Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Culex (Diptera: Culicidae) Mosquitoes in Jazan Region, Saudi Arabia, and Their Molecular Identification

Culex (Diptera: Culicidae) Mosquitoes in Jazan Region, Saudi Arabia, and Their Molecular... Hindawi International Journal of Zoology Volume 2021, Article ID 5563916, 12 pages https://doi.org/10.1155/2021/5563916 Research Article Culex (Diptera: Culicidae) Mosquitoes in Jazan Region, Saudi Arabia, and Their Molecular Identification Elsiddig Noureldin , Ommer Dafalla , Abdualziz Hakami, Mohammed Jubran, Ahmed Alzhrani, Muhannad Mujally, Othman Shajari, Ali Khardali, and Zaki Eisa Saudi Center for Disease Control and Prevention (SCDC), P.O. Box 716, Jazan 45142, Saudi Arabia Correspondence should be addressed to Elsiddig Noureldin; elsiddigha@moh.gov.sa Received 8 February 2021; Accepted 27 June 2021; Published 8 July 2021 Academic Editor: Marco Cucco Copyright © 2021 Elsiddig Noureldin et al. &is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Morphological characteristics have been the gold standard method to identify mosquito species. However, morphological identification has many limitations including lack of expertise and damaging of external characters due to improper specimen handling. &erefore, we used the polymerase chain reaction technique (PCR) as an integrated tool to identify Culex mosquito species to establish a more precise and reliable identification system related to their spatial distribution in Jazan region. We identified Culex mosquito species and subspecies using taxonomic keys, and then we used the polymerase chain reaction technique (PCR) as an integrated tool to confirm and refine the list of Culex mosquito species in the region. Phylogenetic trees were constructed for the identified species, and their distinctive clustering was compared with their reference’s species in the GenBank. We identified 7026 adult Culex mosquitoes belonging to 4 species. Culex tritaeniorhynchus was the predominant species (45%), followed by Cx. quinquefasciatus (32%), then Culex sitiens (20%), and Cx. pipiens (3%). &e most infested areas by Culex in the region were Gizan and Sabya. &e PCR achieved 100% success in identifying the four Culex mosquito species. We also report the molecular identification of Cx. quinquefasciatus and Cx. pipiens species for the first time in Jazan region while the molecular identification of Cx. tritaeniorhynchus and Cx. sitiens was reported for the first time in Jazan region and the whole Saudi Arabia. &is study utilized for the first time PCR to identify Culex mosquito species in Jazan region. &e PCR is a complementary and integrated taxonomy-based identification tool for mosquito species. &is integration has the capacity to promote and enhance vector surveillance and control programs, as well as defining the genetic diversity of species in the region. host availability, climatic conditions, especially rain and 1. Introduction temperature, human mobility and activities, and land cover Mosquito-borne diseases, i.e., malaria [1, 2], filariasis [3], Rift [17]. &ese factors have a potential impact on the vectorial Valley fever [4, 5], West Nile virus [6], dengue, and others capacity of mosquitoes for disease transmission. [7, 8], pose potential public health threats in Saudi Arabia. &e accurate identification of mosquito vector species and knowledge of their biology, ecology, and geographical Several authors have investigated the distribution of mosquito species in Saudi Arabia [1–16]. distribution are considered important factors for surveil- Most of these studies reported the predominance of lance and control of vectors and mosquito-borne diseases Culex mosquitoes over other species. Within Culex species [18]. reported by these studies, Culex quinquefasciatus, Culex Morphological identification is the gold standard and the tritaeniorhynchus, and Cx. pipiens were the most dominant conventional method to identify mosquito species Culex mosquitoes in Saudi Arabia and Jazan region. depending on their external characters [19]. &e abundance and distribution of mosquito fauna are However, morphological identification is highly time influenced by many factors including, but not limited to, consuming and requires experienced taxonomists. 