( P, P< 0.01). cisplatin Hela SiHa 10 10 ** Control resistant Serum-free ** 9 9 8 8 7 7 Hela ** 6 6 ** 5 5 4 4 SiHa 3 3 2 2 1 1 0 0 Control cisplatin resistant Serum-free (a) (b) cisplatin Hela SiHa 4 3 Control resistant Serum-free 3.5 ** 2.5 ** ** 0hr 2.5 Hela 2 1.5 1.5 48hr 0.5 0.5 0 0 Control 0hr cisplatin resistant SiHa Serum-free 48hr (c) (d) Figure 2: Cervical cancer stem-like cells hold superior migration and invasion capability. (a, b) Transwell assays indicated that both cisplatin-resistant and serum-free cultured cells exhibited promoted invasive ability in HeLa and SiHa cells (×100, magnifications). (c, d) *e migration ability of cancer stem cells enriched after cisplatin or serum-free culture medium treatment was enhanced in HeLa and SiHa cells. ∗ ∗ ∗∗ P values represent significant difference based on Student’s t-test from three replicates ( P< 0.05, P< 0.01). their parental cells (Figure 4(a) and 4(b)). Furthermore, the targeting HOTAIR resulted in a statistical decrease of all six role of HOTAIR on stem properties of cervical cancer was stem markers NANOG, OCT4, CD44, ALDH1, CD133, and explored through the loss-of-function approach. As shown SOX2. *ese findings suggested that HOTAIR should hold a in Figure 4(c) and 4(d), transfection of small interference positive role on stem properties of cervical cancer. Relative wound closure Relative cell invasion Relative destiny (gene/β-actin) 6 Journal of Oncology Control pcHOTAIR siHOTAIR Hela SiHa 5 4 ** 4 ** Hela ** ** 0 0 SiHa Control Control pcHOTAIR pcHOTAIR siHOTAIR siHOTAIR (a) (b) Control pcHOTAIR siHOTAIR Hela SiHa 2 2 ** 1.5 1.5 ** 0hr 1 1 Hela ** ** 0.5 0.5 48hr 0 0 Control Control pcHOTAIR pcHOTAIR 0hr siHOTAIR siHOTAIR SiHa 48hr (c) (d) Figure 3: HOTAIR promoted migration and invasion of cervical cancer cells in vitro. (a, b) Transwell assays showed that HOTAIR promoted the invasion of HeLa and SiHa cells (×100, magnifications). (c, d) HOTAIR promoted the migratory ability in HeLa and SiHa cells ∗ ∗ as indicated by wound healing assay. P values represent significant difference based on Student〙s t-test from three replicates ( P< 0.05, ∗∗ P< 0.01). 3 3 ** ** 2.5 2.5 2 2 1.5 1.5 1 1 0.5 0.5 0 0 Control cisplatin Control cisplatin resistant resistant (a) (b) CD44 NANOG 1.2 1.5 0.8 1 0.6 ** 0.4 0.5 0.2 ** 0 0 si-NC si-HOTAIR si-NC si-HOTAIR (c) (d) Figure 4: Continued. Relative mRNA level Relative expression of HOTAIR (%β-actin) (/β-actin) Relative wound closure Relative cell invasion Relative mRNA level Relative expression of HOTAIR (%β-actin) (/β-actin) Journal of Oncology 7 CD133 OCT4 1.5 1.5 1 1 0.5 0.5 ** ** 0 0 si-NC si-HOTAIR si-NC si-HOTAIR (e) (f) SOX2 ALDH1 1.4 1.4 1.2 1.2 1 1 0.8 0.8 0.6 0.6 0.4 0.4 ** 0.2 0.2 ** 0 0 si-NC si-HOTAIR si-NC si-HOTAIR (g) (h) 1.2 NANOG 1.0 OTC4 0.8 ** CD133 0.6 ** ** 0.4 ** SOX2 0.2 β-actin NANOG OTC4 CD133 SOX2 si-NC si-HOTAIR (i) (j) Figure 4: RNA interference targeting HOTAIR generated downregulation of stem cell markers. (a, b) Cancer stem cells of HeLa enriched by treatment with cisplatin (a) or culture in a serum-free medium (b) showed elevated expression of HOTAIR. (c–h) RNA interference targeting HOTAIR downregulated the stem cell markers NANOG, OCT4, CD44, ALDH1, CD133, and SOX2 in cancer stem cells of HeLa. NC, negative control. (i) Western blot analysis of the stem cell markers NANOG, OCT4, CD133, and SOX2 in cisplatin-resistant HeLa cells after RNA interference targeting HOTAIR. (g) Statistic analysis relative destiny of (i). P values represent significant difference based on ∗ ∗∗ Student’s t-test from three replicates ( P< 0.05, P< 0.01). miR-203 downregulated the expressions of stem markers of cervical cancer. In order to explore whether miR-203 involves in regu- upregulation of six genes mentioned above (Figure 5(c)– lating the stemness of cervical cancer cells, the expression 5(g)). *ese findings indicated that miR-203 should exert a level of miR-203 in cisplatin-resistant cells, serum-free negative effect on stem properties of cervical cancer. cultured cells, and their parental cells were identified. *e interaction between HOTAIR and miR-203 was Figure 5(a) and 5(b) shows that miR-203 was statistically explored in further study. We found that transfection with downregulated accompanying with the acquisition of stem small interference RNA targeting HOTAIR resulted in a properties of cervical cancer. Furthermore, the expression statistical increase of miR-203 compared with those normal changes of stem markers along with miR-203 alteration were control cells (Figure 6(a)), indicating that miR-203 was detected and semiquantified. Data showed that transfection negatively correlated with HOTAIR in cervical cancer cells. Furthermore, the expression changes of ZEB1 and ZEB2 with miR-203 mimics caused statistical downregulation in OCT4, CD44, NANOG, CD133, SOX2, and ALDH1, while along with alteration of miR-203 were detected and analyzed cells treated with the miR-203 inhibitor revealed significant (Figure 6(b)). Compared with normal control cells, Relative mRNA level Relative mRNA level (%β-actin) (%β-actin) si-NC si-HOTAIR Relative mRNA level Relative mRNA level Relative destiny (gene/β-actin) (%β-actin) (%β-actin) 8 Journal of Oncology 1.5 1.2 OCT4 1 0.8 ** 0.6 ** 0.5 0.4 0.2 ** 0 0 Control cisplatin resistant Control Serum free NC miR-203 mimics miR-203 inhibitor (a) (b) (c) CD44 NANOG CD133 15 8 5 ** 4 ** ** ** ** ** 0 0 0 NC NC NC miR-203 mimics miR-203 mimics miR-203 mimics miR-203 inhibitor miR-203 inhibitor miR-203 inhibitor (d) (e) (f) SOX2 ALDH1 NANOG 6 5 ** ** OTC4 CD133 SOX2 ** β-actin ** 0 0 NC NC miR-203 mimics miR-203 mimics miR-203 inhibitor miR-203 inhibitor (g) (h) (i) ** ** ** ** ** ** ** ** NANOG OTC4 CD133 SOX2 NC miR-203 mimics miR-203 inhibitor (j) Figure 5: miR-203 downregulated the expressions of stem markers of cervical cancer. (a, b) Cancer stem cells of HeLa enriched by treatment with cisplatin (a) or culture in a serum-free medium (b) showed the downregulated expression of miR-203. (c–h) Expression changes of the stem markers NANOG, OCT4, CD44, ALDH1, CD133, and SOX2 in cancer stem cells of HeLa along with miR-203 alteration were detected and semiquantified by qRT-PCR. NC, negative control. (i). Western blot analysis of the stem cells markers NANOG, OCT4, CD133, and SOX2 in cisplatin-resistant HeLa cells along with miR-203 alteration. (g). Statistic analysis relative destiny of (i). P values represent ∗ ∗∗ significant difference based on Student’s t-test from three replicates ( P< 0.05, P< 0.01). HOTAIR interacted with miR-203 to post- transcriptionally regulate the expressions of ZEB1. Relative mRNA level (%β-actin) Relative expression of miR-203 (/β-actin) Relative mRNA level (%β-actin) Relative destiny (gene/β-actin) Relative expression of miR-203 (/β-actin) Relative mRNA level (%β-actin) Relative mRNA level (%β-actin) Relative mRNA level (%β-actin) Relative mRNA level (%β-actin) NC miR-203 mimics miR-203 inhibitor Journal of Oncology 9 2.5 1.5 ZEB1 0.5 ZEB2 si-NC si-HOTAIR β-actin (a) (b) ZEB1 ZEB2 16 14 ** ** ** ** 0 0 NC NC miR-203 mimics miR-203 mimics miR-203 inhibitor miR-203 inhibitor (c) (d) Figure 6: HOTAIR interacted with miR-203 to regulate the