Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Helicobacter pylori and Epstein–Barr Virus Infection in Gastric Diseases: Correlation with IL-10 and IL1RN Polymorphism

Helicobacter pylori and Epstein–Barr Virus Infection in Gastric Diseases: Correlation with IL-10... Hindawi Journal of Oncology Volume 2019, Article ID 1785132, 8 pages https://doi.org/10.1155/2019/1785132 Research Article Helicobacter pylori and Epstein–Barr Virus Infection in Gastric Diseases: Correlation with IL-10 and IL1RN Polymorphism 1,2 3 1 1 Fasciana Teresa , Nicola Serra , Giuseppina Capra, Chiara Mascarella, 3 1 1 1 1 Cesare Gagliardi, Paola Di Carlo , Sara Cannella, Maria Rosa Simonte, Dario Lipari, 1 4 1 Miriam Sciortino, Letizia Scola, and Anna Giammanco Department of Health Promotion, Mother and Child Care, Internal Medicine and Medical Specialties “G. D’Alessandro”, University of Palermo, Palermo, Italy Department of Surgical, Oncological and Oral Sciences, Doctoral Program in Oncology and Experimental Surgery, University of Palermo, Palermo, Italy Department of Public Health, University Federico II of Naples, Naples, Italy Department of Biomedicine, Neuroscience and Advanced Diagnostics, University of Palermo, Palermo, Italy Correspondence should be addressed to Fasciana Teresa; teresa.fasciana@virgilio.it Received 12 March 2019; Revised 10 July 2019; Accepted 18 August 2019; Published 6 December 2019 Academic Editor: &omas R. Chauncey Copyright © 2019 Fasciana Teresa et al. &is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Introduction. Helicobacter pylori and Epstein–Barr virus (EBV) infection have recently been shown to be associated with gastric diseases. Polymorphisms in genes encoding cytokines such as interleukin 10 (IL-10) and interleukin 1 Receptor (IL-1RN) influence cytokine secretion levels and appear to contribute to the risk of developing gastroduodenal diseases. To our knowledge, this is the first preliminary study to address the association of coinfection with H. pylori and EBV and their correlation with genetic predisposition in the development of gastric diseases. Methods. Gastric biopsy samples of 96 patients with different gastric diseases were used. Results. Our results showed that the rate of coinfection was higher in patients with gastric cancer than in patients with normal gastric mucosa, active chronic gastritis, and MALT lymphoma. As regards the characterization of H. pilory strains, the polymorphism s1m1i1 of vacA gene was more frequent in patients with MALT Lymphoma in comparison to others, while the polymorphism s2m2i2 was most frequent in patients with normal gastric mucosa. In addition, patients who tested positive for the cagA gene were more frequently those affected with gastric cancer than those with inactive chronic gastritis. Similarly, the patients with oipA gene ON were more frequently those with gastric cancer than those with inactive chronic gastritis. Conclusion. According to our analysis, there was no correlation between coinfection and polymorphisms in genes encoding IL-10 and IL-1RN. We conclude that various factors can be involved in the development of gastric diseases. Various virulence factors are involved in the develop- 1. Introduction ment of gastric diseases in H. pylori positive patients; among Gastrointestinal diseases and gastric cancer (GC) are among these, the genes cagA, vacA, and oipA have an important role the most common pathologies worldwide [1]. In recent years, [5]. &e cytotoxicity-associated gene A (cagA) is one of the Helicobacter pylori and EBV infection seem to be strongly most significant virulence factors of H. pylori. It is associated associated with the development of gastric diseases [2, 3]. with the development of peptic ulcers and gastric cancer [6]. H. pylori, a bacterium that colonizes the gastric mucosa &e vacA gene encoding for VacA protein is capable of of more than 50% of the world’s population, is considered to inducing large host cell vacuoles in the cytoplasm of gastric be a group 1 carcinogen by the International Agency for cells [7], while the oipA (outer inflammatory protein) gene Research on cancer [4]. encodes one of the outer-membrane proteins that contribute 2 Journal of Oncology gastric cancer. &ese groups were defined considering both to gastric inflammation, inducing IL-8 secretion by epithelial cells [8]. premalignant disease and most common malignant disease correlated to micro-organisms such as MALT lymphoma OipA expression is predicted to be regulated by a slipped strand mispairing system based on the number of CT di- and gastric cancer. &e use of the groups was introduced to nucleotide repeats in the 5′ signal peptide coding region of individualize the impact of each disease singularly and the gene, with “ON” meaning oipA is functional and “OFF” consequently to reduce possible statistical biases. nonfunctional. OipA functional status is involved in bac- &e investigation was deemed to be of interest as Sicily terial adherence to gastric epithelial cells and in mucosal has one of the most complex mixed ethnic populations in inflammation. Europe due to its geographical position. Treatment failure in H. pylori infections is the current issue for physicians. &ere are many reasons for treatment 2. Materials and Methods failure. &ese can be grouped into microorganism-related 2.1. Patients and Sample Collection. &is study was per- factors, host-related factors, and treatment-related factors. formed on a sample of 96 patients, 34.38% males, and H. pylori resistance to antibiotics is widely recognized as the 65.62% females, aged 20–87 years, mean 58.27 y.o. and chief reason for treatment failure. standard deviation (SD) 16.26 y.o. H. pylori resistance to clarithromycin has been correlated to point mutations in the peptidyl transferase region of domain V of the 23S rRNA. &e most common mutation is 2.2. We Considered Four Groups of 24 Consecutive Patients an A-to-G transition at position 2143 (A2143G) and at position 2142 (A2143G). (i) Group with normal gastric mucosa (Group NGM), EBV infection is present in more than 90% of the composed of 33.33% males and 66.67% females, population. Upon infection, the virus rests latent in aged 22–71 years, mean 46.58 y.o. and standard B lymphocytes throughout the person’s lifetime [9]. deviation (SD) 14.74 y.o Moreover, the association of EBV with gastric carcinoma (ii) Group with active chronic gastritis (Group GCA) was reported for a case of lymphoepithelial-like gastric composed of 37.50% males and 62.50% females, carcinoma, but the mechanism used by the virus to de- aged 20–87 years, mean 49.04 y.o. and standard termine the oncogenesis is still unknown [10]. deviation (SD) 16.83 y.o It seems that EBV deregulation of the expression of (iii) Group with gastric cancer (Group KG), composed immune response-related genes promotes marked intra or of 33.33% males and 66.67% females, aged 55– peritumoral immune cell infiltration [11]. &e relationship 87 years, mean 69.88 y.o. and standard deviation of H. pylori with early inflammatory precancerous lesions is (SD) 8.68 y.o well known. However, only a few studies have evaluated the partic- (iv) Group with gastric MALT lymphoma (Group ML), ipation of EBV infection in these lesions. composed of 33.33% males and 66.67% females, Some studies have found evidence that EBV infects aged 57–80 years, mean 67.58 y.o. and standard epithelial cells of the atrophic gastric mucosa with a rela- deviation (SD) 6.24 y.o tively low frequency [12], whereas other studies favour Exclusion criteria were as follows: previous attempts to higher frequencies [13]. eradicate H. pylori and use of antibiotics or proton pump While both micro-organisms are responsible for the inhibitor within 2 weeks prior to endoscopy. most common infections worldwide, a small percentage of Each patient signed an informed consent form before infected patients will develop severe disease [14]. undergoing endoscopy. &e outcome of the infection depends on the relation- ship between environment, host, and bacterial virulence factors [15, 16]. Recently, the polymorphism of proin- 2.3. Sample Collection and Histological Analysis. Gastric flammatory cytokines such as IL1RN and anti-inflammatory biopsy samples were obtained from patients attending the cytokines such as IL-10 has been implicated in clarifying endoscopy ward of the Endoscopy Services of the A.O.U.P. host factors in the development of gastric diseases [17]. Paolo Giaccone (Palermo, Italy) and M. Raimondi Hospital, In particular, IL1RN genotypes and low IL-10 pro- San Cataldo (Caltanissetta, Italy). Two biopsy samples were duction have been associated with an increased risk for obtained from de the antrum and two from the gastric severe gastric lesions in patients infected with both micro- corpus. One was used for H. pylori culture and the second for organisms [18]. histologic examination. In this preliminary study, we analyze H. pylori and EBV In patients suspected of having gastric cancer and MALT coinfection and correlation with host genetic variability in