2 International Journal of Zoology Furthermore, improper handling of specimen damage is bifurcation of R2+3 veins, as described by some taxonomic often occurred to some important characteristics such as pictorial keys [24–26]. For the Females of Culex tritaeniorhynchus and Culex bristles and scales leads to incomplete identification. Ad- ditionally, the similarity of shared morphological features by sitiens, relevant pictorial keys were used [24, 27, 28]. species complexes’ members makes identification based on taxonomic keys alone a difficult task [20]. Polymerase chain reaction (PCR) is becoming a popular 2.4. Molecular Identification of Culex Species. Previously identified Culex mosquitoes of individual species by technique for mosquitoes identification based on their DNA sequencing and the fact that every species has its own genetic morphometric methods were selected according to their location of capture. identity [19]. Molecular techniques to differentiate between Cx. DNA was extracted from the stored homogenate using GeneJET Genomic DNA Purification Kit (&ermo Scien- pipiens complex or/and other Culex species, or to differ- tific) following the manufacturer’s recommendations: For entiate between the Cx. pipiens complex biotypes, are based every individual mosquito, legs were homogenized in a on gel electrophoretic analysis of certain DNA fragments mortar and pestle (mini borosilicate glass chamber length amplified by PCR [21]. PCR assay identifies Cx. pipiens, Cx. quinquefasciatus, and their hybrids based on the nucleotide 60mm/pestle diameter 9.0mm, 3.0Ml, Fisherbrand) in 150 μL of digestion solution and then the homogenate was sequence differences in the acetylcholinesterase gene Ace.2 [22]. transferred to 1.5 tubes. Twenty microliters of Proteinase K Solution was added and mixed thoroughly by vortexing to &e aim of this study was to determine fauna of adult Culex mosquitoes (Diptera: Culicidae) and to produce obtain a uniform suspension and incubated in the thermo shaker for 30 minutes at 56 C, 1300rpm. Twenty microliters precise and refine records of their species and their distri- bution in Jazan region based on morphological and genomic of RNase A Solution which was added and mixed by vor- texing and incubated for 10min at room temperature, then (molecular) identification. To the best of our knowledge, this is the first study in Jazan region to use molecular charac- 200 μL of lysis solution was added and mixed thoroughly by vortexing for 15s until a homogeneous mixture is obtained. teristics to identify Culex species and their genetic diversity. After adding 400 μL of 50% ethanol and mixed by vortexing the prepared lysate was transferred to a GeneJET Genomic 2. Materials and Methods DNA Purification Column inserted in a collection tube and 2.1. Study Area. Jazan area is about 22,000km and with 1.6 centrifuged for 1min at 8000rpm. &e GeneJET Genomic ° ° million population, lies between 16 –12 and 18 –25, latitude DNA Purification Column was placed into a new 2mL north, and located in the subtropical zone, southwestern of collection tube and 500 μL of wash buffer 1 was added and Saudi Arabia, with a coastal boundary of 250km along the centrifuged for 1min at 8000 RPM, then the column was Red Sea and a 120km border with the Republic of Yemen placed into a new collection tube and 500 μL of wash buffer 2 (Figure 