Get 20M+ Full-Text Papers For Less Than $1.50/day. Subscribe now for You or Your Team.

Learn More →

Evidence that a STAT3 Mutation Causing Hyper IgE Syndrome Leads to Repression of Transcriptional Activity

Evidence that a STAT3 Mutation Causing Hyper IgE Syndrome Leads to Repression of Transcriptional... Hindawi Case Reports in Immunology Volume 2019, Article ID 1869524, 5 pages https://doi.org/10.1155/2019/1869524 Case Report Evidence that a STAT3 Mutation Causing Hyper IgE Syndrome Leads to Repression of Transcriptional Activity 1 2,3 4 1 2 Sameer Bahal , Maha E. Houssen, Ania Manson, Lorena Lorenzo, Mark A. Russell, 2 5 1 Noel G. Morgan, Fariba Tahami, and Sofia Grigoriadou Department of Immunology, Royal London Hospital, Barts Health NHS Trust, London, UK University of Exeter Medical School, UK Biochemistry Department, Damanhour University, Egypt Department of Immunology, Addenbrooke’s Hospital, Cambridge, UK Department of Immunology, Great Ormond Street Hospital, London, UK Correspondence should be addressed to Sameer Bahal; s.bahal@nhs.net Received 15 May 2019; Revised 17 July 2019; Accepted 28 July 2019; Published 13 October 2019 Academic Editor: Elena Bozzola Copyright © 2019 Sameer Bahal et al. �is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. We present the case of a 19-year-old female with a mild form of Autosomal Dominant Hyper IgE syndrome (HIES) associated with a loss-of-function mutation in STAT3. Within the Šrst years of life she developed multiple, Staphylococcus aureus associated abscesses in the neck and face requiring frequent incision and drainage. Respiratory tract infections were not a feature of the clinical phenotype and a high resolution thoracic CT scan was unremarkable. Retained dentition was noted but fungal nail disease and recurrent thrush were absent. �e total IgE was 970 IU/L, Lymphocyte counts and immunoglobulin levels were normal (IgG borderline 18.5 gr/L). �ere was suboptimal response to test immunisation with Pneumovax II vaccine. �17 cell phenotyping revealed low levels of IL-17 expressing cells (0.3% of total CD4 T Cells numbers). Genetic analysis identiŠed a missense mutation, N567D, in a conserved region of the linker domain of STAT3. Functional studies in HEK293 cells reveal that this mutation potently inhibits STAT3 activity when compared to the wildtype protein. �is is consistent with other reported mutations in STAT3 associated with HIES. However, surprisingly, the magnitude of inhibition was similar to another STAT3 mutation (V637M) which causes a much more severe form of the disease. implicated in disease and, in addition to loss-of-function 1. Introduction mutations associated with HIES [2], various activating muta- Hyper IgE syndrome (HIES) is a rare primary immune deŠ- tions have also been described which may predispose to cer- ciency and is characterised by elevated circulating levels of tain forms of cancer [3], autoimmune forms of neonatal IgE. Patients typically experience eczema, lung, and skin infec- diabetes, and various immune deŠciencies [4], including tions, but other co-morbidities have also been described CVID [5]. In the current report, we performed sequencing of including brain and cardiac abnormalities. �e autosomal samples from a patient with a mild form of HIES, to identify dominant form of HIES is most commonly associated with a missense mutation in the linker domain of STAT3 which inactivating mutations in STAT3 although HIES-associated caused a reduction in transcriptional activity and is likely to mutations in DOCK8 and Tyk2 are reported [1]. be causative for disease. �e transcription factor STAT3 is a multifunctional pro- tein, whose activity is controlled by a plethora of cytokines and growth factors acting at their cognate cell surface recep- 2. Patient Description tors. Activated STAT3 translocates to the nucleus where it binds to consensus sequences in the DNA to regulate target We present the case of a 19-year-old female with Autosomal gene expression. A variety of mutations in STAT3 have been Dominant HIES. She was born at 36 weeks gestation and early 2 Case Reports in Immunology in life she developed multiple, Staphylococcus aureus associ- of the various STAT3 constructs. Attractene transfection ated abscesses in the neck and face requiring frequent incision reagent (Qiagen) was used to facilitate DNA uptake, and and drainage. Respiratory tract infections were not a feature STAT3 activity was assessed 24 h aer transfection using a dual of the clinical phenotype and a thoracic CT scan was unre- luciferase reporter assay system (Promega, Madison, WI, USA) markable. Retained dentition and mild eczema were noted but and with luminescence detected using a Pherastar FS (BMG fungal nail disease and recurrent thrush were absent. e cir- Labtech, Ortenberg, Germany). In some experiments, cells culating total IgE was markedly elevated (970 IU/L, NR: were treated with human IL-6 (R&D systems, Minneapolis, 0-81 IU/L); T and B cell counts were normal but IgG was raised MN, USA) 4 h aer transfection. (18.5 gr/L). Complement C3 and C4 levels, and complement 3.5. Western Blotting. Cells were lysed and whole cell protein function tests were normal. ere was a suboptimal response was extracted [8]. Protein was denatured, loaded evenly onto to test immunisation with Pneumovax II vaccine. e patient a 