lymphoma, samples were taken directly from the gastric gastric tissues from adult patients with different gastric lesion. diseases in Italy. One antrum sample and one corpus sample was fixed in In this study, we considered four groups of patients: formaline, paraffin-embedded, and stained with hematox- group with normal gastric mucosa (control group), group ylin and eosin (HE). Inflammatory response was graded with active chronic gastritis, group gastric MALT (Mucosa- according to the Sydney System by a single experienced Associated Lymphoid Tissue) lymphoma, and group with pathologist. Journal of Oncology 3 2.4. DNA Isolation from Gastric Biopsies, H. pylori, and EBV Mutation System (ARMS-PCR) was used to type 819C/Tand DNA Detection by PCR Methodology. DNA from the biopsy 1082G/A IL-10 SNP, as described by Crivello et al. [30]. samples was extracted using a High Pure Template Prepa- ration kit (Roche), in accordance with the manufacturer’s 3. Statistical Analysis instructions. &e extracted DNA was stored at − 20 C until use. Data are presented as number and percentage for categorical H. pylori infection was diagnosed when the ureaseA gene variables, and continuous data are expressed as mean- was detected with nested PCR, while the BAMHI-W frag- ± standard deviation (SD), unless otherwise specified. &e ment region of the EBV genome was used as the target to multiple comparison chi-square test was used to define evaluate the presence of the virus, according to Di Carlo et al. significant differences among percentages: if chi-square test [19] and Giardina et al. [20]. was positive (p value <0.05), then residual analysis with the Z-test to locate the highest or lowest significant presence was performed. To evaluate significant differences of means 2.5.DetectionofcagA,theEPIYAMotif,TypingofvacAAlleles, among groups, we performed the multicomparison ANOVA andDeterminingoipAStatus. In order to detect the presence test. When the ANOVA test was positive (p value <0.05), of the cagA gene and to analyse the EPIYA motif, the DNA pairwise comparisons were performed with Scheffe’s ´ test. from each strain was subjected to PCR, as described by Univariate and multivariate linear correlation analysis Panayotopoulou et al. [21]. In determining the EPIYA motif, was performed, where the test on Pearson’s linear correla- three different PCR products were obtained: EPIYA ABC tion coefficient R was performed with t-Student test, under (550 bp), EPIYA ABCC (650 bp), and EPIYA ABCCC null hypothesis of Pearson’s linear correlation coefficient (750 bp). &e signal peptide (s) and midregion (m) of the R � 0. In this step for dichotomies, we defined the experi- vacA gene were amplified using the primers described by mental probability distribution for the variables Gender, Hp, Atherton et al. [22]. Four different PCR products were EBV, and Coinfected, assigning them the following values: obtained: s1 (259 bp) and s2 (286 bp) from the s-region and m1 (290 bp) and m2 (352 bp) from the m-region (Atherton (i) For Gender, male � 1 and female � 0 et al., 1995). Two different PCR products were obtained from (ii) Hp, presence � 1 and absence � 0 the i-region: i1 (250 bp) and i2 (260 bp) [23]. OipA status (iii) EBV virus, presence � 1 and absence � 0 was determined in all strains by PCR and sequencing of the (iv) Coinfected (patients with HP and EBV virus), signal region of the oipA gene, according to Yamaoka et al. yes � 1, and no � 0 [24]. For polymorphism variables vacA, IL-1RN, and IL-10, we defined, according to the frequency of the variable’s 2.6. Determination of Point Mutations in the H. pylori 23S modalities in our total sample data, the following scales, rRNA Gene. In order to detect mutations related to clari- respectively: thromycin resistance in the 23S rRNA gene and to establish the number of CT repeats present in oipA, the same primers (i) s2m2i2 � 5, s1m1i1 � 4, s1m2i1 � 3, s1m2i2 � 2, and used for the amplification gene were employed. s1m1-m2i1 � 1 and polymorphism absence � 0 &e resulting PCR products were subjected to gel (ii) 1/1 � 5, 1/2 � 4, 2/2 � 3, 1/3 � 2, and 4/4 � 1 and electrophoresis in a 2% agarose gel, subsequently purified polymorphism absence � 0 and concentrated for sequencing using Amicon Ultra 0.5 ml (iii) AA � 3, AG � 2, and GG � 1 and polymorphism columns (Millipore). Purified amplicons were sequenced absence � 0 directly with the same forward and reverse primers used in the previous PCR, using an ABI PRISM BigDye Cycle Se- For the gastric disease variables, we used the following quencing Ready Reaction kit (Applied Biosystems) scale: according to the instructions supplied by the manufacturer. (i) NGM � 1, GCA � 2, ML � 3, and KG � 4. &e analysis of products was performed using BioEdit v. 7.2.0 software according to Chiarini et al. [25] and Fasciana We considered all statistical tests with p value<0.05 to be et al. [26]. significant. All data were analyzed with Matlab statistical toolbox version 2008 (MathWorks, Natick, MA, USA) for 32 bit Windows. 2.7. Genotyping of Cytokine Polymorphisms. &e IL-1RN exon 2 polymorphism was analyzed according to Rad et al. [27] Conditions were as follows: 95 C for 5 min, then 35 4. Results and Discussions ° ° ° cycles of 95 C for 30 s, 50 C for 30 s, 72 C for 30 s, and finally 72 C for 5 min. &e PCR products were analyzed by elec- In this preliminary study, we evaluated the relationship trophoresis on a 2% agarose gel stained with ethidium between H. pylori and EBV infection, and cytokine poly- bromide. Allele 1 (4 repeats) was 410 bp, allele 2 (2 repeats) morphism in gastric diseases in people living in the Med- was 240 bp, allele 3 (5 repeats) was 500 bp, allele 4 (3 repeats) iterranean area [26, 30]. In our study, the positivity rate of H. was 325 bp, and allele 5 (6 repeats) was 595 bp in length, pylori in patients with gastric cancer was higher than that according to Forte et al. [28]. Amplification Refractory found in patients with normal gastric mucosa, active chronic 4 Journal of Oncology Table 1: Clinical information: age, gender, symptoms, and in- gastritis, and MALT lymphoma, namely, 50%, 45.83%, fection type in the total patient sample. 41.67%, and 45.83%, respectively. EBV was detected in 54.17% of the patients with gastric Parameters Sample data cancer. It was detected in smaller percentages in patients Age 58.27± 16.26 with normal gastric mucosa, active chronic gastritis, and Gender MALT lymphoma, namely, 20.83%, 41.67%, and 37.50%, Male 34.38% (33/96) respectively. In any case, the rate of H. pylori in all patients Female 65.62% (63/96) analyzed was 45.83%, and the rate of EBV was 38.54%. Symptoms &e rate of coinfection was higher in patients with gastric NGM 25.00% (24/96) GCA 25.00% (24/96) cancer than that in patients with normal gastric mucosa, ML 25.00% (24/96) active chronic gastritis, and MALT lymphoma, namely, KG 25.00% (24/96) 37.50%, 16.67%, 29.17%, and 25%, respectively. &e cagA Analysis with PCR and vacA genes are commonly used as markers to charac- Not infected 42.71% (41/96) terize H. pylori virulence. Several epidemiological studies Infected by HP 45.83% (44/96) have reported geographical variations in the circulation of Infected by EBV 38.54% (37/96) the virulence factors pertaining to the micro-organisms. In Coinfected 27.08% (26/96) Sicily, the cagA gene is present in 52.27% of strains: in 97% of NGM � normal gastric mucosa; GCA � active chronic gastritis; KG � gastric the strains, it is associated with the ABC EPIYA motif, and in cancer; ML � MALT lymphoma; HP �H. pylori; coinfected � patients with most, it is associated with the presence of the s1i1m1 vacA HP and EBV. allele. In this study, the rate of H. pylori resistance to clari- thromycin was high, occurring in 27% of the cases. &e most Table 2: Gene analysis of our sample data. frequent point mutation in the peptidyl transferase loop Parameters Sample data region of the 23S rRNA gene was A2143G in 83% of resistant Polymorphism of gene vacA strains. &ese data confirm those reported by Fasciana et al. s1m1-m2i1 2.27% (1/44) in a previous study [26]. s1m2i2 4.55% (2/44) Table 1 shows clinical information of the total patient s1m2i1 6.82% (3/44) sample, including age, gender, symptoms, and infection s1m1i1 40.91% (18/44) type, patients infected by H. pylori, by EBV or both s2m2i2 45.45% (20/44) (coinfected). In addition, we identify four groups according Gene cagA ( ) to symptom type: normal gastric mucosa (NGM), active Negative 47.73% (21/44) Positive 52.27% (23/44) chronic gastritis (GCA), gastric cancer (KG), and MALT Gene oipA ( ) lymphoma (ML). “OFF” 47.73% (21/44) In Table 2, we have summarized the results of our gene “ON” 52.27% (23/44) analysis. &e table shows the percentages of polymorphism Polymorphism IL-1RN of vacA gene, polymorphism IL-1RN, and polymorphism 1/1 56.35% (54/96) IL-10 (− 1082). In addition, in patients where the gene vacA 1/2 21.88% (21/96) was present, the percentage of those with gene cagA positive 2/2 18.75 (18/96) and oipA “ON” status is reported. 