1). &is region includes over 3000 villages scattered was added and centrifuged for 3min at 13,000rpm. DNA along the area and about 100 islands located in the Red Sea, Purification Column was transferred to a sterile 1.5mL including the Farasan islands. It is surrounded by the Red microcentrifuge tube, and 200 μL of elution buffer was added Sea from the west and by Arabic Republic of Yemen from the to the center of the column membrane to elute genomic south and east and Asir region from the north ([23]; DNA. Incubated for 2min at room temperature and GASTAT 2017: https://www.stats.gov.sa/en/5655). centrifuged for 1min at 8000rpm. &e molecular identification of Culex species was per- formed by polymerase chain reaction technique (PCR) 2.2. Mosquito Collection. CDCminiaturelighttraps wereused following the described procedure and using the primers for the adult mosquitos’ collection from different parts of Jazan provided in (Table 2.) [22, 29]. region from February 2018 to December 2019 (Table 1). Ten &e PCR was carried out in a total volume of 50 μL using light traps were installed once per month in each of the houses, Dream Tag Green Master Mix (&ermo Scientific) con- animals’ shelters, wild vegetation, near wadies, sewerage plants, taining 25 μL master mix ready to use, 1 μL (10pmol) of each dams, and ponds from 1800 to 0600hr. reverse and species-specific forward primers, 5 μL of DNA For outdoor collections, a 2 kilogram block of dry ice template, and 18 μL nuclease-free water. &e mix was (CO2) was wrapped in a Hessian bag above the trap. To subjected to initial denaturation at 94 C for 3 minutes, 30 minimize the mortality of the collected mosquitoes due to ° ° cycles of denaturation (94 C, 60s), primer annealing (51 C), desiccation, damp cotton pads were kept in the collection primer extension (72 C, 60s), and final extension for 5 cups. Collected mosquitoes were brought to the insectary of minutes. In each run, negative and positive controls were the Saudi Center for Disease Prevention and Control in included. &e PCR products amplifications were analyzed by Gizan city for morphological and genetic identification. gel electrophoresis (1.5 agarose in Tris-Acetate EDTA buffer) staining with ethidium bromide. &e visualization was carried out using Gel Doc XR Imaging System (Bio-Rad). 2.3. Mosquito Morphological Identification. Female Culex pipens and Culex quinquefasciatus mosquitoes were mor- Universal primers [30], LCO1490 and HCO2198 (Ta- ble 2), were used for the PCR amplification of a 710-bp phologically identified and differentiated by using wing measurements of intersection of costa, subcosta, and fragment of the mitochondrial cytochrome oxidase subunit I International Journal of Zoology 3 W E Al-Shaqeq Al-Darb Al-Raith Al-Haqo Haroob Al-Daer Baish 1 centimeter = 7,215 meters Al-Aeidabi Al-Alia Sabya Faifa Quz Al Jaafra Damad Al-Ariddah Wadi Jizan Jizan Abuareesh Farasan Islands Farasan Islands Farasan Islands Al-khoba Ahad Almasarha Al-Madaia Farasan Islands Farasan Islands Al-Qofl Samttah Al-Sehi Al Tawal Al-Moasam Miles 12.5 25 50 75 100 Figure 1: Boundaries of the different study areas in Jazan Region, southwest of Saudi Arabia. gene (COI) for the samples not identified by the species- 3. Results and Discussion specific primers follow the same previous PCR procedure. Results of the identification and counts of Culex species mosquitoes are shown in Table 1. Seven thousand twenty-six 2.5. Sequencing. Purification and standard sequencing for adult Culex mosquitoes were collected from 25 different PCR products were performed by Macrogen Company areas of Jazan region during 2018 and 2019 (Figure 1). (Seoul, Korea). Sequencing reactions were performed in an Clearly, the number of mosquito specimens was rela- ABI PRISM 3730XL Analyzer (96 capillary type) using an