4%–12.5% Bis-Tris polyacrylamide gel and separated by is currently managed with flucloxacillin 500 mg BD for electrophoresis. Protein was then transferred onto a PVDF Staphylococcus aureus prophylaxis. e disease activity cal- membrane prior to immunoblotting using an iBind Flex culated via the score previously described by Grimbacher according to the manufacturer’s guidelines (ermo Fisher et al. was 36 [6]. is is classed as indicating an indeterminate Scientific). Membranes were probed with STAT3 antisera risk of HIES and reflects the mild/moderate phenotype [7]. (1 : 1000; Cell Signalling, Beverly, MA, USA) or beta-actin (1 : 2000; Sigma-Aldrich, Poole, Dorset, UK), and then with appropriate alkaline phosphatase conjugated secondary 3. Materials and Methods antibodies. CDP Star chemiluminescent reagent (Sigma- Aldrich) was used to detect bands, and this was visualised 3.1. Sanger Sequencing. Genomic DNA was isolated from using a cDigit blot scanner. whole blood. Coding genomic sequences and cDNA of STAT3 were purified with the QIAquick PCR purification kit 3.6. 17 Phenotyping. PBMCs were isolated from a 10 ml (Qiagen, Hilden, Germany). Subsequently, PCR products were heparin blood sample using LymphoprepTM (Axis-Shield). sequenced using the ABI PRISM BigDye Terminator cycle e PBMCs were re-suspended in 4 ml of RPMI with 10% ready reaction kit V3.1 (Applied Biosystems). e sequencing foetal bovine serum. Cells were either untreated or stimulated was performed on a 3130xl Applied Biosystems Genetic with 1 µg/mL Staphylococcus enterotoxin B (SEB; Sigma) for Analyzer. Data analysis was performed with DNA Sequencing 2 h. GolgiStop (BD Biosciences) was then added and cells Analysis soware, v5.2 (Applied Biosystems) and Sequencher were incubated for a further 16 h. Subsequently, cells were v4.8 (Gene Codes Corp, Ann Arbor, Mich). surface stained with CD3 (V500), CD4 (V450), and CD45RO (PerCP-Cy5.5) and intracellular stained with IL-4 (PE-Cy7), 3.2. Cell Culture. A DMEM base medium supplemented IFN-γ (Alexa Fluor®488), and IL-17A (Alexa Fluor®647). with 10% foetal calf serum, 2 mM L-glutamine, 100 μg/ml Intracellular staining was performed by using the BD Cytofix/ streptomycin, and 100 U/ml penicillin was used to culture Cytoperm™ Fixation/Permeabilization Kit (BD Biosciences). HEK293 cells. Cells were sub-cultured upon reaching All antibodies were from BD Biosciences. Cells were analysed approximately 80% confluency. using an 8 colour BD FACSCanto. 3.3. Mutagenesis. Mutations within the human STAT3 gene (Source Bioscience, Nottingham, UK) were introduced using the QuikChange site-directed mutagenesis kit (Agilent 4. Results Technologies, CA, USA). e custom primers used to generate STAT3 variants were N567D; Fd ACAAGGT- 4.1. 17 Profiling of Patient. HIES patients typically display reduced numbers of 17 T-helper cells [9]. 17 cell CAATGATATCGTCCAGCCAGACCCAG Rv: TCTGG- GTCTGGCTGGACGATATCATTGACCTTGTG Y640F; phenotyping revealed that 17 cells comprised 0.3% of the total CD4+ T-cell number. is was below the normal range Fd: AGTCCGTGGAACCATTCACAAAGCAGCAGCTG Rv: AGCTGCTGCTTTGTGAATGGTTCCACGGACTG V637M; of >0.4%, and consistent with the diagnosis of Hyper IgE syndrome. Fd; AGACCCAGATCCAGTCCATGGAACCATACACAAAG Rv; TGCTTTGTGTATGGTTCCATGGACTGGATCT- 4.2. Functional Investigations. Sanger sequencing of the GGGTC. e success of mutagenesis was confirmed by full patient’s DNA revealed a missense mutation in the STAT3 sequencing of inserts (Source Bioscience). e STAT3 inserts gene. e variant was heterozygous with a nucleotide exchange were digested out of a pENTR221 vector using PsiI to produce (A to G) at position 1699 in exon 19, leading to an aspartate a blunt-ended product. is was treated with a calf intestinal for asparagine substitution at position 567 within the linker phosphatase enzyme prior to insertion into a pcDNA5/FRT/ domain (N567D) (Figure 1). e amino acid sequence is TO expression vector at the EcoRV restriction site within the highly conserved at this region across multiple species [10]. polylinker. e N567D variant of STAT3 was generated by site-di- 3.4. Reporter Assay. HEK293 cells were seeded into 24-well rected mutagenesis, and upon transfection into HEK293 cells, Western blotting analysis revealed an increase in STAT3 plates and transfected with 200 ng of the STAT3-reponsive dual luciferase Cignal reporter construct (Qiagen) and 400 ng expression compared to cells transfected with empty vector Case Reports in Immunology 3 Trans- N-termCoiled coil DNA bindingLinkerSH2 activation N567D F¬®¯°± 1: Schematic diagram of STAT3 protein structure showing the position of the N567D mutation identiŠed from a patient with Hyper IgE syndrome. STAT3 β-Actin (a) Unstimulated IL-6 stimulated STAT3WT N567D Y640F V637M STAT3WT N567D Y640F V637M (b) F¬®¯°± 2: Transfection of N567D-STAT3 into cells increased STAT3 activity. (a) HEK293 cells were transfected with equal amounts of an empty vector, wildtype STAT3 or N567D and expression of STAT3 was studied by Western blotting. Results are representative of two independent experiments. (b) Cells were alternatively transfected with wildtype, N567D, and mutations which are known to activate (Y640F), and inactivate (V637M) STAT3. �ese cells were either grown in the presence or absence of 20 ng/ml IL-6 for 18 h, and transcriptional activity was determined using a dual-luciferase reporter assay ( = 3−6).  < 0.05. (Figure 2(a)). Importantly, transfection of either the wildtype be reªective of the situation occurring in vivo when a domi- (WT) or mutant form of STAT3 resulted in approximately nant heterozygous mutations is found. equal levels of protein expression (Figure 2(a)). To validate the assay system, previously reported STAT3 To study the impact of N567D on STAT3 transcriptional mutations which enhance (Y640F) or reduce (V637M) STAT3 activity, a STAT3-responsive dual-luciferase reporter construct activity were tested in parallel with N567D. STAT3 activity was employed, and this revealed that STAT3-N567D signiŠ- was modiŠed in the expected direction under both basal and cantly inhibited protein activity compared to WT STAT3 (fold IL-6 stimulated conditions upon the transfection of cells with change from WT; N567D: 0.6 ± 0.2,  < 0.05) (Figure 2(b)). these variants (Figures 2(a) and 2(b)). IL-6 is an agonist of STAT3 signalling, and treatment of HEK293 cells with 20 ng/ml IL-6 enhanced STAT3 activity by ~14-fold in cells expressing WT STAT3. Under IL-6 stimulated 5. Discussion conditions the inhibitory e©ects of N567D were more pro- nounced, and STAT3 activity was reduced to levels comparable Autosomal dominant HIES is caused by loss-of-function to those seen in unstimulated cells expressing WT STAT3 mutations in STAT3 [11]. Consistent with this, we describe a (Figure 2(b)). It is important to emphasise that, in these stud- de novo mutation in the linker domain of STAT3 from a patient ies, expression of the mutant form was achieved in the context with a mild/moderate form of HIES that robustly inhibited of the continued expression of the endogenous (wild type) the activity of STAT3 under both basal and IL-6 stimulated STAT3 present in HEK293 cells. As such, the data are likely to conditions. �is mutation has been described in a single STAT3 activity (fold change from WT) Negative Control STAT3 activity (fold change from WT) STAT3WT N567D 4 Case Reports in Immunology previous case with a more severe phenotype, although the Disclosure authors did not examine its transcriptional activity in vitro �is case was presented in poster format at the United [10]. Interestingly, despite the mild/moderate phenotype seen Kingdom Primary ImmunodeŠciency Network Meeting in in our patient, the magnitude of STAT3 inhibition caused by December 2017. the present mutation was comparable to that observed for other HIES associated mutants (e.g., V637M) which are reported to yield a much more severe disease phenotype [12]. Conflicts of Interest �is suggests that the precise location of the mutation within the structure of STAT3 may be critical for Šnal determination �e authors declare that they have no conªicts of interest. of the disease phenotype even when the net outcome is a mod- est inhibition of transcriptional activity. In considering the e©ects of the present mutation, it is Authors’ Contributions known that STAT3 is crucial for the di©erentiation of T-cells to a �17 phenotype [13], and in accord once with this circu- LL, AM, and SG were involved in evaluating and treating the lating �17 T-cell numbers were reduced in both patients in patient. FT performed �17 phenotyping. MEH and MAR whom the mutation was found [10]. In addition, both patients performed the cell based studies, MAR and NGM designed had elevated IgE levels and recurrent infections with these studies. SB, MAR, NGM, MEH, and SG dra³ed and Staphylococcus aureus. However, some di©erences in pheno- edited the manuscript. All authors approved the Šnal version. type were noted. For example, unlike our patient, the earlier case exhibited an allergic history, bone fractures as well as oral Acknowledgments candidiasis. �e majority of STAT3 mutations were associated with We gratefully acknowledge the Mission Sector of the Egyptian HIES cluster in the SH2 domain, the DNA-binding domain Ministry of Higher Education (Arab Republic of Egypt) who and the transactivation domain of the protein [14]. To our provided funding for MEH to work as a visiting postdoctoral knowledge, only two additional variants have been identiŠed fellow at the University of Exeter (March 2016-September in the linker domain of STAT3, K531E [15], and I568F [16]. 2016). �is work was also supported by Diabetes UK (grant: All STAT family members possess an α-helical linker between 15/0005156). their SH2 and transactivation domains. Since this linker acts as a ridged spacer between functionally distinct groups, its disruption may result in altered protein function. In this con- References text, targeted mutation of several conserved residues within the linker domain of STAT3 strongly reduced IL-6 stimulated [1] A. F. Freeman and S. M. Holland, “Clinical manifestations of transcriptional activity [17]. Similar data have been reported hyper IgE syndromes,” Disease Markers, vol. 29, no. 3–4, pp. for STAT1, which shares high sequence homology with that 123–130, 2010. of STAT3 in the linker region [18]. Merli and colleagues per- [2] Y. Minegishi, M. Saito, S. Tsuchiya et al., “Dominant-negative formed in silico investigations, examining the intramolecular mutations in the DNA-binding domain of STAT3 cause hyper- interactions that occur with the N567 residue, mutated in the IgE syndrome,” Nature, vol. 448, no. 7157, pp. 1058–62, 