1/3 2.08% (2/96) In Table 3, we have described in detail the four groups 4/4 1.04% (1/96) according to symptom type, reported in Table 1. For each Polymorphism IL-10 (− 1082) AA 47.92% (46/96) group, we have reported age, gender, infection type (in- AG 29.17% (28/96) cluding patients infected by H. pilory, EBV, or both), and GG 22.92% (22/96) polymorphism vacA type. In patients where vacA was H. pylori resistant 27.27% (12/44) present, the percentage of those with gene cagA positive and H. pylori sensible 72.73% (32/44) oipA “ON” is indicated. Finally, in the last column, we report HP �H. pylori; GCNA � inactive chronic gastritis; GCA � active chronic the results of univariate and multivariate analysis among gastritis; KG � gastric cancer; ML � MALT lymphoma; cases where gene groups. vacA was present. In Table 3, we can observe a significant difference for age (p value<0.001); in particular, there was a significantly higher number of elderly patients in the gastric cancer and MALT patients with MALT lymphoma, while the polymorphism lymphoma groups, in accordance with Ferlay et al. [1]. s2m2i2 was significantly associated with patients with in- As regards the characterization of H. pilory strains, active chronic gastritis. evaluated directly on gastric biopsies, the polymorphism In addition, the patients positive for cagA gene were more s1m1i1 of vacA gene was more frequent in Group ML (p frequently those affected by gastric cancer (p value � 0.0198) value � 0.0169), while the polymorphism s2m2i2 was most and less frequently those with inactive chronic gastritis frequent in Group NGM (p value � 0.0359) and less frequent compared to patients with other diseases (p value � 0.0130). A in Group KG (p value � 0.0276). In other words, the similar situation was found for the oipA gene. Patients with polymorphism s1m1i1 was significantly associated with oipA gene and “ON” status were more frequently those with Journal of Oncology 5 Table 3: Characteristics of the groups: normal gastric mucosa (NGM), active chronic gastritis (GCA), gastric cancer (KG), and MALT lymphoma (ML). Results of univariate and multivariate analysis among groups. Parameters Group NGM Group GCA Group KG Group ML Univariate and multivariate analysis p< 0.001 (A) NGM< KG, p< 0.05 (Sh) NGM< ML, p< 0.05 (Sh) Age 46.58± 14.74 49.04± 16.83 69.88± 8.68 67.58± 6.24 GCA< KG, p< 0.05 (Sh) GCA< ML, p< 0.05 (Sh) NGM< GCA, p> 0.05 (Sh) ML< KG, p> 0.05 (Sh) Gender Male 33.33% (8/24) 37.50% (9/24) 33.33% (8/24) 33.33% (8/24) p � 0.987 (C) Female 66.67% (16/24) 62.50% (15/24) 66.67% (16/24) 66.67% (16/24) p � 0.987 (C) Analysis with PCR Not infected 50.00% (12/24) 45.83% (11/24) 33.33% (8/24) 41.67% (10/24) p � 0.987 (C) Infected by HP 45.83% (11/24) 41.67% (10/24) 50.00% (12/24) 45.83% (11/24) p � 0.953 (C) Infected by EBV 20.83% (5/24) 41.67% (10/24) 54.17% (13/24) 37.50% (9/24) p � 0.124 (C) Coinfected 16.67% (4/24) 29.17% (7/24) 37.50% (9/24) 25.00% (6/24) p � 0.433 (C) Polymorphism vacA p< 0.0001 (C) s1m1i1 9.09% (1/11) 10.00% (1/10) 58.33% (7/12) 81.82% (9/11) ∗∗ ML, p � 0.0169 (Z) s1m2i1 0.00% (0/11) 10.00% (1/10) 16.67% (2/12) 0.00% (0/11) p � 0.308 (C) s1m2i2 9.09% (1/11) 0.00% (0/10) 8.33% (1/12) 0.00% (0/11) p � 0.589 (C) p< 0.0001 (C) ∗∗ s2m2i2 81.82% (9/11) 80.00% (8/10) 8.33% (1/12) 18.18% (2/11) NGM, p � 0.0359 (Z) ∗∗∗ KG, p � 0.0276 (Z) s1m1-m2i1 0.00% (0/11) 0.00% (0/10) 8.33% (1/12) 0.00% (0/11) p � 0.435 (C) Gene cagA ( ) p< 0.0001 (C) ∗∗ Negative 90.91% (10/11) 80.00% (8/10) 8.33% (1/12) 18.18% (2/11) NGM, p � 0.0130 (Z) ∗∗∗ KG, p � 0.0198 (Z) p< 0.0001 (C) ∗∗ Positive 9.09% (1/11) 20.00% (2/10) 91.67% (11/12) 81.82% (9/11) KG, p � 0.0198 (Z) ∗∗∗ NGM, p � 0.0130 (Z) Gene oipA ( ) p< 0.0001 (C) ∗∗ “OFF” 90.91% (10/11) 80.00% (8/10) 8.33% (1/12) 18.18% (2/11) NGM, p � 0.0130 (Z) ∗∗∗ KG, p � 0.0198 (Z) p< 0.0001 (C) ∗∗ “ON” 9.09% (1/11) 20.00% (2/10) 91.67% (11/12) 81.82% (9/11) KG, p � 0.0198 (Z) ∗∗∗ NGM, p � 0.0130 (Z) ∗ ∗∗ ∗∗∗ significant test; significant most frequent; significant less frequent; A � multicomparison ANOVA test; Sh � post hoc Scheff´e’s test for pairwise comparison; C � multicomparison chi-square test; Z �Z-test; HP �H. pylori; coinfected � patients with HP and EBV; NGM � normal gastric mucosa; GCA � active chronic gastritis; KG � gastric cancer; ML � MALT lymphoma; � cases where gene vacA was present; p � p value. gastric cancer (p value � 0.0198) and less frequently those with Analysis of the 23S rRNA gene demonstrated that 32 inactive chronic gastritis (p value � 0.0130). (73%) patients were infected with H. pylori-susceptible Regarding number of CT repeats, the most prevalent in strains and the remaining 12 (27%) with resistant strains the “ON” frame status had six CT repeats. &is was found to (Table 2). &e predominant point mutation observed among be the case in other studies [26, 30]. Among the out-frame the 12 H. pylori resistant strains was A2143G in 10 cases (83 status, “OFF” variants, the patterns with eight CT repeats %) and A2142G in 2 cases (17%). were the most prevalent. In Table 5, we report the frequency of polymorphism &e evidence pointing to the oipA “ON” as a gastric IL1RN and IL-10 loci for every group. In the last column, we cancer risk factor includes the ability of the bacterium report the results of univariate and multivariate analysis carrying a functional oipA to attach to the gastric epi- performed among the groups. thelial cells and induce inflammation, apoptosis, and a Table 5 shows that there was only one significant as- toxic effect on towards cultured gastric epithelial cell sociation between polymorphism IL-1RN and gastric dis- lines. ease. Particularly, patients with polymorphism IL-1RN type In Table 4, we can see the sequences of signal peptide- 1/2 were significantly less frequent in the ML Group (p encoding region of oipA. value � 0.0248). 6 Journal of Oncology Table 4: oipA CT repeat patterns. Sequence of signal peptide-encoding region of oipA No. CT No. of strains OFF status ATGAAAAAAGCTCTCTTA. . .. . .. . .CTCTCTCTCTCTCTCTCTCGTT 9 5 ATGAAAAAAGCCCTCTTACTAACTCTCTCTCTCTCTCTCGTTT 8 7 ATGAAAAAAGCTCTCTTGCTAACTCTCTCTCTCTCTCTCTCTCGTT 10 2 ATGAAAAAAGCTCTTTTA. . .. . .. . .CTCTCTCTCTCTCGTT 6 3 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCTCTCGTT 7 2 ATGAAAAAGCTCTCTTA. . .. . .. . .CTCTCTCTCTCTCTCGTTCTGG 7 1 ATGAAAAAAGCCCTCTTA. . .. . .. . .CTCTCTCTTTCTCTCGTTTT 4 + 2 1 Total 12 ON status ATGAAAAAAGCTCTCTTACTAATTCTCTCTCTCTCGTT 5 4 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCTCGTT 6 15 ATGAAAAAAGCCCTCTTA. . .. . .. . .CTCTCTCTCTCTCTCTCTCTCTCGT 11 2 ATGAAAAAAGCTCTCTTACTAACT CTCTCTCTCTCTCTCTCGTT 9 1 ATGAAAAAAGCTCTTTTACTCTCT CTCTCTCTCTCGTT 8 1 Total 23 Table 5: Frequency of the polymorphisms IL1RN and IL-10 loci. Results of univariate and multivariate analysis among groups. Parameters Group NGM Group GCA Group KG Group ML Univariate and multivariate analysis Polymorphism IL-1RN 1/1 50.00% (12/24) 62.50% (15/24) 41.67% (10/24) 70.83% (17/24) 0.179 (C) 0.0239 (C) 1/2 29.17% (7/24) 25.00% (6/24) 33.33% (8/24) 0.00% (0/24) ∗∗∗ group ML , p � 0.0248 (Z) 2/2 20.83% (5/24) 8.33% (2/24) 16.67% (4/24) 29.17% (7/24) 0.314 (C) 1/3 0.00% (0/24) 4.17% (1/24) 4.17% (1/24) 0.00% (0/24) 0.564 (C) 4/4 0.00% (0/24) 0.00% (0/24) 4.17% (1/24) 0.00% (0/24) 0.387 (C) Polymorphism IL-10 (− 1082) AA 41.67% (10/24) 45.83% (11/24) 54.17% (13/24) 50.00% (12/24) 0.841 (C) AG 33.33% (8/24) 33.33% (8/24) 29.17% (7/24) 20.83% (5/24) 0.875 (C) GG 25.00% (6/24) 20.83% (5/24) 16.67% (4/24) 29.17% (7/24) 0.768 (C) ∗ ∗∗ ∗∗∗ Significant test; significant most frequent; significant less frequent; # � no localized significant modality with significant level <0.05; C � multicomparison chi-square test; Z �Z-test; HP �H. pylori; NGM � normal gastric mucosa; GCA � active chronic gastritis; KG � gastric cancer; ML � MALT lymphoma; p � p value. Table 6: Results of univariate and multivariate linear correlation analysis between polymorphism of vacA, IL-1RN and IL-10 with age, gender, H. pylori, EBV, coinfected, and gastric disease. Linear correlation analysis Univariate analysis Multivariate analysis R (p value) Multiple linear correlation coefficient � 0.149 Polymorphism IL-1RN/age − 0.092 (0.371) R � − 0.057; p value � 0.593 partial Polymorphism IL-1RN/gender − 0.038 (0.716) R � − 0.013; p value � 0.905 partial Polymorphism IL-1RN/H. pylori 0.02 (0.846) R � − 0.027; p value � 0.800 partial Polymorphism IL-1RN/EBV − 0.027 (0.794) R � 0.052; p value � 0.622 partial Polymorphism IL-1RN/coinfected − 0.015 (0.886) R � − 0.011; p value � 0.917 partial Polymorphism IL-1RN/gastric disease − 0.097 (0.348) R � − 0.107; p value � 0.314 partial R (p value) Multiple linear correlation coefficient � 0.215 Polymorphism IL-10/age 0.116 (0.259) R � 0.106; p value � 0.316 partial Polymorphism IL-10/gender − 0.142 (0.167) R � − 0.125; p value � 0.237 partial Polymorphism IL-10/H. pylori 0.102 (0.322) R � − 0.024; p value � 0.821 partial Polymorphism IL-10/EBV 0.081 (0.430) R � − 0.054; p value � 0.619 partial Polymorphism IL-10/coinfected 0.101 (0.329) R � 0.062; p value � 0.560 partial Polymorphism