tively low compared to the period of study (around 2 years). ABI PRISM BigDyeTM Terminator Cycle Sequencing Kit &is is may be attributed to the fact that effective and ex- with AmpliTaq DNA polymerase (FS enzyme) (Applied tensive vector control activities were taken place during the Biosystems), following the protocols supplied by the man- last 5 years in the region to combat malaria, dengue, and rift ufacturer. Single-pass sequencing was performed on each valley, the most prevalent vector-borne diseases in the template using LCO1490 primer. Gel elution was performed region. using MG Gel Extraction SV (MD007) kit (MGmed), fol- In this study, four Culex species were present in the lowing the protocols supplied by the manufacturer. region, namely; Culex tritaeniorhynchus, Cx. quinque- fasciatus, Cx. sitiens, and Cx. pipiens. &eir respective per- &e sequences were searched for sequence similarity through Basic local Alignment Search Tool (BLAST) (http:// centages of occurrence were 45%, 32%, 20%, and 3%. www.ncbi.nlm.nih.gov/BLAST/) [31] and compared to Culex tritaeniorhynchus was the most abundant species reference sequences of Culex species detected in BLASTand encountered in 23 areas out of 25, followed by Cx. quin- downloaded from GenBank (http://www.ncbi.nlm.nih.gov/ quefasciatus and Cx. sitiens which occurred in 14 areas, and genbank/). Cx. pipiens in 4 areas. Evolutionary relationship of taxa tree was constructed &ese results are in accordance with the findings of Al for each of the Culex species using the Molecular Evolu- Ahmad et al. [15] who indicated that Culex tritaeniorhynchus tionary Genetic Analysis (MEGA 5 software). is a common widespread species in Saudi Arabia and has 4 International Journal of Zoology Table 1: Culex species in Jazan region. Area Cx. tritaeniorhynchus Cx. quinquefasciatus Cx. pipiens Cx. sitiens Total Gizan 750 904 173 333 2160 Al-shegairy 243 102 0 24 369 Ahad Almasarha 0 0 0 29 29 Sabya (Qaem jaaferi) 817 0 0 450 1267 Sabya (Wadi sabya) 37 0 0 3 40 Samtah 0 235 7 0 242 Damad 53 0 0 204 257 Baish 406 208 25 114 753 Aboareesh 119 310 0 0 429 Al-tawal 13 0 0 65 78 Al-madhaya 229 0 0 0 229 Al-darb 67 0 0 0 67 Al-ariddah (Batin asar) 48 93 0 2 143 Haroob 3 61 0 0 64 Al-shegaig 84 0 0 0 84 Haroob (Wadi wasea) 15 0 0 0 15 Faifa 96 1 0 0 97 Al-gofl 61 32 13 84 190 Al-dhabia 0 54 0 2 56 Al-horath 18 0 0 61 79 Al-sehi 0 109 0 0 109 Al-aeidabi 16 15 0 11 42 Al-aeidabi (Wadi qessi) 25 0 0 9 34 Aiban 8 18 0 0 26 Belgazzi 12 103 0 0 115 Total 3144 2266 218 1398 7026 % 45 32 3 20 Table 2: Primers used for molecular identification of Culex species. Consensus CPI6 R GCGGGTACCATGCTTAAATTTAGGGGTA Culex pipiens complex PQIO F CCTATGTCCGCGTATACTA 698bp Cx. restuans R6 F CCAAACACCGGTACCCAA 506bp Cx. salinarius S20F TGAGAATACATACCACTGCT 175bp Cx. nigripalpus N90I F ATACCCATGCGAAAGCATAC 404bp Cx. nigripalpus NRI080R GTACCGCGACCACACGACTT Cx. quinquefasciatus FCQ GGT CGT ATC AAC AAA GTC CA 500bp Cx. quinquefasciatus RCQ ATG GAT ACG GAC TAC ACT GG COI (LCO1490) GGTCAACAAATCATAAAGATATTGG 740bp COI (HC02198) TAAACTTCAGGGTGACCAAAAAATCA been recorded from Jazan and other 14 provinces out of 15. formation of small stagnant water collections following Similar results were also reported by Alsheikh et al. [32], who rainfall and/or water pipe leakage in their urban areas [35]. found Cx. tritaeniorhynchus to be the most predominant &e prevalence of the Culex species in those areas could be species in the Red Sea coastal plain of Jazan region, followed attributed also to their wide suitability to different breeding by Cx. quinquefasciatus. &e findings are also in line with sites and variable extreme climatic factors prevailing there [11]. those of Al Ahmad et al.and Bakr et al. [14, 33] who reported the same four Culex species from Jazan region. Culex tri- &ree of the