2007. present variant [10]. �is revealed that N567 interacts with [3] C. Pilati, M. Amessou, M. P. Bihl et al., “Somatic mutations K615, a highly conserved residue in the DNA binding domain, activating STAT3 in human inªammatory hepatocellular and that the aspartic acid substitution is likely to disrupt this adenomas,” ‰e Journal of Experimental Medicine, vol. 208, no. 7, pp. 1359–1366, 2011. interaction and impinge on DNA binding and dimer stability. In support of this, MUpro so³ware, which calculates protein [4] S. E. Flanagan, E. Haapaniemi, M. A. Russell et al., “Activating stability, predicts that N567D will decrease stability germline mutations in STAT3 cause early-onset multi-organ autoimmune disease,” Nature Genetics, vol. 46, no. 8, pp. 812– ( = −1.05) [19]. Taken together, these data support the 814, 2014. notion that disruption of the linker domain (as in N567D) will [5] M. A. Russell, M. Pigors, M. E. Houssen et al., “A novel de impact STAT3 protein function. novo activating mutation in STAT3 identiŠed in a patient �e loss of STAT3 activity is an important driver of HIES, with common variable immunodeŠciency (CVID),” Clinical and therapeutic strategies to prevent or reverse this would Immunology, vol. 187, pp. 132–136, 2018. be of interest to the Šeld. In this context, a recent study [6] B. Grimbacher, A. A. Schä©er, S. M. Holland et al., “Genetic revealed that certain small molecule compounds can improve linkage of hyper-IgE syndrome to chromosome 4,” ‰e American the stability and activity of speciŠc HIES-associated STAT3 Journal of Human Genetics, vol. 65, no. 3, pp. 735–744, 1999. mutants [20]. Whilst these Šndings have potentially exciting implications, they are based on in vitro studies and these [7] A. P. Hsu, J. Davis, J. M. Puck, S. M. Holland, and A. F. Freeman, molecules were only e©ective against the mutations which “Autosomal dominant hyper IgE syndrome,” in GeneReviews®, destabilised STAT3, presumably due to their upregulation of M. P. Adam, H. H. Ardinger, and R. A. Pagon, Eds., University chaperone proteins. �us, alternative methods to improve of Washington, Seattle, WA, 1993, https://www.ncbi.nlm.nih. gov/books/NBK25507/. the activity of STAT3 are needed. Perhaps, small molecules targeted to the linker region of STAT3 may be one mecha- [8] H. J. Welters, A. Oknianska, K. S. Erdmann, G. U. Ry©el, and N. nism to achieve this. G. Morgan, “�e protein tyrosine phosphatase-BL, modulates Case Reports in Immunology 5 pancreatic beta-cell proliferation by interaction with the Wnt signalling pathway,” Journal of Endocrinology, vol. 197, no. 3, pp. 543–552, 2008. [9] A. F. Freeman and S. M. Holland, “e hyper-IgE syndromes,” Immunology and Allergy Clinics of North America, vol. 28, no. 2, pp. 277–291, 2008. [10] P. Merli, F. Novara, D. Montagna et al., “Hyper IgE syndrome: anaphylaxis in a patient carrying the N567D STAT3 mutation,” Pediatric Allergy and Immunology, vol. 25, no. 5, pp. 503–505, [11] T. H. Mogensen, “STAT3 and the Hyper-IgE syndrome: Clinical presentation, genetic origin, pathogenesis, novel findings and remaining uncertainties,” JAK-STAT, vol. 2, no. 2, Article ID e23435, 2013. [12] H. Jiao, B. Tóth, M. Erdos et al., “Novel and recurrent STAT3 mutations in hyper-IgE syndrome patients from different ethnic groups,” Molecular Immunology, vol. 46, no. 1, pp. 202–206, [13] X. O . Yang, A. D. Panopoulos, R. Nurieva et al., “STAT3 regulates cytokine-mediated generation of inflammatory helper T cells,” Journal of Biological Chemistry, vol. 282, no. 13, pp. 9358–9363, [14] S. M. Holland, F. R. DeLeo, H. Z. Elloumi et al., “STAT3 mutations in the hyper-IgE syndrome,” New England journal of Medicine, vol. 357, no. 16, pp. 1608–1619, 2007. [15] H.-J. Kim, J.-H. Kim, Y. K. Shin, S.-I. Lee, and K.-M. Ahn, “A novel mutation in the linker domain of the signal transducer and activator of transcription 3 gene, p.Lys531Glu, in hyper-IgE syndrome,” Journal of Allergy and Clinical Immunology, vol. 123, no. 4, pp. 956–958, 2009. [16] M.-O. Chandesris, I. Melki, A. Natividad et al., “Autosomal dominant STAT3 deficiency and hyper-IgE syndrome: molecular, cellular, and clinical features from a French national survey,” Medicine, vol. 91, pp. e1–e19, 2012. [17] C. Mertens, B. Haripal, S. Klinge, and J. Darnell, “Mutations in the linker domain affect phospho-STAT3 function and suggest targets for interrupting STAT3 activity,” Proceedings of the National Academy of Sciences, vol. 112, no. 48, pp. 14811–14816, [18] E. Y ang, Z. Wen, R. L. Haspel, J. J. Zhang, and J. E. Darnell, “e Linker Domain of Stat1 Is Required for Gamma Interferon- Driven Transcription,” Molecular and Cellular Biology, vol. 19, no. 7, pp. 5106–5112, 1999. [19] J. Cheng, A. Randall, and P. Baldi, “Prediction of protein stability changes for single-site mutations using support vector machines,” Proteins: Structure, Function, and Bioinformatics, vol. 62, no. 4, pp. 1125–1132, 2006. [20] C. E. Bocchini, K. Nahmod, P. Katsonis et al., “Protein stabilization improves STAT3 function in autosomal dominant hyper-IgE syndrome,” Blood, vol. 128, pp. 3061–3072, 2016. MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Case Reports in Immunology Hindawi Publishing Corporation

Evidence that a STAT3 Mutation Causing Hyper IgE Syndrome Leads to Repression of Transcriptional Activity

Loading next page...