expression of ZEB1 and ZEB2. (a) Cells were treated with RNA interference targeting HOTAIR, and the miR-203 level was detected by qRT-PCR. *e result indicated that miR-203 was negatively correlated with HOTAIR in HeLa cells. (b–d) Expression changes of ZEB1 and ZEB2 along with alteration of miR-203 was detected and analyzed by Western blot (b) and qPCR (c, d). NC, negative control. P values represent significant difference based on Student’s t-test from three ∗ ∗∗ replicates ( P< 0.05, P< 0.01). differentiation into mature and specialized cancer cell transfection with miR-203 mimics generated statistical downregulation of ZEB1 and ZEB2, while transfection with types. Cancer stem cells express specific markers. How- ever, there is currently no universal markers for isolation the miR-203 inhibitor revealed a significant increase of their levels (Figure 6(c) and 6(d)). and identification of cancer stem cells in any type of cancer. *erefore, cancer stem cells are commonly har- vested and enriched through different approaches based 4. Discussion on its characteristics [14]. In current approaches, cell lines Cervical cancer is the second most common type of ma- cultured with definite chemotherapeutics or with defined lignant tumors and the fourth leading cause of cancer-as- serum-free culture conditions are commonly used sociated mortalities in women worldwide [6, 7]. Cervical methods to enrich cancer stem cells from mixed pop- carcinoma has a risk of considerable recurrence and me- ulations and have been recognized effective to establish in vitro models for cancer stem cells expansion [15]. *us, tastasis following conventional therapy, leading to a high mortality. Currently, more and more evidence has con- these two methods were employed in the present study to harvest and enrich cervical cancer stem cells from the firmed that a small population of cancer stem cells may be responsible for tumor recurrence, relapse, metastasis, and human cervical adenocarcinoma cell lines HeLa and the resistance to conventional treatment [13]. *us, a complete cervical squamous carcinoma cell SiHa. Data showed that understanding of the molecular mechanisms underlying either cisplatin-resistant cells or serum-free cultured cells acquisition and maintaining of stemness of cervical cancer expressed statistically higher expression levels of CD133 stem cells (CCSCs) is essential to provide effective methods and CD44, which have been confirmed as contributors in to eradicate malignant tumors. migration and aggregation of cancer cells and cancer Cancer stem cells are a subpopulation within cancer development and hence have been broadly accepted as cells, characterized by the abilities of self-renewal and general cancer stem cell markers in many types of Relative mRNA level (%β-actin) Relative expression of miR-203 (/β-actin) Relative mRNA level (%β-actin) NC miR-203 mimics miR-203 inhibitor 10 Journal of Oncology was confirmed in the present study, which is exhibited as malignant tumors, including cervical carcinoma [13]. Additionally, cisplatin-resistant cells and serum-free cul- statistical decreased levels along with enrichment of cervical cancer stem cells and the suppressive effect on the expres- tured cells increased the expression of ALDH1, OCT4, and NANOG. Previous data have identified that the high ac- sions of all six stemness markers. Besides, ZEB1’s ability to tivity of ALDH1 in a subpopulation of cervical cancer cells repress stemness-inhibiting miR-203 expression to promote exhibited stemness properties with great capacity for self- tumorigenicity can be seen in previous studies [30]. It was renewal, high differentiation potential, and high tumori- presumed that the interaction of miR-203 with ZEB1 should genicity. Also, cells with high ALDH1 activity were re- contribute to stemness acquisition of cervical cancer cells. sistant to cisplatin and increased the expression of OCT4 In conclusion, both chemotherapeutics resistance and serum-free culture can be used to enrich cancer stem cells and NANOG, which are pluripotency markers [16]. Our data also showed that cisplatin resistance and serum-free from human cervical cancer HeLa and SiHa cells. And, lncRNA HOTAIR holds positive effects for stem acquisition culture significantly upregulated SOX2. Previous reports demonstrated that SOX2-positive cervical cancer cells of cervical cancer, which should correlate to its interaction with miR-203. *e EMTactivator ZEB1 could regulate miR- shared all the characteristics with cancer stem cells in- cluding self-renewal, differentiation, and tumor-initiating 203 expression, therefore, to maintain stem properties of properties [17]. And, SOX2-positive cells displayed cervical cancer cells. overexpression of OCT4 and ALDH1. *erefore, the overexpression of these stemness-associated markers Data Availability showed here indicated that cisplatin-resistant and serum- free cultured cervical cancer cells were cancer stem-like *e data used to support the findings of this study are in- cluded within the article. cells. Cervical cancer stem cells have been recognized essential contributors for distal metastasis and recurrence of cervical Conflicts of Interest carcinoma. As expected, cervical cancer stem-like cells *e authors declare that there are no conflicts of interests. enriched from either HeLa or SiHa cells revealed greater capability to migrate and invade in vitro compared with their parental cells. Interestingly, HOTAIR also promoted the Authors’ Contributions migration and invasion level of cervical cancer cells, just like Wenying Zhang performed the major experiments. Jing Liu cervical cancer stem-like cells. Similarity of migration and performed the experiment of migration. Qiongwei Wu invasion suggested that HOTAIR should exert a positive performed the experiments of Western blot. Yu Liu provided effect on stemness acquisition of cervical cancer cells. Ac- the statistical data. Chengbin Ma directed the research and tually, HOTAIR’s pivotal role on stem cells of various types edited the manuscript. All the authors have read and ap- of malignant tumors has been reported previously [18], but proved the final manuscript. the role of HOTAIR on the phenotype of cervical cancer stem cells was currently unknown. In order to identify this hypothesis, effects of HOTAIR on the expressions of Acknowledgments stemness-associated markers was explored in present study. *is work was supported by the grants from Shanghai Data showed that treatment of cisplatin resistance and se- Municipal Health and Health Committee (No. 201840312). rum-free culture actually resulted in significant upregulation of HOTAIR; furthermore, knockdown of HOTAIR gener- References ated statistical downregulation of the six stemness markers mentioned above. *ese findings suggested that HOTAIR [1] A. Yang, E. Farmer, T. C. Wu, and C.