Culex species reported in the present study are considered important disease vectors, namely Culex taeniorhynchus, Cx. quinquefasciatus, and Cx. sitiens have also been reported from different parts of Jazan region with tritaeniorhynchus, Cx. quinquefasciatus, and Cx. pipiens. the predominance of Culex tritaeniorhynchus over other Characterizations of dominant mosquito vectors include Culex species [34]. well adaptation to a wide range of climatic conditions and In the present study, the most infested areas by Culex habitats, high anthropophilic propensity, and variable adult mosquitoes in Jazan region were Gizan (2160 specimens), resting behaviour [36]. Sabya (1267), Baish (753), and Aboareesh (429) (Table 1). Mosquito fauna and their distribution in Saudi Arabia &is may be due to the nature of those areas, which are had been widely investigated by many authors. For example, highly populated and relatively flat and permit for the forty-nine mosquito species belonging to seven genera from International Journal of Zoology 5 working with Culex in Saudi Arabia have rarely, if not ever, 1956 to 2017 (18 Anophelines and 31 Culicines) have been listed [37]. used male genitalia diagnostic features to confirm identifi- cation of the two species [37]. Out of the 31 Culicines, 19 species were belonging to the genus Culex Linnaeus (1758): one species under the sub- &is was the reason why we adopted the molecular genus Barraudius Edwards, 1921, Cx. (Barraudius) pusillus; technique, which is known to be highly specific and sensitive one species under subgenus Culiciomyia &eobald, 1907, Cx. for the identification of Culex species complex and their (Culiciomyia) nebulosus; one species under subgenus Ocu- hybrids [42, 43]. In addition, new methods of genomic leomyia &eobald, 1907, Cx. (Oculeomyia) bitaeniorhynchus; (molecular) identification of species, subspecies, races, two species under subgenus Maillotia &eobald, 1907, Cx. biotypes, and forms are more reliable and precise than older morphological identification methods of species complexes (Maillotia) arbieeni and Cx. (Maillotia) salisburiensis; and fourteen species under subgenus Culex Linnaeus, 1758: Cx. [44]. (Culex) decens, Cx. (Culex) duttoni, Cx. (Culex) laticinctus, Cx. (Culex) mattinglyi, Cx. (Culex) mimeticus, Cx. (Culex) 3.1. Culex quinquefasciatus (Figure 2). Larvae of Cx. quin- perexiguus, Cx. (Culex) pipiens, Cx. (Culex) quinquefasciatus, quefasciatus breed in water bodies with a high degree of Cx. (Culex) simpsoni, Cx. (Culex) sinaiticus, Cx. (Culex) organic pollution and close to human habitats. Females are sitiens, Cx. (Culex) theileri, Cx. (Culex) tritaeniorhynchus, nocturnal and enter houses and bite the man in preference to and Cx. (Culex) univittatus. other mammals [45]. Likewise, 7 species of Culex had also been identified in Cx. quinquefasciatus was found breeding all year round Jazan region: (1) Culex pipiens from Gizan City, Alariddah, with peaks during winter in Taif, Jeddah, and Tabuk of Saudi Baish, Ahad Almasarha, Samtah, Eldarab, Haroob, Bani Arabia [46]. In Jazan region, this species was collected from Malik, and Farasan Islands; (2) Culex quinquefasciatus from rocky pits and streams. It was found together with Anopheles Gizan City, Alariddah, Baish, Ahad Almasarha and Farasan arabiensis and Cx. tritaeniorhynchus at the ratio of 1:4: 1:3 Islands; (3) Culex tritaeniorhynchus from Gizan City, [34]. Alariddah, Baish, Ahad almasarha, Samtah, Eldarab, Har- &e species is a primary vector of Wuchereria bancrofti, oob, and Bani Malik; (4) Culex sitiens from Gizan City, vector of avian malaria, western equine encephalomyelitis, Alariddah, Baish, Ahad almasarha, Samtah, Wadi Jazan, and and St. Louis encephalitis. It was implicated as a vector of Farasan Islands; (5) Cx. Sinaiticus; (6) Cx. decens; (7) Cx. dog