IL-10/gastric disease 0.061 (0.552) R � 0.027; p value � 0.797 partial Significant test; R � Pearson’s linear correlation coefficient; R � the partial correlation coefficient is the coefficient of correlation of the variable with the partial dependent variable, adjusted for the effect of the other variables in the mode; coinfected � patients with H. pylori and EBV. Journal of Oncology 7 pathogenesis,” Frontiers in Cellular and Infection Microbiol- &ese results, in accordance with other reports, do not ogy, vol. 2, p. 92, 2012. seem to attribute any particular role to proinflammatory or [6] A. T. Franco, E. Johnston, U. Krishna et al., “Regulation of anti-inflammatory cytokine genotypes in gastric disease gastric carcinogenesis by Helicobacter pylori virulence fac- susceptibility [28]. tors,” Cancer Research, vol. 68, no. 2, pp. 379–387, 2008. Finally, in Table 6, we report the results of univariate and [7] T. L. Testerman and J. Morris, “Beyond the stomach: an multivariate linear correlation analyses between poly- updated view of Helicobacter pylori pathogenesis, diagnosis, morphisms IL-1RN and IL-10, with the independent variables and treatment,” World Journal of Gastroenterology, vol. 20, age, gender, H. pylori infection, EBV infection, coinfection, no. 36, pp. 12781–12808, 2014. and gastric disease. In this case, no correlations were found. [8] Y. Yamaoka, D. H. Kwon, and D. Y. Graham, “A Mr 34,000 proinflammatory outer membrane protein (oipA) of Heli- cobacter pylori,” Proceedings of the National Academy of 5. Conclusions Sciences, vol. 97, no. 13, pp. 7533–7538, 2000. We can conclude that the various factors that can be in- [9] O. L. Hatton, A. Arnold-Harris, S. Schaffert, S. M. Krams, and O. M. Martinez, “&e interplay between Epstein Barr virus and volved in cancer development are very complex. A limitation B lymphocytes: implications for infection, immunity, and dis- of this study was the limited number of patients with the ease,” Immunologic Research, vol. 58, no. 2-3, pp. 268–276, 2014. various gastric diseases. &erefore, further investigations are [10] W. K. K. Wu, J. Yu, M. T. V. Chan, K. F. To, and necessary to fully correlate the role of coinfection in gastric A. S. L. Cheng, “Combinatorial epigenetic deregulation by diseases in the Sicilian population. In addition, coinfection Helicobacter pylori and Epstein-Barr virus infections in gastric should be evaluated at an early age and in children with an tumorigenesis,” :e Journal of Pathology, vol. 239, no. 3, increased risk of presenting more serious lesions later in life. pp. 245–249, 2016. [11] A. Shinozaki-Ushiku, A. Kunita, M. Isogai et al., “Profiling of Disclosure virus-encoded microRNAs in Epstein-Barr virus-associated gastric carcinoma and their roles in gastric carcinogenesis,” An earlier version of this manuscript was presented as an Journal of Virology, vol. 89, no. 10, pp. 5581–5591, 2015. th abstract at the 46 Congress of the Italian Society of Mi- [12] M. G. Cardenas-Mondrag ´ on, ´ J. Torres, L. Flores-Luna et al., th th crobiology, September 26 –29 , 2018. “Case–control study of Epstein–Barr virus and Helicobacter pylori serology in Latin American patients with gastric dis- ease,” British Journal of Cancer, vol. 112, no. 12, pp. 1866– Conflicts of Interest 1873, 2015. [13] J. L. Ryan, Y.-J. Shen, D. R. Morgan et al., “Epstein-Barr virus &e authors declare that they have no conflicts of interest. infection is common in inflamed gastrointestinal mucosa,” Digestive Diseases and Sciences, vol. 57, no. 7, pp. 1887–1898, Authors’ Contributions ´ ´ [14] A. Morales-Sanchez and E. Fuentes-Panana, “Human viruses TF, AG, LS, and PDC conceived and designed the study. TF, and cancer,” Viruses, vol. 6, no. 10, pp. 4047–4079, 2014. AG, and NS managed the conduction of the study. TF, CM, [15] S. Mishra, “Is Helicobacter pylori good or bad?,” European GC, SC, and MS performed molecular analysis. NS and CG Journal of Clinical Microbiology & Infectious Diseases, vol. 32, performed statistical analysis and drafted the manuscript. no. 3, pp. 301–304, 2013. TF, AG, GC, and CG analyzed the data and drafted the [16] H. C. Leggett, C. K. Cornwallis, A. Buckling, and S. A. West, manuscript. All authors read and approved the final “Growth rate, transmission mode and virulence in human pathogens,” Philosophical Transactions of the Royal Society B: manuscript. Biological Sciences, vol. 372, no. 1719, article 20160094, 2017. [17] I. B. Ramis, J. S. Vianna, C. V. Gonçalves, A. von Groll, References O. A. Dellagostin, and P. E. A. da Silva, “Polymorphisms of the IL- 6, IL-8 and IL-10 genes and the risk of gastric pathology in [1] J. Ferlay, I. Soerjomataram, R. Dikshit et al., “Cancer in- patients infected with Helicobacter pylori,” Journal of Microbiol- cidence and mortality worldwide: sources, methods and major ogy, Immunology and Infection, vol. 50, no. 2, pp. 153–159, 2017. patterns in GLOBOCAN 2012,” International Journal of [18] J. M. Kang, N. Kim, D. H. Lee et al., “&e effects of genetic Cancer, vol. 136, no. 5, pp. E359–E386, 2015. polymorphisms of IL-6, IL-8, and IL-10 on Helicobacter py- [2] J. M. Noto, J. A. Gaddy, J. Y. Lee et al., “Iron deficiency lori-induced gastroduodenal diseases in Korea,” Journal of accelerates Helicobacter pylori-induced carcinogenesis in Clinical Gastroenterology, vol. 43, no. 5, pp. 420–428, 2009. rodents and humans,” Journal of Clinical Investigation, [19] P. Di Carlo, M. Trizzino, L. Titone et al., “Unusual MRI findings vol. 123, no. 1, pp. 479–492, 2013. in an immunocompetent patient with EBV encephalitis: a case [3] D. Iwakiri and K. Takada, “Epstein-Barr virus and gastric report,” BMC Medical Imaging, vol. 11, no. 1, p. 6, 2011. cancers,” in Epstein-Barr Virus, E. S. Roberston, Ed., Caister [20] A. Giardina, A. Rizzo, A. Ferrante, G. Capra, G. Triolo, and Academic Press, Norfolk, VA, USA, 2005. F. Ciccia, “Giant cell arteritis associated with chronic active [4] H. Tanaka, M. Yoshida, S. Nishiumi et al., “&e CagA protein Epstein Barr virus infection,” Reumatismo, vol. 65, no. 1, of Helicobacter pylori suppresses the functions of dendritic cell pp. 36–39, 2013. in mice,” Archives of Biochemistry and Biophysics, vol. 498, no. 1, pp. 35–42, 2010. [21] E. G. Panayotopoulou, D. N. Sgouras, K. Papadakos et al., “Strategy to characterize the number and type of repeating [5] S. L. Palframan, T. Kwok, and K. Gabriel, “Vacuolating cy- totoxin A (VacA), a key toxin for Helicobacter pylori EPIYA phosphorylation motifs in the carboxyl terminus of 8 Journal of Oncology CagA protein in Helicobacter pylori clinical isolates,” Journal of Clinical Microbiology, vol. 45, no. 2, pp. 488–495, 2007. [22] J. C. Atherton, P. Cao, R. M. Peek Jr., M. K. Tummuru, M. J. Blaser, and T. L. Cover, “Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori: association of specific vacA types with cytotoxin production and peptic ulceration,” Journal of Biological Chemistry, vol. 270, no. 30, pp. 17771– 17777, 1995. [23] J. L. Rhead, D. P. Letley, M. Mohammadi et al., “A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer,” Gastroenterology, vol. 133, no. 3, pp. 926–36, 2007. [24] Y. Yamaoka, S. Kikuchi, H. M T el-Zimaity, O. Gutierrez, M. S. Osato, and D. Graham, “Importance of Helicobacter pylori oipA in clinical presentation, gastric inflammation, and mucosal interleukin 8 production,” Gastroenterology, vol. 123 (2), pp. 414–424, 2002. [25] A. Chiarini, C. Cala, ` C. Bonura et al., “Prevalence of virulence- associated genotypes of Helicobacter pylori and correlation with severity of gastric pathology in patients from western Sicily, Italy,” European Journal of Clinical Microbiology & Infectious Diseases, vol. 28, no. 5, pp. 437–446, 2009. [26] T. Fasciana, G. Scarpulla, A. Giammanco et al., “Resistance to clarithromycin and genotypes in Helicobacter pylori strains isolated in Sicily,” Journal of Medical Microbiology, vol. 64, no. 11, pp. 1408–1414, 2015. [27] R. Rad, C. Prinz, B. Neu et al., “Synergistic effect of Heli- cobacter pylori virulence factors and interleukin-1 poly- morphisms for the development of severe histological changes in the gastric mucosa,” Journal of Infectious Diseases, vol. 188, no. 2, pp. 272–815, 2003. [28] G. I. Forte, C. Cala, ` L. Scola et al., “Role of environmental and genetic factor interaction in age-related disease development: the gastric cancer paradigm,” Rejuvenation Research, vol. 11, no. 2, pp. 509–512, 2008. [29] A. Crivello, A. Giacalone, M. Vaglica et al., “Regulatory cy- tokine gene polymorphisms and risk of colorectal carcinoma,” Annals of the New York Academy of Sciences, vol. 1089, no. 1, pp. 98–103, 2006. [30] T. Fasciana, G. Capra, C. Cala` et al., “Helicobacter pylori and Epstein Barr co-infection in gastric disease,” Pharmacology Online, vol. 1, pp. 73–82, 2017. MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Oncology Hindawi Publishing Corporation

Helicobacter pylori and Epstein–Barr Virus Infection in Gastric Diseases: Correlation with IL-10 and IL1RN Polymorphism

Download PDF
9 pages

Loading next page...