-F. Hung, “Perspectives should be a contributor of stemness acquisition of cervical for therapeutic HPV vaccine development,” Journal of Bio- cancer. medical Science, vol. 23, no. 1, p. 75, 2016. HOTAIR regulated the stemness of cancer stem cells [2] M. Vu, J. Yu, O. A. Awolude, and L. Chuang, “Cervical cancer through various approaches, among which HOTAIR in- worldwide,” Current Problems in Cancer, vol. 42, no. 5, teraction with definite miRNAs was generally accepted as an pp. 457–465, 2018. important mechanism. Bioinformatics analysis and previous [3] R. Huang and E. K. Rofstad, “Cancer stem cells (CSCs), studies have identified that HOTAIR can interact with miR- cervical CSCs and targeted therapies,” Oncotarget, vol. 8, no. 21, pp. 35351–35367, 2017. 203, which has been considered a tumor suppressive [4] M. Li, B. Lu, X. Dong et al., “Enhancement of cisplatin-in- miRNA. Current reports have documented that miR-203 is a duced cytotoxicity against cervical cancer spheroid cells by stemness-inhibiting miRNA owing to its modulation of targeting long non-coding RNAs,” Pathology, Research & stemness properties through regulating the expressions of Practice, vol. 215, no. 11, Article ID 152653, 2019. various targets in different types of cancers, including [5] H. Aalijahan and S. Ghorbian, “Long non-coding RNAs and SOCS3, survivin, Bmi-1, and GATA6. [19–23]. Actually, cervical cancer,” Experimental and Molecular Pathology, epigenetic silencing of miR-203 is required for cancer stem vol. 106, pp. 7–16, 2019. cell properties and epithelial-mesenchymal transition [6] L. Li, B. Liu, O. L. Wapinski et al., “Targeted disruption of (EMT), which is a rich source of cancer stem cells [24–29]. Hotair leads to homeotic transformation and gene dere- *e stemness-inhibitory role of miR-203 in cervical cancer pression,” Cell Reports, vol. 5, no. 1, pp. 3–12, 2013. Journal of Oncology 11 [7] T. Rajagopal, S. Talluri, R. L. Akshaya, N. R. Dunna, and Oncology Research Featuring Preclinical and Clinical Cancer L. R. N. A. Hotair, “HOTAIR LncRNA: a novel oncogenic =erapeutics, vol. 26, no. 8, pp. 1155–1165, 2018. propellant in human cancer,” Clinica Chimica Acta, vol. 503, [22] X. Yu, X. Jiang, H. Li, L. Guo, W. Jiang, and S.-H. Lu, “miR- 203 inhibits the proliferation and self-renewal of esophageal pp. 1–18, 2020. [8] R. Castro-Oropeza, J. Melendez-Zajgla, V. Maldonado, and cancer stem-like cells by suppressing stem renewal factor K. Vazquez-Santillan, “*e emerging role of lncRNAs in the Bmi-1,” Stem Cells and Development, vol. 23, no. 6, regulation of cancer stem cells,” Cellular Oncology, vol. 41, pp. 576–585, 2014. no. 6, pp. 585–603, 2018. [23] Y. Zhang, S.-y. Zhou, H.-z. Yan et al., “miR-203 inhibits [9] L. Tang, W. Zhang, B. Su, and B. Yu, “Long noncoding RNA proliferation and self-renewal of leukemia stem cells by tar- HOTAIR is associated with motility, invasion, and metastatic geting survivin and Bmi-1,” Scientific Reports, vol. 6, no. 1, potential of metastatic melanoma,” BioMed Research Inter- Article ID 19995, 2016. national, vol. 2013, Article ID 251098, , 2013. [24] Y. Deng, G. Zhu, H. Luo, and S. Zhao, “MicroRNA-203 as a [10] D. N. Zhong, Y. H. Luo, W. J. Mo et al., “High expression of stemness inhibitor of glioblastoma stem cells,” Molecules and long non-coding HOTAIR correlated with hepatocarcino- Cells, vol. 39, no. 8, pp. 619–624, 2016. genesis and metastasis,” Molecular Medicine Reports, vol. 17, [25] S.-Y. Ju, S.-H. Chiou, and Y. Su, “Maintenance of the stemness no. 1, pp. 1148–1156, 2018. in CD44+ HCT-15 and HCT-116 human colon cancer cells requires miR-203 suppression,” Stem Cell Research, vol. 12, [11] X. Guo, H. Xiao, S. Guo et al., “Retracted: long noncoding RNA HOTAIR knockdown inhibits autophagy and epithelial- no. 1, pp. 86–100, 2014. mesenchymal transition through the Wnt signaling pathway [26] O. F. Karatas, I. Suer, B. Yuceturk et al., “Identification of in radioresistant human cervical cancer HeLa cells,” Journal of microRNA profile specific to cancer stem-like cells directly Cellular Physiology, vol. 234, no. 4, pp. 3478–3489, 2019. isolated from human larynx cancer specimens,” BMC Cancer, [12] X. Tian, F. Tao, B. Zhang, J.-T. Dong, and Z. Zhang, “*e miR- vol. 16, no. 1, p. 853, 2016. 203/SNAI2 axis regulates prostate tumor growth, migration, [27] P. Sahranavardfard, J. Firouzi, M. Azimi et al., “MicroRNA- angiogenesis and stemness potentially by modulating GSK- 203 reinforces stemness properties in melanoma and aug- 3β/β-CATENIN signal pathway,” IUBMB Life, vol. 70, no. 3, ments tumorigenesis in vivo,” Journal of Cellular Physiology, pp. 224–236, 2018. vol. 234, no. 11, pp. 20193–20205, 2019. [13] G. Mendoza-Almanza, E. Ort´ız-Sanchez, ´ L. Rocha-Zavaleta, [28] J. H. Taube, G. G. Malouf, E. Lu et al., “Epigenetic silencing of C. Rivas-Santiago, E. Esparza-Ibarra, and J. Olmos, “Cervical microRNA-203 is required for EMT and cancer stem cell cancer stem cells and other leading factors associated with properties,” Scientific Reports, vol. 3, no. 1, p. 2687, 2013. [29] L. Tian, M. Li, J. Ge et al., “MiR-203 is downregulated in cervical cancer development,” Oncol Lett, vol. 18, no. 4, pp. 3423–3432, 2019. laryngeal squamous cell carcinoma and can suppress prolif- [14] J. Zhang, X. Chen, L. Bian, Y. Wang, and H. Liu, “CD44+/ eration and induce apoptosis of tumours,” Tumor Biology, CD24+-Expressing cervical cancer cells and radioresistant vol. 35, no. 6, pp. 5953–5963, 2014. cervical cancer cells exhibit cancer stem cell characteristics,” [30] U. Wellner, J. Schubert, U. C. Burk et al., “*e EMT-activator Gynecologic and Obstetric Investigation, vol. 84, no. 2, ZEB1 promotes tumorigenicity by repressing stemness- pp. 174–182, 2019. inhibiting microRNAs,” Nature Cell Biology, vol. 11, no. 12, [15] L. Wang, H. Guo, C. Lin, L. Yang, and X. Wang, “Enrichment pp. 1487–1495, 2009. and characterization of cancer stem-like cells from a cervical cancer cell line,” Molecular Medicine Reports, vol. 9, no. 6, pp. 2117–2123, 2014. [16] S.-Y. Liu and P.-S. Zheng, “High aldehyde dehydrogenase activity identifies cancer stem cells in human cervical cancer,” Oncotarget, vol. 4, no. 12, pp. 2462–2475, 2013. [17] X.-F. Liu, W.-T. Yang, R. Xu, J.-T. Liu, and P.-S. Zheng, “Cervical cancer cells with positive Sox2 expression exhibit the properties of cancer stem cells,” PloS One, vol. 9, no. 1, Article ID e87092, 2014. [18] J. Deng, M. Yang, R. Jiang, N. An, X. Wang, and B. Liu, “Long non-coding RNA HOTAIR regulates the proliferation, self- renewal capacity, tumor formation and migration of the cancer stem-like cell (CSC) subpopulation enriched from breast cancer cells,” PloS One, vol. 12, no. 1, Article ID e0170860, 2017. [19] H. T. Lai, W. K. Tseng, S. W. Huang, T. C. Chao, and Y. Su, “MicroRNA-203 diminishes the stemness of human colon cancer cells by suppressing GATA6 expression,” Journal of Cellular Physiology, vol. 235, no. 3, pp. 2866–2880, 2020. [20] N. Muhammad, S. Bhattacharya, R. Steele, and R. B. Ray, “Anti-miR-203 suppresses ER-positive breast cancer growth and stemness by targeting SOCS3,” Oncotarget, vol. 7, no. 36, pp. 58595–58605, 2016. [21] J. Shen, J. Zhang, M. Xiao, J. Yang, and N. Zhang, “miR-203 suppresses bladder cancer cell growth and targets Twist1,” http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Oncology Hindawi Publishing Corporation

HOTAIR Contributes to Stemness Acquisition of Cervical Cancer through Regulating miR-203 Interaction with ZEB1 on Epithelial-Mesenchymal Transition

Download PDF
11 pages

Loading next page...