heartworm [45, 47]. bitaeniorhynchus [33]. Cx. quinquefasciatus and Cx. pipiens, which are the main On the other hand, another 10 species have been vectors of bancroftian filariasis, Wuchereria bancrofti identified from different areas of Jazan region including Cx. worldwide including the Middle East countries, have been tritaeniorhynchus, Cx. laticinctus, Cx. pipiens, Cx. quin- reported from the south-western districts of Saudi Arabia quefasciatus, Cx. sinaiticus, Cx. simpsoni, Cx. torrentium, Cx. [6]. sitiens, Cx. univittatus, and Cx. tigripes [14]. Similarly, seven species were recorded from different parts of Jazan region including Culex tritaeniorhynchus, Cx. 3.2. Culex pipiens (Figure 3). Larvae of Culex pipiens breed in quinquefasciatus, Cx. Sinaiticus, Cx. sitiens, Culex duttoni, various places ranging from highly polluted sewages and Cx. Arbieeni, and Cx. mimeticus [34]. cesspits to clear pools and containers. It breeds in stagnant Cx. (Culex) perexiguus &eobald, 1903, and Cx. pusillus water in shaded or unshaded habitats. Females bite the man (Macquart) have been reported from the region [24, 38]. outdoors and indoors [41]. Consequently, 18 Culex species so far have been reported Cx. pipiens larvae were reported all year round in Taif, from Jazan region, namely: Culex tritaeniorhynchus, Cx. Jeddah, and Tabuk. &e peak was at autumn while high laticinctus, Cx. pipiens, Cx. quinquefasciatus, Cx. sinaiticus, density was in summer when temperature is high [46]. Cx. pipiens is a primary vector of periodic Bancroftian Cx. univittatus, Cx. (Culex) perexiguus, Cx. pusillus, Cx. simpsoni, Cx. torrentium, Cx. sitiens, Cx. decens, Cx. bitae- filariasis. It has been naturally infected with West Nile and Sindbis viruses in Israel, while it was infected with Rift Valley niorhynchus, Cx. theileri, Cx. tigripes, Cx. duttoni, Cx. arbieeni, and Cx. mimeticus [37]. Fever virus and West Nile virus in Egypt [41]. Culex mosquitoes are proven or suspected vectors of W. bancrofti has been identified within foreign workers West Nile, and Rift Valley fever viruses, microfilariae, and a from five South-East Asian countries in Abha, southwest of variety of encephalitis [39, 40]. the Saudi Arabia. Cx. pipiens may act as a potential vector of It has been stated that Cx. quinquefasciatus occurs more Bancroftian filariasis in Saudi Arabia [48]. in the south of the Arabian Peninsula with isolated occurring Culex pipiens complex has occurred in different climatic of Cx. pipiens in the southwestern mountains [41]. and habitat zones, particularly temperate and temperate- Due to the close similarity of Cx. pipiens and Cx. humid regions of the world [44]. It is always difficult and problematic to differentiate quinquefasciatus, many of their occurrences and morpho- logical identifications in Saudi Arabia are problematic, es- morphologically between adults of Cx. quinquefasciatus and Culex pipiens especially females. Nonetheless, taxonomists pecially females [37]. Considerable discrepancies in the larval and adult stages used to differentiate between the two species by wing ve- are exhibited between the two species, and it is difficult to nations where the intersection of the vein subcosta with distinguish them morphologically. Additionally, researchers costa is before the level of furcation of R in the case of Cx. 1+2 6 International Journal of Zoology Costa Subcosta 1+2 1 2 3 5 4 6 7 8 9 10 11 12 13 14 15 Figure 2: Wing of Culex quinquefasciatus showing the intersection of the vein subcosta with costa before the level of furcation of R . 1+2 R Subcosta Costa 1+2 Figure 4: PCR amplified 700bp DNA bands using consensus CPI6 R and Cx. pipiens complex PQIO F primers. Lane 1: 100bp ladder, lanes 2–15 tested samples. (Figure 10(b)), whereas the furcation of R is proximal to 2+3 the furcation of M (Figure 11(b)). 