 
/lp/hindawi-publishing-corporation/helicobacter-pylori-and-epstein-barr-virus-infection-in-gastric-88tEnVNVRL

References (31)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2019 Fasciana Teresa et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8450
eISSN
1687-8469
DOI
10.1155/2019/1785132
Publisher site
See Article on Publisher Site

Abstract

Hindawi Journal of Oncology Volume 2019, Article ID 1785132, 8 pages https://doi.org/10.1155/2019/1785132 Research Article Helicobacter pylori and Epstein–Barr Virus Infection in Gastric Diseases: Correlation with IL-10 and IL1RN Polymorphism 1,2 3 1 1 Fasciana Teresa , Nicola Serra , Giuseppina Capra, Chiara Mascarella, 3 1 1 1 1 Cesare Gagliardi, Paola Di Carlo , Sara Cannella, Maria Rosa Simonte, Dario Lipari, 1 4 1 Miriam Sciortino, Letizia Scola, and Anna Giammanco Department of Health Promotion, Mother and Child Care, Internal Medicine and Medical Specialties “G. D’Alessandro”, University of Palermo, Palermo, Italy Department of Surgical, Oncological and Oral Sciences, Doctoral Program in Oncology and Experimental Surgery, University of Palermo, Palermo, Italy Department of Public Health, University Federico II of Naples, Naples, Italy Department of Biomedicine, Neuroscience and Advanced Diagnostics, University of Palermo, Palermo, Italy Correspondence should be addressed to Fasciana Teresa; teresa.fasciana@virgilio.it Received 12 March 2019; Revised 10 July 2019; Accepted 18 August 2019; Published 6 December 2019 Academic Editor: &omas R. Chauncey Copyright © 2019 Fasciana Teresa et al. &is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Introduction. Helicobacter pylori and Epstein–Barr virus (EBV) infection have recently been shown to be associated with gastric diseases. Polymorphisms in genes encoding cytokines such as interleukin 10 (IL-10) and interleukin 1 Receptor (IL-1RN) influence cytokine secretion levels and appear to contribute to the risk of developing gastroduodenal diseases. To our knowledge, this is the first preliminary study to address the association of coinfection with H. pylori and EBV and their correlation with genetic predisposition in the development of gastric diseases. Methods. Gastric biopsy samples of 96 patients with different gastric diseases were used. Results. Our results showed that the rate of coinfection was higher in patients with gastric cancer than in patients with normal gastric mucosa, active chronic gastritis, and MALT lymphoma. As regards the characterization of H. pilory strains, the polymorphism s1m1i1 of vacA gene was more frequent in patients with MALT Lymphoma in comparison to others, while the polymorphism s2m2i2 was most frequent in patients with normal gastric mucosa. In addition, patients who tested positive for the cagA gene were more frequently those affected with gastric cancer than those with inactive chronic gastritis. Similarly, the patients with oipA gene ON were more frequently those with gastric cancer than those with inactive chronic gastritis. Conclusion. According to our analysis, there was no correlation between coinfection and polymorphisms in genes encoding IL-10 and IL-1RN. We conclude that various factors can be involved in the development of gastric diseases. Various virulence factors are involved in the develop- 1. Introduction ment of gastric diseases in H. pylori positive patients; among Gastrointestinal diseases and gastric cancer (GC) are among these, the genes cagA, vacA, and oipA have an important role the most common pathologies worldwide [1]. In recent years, [5]. &e cytotoxicity-associated gene A (cagA) is one of the Helicobacter pylori and EBV infection seem to be strongly most significant virulence factors of H. pylori. It is associated associated with the development of gastric diseases [2, 3]. with the development of peptic ulcers and gastric cancer [6]. H. pylori, a bacterium that colonizes the gastric mucosa &e vacA gene encoding for VacA protein is capable of of more than 50% of the world’s population, is considered to inducing large host cell vacuoles in the cytoplasm of gastric be a group 1 carcinogen by the International Agency for cells [7], while the oipA (outer inflammatory protein) gene Research on cancer [4]. encodes one of the outer-membrane proteins that contribute 2 Journal of Oncology gastric cancer. &ese groups were defined considering both to gastric inflammation, inducing IL-8 secretion by epithelial cells [8]. premalignant disease and most common malignant disease correlated to micro-organisms such as MALT lymphoma OipA expression is predicted to be regulated by a slipped strand mispairing system based on the number of CT di- and gastric cancer. &e use of the groups was introduced to nucleotide repeats in the 5′ signal peptide coding region of individualize the impact of each disease singularly and the gene, with “ON” meaning oipA is functional and “OFF” consequently to reduce possible statistical biases. nonfunctional. OipA functional status is involved in bac- &e investigation was deemed to be of interest as Sicily terial adherence to gastric epithelial cells and in mucosal has one of the most complex mixed ethnic populations in inflammation. Europe due to its geographical position. Treatment failure in H. pylori infections is the current issue for physicians. &ere are many reasons for treatment 2. Materials and Methods failure. &ese can be grouped into microorganism-related 2.1. Patients and Sample Collection. &is study was per- factors, host-related factors, and treatment-related factors. formed on a sample of 96 patients, 34.38% males, and H. pylori resistance to antibiotics is widely recognized as the 65.62% females, aged 20–87 years, mean 58.27 y.o. and chief reason for treatment failure. standard deviation (SD) 16.26 y.o. H. pylori resistance to clarithromycin has been correlated to point mutations in the peptidyl transferase region of domain V of the 23S rRNA. &e most common mutation is 2.2. We Considered Four Groups of 24 Consecutive Patients an A-to-G transition at position 2143 (A2143G) and at position 2142 (A2143G). (i) Group with normal gastric mucosa (Group NGM), EBV infection is present in more than 90% of the composed of 33.33% males and 66.67% females, population. Upon infection, the virus rests latent in aged 22–71 years, mean 46.58 y.o. and standard B lymphocytes throughout the person’s lifetime [9]. deviation (SD) 14.74 y.o Moreover, the association of EBV with gastric carcinoma (ii) Group with active chronic gastritis (Group GCA) was reported for a case of lymphoepithelial-like gastric composed of 37.50% males and 62.50% females, carcinoma, but the mechanism used by the virus to de- aged 20–87 years, mean 49.04 y.o. and standard termine the oncogenesis is still unknown [10]. deviation (SD) 16.83 y.o It seems that EBV deregulation of the expression of (iii) Group with gastric cancer (Group KG), composed immune response-related genes promotes marked intra or of 33.33% males and 66.67% females, aged 55– peritumoral immune cell infiltration [11]. &e relationship 87 years, mean 69.88 y.o. and standard deviation of H. pylori with early inflammatory precancerous lesions is (SD) 8.68 y.o well known. However, only a few studies have evaluated the partic- (iv) Group with gastric MALT lymphoma (Group ML), ipation of EBV infection in these lesions. composed of 33.33% males and 66.67% females, Some studies have found evidence that EBV infects aged 57–80 years, mean 67.58 y.o. and standard epithelial cells of the atrophic gastric mucosa with a rela- deviation (SD) 6.24 y.o tively low frequency [12], whereas other studies favour Exclusion criteria were as follows: previous attempts to higher frequencies [13]. eradicate H. pylori and use of antibiotics or proton pump While both micro-organisms are responsible for the inhibitor within 2 weeks prior to endoscopy. most common infections worldwide, a small percentage of Each patient signed an informed consent form before infected patients will develop severe disease [14]. undergoing endoscopy. &e outcome of the infection depends on the relation- ship between environment, host, and bacterial virulence factors [15, 16]. Recently, the polymorphism of proin- 2.3. Sample Collection and Histological Analysis. Gastric flammatory cytokines such as IL1RN and anti-inflammatory biopsy samples were obtained from patients attending the cytokines such as IL-10 has been implicated in clarifying endoscopy ward of the Endoscopy Services of the A.O.U.P. host factors in the development of gastric diseases [17]. Paolo Giaccone (Palermo, Italy) and M. Raimondi Hospital, In particular, IL1RN genotypes and low IL-10 pro- San Cataldo (Caltanissetta, Italy). Two biopsy samples were duction have been associated with an increased risk for obtained from de the antrum and two from the gastric severe gastric lesions in patients infected with both micro- corpus. One was used for H. pylori culture and the second for organisms [18]. histologic examination. In this preliminary study, we analyze H. pylori and EBV In patients suspected of having