 
/lp/hindawi-publishing-corporation/hotair-contributes-to-stemness-acquisition-of-cervical-cancer-through-ETmdmWjTWI

References (33)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2021 Wenying Zhang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8450
eISSN
1687-8469
DOI
10.1155/2021/4190764
Publisher site
See Article on Publisher Site

Abstract

Hindawi Journal of Oncology Volume 2021, Article ID 4190764, 11 pages https://doi.org/10.1155/2021/4190764 Research Article HOTAIR Contributes to Stemness Acquisition of Cervical Cancer through Regulating miR-203 Interaction with ZEB1 on Epithelial-Mesenchymal Transition Wenying Zhang , Jing Liu , Qiongwei Wu, Yu Liu, and Chengbin Ma Department of Gynecology, Shanghai Changning Maternity and Infant Health Hospital, Shanghai 200051, China Correspondence should be addressed to Chengbin Ma; macb66@126.com Received 7 June 2021; Accepted 10 August 2021; Published 10 September 2021 Academic Editor: Prasanna Kumar Santhekadur Copyright © 2021 Wenying Zhang et al. *is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Cervical cancer stem cells contribute respond to considerable recurrence and metastasis of patients with cervical cancer. *e stemness properties were partly regulated by the interaction of lncRNAs and miRNAs. HOTAIR functions as an oncogenic lncRNA. Previous research studies revealed its role in regulating stemness properties in various cancers. However, the role of HOTAIR in cervical cancer stem cells is still unknown. Here, cisplatin-resistant and serum-free cultured cells exhibited stem cells properties. Cervical cancer stem cells exhibited greater invasion and migration compared with their parental cells, which was similar to cells over- expressing HOTAIR. HOTAIR was significantly overexpressed in cervical cancer stem cells, and knockdown of HOTAIR generated statistical downregulation of stemness markers. Additionally, HOTAIR expression was negatively correlated with the level of miR- 203, which was found to be an inhibitory miRNA in regulating the expressions of stemness markers. Also, miR-203 expression was negatively correlated with ZEB1. *ese findings suggested that HOTAIR should be a positive contributor in stemness acquisition of cervical cancer cells, and this effect should correlate with the interaction with miR-203, which can be suppressed by ZEB1. HOX transcript antisense intergenic RNA (HOTAIR) is 1. Introduction transcribed from the antisense strand of the homeobox gene Despite considerable advances in screening, diagnosis, C cluster (HOXC) and recognized as an oncogenic lncRNA prevention, and treatment, cervical cancer is still one of the in various types of malignant tumors, including cervix leading causes of cancer-related death in women worldwide cancer. HOTAIR recruited the PRC2 (polycomb repressive [1, 2]. Surgery and chemoradiotherapy offer survival ad- complex 2) complex to induce methylation of H3K27me3 vantage for patients with cervical carcinoma. However, and ultimately provoke gene silencing. Also, HOTAIR can recurrence occurs in∼35% cervical cancer patients and 90% recruit the MLL1 methyltransferase and induce H3K4me3, thereby relaxing chromatin and allowing binding of tran- were found within three years after the initial management. Burgeoning evidence indicated that current cancer treat- scription machinery [6, 7]. Besides, HOTAIR is capable to ments failed to eradicate a subset of cells within tumor sponge definite miRNAs to avoid their effect on mRNA known as cancer stem cells (CSCs); therefore, this failure targets. *rough aforementioned approaches, HOTAIR allows CSCs to self-renew and provoke tumor relapse [3]. exerts its crucial effects on proliferation, migration, and Recently, various long noncoding RNAs (lncRNAs) have invasion in cervical cancer. Recently, HOTAIR has been been recognized crucial players in regulating CSC properties reported to be elevated in CSCs derived from various ma- and allowing them to self-renew and promote tumor growth lignant tumors [8]. HOTAIR overexpression is believed to [4, 5]. *us, these lncRNAs hold potential as specific targets be associated with the acquisition of stem cell properties, to eliminate the CSC fraction, thereby, to eradicate cancer. which resulted in an increased tumor growth and metastatic 2 Journal of Oncology potential [9, 10]. Our previous data showed that HOTAIR the SanPrep Column microRNA Extraction Kit (Cat. No: participated in chemoresistance of cervical cancer through B518811; Sangon Biotech (Shanghai) Co., Ltd., China) and triggering epithelial-to-mesenchymal transition (EMT), the first-strand cDNA synthesis was carried out using which was considered the main factor responding for miRNA First-Strand cDNA Synthesis (Tailing Reaction) stemness acquisition by HOTAIR [11]. Actually, HOTAIR (Cat. No: B532451; Sangon Biotech (Shanghai) Co., Ltd., interacted to miR-203, which has been recognized as a China) according to the manufacturer’s protocol. PCR pivotal contributor in EMT and cancer stem cell properties amplification was carried out in a 20 μL reaction system, through suppressing the expressions of various targets. which contained 2 μL cDNA, 10 μL SYBR Premix Ex Taq II However, the role of HOTAIR and miR-203 in acquisition of (TaKaRa, Otsu, Shiga, Japan), and 10 μM of both sense and cervical cancer stem cells is still unknown [12]. antisense primers. *e expressions were calculated using the −ΔΔCT In present study, chemotherapeutics resistance and se- 2 method. Experiments were performed in triplicate. rum-free culture were proven to be effective to enrich cell Primers used here are presented in Table 1. subpopulation with stemness properties from human cer- vical cancer HeLa and SiHa cells. HOTAIR was statistically 2.4. Cell Transfection. Cell transfection was performed using upregulated along with enrichment of cervical cancer stem Lipofectamine 2000 (Invitrogen) according to the manufac- cells, and knockdown of HOTAIR significantly down- turer’s protocol. In brief, the target plasmid (1 μg) and Lip- regulated the expressions of stemness markers. *e ofectamine 2000 (3 μL) were previously diluted by 100 μL HOTAIR level was negatively correlated to the expression of serum-free Opti-MEM medium (Gibco, Grand Island, NY) miR-203, which promoted EMT and regulated by ZEB1. and then mixed up after being placed at room temperature for 5 min. *en, the mixture was added into the medium of cells 2. Materials and Methods that reached to 50% confluence and left for another 20 min. After being incubated for 6–8 hours, the original medium was 2.1. Cell Culture. *e human cervical adenocarcinoma cell replaced with a complete growth medium, and then, the cells lines HeLa (ATCC CRM-CCL-2 ) and the cervical TM were incubated for 24–48 hours. In the present study, squamous carcinoma cell SiHa (ATCC HTB-35 ) ob- recombinant vector pc.DNA3.1-HOTAIR was transfected tained from American Type Culture Collection (ATCC; into cells to overexpress HOTAIR, while cells transfected with Manassas, VA, USA) were cultured in Eagle’s Minimum pc.DNA3.1 were used as controls. Small interference RNA Essential Medium (Catalog No. 30-2003) supplemented with targeting HOTAIR (F: CTCCGCTTCGCAGTGGAATGG; R: 10% fetal bovine serum (FBS) (st30-3302; PAN, Germany) ° TCTCGCCGCCGTCTGTAACTC) was transfected into and were maintained at 37 C in a 5% CO humidified at- cervical cancer cells to knockdown HOTAIR, and cells mosphere. Cell layers that reached 80% confluence were transfected with scramble siRNAs were used as controls. In dispersed by 0.25% (w/v) Trypsin-0.53 mM EDTA solution. order to explore the role of miR-203 in cervical cancer cells, *en, cells were treated with a