1+2 Figure 3: Wing of Culex pipiens showing the intersection of the Larvae of Cx tritaeinorhynchus are found in many vein subcosta with costa at the level of furcation of R . 1+2 habitats that are sunlit and contain vegetation like the temporary, semi-permanent, and permanent ground water habitats, low-salinity tidal marshes, streams, ground pools, quinquefasciatus (Figure 2), while this intersection is at or and swamps. Females feed primarily on pigs and cattle, but beyond the level of furcation of R in the case of Cx. pipiens 1+2 in their absence will feed on men [27]. It has been reported (Figure 3) [24]. However, this is readily achieved by mo- that larvae of Cx. tritaeniorhynchus preferred aquatic hab- lecular characteristics. itats with wet muddy substrate and low total dissolved salts Molecular identification of both Cx. pipiens (Figures 4 and (TDS). &ose areas are found in eastern Sarwat Mountain 5) and Cx. quinquefasciatus (Figures 6 and 7) confirmed their range near the cities in Ahd almasarha, Eleidabi, Sabya, Al- initial morphological identification. Phylogenetic trees were Ariddah, and Abuareesh [51]. constructed for Cx. pipiens and Cx. quinquefasciatus, and their Cx. tritaeniorhynchus was found in all types of breeding distinctive clustering was compared with their reference’s sites in the Red Sea coastal plain of Jazan region (man-made speciesintheGenBankasshowninFigures5and7.Itisworthy pools, especially turbid ones, rain pools, dams, rock pools, to mention that the molecular characteristics of Cx. pipiens and domestic water tanks). It was also noticed to share when compared with the records of the gene bank showed its breeding sites with Anopheles arabiensis, the main malaria similarity to those of Egypt, Kenya (100%) and very close to vector in the region [23]. those of Iran (99.85%) (Table 3). While the molecular iden- Cx. tritaeinorhynchus is a primary vector of Japanese B tification revealed one species of Cx. quinquefasciatus that is encephalitis in the oriental region [27] and Rift valley virus similar to the Turkish species (100%), and one subspecies of Cx. in Jazan region of Saudi Arabia with a biting preference for pipiens quinquefasciatus (Q primers 500bp) is similar to the Sri humans and sheep [4]. In the present study, the molecular Lankan subspecies (100%) (Table 3). identification of Cx. tritaeniorhynchus using the universal In Baljurashi Province of Saudi Arabia, the results of primer COI (Figure 12), along with the constructed phy- molecular identification of Cx. pipiens using PCR technique logenetic trees and their distinctive clustering, was com- revealed that the Cx. pipiens cf-3 strain was the accurate pared with their reference’s species in the GenBank definition after initial morphological identification of the (Figure 13) and showed that it is quite similar to the species species [49]. Likewise, the molecular characteristics of Cx. of USA, Japan, and China (100% similarity, Table 3). quinquefasciatus samples from Yanbu Province of Saudi Arabia indicated that they were very close to those found in Pakistan, Brazil, and India (GenBank references; 3.4. Culex sitiens (Figure 8(a)). &e main morphological KF406862.1, MK575480.1, MH538709.1, and MH538707.1.) features of the proboscis indicate that the median pale ring is [50]. present, but not extending proximally to the ventral surface as in Cx. tritaeinorhynchus (Figure 9(a)); the fore and 3.3. Culex tritaeniorhynchus (Figure 8(b)). &e main mor- midfemora are speckled (Figure 10(a)). On the other hand, phological features found in Cx. tritaeniorhynchus are the the furcation of R is distal to the furcation of M 2+3 1+2 presence of a median pale ring in the proboscis that extends (Figure 11(a)). proximally to the ventral surface of the proboscis Bionomics of Cx. sitiens showed