 
/lp/hindawi-publishing-corporation/evidence-that-a-stat3-mutation-causing-hyper-ige-syndrome-leads-to-b4GhLovJfP

References (22)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2019 Sameer Bahal et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
2090-6609
eISSN
2090-6617
DOI
10.1155/2019/1869524
Publisher site
See Article on Publisher Site

Abstract

Hindawi Case Reports in Immunology Volume 2019, Article ID 1869524, 5 pages https://doi.org/10.1155/2019/1869524 Case Report Evidence that a STAT3 Mutation Causing Hyper IgE Syndrome Leads to Repression of Transcriptional Activity 1 2,3 4 1 2 Sameer Bahal , Maha E. Houssen, Ania Manson, Lorena Lorenzo, Mark A. Russell, 2 5 1 Noel G. Morgan, Fariba Tahami, and Sofia Grigoriadou Department of Immunology, Royal London Hospital, Barts Health NHS Trust, London, UK University of Exeter Medical School, UK Biochemistry Department, Damanhour University, Egypt Department of Immunology, Addenbrooke’s Hospital, Cambridge, UK Department of Immunology, Great Ormond Street Hospital, London, UK Correspondence should be addressed to Sameer Bahal; s.bahal@nhs.net Received 15 May 2019; Revised 17 July 2019; Accepted 28 July 2019; Published 13 October 2019 Academic Editor: Elena Bozzola Copyright © 2019 Sameer Bahal et al. �is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. We present the case of a 19-year-old female with a mild form of Autosomal Dominant Hyper IgE syndrome (HIES) associated with a loss-of-function mutation in STAT3. Within the Šrst years of life she developed multiple, Staphylococcus aureus associated abscesses in the neck and face requiring frequent incision and drainage. Respiratory tract infections were not a feature of the clinical phenotype and a high resolution thoracic CT scan was unremarkable. Retained dentition was noted but fungal nail disease and recurrent thrush were absent. �e total IgE was 970 IU/L, Lymphocyte counts and immunoglobulin levels were normal (IgG borderline 18.5 gr/L). �ere was suboptimal response to test immunisation with Pneumovax II vaccine. �17 cell phenotyping revealed low levels of IL-17 expressing cells (0.3% of total CD4 T Cells numbers). Genetic analysis identiŠed a missense mutation, N567D, in a conserved region of the linker domain of STAT3. Functional studies in HEK293 cells reveal that this mutation potently inhibits STAT3 activity when compared to the wildtype protein. �is is consistent with other reported mutations in STAT3 associated with HIES. However, surprisingly, the magnitude of inhibition was similar to another STAT3 mutation (V637M) which causes a much more severe form of the disease. implicated in disease and, in addition to loss-of-function 1. Introduction mutations associated with HIES [2], various activating muta- Hyper IgE syndrome (HIES) is a rare primary immune deŠ- tions have also been described which may predispose to cer- ciency and is characterised by elevated circulating levels of tain forms of cancer [3], autoimmune forms of neonatal IgE. Patients typically experience eczema, lung, and skin infec- diabetes, and various immune deŠciencies [4], including tions, but other co-morbidities have also been described CVID [5]. In the current report, we performed sequencing of including brain and cardiac abnormalities. �e autosomal samples from a patient with a mild form of HIES, to identify dominant form of HIES is most commonly associated with a missense mutation in the linker domain of STAT3 which inactivating mutations in STAT3 although HIES-associated caused a reduction in transcriptional activity and is likely to mutations in DOCK8 and Tyk2 are reported [1]. be causative for disease. �e transcription factor STAT3 is a multifunctional pro- tein, whose activity is controlled by a plethora of cytokines and growth factors acting at their cognate cell surface recep- 2. Patient Description tors. Activated STAT3 translocates to the nucleus where it binds to consensus sequences in the DNA to regulate target We present the case of a 19-year-old female with Autosomal gene expression. A variety of mutations in STAT3 have been Dominant HIES. She was born at 36 weeks gestation and early 2 Case Reports in Immunology in life she developed multiple, Staphylococcus aureus associ- of the various STAT3 constructs. Attractene transfection ated abscesses in the neck and face requiring frequent incision reagent (Qiagen) was used to facilitate DNA uptake, and and drainage. Respiratory tract infections were not a feature STAT3 activity was assessed 24 h aer transfection using a dual of the clinical phenotype and a thoracic CT scan was unre- luciferase reporter assay system (Promega, Madison, WI, USA) markable. Retained dentition and mild eczema were noted but and with luminescence detected using a Pherastar FS (BMG fungal nail disease and recurrent thrush were absent. e cir- Labtech, Ortenberg, Germany). In some experiments, cells culating total IgE was markedly elevated (970 IU/L, NR: were treated with human IL-6 (R&D systems, Minneapolis, 0-81 IU/L); T and B cell counts were normal but IgG was raised MN, USA) 4 h aer transfection. (18.5 gr/L). Complement C3 and C4 levels, and complement 3.5. Western Blotting. Cells were lysed and whole cell protein function tests were normal. ere was a suboptimal response was extracted [8]. Protein was denatured, loaded evenly onto to test