complete growth medium and miR-203 mimics and miR-203 inhibitor were respectively aspirated by gently pipetting. *e cell suspension was transfected into cells. transmitted to a new culture flask at a ratio of 1 : 3 and incubated at 37 C in a 5% CO humidified atmosphere. During subcultivation, the medium was renewed 3 times per 2.5. Cell Migration and Invasion Assay. Migration and in- week. Cells within 3 to 5 passages were used in this vasion of differently treated cervical cancer cells were de- experiment. termined by using culture inserts of 8 μm pore size (Transwell, Costar) that were placed into the wells of 24-well culture plates. For invasion assay, cell inserts were precoated 2.2. Enrichment of Cervical Cancer Stem Cells. HeLa and with Matrigel Matrix (BD Biosciences) (100 μg/well). *e SiHa cells were trypsinized and washed twice with PBS. After 1 × 10 cells in serum-free medium were seeded into the that, the cells were resuspended with serum-free DMEM/ upper chamber, while the lower chamber was added with F12 medium containing 2% B27, 20 ng/mL bFGF, and 20 ng/ 500 μL of DMEM medium supplemented with 10% FBS. mL EGF. *e cells were incubated at 37 C with 5% CO . After being incubated at 37 C with 5% CO for 48–72 h, the Subculture was performed every 2–4 days. cells migrated or invaded through the pores were fixed with 4% paraformaldehyde (Beyotime Biotechnology, Shanghai, 2.3. qPCR Assay. Total RNA was extracted with TRIzol China) and stained with 0.1% crystal violet (Beyotime Reagent (Cat. No: 15596018; Invitrogen, *ermo Fisher Biotechnology, Shanghai, China) for 30 min. Images were Scientific, Wilmington, DE, USA), and its purity was de- captured, and the cells were calculated on five random fields termined using the NanoDrop spectrophotometer (ND- of each insert. 2000; *ermo Fisher Scientific, Waltham, MA, USA). *e RNA samples with high purity were reversely transcribed into complementary DNAs (cDNAs) using the TAKARA 2.6. Migration Assay. *e differently treated cervical cancer PrimeScript RTreagent kit with gDNA Eraser (Perfect Real cells were harvested and seeded into 6-well plates at a Time) (Cat. No: RR047A; Takara, Dalian, China) according concentration of 1500 cells/well. *en, the cells were grown to the manufacturer’s instruction. In order to determine in Eagle’s Minimum Essential Medium supplemented with miRNA-203 expression, the microRNAs were purified using 10% FBS until confluence. *ereafter, a vertical line was Journal of Oncology 3 Table 1: Primer sequences in qPCR assay. 3. Results Primer Sequence (5′–3′) 3.1. Cisplatin-Resistant Cells and Serum-Free Cultured Cells HOTAIR-F CTCCGCTTCGCAGTGGAATGG from Cervical Cancer Cell Lines Exhibit Stem-Like Properties. HOTAIR-R TCTCGCCGCCGTCTGTAACTC In this study, stem-like cells were enriched from two human CD133-F ACCGACTGAGACCCAACATC cervical cancer cell lines, HeLa and SiHa, in presence of CD133-R GACCGCAGGCTAGTTTTCAC cisplatin and in a serum-free medium. *en, enriched cis- NANOG-F CTCGCTTCGGCAGCACA platin-resistant cells and serum-free cultured cells were NANOG-R TGCTGGAGGCTGAGGTATTT submitted to detect the expressions of stem cell markers, SOX2-F TTTTGTCGGAGACGGAGAAG including NANOG, OCT4, CD44, ALDH1, CD133, and SOX2-R TTCATGTGCGCGTAACTGTC SOX2. Data showed that the expression level of these six CD44-F TGGAGCAAACACAACCTCTG CD44-R TGAGTCCACTTGGCTTTCTG marker genes in serum-free cultured HeLa cells revealed a OCT4-F GAAGGATGTGGTCCGAGTGT similar higher expression level of stem cell biomarkers than OCT4-R TGAAGTGAGGGCTCCCATAG their parental cells (Figure 1(a)–1(f)). And, the expression ALDH1-F TCCTGGTTATGGGCCTACAG level in cisplatin-resistant HeLa cells was significantly higher ALDH1-R CAAGTCGGCATCAGCTAACA than that in their parental cells (Figure 1(g)–1(l)). *e same HS-ACTB-F CCTGGCACCCAGCACAAT results were also found in SiHa cells (data not shown). *ese HS-ACTB-R GGGCCGGACTCGTCATAC findings suggested both cisplatin-resistant cells and serum- U6-F CTCGCTTCGGCAGCACA free cultured cells from cervical cancer cell lines exhibited miR-203-F GCCGCAGTGGTTCTTAACAGTTCA stem-like properties. General reverse primer AACGCTTCACGAATTTGC for amplifying miRNAs 3.2. Cervical Cancer Stem-Like Cells Hold Superior Migration drawn at the bottom of a six-well plate, which went through and Invasion Capability. In this study, HeLa and SiHa cells the center of the plate before seeding cells. *e cells were were treated with cisplatin or cultured in a serum-free photographed, and the wound width was quantified at 0 and medium to enrich cervical cancer stem cells. And then, 48 hours. cervical cancer stem-like cells and their parental cells were submitted to analyze invasion and migration. Compared with parental HeLa and SiHa cervical cancer cells, cancer 2.7. Western Blotting. *e proteins of differently treated stem cells resistant against cisplatin revealed significantly cervical cancer cells were extracted with RIPA Lysis Buffer more invaded cells through the pore (Figure 2(a) and 2(b)) (PP110; Protein Biotechnology Co., Ltd, China) according to and narrow wound closure (Figure 2(c) and 2(d)), which the manufacturer’s instruction. *en, the concentration of were inferior to the data from cancer stem cells cultured in the proteins was determined using a BCA protein assay kit the serum-free medium. (PP202; Protein Biotechnology Co., Ltd, China). Subse- quently, 30 µg proteins in each group were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis 3.3. HOTAIR Promoted Migration and Invasion of Cervical (SDS-PAGE). *e gels were then transferred onto a poly- Cancer Cells In Vitro. *e role of HOTAIR in migration and vinylidene fluoride (PVDF) membrane. *e membrane was invasion of cervical cancer cells was determined in vitro incubated in Tris-buffered saline containing 0.1% Tween-20 through both gain-of-function and loss-of-function ap- and 5% nonfat milk for 1 h. *en, the PVDF membrane was proaches. As shown in Figure 3, the overexpression of incubated overnight with primary antibodies against HOTAIR resulted in statistically more invaded either HeLa NANOG (ab203919; Abcam, USA), OCT4 (ab200834; or SiHa cells through the pores, while interference targeting Abcam, USA), CD133 (ab278053; Abcam, USA), SOX2 HOTAIR revealed a significant decrease in invaded cervical (ab92494; Abcam, USA), and β-actin (ab8227; Abcam, cancer cells. In addition, the effect of HOTAIR on migration USA). *en, the membrane was incubated with HRP-con- of both HeLa and SiHa cells were analyzed using wound jugated secondary antibody (ab205718; Abcam, USA) for 2 h closure assay. Data showed that overexpression of HOTAIR at room temperature. *e bands of individual proteins were produced statistically promoted migration of both HeLa and visualized using a chemiluminescence (ECL) kit (PP404; SiHa cells, while knockdown of HOTAIR exhibited signif- Protein Biotechnology Co., Ltd., China). icantly lower migration of either HeLa or SiHa cells. *ese findings suggested that HOTAIR promoted migration and invasion of cervical cancer cells in vitro. 