gastric cancer and MALT coinfection and correlation with host genetic variability in lymphoma, samples were taken directly from the gastric gastric tissues from adult patients with different gastric lesion. diseases in Italy. One antrum sample and one corpus sample was fixed in In this study, we considered four groups of patients: formaline, paraffin-embedded, and stained with hematox- group with normal gastric mucosa (control group), group ylin and eosin (HE). Inflammatory response was graded with active chronic gastritis, group gastric MALT (Mucosa- according to the Sydney System by a single experienced Associated Lymphoid Tissue) lymphoma, and group with pathologist. Journal of Oncology 3 2.4. DNA Isolation from Gastric Biopsies, H. pylori, and EBV Mutation System (ARMS-PCR) was used to type 819C/Tand DNA Detection by PCR Methodology. DNA from the biopsy 1082G/A IL-10 SNP, as described by Crivello et al. [30]. samples was extracted using a High Pure Template Prepa- ration kit (Roche), in accordance with the manufacturer’s 3. Statistical Analysis instructions. &e extracted DNA was stored at − 20 C until use. Data are presented as number and percentage for categorical H. pylori infection was diagnosed when the ureaseA gene variables, and continuous data are expressed as mean- was detected with nested PCR, while the BAMHI-W frag- ± standard deviation (SD), unless otherwise specified. &e ment region of the EBV genome was used as the target to multiple comparison chi-square test was used to define evaluate the presence of the virus, according to Di Carlo et al. significant differences among percentages: if chi-square test [19] and Giardina et al. [20]. was positive (p value <0.05), then residual analysis with the Z-test to locate the highest or lowest significant presence was performed. To evaluate significant differences of means 2.5.DetectionofcagA,theEPIYAMotif,TypingofvacAAlleles, among groups, we performed the multicomparison ANOVA andDeterminingoipAStatus. In order to detect the presence test. When the ANOVA test was positive (p value <0.05), of the cagA gene and to analyse the EPIYA motif, the DNA pairwise comparisons were performed with Scheffe’s ´ test. from each strain was subjected to PCR, as described by Univariate and multivariate linear correlation analysis Panayotopoulou et al. [21]. In determining the EPIYA motif, was performed, where the test on Pearson’s linear correla- three different PCR products were obtained: EPIYA ABC tion coefficient R was performed with t-Student test, under (550 bp), EPIYA ABCC (650 bp), and EPIYA ABCCC null hypothesis of Pearson’s linear correlation coefficient (750 bp). &e signal peptide (s) and midregion (m) of the R � 0. In this step for dichotomies, we defined the experi- vacA gene were amplified using the primers described by mental probability distribution for the variables Gender, Hp, Atherton et al. [22]. Four different PCR products were EBV, and Coinfected, assigning them the following values: obtained: s1 (259 bp) and s2 (286 bp) from the s-region and m1 (290 bp) and m2 (352 bp) from the m-region (Atherton (i) For Gender, male � 1 and female � 0 et al., 1995). Two different PCR products were obtained from (ii) Hp, presence � 1 and absence � 0 the i-region: i1 (250 bp) and i2 (260 bp) [23]. OipA status (iii) EBV virus, presence � 1 and absence � 0 was determined in all strains by PCR and sequencing of the (iv) Coinfected (patients with HP and EBV virus), signal region of the oipA gene, according to Yamaoka et al. yes � 1, and no � 0 [24]. For polymorphism variables vacA, IL-1RN, and IL-10, we defined, according to the frequency of the variable’s 2.6. Determination of Point Mutations in the H. pylori 23S modalities in our total sample data, the following scales, rRNA Gene. In order to detect mutations related to clari- respectively: thromycin resistance in the 23S rRNA gene and to establish the number of CT repeats present in oipA, the same primers (i) s2m2i2 � 5, s1m1i1 � 4, s1m2i1 � 3, s1m2i2 � 2, and used for the amplification gene were employed. s1m1-m2i1 � 1 and polymorphism absence � 0 &e resulting PCR products were subjected to gel (ii) 1/1 � 5, 1/2 � 4, 2/2 � 3, 1/3 � 2, and 4/4 � 1 and electrophoresis in a 2% agarose gel, subsequently purified polymorphism absence � 0 and concentrated for sequencing using Amicon Ultra 0.5 ml (iii) AA � 3, AG � 2, and GG � 1 and polymorphism columns (Millipore). Purified amplicons were sequenced absence � 0 directly with the same forward and reverse primers used in the previous PCR, using an ABI PRISM BigDye Cycle Se- For the gastric disease variables, we used the following quencing Ready Reaction kit (Applied Biosystems) scale: according to the instructions supplied by the manufacturer. (i) NGM � 1, GCA � 2, ML � 3, and KG � 4. &e analysis of products was performed using BioEdit v. 7.2.0 software according to Chiarini et al. [25] and Fasciana We considered all statistical tests with p value<0.05 to be et al. [26]. significant. All data were analyzed with Matlab statistical toolbox version 2008 (MathWorks, Natick, MA, USA) for 32 bit Windows. 2.7. Genotyping of Cytokine Polymorphisms. &e IL-1RN exon 2 polymorphism was analyzed according to Rad et al. [27] Conditions were as follows: 95 C for 5 min, then 35 4. Results and Discussions ° ° ° cycles of 95 C for 30 s, 50 C for 30 s, 72 C for 30 s, and finally 72 C for 5 min. &e PCR products were analyzed by elec- In this preliminary study, we evaluated the relationship trophoresis on a 2% agarose gel stained with ethidium between H. pylori and EBV infection, and cytokine poly- bromide. Allele 1 (4 repeats) was 410 bp, allele 2 (2 repeats) morphism in gastric diseases in people living in the Med- was 240 bp, allele 3 (5 repeats) was 500 bp, allele 4 (3 repeats) iterranean area [26, 30]. In our study, the positivity rate of H. was 325 bp, and allele 5 (6 repeats) was 595 bp in length, pylori in patients with gastric cancer was higher than that according to Forte et al. [28]. Amplification Refractory found in patients with normal gastric mucosa, active chronic 4 Journal of Oncology Table 1: Clinical information: age, gender, symptoms, and in- gastritis, and MALT lymphoma, namely, 50%, 45.83%, fection type in the total patient sample. 41.67%, and 45.83%, respectively. EBV was detected in 54.17% of the patients with gastric Parameters Sample data cancer. It was detected in smaller percentages in patients Age 58.27± 16.26 with normal gastric mucosa, active chronic gastritis, and Gender MALT lymphoma, namely, 20.83%, 41.67%, and 37.50%, Male 34.38% (33/96) respectively. In any case, the rate of H. pylori in all patients Female 65.62% (63/96) analyzed was 45.83%, and the rate of EBV was 38.54%. Symptoms &e rate of coinfection was higher in patients with gastric NGM 25.00% (24/96) GCA 25.00% (24/96) cancer than that in patients with normal gastric mucosa, ML 25.00% (24/96) active chronic gastritis, and MALT lymphoma, namely, KG 25.00% (24/96) 37.50%, 16.67%, 29.17%, and 25%, respectively. &e cagA Analysis with PCR and vacA genes are commonly used as markers to charac- Not infected 42.71% (41/96) terize H. pylori virulence. Several epidemiological studies Infected by HP 45.83% (44/96) have reported geographical variations in the circulation of Infected by EBV 38.54% (37/96) the virulence factors pertaining to the micro-organisms. In Coinfected 27.08% (26/96) Sicily, the cagA gene is present in 52.27% of strains: in 97% of NGM � normal gastric mucosa; GCA � active chronic gastritis; KG � gastric the strains, it is associated with the ABC EPIYA motif, and in cancer; ML � MALT lymphoma; HP �H. pylori; coinfected � patients with most, it is associated with the presence of the s1i1m1 vacA HP and EBV. allele. In this study, the rate of H. pylori resistance to clari- thromycin was high, occurring in 27% of the cases. &e most Table 2: Gene analysis of our sample data. frequent point mutation in the peptidyl transferase loop Parameters Sample data region of the 23S rRNA gene was A2143G in 83% of resistant Polymorphism of gene vacA strains. &ese data confirm those reported by Fasciana et al. s1m1-m2i1 2.27% (1/44) in a previous study [26]. s1m2i2 4.55% (2/44) Table 1 shows clinical information of the total patient s1m2i1 6.82% (3/44) sample, including age, gender, symptoms, and infection s1m1i1 40.91% (18/44) type, patients infected by H. pylori, by EBV or both s2m2i2 45.45% (20/44) (coinfected). In addition, we identify four groups according Gene cagA ( ) to symptom type: normal gastric mucosa (NGM), active Negative 47.73% (21/44) Positive 52.27% (23/44) chronic gastritis (GCA), gastric cancer (KG), and MALT Gene oipA ( ) lymphoma (ML). “OFF” 47.73% (21/44) In Table 2, we have summarized the results of our gene “ON” 52.27% (23/44) analysis. &e table shows the percentages of polymorphism Polymorphism IL-1RN of vacA gene, polymorphism IL-1RN, and polymorphism 1/1 56.35% (54/96) IL-10 (− 1082). In addition, in patients where the gene vacA 1/2 21.88% (21/96) was present, the percentage of those with gene cagA positive 2/2 18.75 (18/96) and oipA “ON” status is reported. 