immunisation with Pneumovax II vaccine. e patient a 4%–12.5% Bis-Tris polyacrylamide gel and separated by is currently managed with flucloxacillin 500 mg BD for electrophoresis. Protein was then transferred onto a PVDF Staphylococcus aureus prophylaxis. e disease activity cal- membrane prior to immunoblotting using an iBind Flex culated via the score previously described by Grimbacher according to the manufacturer’s guidelines (ermo Fisher et al. was 36 [6]. is is classed as indicating an indeterminate Scientific). Membranes were probed with STAT3 antisera risk of HIES and reflects the mild/moderate phenotype [7]. (1 : 1000; Cell Signalling, Beverly, MA, USA) or beta-actin (1 : 2000; Sigma-Aldrich, Poole, Dorset, UK), and then with appropriate alkaline phosphatase conjugated secondary 3. Materials and Methods antibodies. CDP Star chemiluminescent reagent (Sigma- Aldrich) was used to detect bands, and this was visualised 3.1. Sanger Sequencing. Genomic DNA was isolated from using a cDigit blot scanner. whole blood. Coding genomic sequences and cDNA of STAT3 were purified with the QIAquick PCR purification kit 3.6. 17 Phenotyping. PBMCs were isolated from a 10 ml (Qiagen, Hilden, Germany). Subsequently, PCR products were heparin blood sample using LymphoprepTM (Axis-Shield). sequenced using the ABI PRISM BigDye Terminator cycle e PBMCs were re-suspended in 4 ml of RPMI with 10% ready reaction kit V3.1 (Applied Biosystems). e sequencing foetal bovine serum. Cells were either untreated or stimulated was performed on a 3130xl Applied Biosystems Genetic with 1 µg/mL Staphylococcus enterotoxin B (SEB; Sigma) for Analyzer. Data analysis was performed with DNA Sequencing 2 h. GolgiStop (BD Biosciences) was then added and cells Analysis soware, v5.2 (Applied Biosystems) and Sequencher were incubated for a further 16 h. Subsequently, cells were v4.8 (Gene Codes Corp, Ann Arbor, Mich). surface stained with CD3 (V500), CD4 (V450), and CD45RO (PerCP-Cy5.5) and intracellular stained with IL-4 (PE-Cy7), 3.2. Cell Culture. A DMEM base medium supplemented IFN-γ (Alexa Fluor®488), and IL-17A (Alexa Fluor®647). with 10% foetal calf serum, 2 mM L-glutamine, 100 μg/ml Intracellular staining was performed by using the BD Cytofix/ streptomycin, and 100 U/ml penicillin was used to culture Cytoperm™ Fixation/Permeabilization Kit (BD Biosciences). HEK293 cells. Cells were sub-cultured upon reaching All antibodies were from BD Biosciences. Cells were analysed approximately 80% confluency. using an 8 colour BD FACSCanto. 3.3. Mutagenesis. Mutations within the human STAT3 gene (Source Bioscience, Nottingham, UK) were introduced using the QuikChange site-directed mutagenesis kit (Agilent 4. Results Technologies, CA, USA). e custom primers used to generate STAT3 variants were N567D; Fd ACAAGGT- 4.1. 17 Profiling of Patient. HIES patients typically display reduced numbers of 17 T-helper cells [9]. 17 cell CAATGATATCGTCCAGCCAGACCCAG Rv: TCTGG- GTCTGGCTGGACGATATCATTGACCTTGTG Y640F; phenotyping revealed that 17 cells comprised 0.3% of the total CD4+ T-cell number. is was below the normal range Fd: AGTCCGTGGAACCATTCACAAAGCAGCAGCTG Rv: AGCTGCTGCTTTGTGAATGGTTCCACGGACTG V637M; of >0.4%, and consistent with the diagnosis of Hyper IgE syndrome. Fd; AGACCCAGATCCAGTCCATGGAACCATACACAAAG Rv; TGCTTTGTGTATGGTTCCATGGACTGGATCT- 4.2. Functional Investigations. Sanger sequencing of the GGGTC. e success of mutagenesis was confirmed by full patient’s DNA revealed a missense mutation in the STAT3 sequencing of inserts (Source Bioscience). e STAT3 inserts gene. e variant was heterozygous with a nucleotide exchange were digested out of a pENTR221 vector using PsiI to produce (A to G) at position 1699 in exon 19, leading to an aspartate a blunt-ended product. is was treated with a calf intestinal for asparagine substitution at position 567 within the linker phosphatase enzyme prior to insertion into a pcDNA5/FRT/ domain (N567D) (Figure 1). e amino acid sequence is TO expression vector at the EcoRV restriction site within the highly conserved at this region across multiple species [10]. polylinker. e N567D variant of STAT3 was generated by site-di- 3.4. Reporter Assay. HEK293 cells were seeded into 24-well rected mutagenesis, and upon transfection into HEK293 cells, Western blotting analysis revealed an increase in STAT3 plates and transfected with 200 ng of the STAT3-reponsive dual luciferase Cignal reporter construct (Qiagen) and 400 ng expression compared to cells transfected with empty vector Case Reports in Immunology 3 Trans- N-termCoiled coil DNA bindingLinkerSH2 activation N567D F¬®¯°± 1: Schematic diagram of STAT3 protein structure showing the position of the N567D mutation identiŠed from a patient with Hyper IgE syndrome. STAT3 β-Actin (a) Unstimulated IL-6 stimulated STAT3WT N567D Y640F V637M STAT3WT N567D Y640F V637M (b) F¬®¯°± 2: Transfection of N567D-STAT3 into cells increased STAT3 activity. (a) HEK293 cells were transfected with equal amounts of an empty vector, wildtype STAT3 or N567D and expression of STAT3 was studied by Western blotting. Results are representative of two independent experiments. (b) Cells were alternatively transfected with wildtype, N567D, and mutations which are known to activate (Y640F), and inactivate (V637M) STAT3. �ese cells were either grown in the presence or absence of 20 ng/ml IL-6 for 18 h, and transcriptional activity was determined using a dual-luciferase reporter assay ( = 3−6).  < 0.05. (Figure 2(a)). Importantly, transfection of either the wildtype be reªective of the situation occurring in vivo when a domi- (WT) or mutant form of STAT3 resulted in approximately nant heterozygous mutations is found. equal levels of protein expression (Figure 2(a)). To validate the assay system, previously reported STAT3 To study the impact of N567D on STAT3 transcriptional mutations which enhance (Y640F) or reduce (V637M) STAT3 activity, a STAT3-responsive dual-luciferase reporter construct activity were tested in parallel with N567D. STAT3 activity was employed, and this revealed that STAT3-N567D signiŠ- was modiŠed in the expected direction under both basal and cantly inhibited protein activity compared to WT STAT3 (fold IL-6 stimulated conditions upon the transfection of cells with change from WT; N567D: 0.6 ± 0.2,  < 0.05) (Figure 2(b)). these variants (Figures 2(a) and 2(b)). IL-6 is an agonist of STAT3 signalling, and treatment of HEK293 cells with 20 ng/ml IL-6 enhanced STAT3 activity by ~14-fold in cells expressing WT STAT3. Under IL-6 stimulated 5. Discussion conditions the inhibitory e©ects of N567D were more pro- nounced, and STAT3 activity was reduced to levels comparable Autosomal dominant HIES is caused by loss-of-function to those seen in unstimulated cells expressing WT STAT3 mutations in STAT3 [11]. Consistent with this, we describe a (Figure 2(b)). It is important to emphasise that, in these stud- de novo mutation in the linker domain of STAT3 from a patient ies, expression of the mutant form was achieved in the context with a mild/moderate form of HIES that robustly inhibited of the continued expression of the endogenous (wild type) the activity of STAT3 under both basal and IL-6 stimulated STAT3 present in HEK293 cells. As such, the data are likely to conditions. �is mutation has been described in a single STAT3 activity (fold change from WT) Negative Control STAT3 activity (fold change from WT) STAT3WT N567D 4 Case Reports in Immunology previous case with a more severe phenotype, although the Disclosure authors did not examine its transcriptional activity in vitro �is case was presented in poster format at the United [10]. Interestingly, despite the mild/moderate phenotype seen Kingdom Primary ImmunodeŠciency Network Meeting in in our patient, the magnitude of STAT3 inhibition caused by December 2017. the present mutation was comparable to that observed for other HIES associated mutants (e.g., V637M) which are reported to yield a much more severe disease phenotype [12]. Conflicts of Interest �is suggests that the precise location of the mutation within the structure of STAT3 may be critical for Šnal determination �e authors declare that they have no conªicts of interest. of the disease phenotype even when the net outcome is a mod- est inhibition of transcriptional activity. In considering the e©ects of the present mutation, it is Authors’ Contributions known that STAT3 is crucial for the di©erentiation of T-cells to a �17 phenotype [13], and in accord once with this circu- LL, AM, and SG were involved in evaluating and treating the lating �17 T-cell numbers were reduced in both patients in patient. FT performed �17 phenotyping. MEH and MAR whom the mutation was found [10]. In addition, both patients performed the cell based studies, MAR and NGM designed had elevated IgE levels and recurrent infections with these studies. SB, MAR, NGM, MEH, and SG dra³ed and Staphylococcus aureus. However, some di©erences in pheno- edited the manuscript. All authors approved the Šnal version. type were noted. For example, unlike our patient, the earlier case exhibited an allergic history, bone fractures as well as oral Acknowledgments candidiasis. �e majority of STAT3 mutations were associated with We gratefully acknowledge the Mission Sector of the Egyptian HIES cluster in the SH2 domain, the DNA-binding domain Ministry of Higher Education (Arab Republic of Egypt) who and the transactivation domain of the protein [14]. To our provided funding for MEH to work as a visiting postdoctoral knowledge, only two additional variants have been identiŠed fellow at the University of Exeter (March 2016-September in the linker domain of STAT3, K531E [15], and I568F [16]. 2016). �is work was also supported by Diabetes UK (grant: All STAT family members possess an α-helical linker between 15/0005156). their SH2 and transactivation domains. Since this linker acts as a ridged spacer between functionally distinct groups, its disruption may result in altered protein function. In this con- References text, targeted mutation of several conserved residues within the linker domain of STAT3 strongly reduced IL-6 stimulated [1] A. F. Freeman and S. M. Holland, “Clinical manifestations of transcriptional activity [17]. Similar data have been reported hyper IgE syndromes,” Disease Markers, vol. 29, no. 3–4, pp. for STAT1, which shares high sequence homology with that 123–130, 2010. of STAT3 in the linker region [18]. Merli and colleagues per- [2] Y. Minegishi, M. Saito, S. Tsuchiya et al., “Dominant-negative formed in silico investigations, examining the intramolecular mutations in the DNA-binding domain of STAT3 cause hyper- interactions that occur with the N567 residue, mutated