2.8. Statistical Analysis. Data were presented by mean- ± standard deviation and analyzed with SPSS 21.0 (SPSS, IBM Corp, Armonk, NY). *e differences between groups 3.4. Knockdown of HOTAIR Downregulated Expression of were analyzed with one-way analysis of variance (ANOVA) Stem Makers in Cervical Cancer. In order to explore whether or two-tailed Student’s t-test. *e correlation of miR-203 HOTAIR participates in regulating stem properties of cer- expression with HOTAIR was analyzed with Pearson’s vical cancer, the levels of HOTAIR in two stem-like cells and their parental cells were evaluated. Data showed that the correlation analysis. P< 0.05 was considered statistical significance. HOTAIR level in both stem-like cells was higher than that in 4 Journal of Oncology NANOG OCT4 CD44 3 4 5 ** 3.5 2.5 ** 2.5 1.5 2 1.5 0.5 0.5 0 0 Control Control Control Serum-free Serum-free Serum-free (a) (b) (c) ALDH1 CD133 SOX2 6 5 6 ** ** 5 5 ** 4 4 3 3 2 2 1 1 0 0 0 Control Control Control Serum-free Serum-free Serum-free (d) (e) (f) NANOG OCT4 CD44 2.5 2.5 3 ** ** 2.5 2 2 1.5 1.5 1.5 1 1 0.5 0.5 0.5 0 0 0 Control Control Control cisplatin resistant cisplatin resistant cisplatin resistant (g) (h) (i) ALDH1 CD133 SOX2 3 3 4 ** ** 2.5 2.5 ** 2 2 1.5 1.5 2 1 1 0.5 0.5 0 0 0 Control Control Control cisplatin resistant cisplatin resistant cisplatin resistant (j) (k) (l) Figure 1: Continued. Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Relative mRNA level (/GAPDH) Journal of Oncology 5 1.6 NANOG ** ** OTC4 1.2 CD133 ** 0.8 SOX2 0.4 β-actin Control cisplatin NANOG OTC4 CD133 SOX2 resistant Control cisplatin resistant (m) (n) Figure 1: Cisplatin-resistant cells and serum-free cultured cells from cervical cancer cell lines exhibit stem-like properties. (a–f) Detection of the stem cell markers NANOG, OCT4, CD44, ALDH1, CD133, and SOX2 in HeLa cells cultured in a serum-free medium by qRT-PCR. (g–l) Detection of the stem cell markers NANOG, OCT4, CD44, ALDH1, CD133, and SOX2 in cisplatin-resistant HeLa cells by qRT-PCR. (m) Western blot analysis of the stem cell markers NANOG, OCT4, CD133, and SOX2 in cisplatin-resistant HeLa cells. (n) Statistic analysis ∗ ∗ ∗∗ relative destiny of (m). P values represent significant difference based on Student’s t-test from three replicates ( P, P< 0.01). cisplatin Hela SiHa 10 10 ** Control resistant Serum-free ** 9 9 8 8 7 7 Hela ** 6 6 ** 5 5 4 4 SiHa 3 3 2 2 1 1 0 0 Control cisplatin resistant Serum-free (a) (b) cisplatin Hela SiHa 4 3 Control resistant Serum-free 3.5 ** 2.5 ** ** 0hr 2.5 Hela 2 1.5 1.5 48hr 0.5 0.5 0 0 Control 0hr cisplatin resistant SiHa Serum-free 48hr (c) (d) Figure 2: Cervical cancer stem-like cells hold superior migration and invasion capability. (a, b) Transwell assays indicated that both cisplatin-resistant and serum-free cultured cells exhibited promoted invasive ability in HeLa and SiHa cells (×100, magnifications). (c, d) *e migration ability of cancer stem cells enriched after cisplatin or serum-free culture medium treatment was enhanced in HeLa and SiHa cells. ∗ ∗ ∗∗ P values represent significant difference based on Student’s t-test from three replicates ( P< 0.05, P< 0.01). their parental cells (Figure 4(a) and 4(b)). Furthermore, the targeting HOTAIR resulted in a statistical decrease of all six role of HOTAIR on stem properties of cervical cancer was stem markers NANOG, OCT4, CD44, ALDH1, CD133, and explored through the loss-of-function approach. As shown SOX2. *ese findings suggested that HOTAIR should hold a in Figure 4(c) and 4(d), transfection of small interference positive role on stem properties of cervical cancer. Relative wound closure Relative cell invasion Relative destiny (gene/β-actin) 6 Journal of Oncology Control pcHOTAIR siHOTAIR Hela SiHa 5 4 ** 4 ** Hela ** ** 0 0 SiHa Control Control pcHOTAIR pcHOTAIR siHOTAIR siHOTAIR (a) (b) Control pcHOTAIR siHOTAIR Hela SiHa 2 2 ** 1.5 1.5 ** 0hr 1 1 Hela ** ** 0.5 0.5 48hr 0 0 Control Control pcHOTAIR pcHOTAIR 0hr siHOTAIR siHOTAIR SiHa 48hr (c) (d) Figure 3: HOTAIR promoted migration and invasion of cervical cancer cells in vitro. (a, b) Transwell assays showed that HOTAIR promoted the invasion of HeLa and SiHa cells (×100, magnifications). (c, d) HOTAIR promoted the migratory ability in HeLa and SiHa cells ∗ ∗ as indicated by wound healing assay. P values represent significant difference based on Student〙s t-test from three replicates ( P< 0.05, ∗∗ P< 0.01). 3 3 ** ** 2.5 2.5 2 2 1.5 1.5 1 1 0.5 0.5 0 0 Control cisplatin Control cisplatin resistant resistant (a) (b) CD44 NANOG 1.2 1.5 0.8 1 0.6 ** 0.4 0.5 0.2 ** 0 0 si-NC si-HOTAIR si-NC si-HOTAIR (c) (d) Figure 4: Continued. Relative mRNA level Relative expression of HOTAIR (%β-actin) (/β-actin) Relative wound closure Relative cell invasion Relative mRNA level Relative expression of HOTAIR (%β-actin) (/β-actin) Journal of Oncology 7 CD133 OCT4 1.5 1.5 1 1 0.5 0.5 ** ** 0 0 si-NC si-HOTAIR si-NC si-HOTAIR (e) (f) SOX2 ALDH1 1.4 1.4 1.2 1.2 1 1 0.8 0.8 0.6 0.6 0.4 0.4 ** 0.2 0.2 ** 0 0 si-NC si-HOTAIR si-NC si-HOTAIR (g) (h) 1.2 NANOG 1.0 OTC4 0.8 ** CD133 0.6 ** ** 0.4 ** SOX2 0.2 β-actin NANOG OTC4 CD133 SOX2 si-NC si-HOTAIR (i) (j) Figure 4: RNA interference targeting HOTAIR generated downregulation of stem cell markers. (a, b) Cancer stem cells of HeLa enriched by treatment with cisplatin (a) or culture in a serum-free medium (b) showed elevated expression of HOTAIR. (c–h) RNA interference targeting HOTAIR downregulated the stem cell markers NANOG, OCT4, CD44, ALDH1, CD133, and SOX2 in cancer stem cells of HeLa. NC, negative control. (i) Western blot analysis of the stem cell markers NANOG, OCT4, CD133, and SOX2 in cisplatin-resistant HeLa cells after RNA interference targeting HOTAIR. (g) Statistic analysis relative destiny of (i). P values represent significant difference based on ∗ ∗∗ Student’s t-test from three replicates ( P< 0.05, P< 0.01). miR-203 downregulated the expressions of stem markers of cervical cancer. In order to explore whether miR-203 involves in regu- upregulation of six genes mentioned above (Figure 5(c)– lating the stemness of cervical cancer cells, the expression 5(g)). *ese findings indicated that miR-203 should exert a level of miR-203 in cisplatin-resistant cells, serum-free negative effect on stem properties of cervical cancer. cultured cells, and their parental cells were identified. *e interaction between HOTAIR and miR-203 was Figure 5(a) and 5(b) shows that miR-203 was statistically explored in further study. We found that transfection with downregulated accompanying with the acquisition of stem small interference RNA targeting HOTAIR resulted in a properties of cervical cancer. Furthermore, the expression statistical increase of miR-203 compared with those normal changes of stem markers along with miR-203 alteration were control cells (Figure 6(a)), indicating that miR-203 was detected and semiquantified. Data showed that transfection negatively correlated with HOTAIR in cervical cancer cells. Furthermore, the expression changes of ZEB1 and ZEB2 with miR-203 mimics caused statistical downregulation in OCT4, CD44, NANOG, CD133, SOX2, and ALDH1, while along with alteration of miR-203 were detected and analyzed cells treated with the miR-203 inhibitor revealed significant (Figure 6(b)). Compared with normal control cells, Relative mRNA level Relative mRNA level (%β-actin) (%β-actin) si-NC si-HOTAIR Relative mRNA level Relative mRNA level Relative destiny (gene/β-actin) (%β-actin) (%β-actin) 8 Journal of Oncology 1.5 1.2 OCT4 1 0.8 ** 0.6 ** 0.5 0.4 0.2 ** 0 0 Control cisplatin resistant Control Serum free NC miR-203 mimics miR-203 inhibitor (a) (b) (c) CD44 NANOG CD133 15 8 5 ** 4 ** ** ** ** ** 0 0 0 NC NC NC miR-203 mimics miR-203 mimics miR-203 mimics miR-203 inhibitor miR-203 inhibitor miR-203 inhibitor (d) (e) (f) SOX2 ALDH1 NANOG 6 5 ** ** OTC4 CD133 SOX2 ** β-actin ** 0 0 NC NC miR-203 mimics miR-203 mimics miR-203 inhibitor miR-203 inhibitor (g) (h) (i) ** ** ** ** ** ** ** ** NANOG OTC4 CD133 SOX2 NC miR-203 mimics miR-203 inhibitor (j) Figure 5: miR-203 downregulated the expressions of stem markers of cervical cancer. (a, b) Cancer stem cells of HeLa enriched by treatment with cisplatin (a) or culture in a serum-free medium (b) showed the downregulated expression of miR-203. (c–h) Expression changes of the stem markers