1/3 2.08% (2/96) In Table 3, we have described in detail the four groups 4/4 1.04% (1/96) according to symptom type, reported in Table 1. For each Polymorphism IL-10 (− 1082) AA 47.92% (46/96) group, we have reported age, gender, infection type (in- AG 29.17% (28/96) cluding patients infected by H. pilory, EBV, or both), and GG 22.92% (22/96) polymorphism vacA type. In patients where vacA was H. pylori resistant 27.27% (12/44) present, the percentage of those with gene cagA positive and H. pylori sensible 72.73% (32/44) oipA “ON” is indicated. Finally, in the last column, we report HP �H. pylori; GCNA � inactive chronic gastritis; GCA � active chronic the results of univariate and multivariate analysis among gastritis; KG � gastric cancer; ML � MALT lymphoma; cases where gene groups. vacA was present. In Table 3, we can observe a significant difference for age (p value<0.001); in particular, there was a significantly higher number of elderly patients in the gastric cancer and MALT patients with MALT lymphoma, while the polymorphism lymphoma groups, in accordance with Ferlay et al. [1]. s2m2i2 was significantly associated with patients with in- As regards the characterization of H. pilory strains, active chronic gastritis. evaluated directly on gastric biopsies, the polymorphism In addition, the patients positive for cagA gene were more s1m1i1 of vacA gene was more frequent in Group ML (p frequently those affected by gastric cancer (p value � 0.0198) value � 0.0169), while the polymorphism s2m2i2 was most and less frequently those with inactive chronic gastritis frequent in Group NGM (p value � 0.0359) and less frequent compared to patients with other diseases (p value � 0.0130). A in Group KG (p value � 0.0276). In other words, the similar situation was found for the oipA gene. Patients with polymorphism s1m1i1 was significantly associated with oipA gene and “ON” status were more frequently those with Journal of Oncology 5 Table 3: Characteristics of the groups: normal gastric mucosa (NGM), active chronic gastritis (GCA), gastric cancer (KG), and MALT lymphoma (ML). Results of univariate and multivariate analysis among groups. Parameters Group NGM Group GCA Group KG Group ML Univariate and multivariate analysis p< 0.001 (A) NGM< KG, p< 0.05 (Sh) NGM< ML, p< 0.05 (Sh) Age 46.58± 14.74 49.04± 16.83 69.88± 8.68 67.58± 6.24 GCA< KG, p< 0.05 (Sh) GCA< ML, p< 0.05 (Sh) NGM< GCA, p> 0.05 (Sh) ML< KG, p> 0.05 (Sh) Gender Male 33.33% (8/24) 37.50% (9/24) 33.33% (8/24) 33.33% (8/24) p � 0.987 (C) Female 66.67% (16/24) 62.50% (15/24) 66.67% (16/24) 66.67% (16/24) p � 0.987 (C) Analysis with PCR Not infected 50.00% (12/24) 45.83% (11/24) 33.33% (8/24) 41.67% (10/24) p � 0.987 (C) Infected by HP 45.83% (11/24) 41.67% (10/24) 50.00% (12/24) 45.83% (11/24) p � 0.953 (C) Infected by EBV 20.83% (5/24) 41.67% (10/24) 54.17% (13/24) 37.50% (9/24) p � 0.124 (C) Coinfected 16.67% (4/24) 29.17% (7/24) 37.50% (9/24) 25.00% (6/24) p � 0.433 (C) Polymorphism vacA p< 0.0001 (C) s1m1i1 9.09% (1/11) 10.00% (1/10) 58.33% (7/12) 81.82% (9/11) ∗∗ ML, p � 0.0169 (Z) s1m2i1 0.00% (0/11) 10.00% (1/10) 16.67% (2/12) 0.00% (0/11) p � 0.308 (C) s1m2i2 9.09% (1/11) 0.00% (0/10) 8.33% (1/12) 0.00% (0/11) p � 0.589 (C) p< 0.0001 (C) ∗∗ s2m2i2 81.82% (9/11) 80.00% (8/10) 8.33% (1/12) 18.18% (2/11) NGM, p � 0.0359 (Z) ∗∗∗ KG, p � 0.0276 (Z) s1m1-m2i1 0.00% (0/11) 0.00% (0/10) 8.33% (1/12) 0.00% (0/11) p � 0.435 (C) Gene cagA ( ) p< 0.0001 (C) ∗∗ Negative 90.91% (10/11) 80.00% (8/10) 8.33% (1/12) 18.18% (2/11) NGM, p � 0.0130 (Z) ∗∗∗ KG, p � 0.0198 (Z) p< 0.0001 (C) ∗∗ Positive 9.09% (1/11) 20.00% (2/10) 91.67% (11/12) 81.82% (9/11) KG, p � 0.0198 (Z) ∗∗∗ NGM, p � 0.0130 (Z) Gene oipA ( ) p< 0.0001 (C) ∗∗ “OFF” 90.91% (10/11) 80.00% (8/10) 8.33% (1/12) 18.18% (2/11) NGM, p � 0.0130 (Z) ∗∗∗ KG, p � 0.0198 (Z) p< 0.0001 (C) ∗∗ “ON” 9.09% (1/11) 20.00% (2/10) 91.67% (11/12) 81.82% (9/11) KG, p � 0.0198 (Z) ∗∗∗ NGM, p � 0.0130 (Z) ∗ ∗∗ ∗∗∗ significant test; significant most frequent; significant less frequent; A � multicomparison ANOVA test; Sh � post hoc Scheff´e’s test for pairwise comparison; C � multicomparison chi-square test; Z �Z-test; HP �H. pylori; coinfected � patients with HP and EBV; NGM � normal gastric mucosa; GCA � active chronic gastritis; KG � gastric cancer; ML � MALT lymphoma; � cases where gene vacA was present; p � p value. gastric cancer (p value � 0.0198) and less frequently those with Analysis of the 23S rRNA gene demonstrated that 32 inactive chronic gastritis (p value � 0.0130). (73%) patients were infected with H. pylori-susceptible Regarding number of CT repeats, the most prevalent in strains and the remaining 12 (27%) with resistant strains the “ON” frame status had six CT repeats. &is was found to (Table 2). &e predominant point mutation observed among be the case in other studies [26, 30]. Among the out-frame the 12 H. pylori resistant strains was A2143G in 10 cases (83 status, “OFF” variants, the patterns with eight CT repeats %) and A2142G in 2 cases (17%). were the most prevalent. In Table 5, we report the frequency of polymorphism &e evidence pointing to the oipA “ON” as a gastric IL1RN and IL-10 loci for every group. In the last column, we cancer risk factor includes the ability of the bacterium report the results of univariate and multivariate analysis carrying a functional oipA to attach to the gastric epi- performed among the groups. thelial cells and induce inflammation, apoptosis, and a Table 5 shows that there was only one significant as- toxic effect on towards cultured gastric epithelial cell sociation between polymorphism IL-1RN and gastric dis- lines. ease. Particularly, patients with polymorphism IL-1RN type In Table 4, we can see the sequences of signal peptide- 1/2 were significantly less frequent in the ML Group (p encoding region of oipA. value � 0.0248). 6 Journal of Oncology Table 4: oipA CT repeat patterns. Sequence of signal peptide-encoding region of oipA No. CT No. of strains OFF status ATGAAAAAAGCTCTCTTA. . .. . .. . .CTCTCTCTCTCTCTCTCTCGTT 9 5 ATGAAAAAAGCCCTCTTACTAACTCTCTCTCTCTCTCTCGTTT 8 7 ATGAAAAAAGCTCTCTTGCTAACTCTCTCTCTCTCTCTCTCTCGTT 10 2 ATGAAAAAAGCTCTTTTA. . .. . .. . .CTCTCTCTCTCTCGTT 6 3 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCTCTCGTT 7 2 ATGAAAAAGCTCTCTTA. . .. . .. . .CTCTCTCTCTCTCTCGTTCTGG 7 1 ATGAAAAAAGCCCTCTTA. . .. . .. . .CTCTCTCTTTCTCTCGTTTT 4 + 2 1 Total 12 ON status ATGAAAAAAGCTCTCTTACTAATTCTCTCTCTCTCGTT 5 4 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCTCGTT 6 15 ATGAAAAAAGCCCTCTTA. . .. . .. . .CTCTCTCTCTCTCTCTCTCTCTCGT 11 2 ATGAAAAAAGCTCTCTTACTAACT CTCTCTCTCTCTCTCTCGTT 9 1 ATGAAAAAAGCTCTTTTACTCTCT CTCTCTCTCTCGTT 8 1 Total 23 Table 5: Frequency of the polymorphisms IL1RN and IL-10 loci. Results of univariate and multivariate analysis among groups. Parameters Group NGM Group GCA Group KG Group ML Univariate and multivariate analysis Polymorphism IL-1RN 1/1 50.00% (12/24) 62.50% (15/24) 41.67% (10/24) 70.83% (17/24) 0.179 (C) 0.0239 (C) 1/2 29.17% (7/24) 25.00% (6/24) 33.33% (8/24) 0.00% (0/24) ∗∗∗ group ML , p � 0.0248 (Z) 2/2 20.83% (5/24) 8.33% (2/24) 16.67% (4/24) 29.17% (7/24) 0.314 (C) 1/3 0.00% (0/24) 4.17% (1/24) 4.17% (1/24) 0.00% (0/24) 0.564 (C) 4/4 0.00% (0/24) 0.00% (0/24) 4.17% (1/24) 0.00% (0/24) 0.387 (C) Polymorphism IL-10 (− 1082) AA 41.67% (10/24) 45.83% (11/24) 54.17% (13/24) 50.00% (12/24) 0.841 (C) AG 33.33% (8/24) 33.33% (8/24) 29.17% (7/24) 20.83% (5/24) 0.875 (C) GG 25.00% (6/24) 20.83% (5/24) 16.67% (4/24) 29.17% (7/24) 0.768 (C) ∗ ∗∗ ∗∗∗ Significant test; significant most frequent; significant less frequent; # � no localized significant modality with significant level <0.05; C � multicomparison chi-square test; Z �Z-test; HP �H. pylori; NGM � normal gastric mucosa; GCA � active chronic gastritis; KG � gastric cancer; ML � MALT lymphoma; p � p value. Table 6: Results of univariate and multivariate linear correlation analysis between polymorphism of vacA, IL-1RN and IL-10 with age, gender, H. pylori, EBV, coinfected, and gastric disease. Linear correlation analysis Univariate analysis Multivariate analysis R (p value) Multiple linear correlation coefficient � 0.149 Polymorphism IL-1RN/age − 0.092 (0.371) R � − 0.057; p value � 0.593 partial Polymorphism IL-1RN/gender − 0.038 (0.716) R � − 0.013; p value � 0.905 partial Polymorphism IL-1RN/H. pylori 0.02 (0.846) R � − 0.027; p value � 0.800 partial Polymorphism IL-1RN/EBV − 0.027 (0.794) R � 0.052; p value � 0.622 partial Polymorphism IL-1RN/coinfected − 0.015 (0.886) R � − 0.011; p value � 0.917 partial Polymorphism IL-1RN/gastric disease − 0.097 (0.348) R � − 0.107; p value � 0.314 partial R (p value) Multiple linear correlation coefficient � 0.215 Polymorphism IL-10/age 0.116 (0.259) R � 0.106; p value � 0.316 partial Polymorphism IL-10/gender − 0.142 (0.167) R � − 0.125; p value � 0.237 partial Polymorphism IL-10/H. pylori 0.102 (0.322) R � − 0.024; p value � 0.821 partial Polymorphism IL-10/EBV 0.081 (0.430) R � − 0.054; p value � 0.619 partial