in the IgE syndrome,” Nature, vol. 448, no. 7157, pp. 1058–62, 2007. present variant [10]. �is revealed that N567 interacts with [3] C. Pilati, M. Amessou, M. P. Bihl et al., “Somatic mutations K615, a highly conserved residue in the DNA binding domain, activating STAT3 in human inªammatory hepatocellular and that the aspartic acid substitution is likely to disrupt this adenomas,” ‰e Journal of Experimental Medicine, vol. 208, no. 7, pp. 1359–1366, 2011. interaction and impinge on DNA binding and dimer stability. In support of this, MUpro so³ware, which calculates protein [4] S. E. Flanagan, E. Haapaniemi, M. A. Russell et al., “Activating stability, predicts that N567D will decrease stability germline mutations in STAT3 cause early-onset multi-organ autoimmune disease,” Nature Genetics, vol. 46, no. 8, pp. 812– ( = −1.05) [19]. Taken together, these data support the 814, 2014. notion that disruption of the linker domain (as in N567D) will [5] M. A. Russell, M. Pigors, M. E. Houssen et al., “A novel de impact STAT3 protein function. novo activating mutation in STAT3 identiŠed in a patient �e loss of STAT3 activity is an important driver of HIES, with common variable immunodeŠciency (CVID),” Clinical and therapeutic strategies to prevent or reverse this would Immunology, vol. 187, pp. 132–136, 2018. be of interest to the Šeld. In this context, a recent study [6] B. Grimbacher, A. A. Schä©er, S. M. Holland et al., “Genetic revealed that certain small molecule compounds can improve linkage of hyper-IgE syndrome to chromosome 4,” ‰e American the stability and activity of speciŠc HIES-associated STAT3 Journal of Human Genetics, vol. 65, no. 3, pp. 735–744, 1999. mutants [20]. Whilst these Šndings have potentially exciting implications, they are based on in vitro studies and these [7] A. P. Hsu, J. Davis, J. M. Puck, S. M. Holland, and A. F. Freeman, molecules were only e©ective against the mutations which “Autosomal dominant hyper IgE syndrome,” in GeneReviews®, destabilised STAT3, presumably due to their upregulation of M. P. Adam, H. H. Ardinger, and R. A. Pagon, Eds., University chaperone proteins. �us, alternative methods to improve of Washington, Seattle, WA, 1993, https://www.ncbi.nlm.nih. gov/books/NBK25507/. the activity of STAT3 are needed. Perhaps, small molecules targeted to the linker region of STAT3 may be one mecha- [8] H. J. Welters, A. Oknianska, K. S. Erdmann, G. U. Ry©el, and N. nism to achieve this. G. Morgan, “�e protein tyrosine phosphatase-BL, modulates Case Reports in Immunology 5 pancreatic beta-cell proliferation by interaction with the Wnt signalling pathway,” Journal of Endocrinology, vol. 197, no. 3, pp. 543–552, 2008. [9] A. F. Freeman and S. M. Holland, “e hyper-IgE syndromes,” Immunology and Allergy Clinics of North America, vol. 28, no. 2, pp. 277–291, 2008. [10] P. Merli, F. Novara, D. Montagna et al., “Hyper IgE syndrome: anaphylaxis in a patient carrying the N567D STAT3 mutation,” Pediatric Allergy and Immunology, vol. 25, no. 5, pp. 503–505, [11] T. H. Mogensen, “STAT3 and the Hyper-IgE syndrome: Clinical presentation, genetic origin, pathogenesis, novel findings and remaining uncertainties,” JAK-STAT, vol. 2, no. 2, Article ID e23435, 2013. [12] H. Jiao, B. Tóth, M. Erdos et al., “Novel and recurrent STAT3 mutations in hyper-IgE syndrome patients from different ethnic groups,” Molecular Immunology, vol. 46, no. 1, pp. 202–206, [13] X. O . Yang, A. D. Panopoulos, R. Nurieva et al., “STAT3 regulates cytokine-mediated generation of inflammatory helper T cells,” Journal of Biological Chemistry, vol. 282, no. 13, pp. 9358–9363, [14] S. M. Holland, F. R. DeLeo, H. Z. Elloumi et al., “STAT3 mutations in the hyper-IgE syndrome,” New England journal of Medicine, vol. 357, no. 16, pp. 1608–1619, 2007. [15] H.-J. Kim, J.-H. Kim, Y. K. Shin, S.-I. Lee, and K.-M. Ahn, “A novel mutation in the linker domain of the signal transducer and activator of transcription 3 gene, p.Lys531Glu, in hyper-IgE syndrome,” Journal of Allergy and Clinical Immunology, vol. 123, no. 4, pp. 956–958, 2009. [16] M.-O. Chandesris, I. Melki, A. Natividad et al., “Autosomal dominant STAT3 deficiency and hyper-IgE syndrome: molecular, cellular, and clinical features from a French national survey,” Medicine, vol. 91, pp. e1–e19, 2012. [17] C. Mertens, B. Haripal, S. Klinge, and J. Darnell, “Mutations in the linker domain affect phospho-STAT3 function and suggest targets for interrupting STAT3 activity,” Proceedings of the National Academy of Sciences, vol. 112, no. 48, pp. 14811–14816, [18] E. Y ang, Z. Wen, R. L. Haspel, J. J. Zhang, and J. E. Darnell, “e Linker Domain of Stat1 Is Required for Gamma Interferon- Driven Transcription,” Molecular and Cellular Biology, vol. 19, no. 7, pp. 5106–5112, 1999. [19] J. Cheng, A. Randall, and P. Baldi, “Prediction of protein stability changes for single-site mutations using support vector machines,” Proteins: Structure, Function, and Bioinformatics, vol. 62, no. 4, pp. 1125–1132, 2006. [20] C. E. Bocchini, K. Nahmod, P. Katsonis et al., “Protein stabilization improves STAT3 function in autosomal dominant hyper-IgE syndrome,” Blood, vol. 128, pp. 3061–3072, 2016. MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal

Case Reports in ImmunologyHindawi Publishing Corporation

Published: Oct 13, 2019

There are no references for this article.