NANOG, OCT4, CD44, ALDH1, CD133, and SOX2 in cancer stem cells of HeLa along with miR-203 alteration were detected and semiquantified by qRT-PCR. NC, negative control. (i). Western blot analysis of the stem cells markers NANOG, OCT4, CD133, and SOX2 in cisplatin-resistant HeLa cells along with miR-203 alteration. (g). Statistic analysis relative destiny of (i). P values represent ∗ ∗∗ significant difference based on Student’s t-test from three replicates ( P< 0.05, P< 0.01). HOTAIR interacted with miR-203 to post- transcriptionally regulate the expressions of ZEB1. Relative mRNA level (%β-actin) Relative expression of miR-203 (/β-actin) Relative mRNA level (%β-actin) Relative destiny (gene/β-actin) Relative expression of miR-203 (/β-actin) Relative mRNA level (%β-actin) Relative mRNA level (%β-actin) Relative mRNA level (%β-actin) Relative mRNA level (%β-actin) NC miR-203 mimics miR-203 inhibitor Journal of Oncology 9 2.5 1.5 ZEB1 0.5 ZEB2 si-NC si-HOTAIR β-actin (a) (b) ZEB1 ZEB2 16 14 ** ** ** ** 0 0 NC NC miR-203 mimics miR-203 mimics miR-203 inhibitor miR-203 inhibitor (c) (d) Figure 6: HOTAIR interacted with miR-203 to regulate the expression of ZEB1 and ZEB2. (a) Cells were treated with RNA interference targeting HOTAIR, and the miR-203 level was detected by qRT-PCR. *e result indicated that miR-203 was negatively correlated with HOTAIR in HeLa cells. (b–d) Expression changes of ZEB1 and ZEB2 along with alteration of miR-203 was detected and analyzed by Western blot (b) and qPCR (c, d). NC, negative control. P values represent significant difference based on Student’s t-test from three ∗ ∗∗ replicates ( P< 0.05, P< 0.01). differentiation into mature and specialized cancer cell transfection with miR-203 mimics generated statistical downregulation of ZEB1 and ZEB2, while transfection with types. Cancer stem cells express specific markers. How- ever, there is currently no universal markers for isolation the miR-203 inhibitor revealed a significant increase of their levels (Figure 6(c) and 6(d)). and identification of cancer stem cells in any type of cancer. *erefore, cancer stem cells are commonly har- vested and enriched through different approaches based 4. Discussion on its characteristics [14]. In current approaches, cell lines Cervical cancer is the second most common type of ma- cultured with definite chemotherapeutics or with defined lignant tumors and the fourth leading cause of cancer-as- serum-free culture conditions are commonly used sociated mortalities in women worldwide [6, 7]. Cervical methods to enrich cancer stem cells from mixed pop- carcinoma has a risk of considerable recurrence and me- ulations and have been recognized effective to establish in vitro models for cancer stem cells expansion [15]. *us, tastasis following conventional therapy, leading to a high mortality. Currently, more and more evidence has con- these two methods were employed in the present study to harvest and enrich cervical cancer stem cells from the firmed that a small population of cancer stem cells may be responsible for tumor recurrence, relapse, metastasis, and human cervical adenocarcinoma cell lines HeLa and the resistance to conventional treatment [13]. *us, a complete cervical squamous carcinoma cell SiHa. Data showed that understanding of the molecular mechanisms underlying either cisplatin-resistant cells or serum-free cultured cells acquisition and maintaining of stemness of cervical cancer expressed statistically higher expression levels of CD133 stem cells (CCSCs) is essential to provide effective methods and CD44, which have been confirmed as contributors in to eradicate malignant tumors. migration and aggregation of cancer cells and cancer Cancer stem cells are a subpopulation within cancer development and hence have been broadly accepted as cells, characterized by the abilities of self-renewal and general cancer stem cell markers in many types of Relative mRNA level (%β-actin) Relative expression of miR-203 (/β-actin) Relative mRNA level (%β-actin) NC miR-203 mimics miR-203 inhibitor 10 Journal of Oncology was confirmed in the present study, which is exhibited as malignant tumors, including cervical carcinoma [13]. Additionally, cisplatin-resistant cells and serum-free cul- statistical decreased levels along with enrichment of cervical cancer stem cells and the suppressive effect on the expres- tured cells increased the expression of ALDH1, OCT4, and NANOG. Previous data have identified that the high ac- sions of all six stemness markers. Besides, ZEB1’s ability to tivity of ALDH1 in a subpopulation of cervical cancer cells repress stemness-inhibiting miR-203 expression to promote exhibited stemness properties with great capacity for self- tumorigenicity can be seen in previous studies [30]. It was renewal, high differentiation potential, and high tumori- presumed that the interaction of miR-203 with ZEB1 should genicity. Also, cells with high ALDH1 activity were re- contribute to stemness acquisition of cervical cancer cells. sistant to cisplatin and increased the expression of OCT4 In conclusion, both chemotherapeutics resistance and serum-free culture can be used to enrich cancer stem cells and NANOG, which are pluripotency markers [16]. Our data also showed that cisplatin resistance and serum-free from human cervical cancer HeLa and SiHa cells. And, lncRNA HOTAIR holds positive effects for stem acquisition culture significantly upregulated SOX2. Previous reports demonstrated that SOX2-positive cervical cancer cells of cervical cancer, which should correlate to its interaction with miR-203. *e EMTactivator ZEB1 could regulate miR- shared all the characteristics with cancer stem cells in- cluding self-renewal, differentiation, and tumor-initiating 203 expression, therefore, to maintain stem properties of properties [17]. And, SOX2-positive cells displayed cervical cancer cells. overexpression of OCT4 and ALDH1. *erefore, the overexpression of these stemness-associated markers Data Availability showed here indicated that cisplatin-resistant and serum- free cultured cervical cancer cells were cancer stem-like *e data used to support the findings of this study are in- cluded within the article. cells. Cervical cancer stem cells have been recognized essential contributors for distal metastasis and recurrence of cervical Conflicts of Interest carcinoma. As expected, cervical cancer stem-like cells *e authors declare that there are no conflicts of interests. enriched from either HeLa or SiHa cells revealed greater capability to migrate and invade in vitro compared with their parental cells. Interestingly, HOTAIR also promoted the Authors’ Contributions migration and invasion level of cervical cancer cells, just like Wenying Zhang performed the major experiments. Jing Liu cervical cancer stem-like cells. Similarity of migration and performed the experiment of migration. Qiongwei Wu invasion suggested that HOTAIR should exert a positive performed the experiments of Western blot. Yu Liu provided effect on stemness acquisition of cervical cancer cells. Ac- the statistical data. Chengbin Ma directed the research and tually, HOTAIR’s pivotal role on stem cells of various types edited the manuscript. All the authors have read and ap- of malignant tumors has been reported previously [18], but proved the final manuscript. the role of HOTAIR on the phenotype of cervical cancer stem cells was currently unknown. In order to identify this hypothesis, effects of HOTAIR on the expressions of Acknowledgments stemness-associated markers was explored in present study. *is work was supported by the grants from Shanghai Data showed that treatment of cisplatin resistance and se- Municipal Health and Health Committee (No. 201840312). rum-free culture actually resulted in significant upregulation of HOTAIR; furthermore, knockdown of HOTAIR gener- References ated statistical downregulation of the six stemness markers mentioned above. *ese findings suggested that HOTAIR [1] A. Yang, E. Farmer, T. C. Wu, and C.