Polymorphism IL-10/coinfected 0.101 (0.329) R � 0.062; p value � 0.560 partial Polymorphism IL-10/gastric disease 0.061 (0.552) R � 0.027; p value � 0.797 partial Significant test; R � Pearson’s linear correlation coefficient; R � the partial correlation coefficient is the coefficient of correlation of the variable with the partial dependent variable, adjusted for the effect of the other variables in the mode; coinfected � patients with H. pylori and EBV. Journal of Oncology 7 pathogenesis,” Frontiers in Cellular and Infection Microbiol- &ese results, in accordance with other reports, do not ogy, vol. 2, p. 92, 2012. seem to attribute any particular role to proinflammatory or [6] A. T. Franco, E. Johnston, U. Krishna et al., “Regulation of anti-inflammatory cytokine genotypes in gastric disease gastric carcinogenesis by Helicobacter pylori virulence fac- susceptibility [28]. tors,” Cancer Research, vol. 68, no. 2, pp. 379–387, 2008. Finally, in Table 6, we report the results of univariate and [7] T. L. Testerman and J. Morris, “Beyond the stomach: an multivariate linear correlation analyses between poly- updated view of Helicobacter pylori pathogenesis, diagnosis, morphisms IL-1RN and IL-10, with the independent variables and treatment,” World Journal of Gastroenterology, vol. 20, age, gender, H. pylori infection, EBV infection, coinfection, no. 36, pp. 12781–12808, 2014. and gastric disease. In this case, no correlations were found. [8] Y. Yamaoka, D. H. Kwon, and D. Y. Graham, “A Mr 34,000 proinflammatory outer membrane protein (oipA) of Heli- cobacter pylori,” Proceedings of the National Academy of 5. Conclusions Sciences, vol. 97, no. 13, pp. 7533–7538, 2000. We can conclude that the various factors that can be in- [9] O. L. Hatton, A. Arnold-Harris, S. Schaffert, S. M. Krams, and O. M. Martinez, “&e interplay between Epstein Barr virus and volved in cancer development are very complex. A limitation B lymphocytes: implications for infection, immunity, and dis- of this study was the limited number of patients with the ease,” Immunologic Research, vol. 58, no. 2-3, pp. 268–276, 2014. various gastric diseases. &erefore, further investigations are [10] W. K. K. Wu, J. Yu, M. T. V. Chan, K. F. To, and necessary to fully correlate the role of coinfection in gastric A. S. L. Cheng, “Combinatorial epigenetic deregulation by diseases in the Sicilian population. In addition, coinfection Helicobacter pylori and Epstein-Barr virus infections in gastric should be evaluated at an early age and in children with an tumorigenesis,” :e Journal of Pathology, vol. 239, no. 3, increased risk of presenting more serious lesions later in life. pp. 245–249, 2016. [11] A. Shinozaki-Ushiku, A. Kunita, M. Isogai et al., “Profiling of Disclosure virus-encoded microRNAs in Epstein-Barr virus-associated gastric carcinoma and their roles in gastric carcinogenesis,” An earlier version of this manuscript was presented as an Journal of Virology, vol. 89, no. 10, pp. 5581–5591, 2015. th abstract at the 46 Congress of the Italian Society of Mi- [12] M. G. Cardenas-Mondrag ´ on, ´ J. Torres, L. Flores-Luna et al., th th crobiology, September 26 –29 , 2018. “Case–control study of Epstein–Barr virus and Helicobacter pylori serology in Latin American patients with gastric dis- ease,” British Journal of Cancer, vol. 112, no. 12, pp. 1866– Conflicts of Interest 1873, 2015. [13] J. L. Ryan, Y.-J. Shen, D. R. Morgan et al., “Epstein-Barr virus &e authors declare that they have no conflicts of interest. infection is common in inflamed gastrointestinal mucosa,” Digestive Diseases and Sciences, vol. 57, no. 7, pp. 1887–1898, Authors’ Contributions ´ ´ [14] A. Morales-Sanchez and E. Fuentes-Panana, “Human viruses TF, AG, LS, and PDC conceived and designed the study. TF, and cancer,” Viruses, vol. 6, no. 10, pp. 4047–4079, 2014. AG, and NS managed the conduction of the study. TF, CM, [15] S. Mishra, “Is Helicobacter pylori good or bad?,” European GC, SC, and MS performed molecular analysis. NS and CG Journal of Clinical Microbiology & Infectious Diseases, vol. 32, performed statistical analysis and drafted the manuscript. no. 3, pp. 301–304, 2013. TF, AG, GC, and CG analyzed the data and drafted the [16] H. C. Leggett, C. K. Cornwallis, A. Buckling, and S. A. West, manuscript. All authors read and approved the final “Growth rate, transmission mode and virulence in human pathogens,” Philosophical Transactions of the Royal Society B: manuscript. Biological Sciences, vol. 372, no. 1719, article 20160094, 2017. [17] I. B. Ramis, J. S. Vianna, C. V. Gonçalves, A. von Groll, References O. A. Dellagostin, and P. E. A. da Silva, “Polymorphisms of the IL- 6, IL-8 and IL-10 genes and the risk of gastric pathology in [1] J. Ferlay, I. Soerjomataram, R. Dikshit et al., “Cancer in- patients infected with Helicobacter pylori,” Journal of Microbiol- cidence and mortality worldwide: sources, methods and major ogy, Immunology and Infection, vol. 50, no. 2, pp. 153–159, 2017. patterns in GLOBOCAN 2012,” International Journal of [18] J. M. Kang, N. Kim, D. H. Lee et al., “&e effects of genetic Cancer, vol. 136, no. 5, pp. E359–E386, 2015. polymorphisms of IL-6, IL-8, and IL-10 on Helicobacter py- [2] J. M. Noto, J. A. Gaddy, J. Y. Lee et al., “Iron deficiency lori-induced gastroduodenal diseases in Korea,” Journal of accelerates Helicobacter pylori-induced carcinogenesis in Clinical Gastroenterology, vol. 43, no. 5, pp. 420–428, 2009. rodents and humans,” Journal of Clinical Investigation, [19] P. Di Carlo, M. Trizzino, L. Titone et al., “Unusual MRI findings vol. 123, no. 1, pp. 479–492, 2013. in an immunocompetent patient with EBV encephalitis: a case [3] D. Iwakiri and K. Takada, “Epstein-Barr virus and gastric report,” BMC Medical Imaging, vol. 11, no. 1, p. 6, 2011. cancers,” in Epstein-Barr Virus, E. S. Roberston, Ed., Caister [20] A. Giardina, A. Rizzo, A. Ferrante, G. Capra, G. Triolo, and Academic Press, Norfolk, VA, USA, 2005. F. Ciccia, “Giant cell arteritis associated with chronic active [4] H. Tanaka, M. Yoshida, S. Nishiumi et al., “&e CagA protein Epstein Barr virus infection,” Reumatismo, vol. 65, no. 1, of Helicobacter pylori suppresses the functions of dendritic cell pp. 36–39, 2013. in mice,” Archives of Biochemistry and Biophysics, vol. 498, no. 1, pp. 35–42, 2010. [21] E. G. Panayotopoulou, D. N. Sgouras, K. Papadakos et al., “Strategy to characterize the number and type of repeating [5] S. L. Palframan, T. Kwok, and K. Gabriel, “Vacuolating cy- totoxin A (VacA), a key toxin for Helicobacter pylori EPIYA phosphorylation motifs in the carboxyl terminus of 8 Journal of Oncology CagA protein in Helicobacter pylori clinical isolates,” Journal of Clinical Microbiology, vol. 45, no. 2, pp. 488–495, 2007. [22] J. C. Atherton, P. Cao, R. M. Peek Jr., M. K. Tummuru, M. J. Blaser, and T. L. Cover, “Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori: association of specific vacA types with cytotoxin production and peptic ulceration,” Journal of Biological Chemistry, vol. 270, no. 30, pp. 17771– 17777, 1995. [23] J. L. Rhead, D. P. Letley, M. Mohammadi et al., “A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer,” Gastroenterology, vol. 133, no. 3, pp. 926–36, 2007. [24] Y. Yamaoka, S. Kikuchi, H. M T el-Zimaity, O. Gutierrez, M. S. Osato, and D. Graham, “Importance of Helicobacter pylori oipA in clinical presentation, gastric inflammation, and mucosal interleukin 8 production,” Gastroenterology, vol. 123 (2), pp. 414–424, 2002. [25] A. Chiarini, C. Cala, ` C. Bonura et al., “Prevalence of virulence- associated genotypes of Helicobacter pylori and correlation with severity of gastric pathology in patients from western Sicily, Italy,” European Journal of Clinical Microbiology & Infectious Diseases, vol. 28, no. 5, pp. 437–446, 2009. [26] T. Fasciana, G. Scarpulla, A. Giammanco et al., “Resistance to clarithromycin and genotypes in Helicobacter pylori strains isolated in Sicily,” Journal of Medical Microbiology, vol. 64, no. 11, pp. 1408–1414, 2015. [27] R. Rad, C. Prinz, B. Neu et al., “Synergistic effect of Heli- cobacter pylori virulence factors and interleukin-1 poly- morphisms for the development of severe histological changes in the gastric mucosa,” Journal of Infectious Diseases, vol. 188, no. 2, pp. 272–815, 2003. [28] G. I. Forte, C. Cala, ` L. Scola et al., “Role of environmental and genetic factor interaction in age-related disease development: the gastric cancer paradigm,” Rejuvenation Research, vol. 11, no. 2, pp. 509–512, 2008. [29] A. Crivello, A. Giacalone, M. Vaglica et al., “Regulatory cy- tokine gene polymorphisms and risk of colorectal carcinoma,” Annals of the New York Academy of Sciences, vol. 1089, no. 1, pp. 98–103, 2006. [30] T. Fasciana, G. Capra, C. Cala` et al., “Helicobacter pylori and Epstein Barr co-infection in gastric disease,” Pharmacology Online, vol. 1, pp. 73–82, 2017. MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal

Journal of Oncology – Hindawi Publishing Corporation

Published: Dec 6, 2019

There are no references for this article.