-F. Hung, “Perspectives should be a contributor of stemness acquisition of cervical for therapeutic HPV vaccine development,” Journal of Bio- cancer. medical Science, vol. 23, no. 1, p. 75, 2016. HOTAIR regulated the stemness of cancer stem cells [2] M. Vu, J. Yu, O. A. Awolude, and L. Chuang, “Cervical cancer through various approaches, among which HOTAIR in- worldwide,” Current Problems in Cancer, vol. 42, no. 5, teraction with definite miRNAs was generally accepted as an pp. 457–465, 2018. important mechanism. Bioinformatics analysis and previous [3] R. Huang and E. K. Rofstad, “Cancer stem cells (CSCs), studies have identified that HOTAIR can interact with miR- cervical CSCs and targeted therapies,” Oncotarget, vol. 8, no. 21, pp. 35351–35367, 2017. 203, which has been considered a tumor suppressive [4] M. Li, B. Lu, X. Dong et al., “Enhancement of cisplatin-in- miRNA. Current reports have documented that miR-203 is a duced cytotoxicity against cervical cancer spheroid cells by stemness-inhibiting miRNA owing to its modulation of targeting long non-coding RNAs,” Pathology, Research & stemness properties through regulating the expressions of Practice, vol. 215, no. 11, Article ID 152653, 2019. various targets in different types of cancers, including [5] H. Aalijahan and S. Ghorbian, “Long non-coding RNAs and SOCS3, survivin, Bmi-1, and GATA6. [19–23]. Actually, cervical cancer,” Experimental and Molecular Pathology, epigenetic silencing of miR-203 is required for cancer stem vol. 106, pp. 7–16, 2019. cell properties and epithelial-mesenchymal transition [6] L. Li, B. Liu, O. L. Wapinski et al., “Targeted disruption of (EMT), which is a rich source of cancer stem cells [24–29]. Hotair leads to homeotic transformation and gene dere- *e stemness-inhibitory role of miR-203 in cervical cancer pression,” Cell Reports, vol. 5, no. 1, pp. 3–12, 2013. Journal of Oncology 11 [7] T. Rajagopal, S. Talluri, R. L. Akshaya, N. R. Dunna, and Oncology Research Featuring Preclinical and Clinical Cancer L. R. N. A. Hotair, “HOTAIR LncRNA: a novel oncogenic =erapeutics, vol. 26, no. 8, pp. 1155–1165, 2018. propellant in human cancer,” Clinica Chimica Acta, vol. 503, [22] X. Yu, X. Jiang, H. Li, L. Guo, W. Jiang, and S.-H. Lu, “miR- 203 inhibits the proliferation and self-renewal of esophageal pp. 1–18, 2020. [8] R. Castro-Oropeza, J. Melendez-Zajgla, V. Maldonado, and cancer stem-like cells by suppressing stem renewal factor K. Vazquez-Santillan, “*e emerging role of lncRNAs in the Bmi-1,” Stem Cells and Development, vol. 23, no. 6, regulation of cancer stem cells,” Cellular Oncology, vol. 41, pp. 576–585, 2014. no. 6, pp. 585–603, 2018. [23] Y. Zhang, S.-y. Zhou, H.-z. Yan et al., “miR-203 inhibits [9] L. Tang, W. Zhang, B. Su, and B. Yu, “Long noncoding RNA proliferation and self-renewal of leukemia stem cells by tar- HOTAIR is associated with motility, invasion, and metastatic geting survivin and Bmi-1,” Scientific Reports, vol. 6, no. 1, potential of metastatic melanoma,” BioMed Research Inter- Article ID 19995, 2016. national, vol. 2013, Article ID 251098, , 2013. [24] Y. Deng, G. Zhu, H. Luo, and S. Zhao, “MicroRNA-203 as a [10] D. N. Zhong, Y. H. Luo, W. J. Mo et al., “High expression of stemness inhibitor of glioblastoma stem cells,” Molecules and long non-coding HOTAIR correlated with hepatocarcino- Cells, vol. 39, no. 8, pp. 619–624, 2016. genesis and metastasis,” Molecular Medicine Reports, vol. 17, [25] S.-Y. Ju, S.-H. Chiou, and Y. Su, “Maintenance of the stemness no. 1, pp. 1148–1156, 2018. in CD44+ HCT-15 and HCT-116 human colon cancer cells requires miR-203 suppression,” Stem Cell Research, vol. 12, [11] X. Guo, H. Xiao, S. Guo et al., “Retracted: long noncoding RNA HOTAIR knockdown inhibits autophagy and epithelial- no. 1, pp. 86–100, 2014. mesenchymal transition through the Wnt signaling pathway [26] O. F. Karatas, I. Suer, B. Yuceturk et al., “Identification of in radioresistant human cervical cancer HeLa cells,” Journal of microRNA profile specific to cancer stem-like cells directly Cellular Physiology, vol. 234, no. 4, pp. 3478–3489, 2019. isolated from human larynx cancer specimens,” BMC Cancer, [12] X. Tian, F. Tao, B. Zhang, J.-T. Dong, and Z. Zhang, “*e miR- vol. 16, no. 1, p. 853, 2016. 203/SNAI2 axis regulates prostate tumor growth, migration, [27] P. Sahranavardfard, J. Firouzi, M. Azimi et al., “MicroRNA- angiogenesis and stemness potentially by modulating GSK- 203 reinforces stemness properties in melanoma and aug- 3β/β-CATENIN signal pathway,” IUBMB Life, vol. 70, no. 3, ments tumorigenesis in vivo,” Journal of Cellular Physiology, pp. 224–236, 2018. vol. 234, no. 11, pp. 20193–20205, 2019. [13] G. Mendoza-Almanza, E. Ort´ız-Sanchez, ´ L. Rocha-Zavaleta, [28] J. H. Taube, G. G. Malouf, E. Lu et al., “Epigenetic silencing of C. Rivas-Santiago, E. Esparza-Ibarra, and J. Olmos, “Cervical microRNA-203 is required for EMT and cancer stem cell cancer stem cells and other leading factors associated with properties,” Scientific Reports, vol. 3, no. 1, p. 2687, 2013. [29] L. Tian, M. Li, J. Ge et al., “MiR-203 is downregulated in cervical cancer development,” Oncol Lett, vol. 18, no. 4, pp. 3423–3432, 2019. laryngeal squamous cell carcinoma and can suppress prolif- [14] J. Zhang, X. Chen, L. Bian, Y. Wang, and H. Liu, “CD44+/ eration and induce apoptosis of tumours,” Tumor Biology, CD24+-Expressing cervical cancer cells and radioresistant vol. 35, no. 6, pp. 5953–5963, 2014. cervical cancer cells exhibit cancer stem cell characteristics,” [30] U. Wellner, J. Schubert, U. C. Burk et al., “*e EMT-activator Gynecologic and Obstetric Investigation, vol. 84, no. 2, ZEB1 promotes tumorigenicity by repressing stemness- pp. 174–182, 2019. inhibiting microRNAs,” Nature Cell Biology, vol. 11, no. 12, [15] L. Wang, H. Guo, C. Lin, L. Yang, and X. Wang, “Enrichment pp. 1487–1495, 2009. and characterization of cancer stem-like cells from a cervical cancer cell line,” Molecular Medicine Reports, vol. 9, no. 6, pp. 2117–2123, 2014. [16] S.-Y. Liu and P.-S. Zheng, “High aldehyde dehydrogenase activity identifies cancer stem cells in human cervical cancer,” Oncotarget, vol. 4, no. 12, pp. 2462–2475, 2013. [17] X.-F. Liu, W.-T. Yang, R. Xu, J.-T. Liu, and P.-S. Zheng, “Cervical cancer cells with positive Sox2 expression exhibit the properties of cancer stem cells,” PloS One, vol. 9, no. 1, Article ID e87092, 2014. [18] J. Deng, M. Yang, R. Jiang, N. An, X. Wang, and B. Liu, “Long non-coding RNA HOTAIR regulates the proliferation, self- renewal capacity, tumor formation and migration of the cancer stem-like cell (CSC) subpopulation enriched from breast cancer cells,” PloS One, vol. 12, no. 1, Article ID e0170860, 2017. [19] H. T. Lai, W. K. Tseng, S. W. Huang, T. C. Chao, and Y. Su, “MicroRNA-203 diminishes the stemness of human colon cancer cells by suppressing GATA6 expression,” Journal of Cellular Physiology, vol. 235, no. 3, pp. 2866–2880, 2020. [20] N. Muhammad, S. Bhattacharya, R. Steele, and R. B. Ray, “Anti-miR-203 suppresses ER-positive breast cancer growth and stemness by targeting SOCS3,” Oncotarget, vol. 7, no. 36, pp. 58595–58605, 2016. [21] J. Shen, J. Zhang, M. Xiao, J. Yang, and N. Zhang, “miR-203 suppresses bladder cancer cell growth and targets Twist1,”

Journal

Journal of Oncology – Hindawi Publishing Corporation

Published: Sep 10, 2021

There are no references for this article.