various breeding (Figure 9(b)), and the fore and midfemora are entirely black habitats including fresh ground water, salt, brackish, and International Journal of Zoology 7 Culex pipiens COI S41 MK713990 Culex pipiens COI S67 MK714012 Culex pipiens COI NAH4 MK300247 Culex pipiens COI FCH8 MK300245 Culex pipiens COI S46 MK713995 Culex pipiens COI stin.cpip contig781 KP293425 Culex pipiens COI boli.cpip contig1851 KP293419 Culex pipiens COX1 Cx pip Port-2169 LC102133 Culex pipiens COI cf-3 JQ958371 Culex pipiens Jazan Culex pipiens COI Col3 MN299023 Culex pipiens COI MK347224 Culex pipiens pipiens pipiens HQ724614 Culex pipiens COI Cx.Pipiens 2013 No5 KJ401311 Culex pipiens COI Mm-128 MK533637 Figure 5: Evolutionary relationship of taxa of Culex pipiens identified in Jazan region using MEGA 5. 6 15 2 3 45 7 8 10 11 12 13 14 1 9 Figure 6: PCR amplified 500bp DNA bands using Cx. quinquefasciatus specific primers. Lane 1:100bp ladder, lane 2: positive control, lane 3: negative control, lane 4: negative sample, lanes 5–15 positive samples. Culex pipiens COI NAH4 MK300247 Culex quinquefasciatus COI S44 MK713993 (2) Culex quinquefasciatus COI S44 MK713993 Culex quinquefasciatus COI NC-216 MN733799 Culex quinquefasciatus COI NC-429 MN733800 Culex quinquefasciatus Jazan Culex pipiens COI Col3 MN299023 Culex quinquefasciatus cox1 92-B103165 47 MG712557 Culex quinquefasciatus cox1 92-B103169 48 MG712558 Culex quinquefasciatus MK575480 95 Culex quinquefasciatus GU188856 Culex quinquefasciatus COI Hydarabad12 FN395201 Culex quinquefasciatus cox1 92-B103132 46 MG712556 Culex quinquefasciatus COI NC-952 MN733801 Culex quinquefasciatus COI BUZOOS-Cq MH538709 100 Culex quinquefasciatus COI MB10499 MF172300 Figure 7: Evolutionary relationship of taxa of Culex quinquefasciatus identified in Jazan region using MEGA 5. 8 International Journal of Zoology Table 3: Similarity of Culex species in Jazan Region related to gene bank references. Culex species Gene bank accession no. Similarity (%) Country KJ012245.1 100 USA Culex tritaeniorhynchus AB738247.1 100 Japan MF179221 100 China MT199095 100 Egypt Culex pipiens MK300250 100 Kenya JQ958371 99.85 Iran Culex quinquefasciatus MK713993.1 100 Turkey Culex pipiens quinquefasciatus (Q primers 500bp) AF089002.1 100 Sri Lanka MN552296 100 Guinea Culex sitiens MK300241 100 Kenya MF179212 100 China (a) (b) Figure 8: Culex sitiens (a) and Culex tritaeniorhynchus (b). (a) (b) Figure 9: Proboscis of Culex sitiens (a) and Culex tritaeniorhynchus (b). artificial containers in coastal, urban, and suburban areas and birds, but will also bite men. It is an implicated vector of Japanese B encephalitis [41]. [41]. It can also be found in almost every stagnant brackish In Jeddah, Saudi Arabia, the density of Cx. sitiens was waters with full sunlight [52]. Females feed primarily on pigs directly related to temperature. Its peak of density is in International Journal of Zoology 9 (a) (b) Figure 10: Fore and midfemora of Cx. sitiens (speckled) (a) and (entirely black) Cx. tritaeniorhynchus (b). R M R M 2+3 1+2 2+3 1+2 (a) (b) Figure 11: Furcation of R of Cx. sitiens (distal to furcation of M ) (a) and (proximal to furcation of M ) Cx. tritaeniorhynchus (b). 2+3 1+2 1+2 1 2 3 4 56 7 8 Figure 12: PCR amplified 745bp DNA bands using COI primers to identify Culex tritaeniorhynchus and Culex sitiens. Lane 1:100bp ladder, lane 2: positive control, lanes 3–7: tested samples, lane 8: negative control. summer, and it is highly abundant in spring, while it breeds species of Guinea and Kenya (100%) and China (100%) throughout the year [46]. (Table 3). Cx. sitiens molecular identification in the present study All mosquito species identified morphologically in this using the universal primer COI (Figure 12), along with the study have also been molecularly identified, assuring ab- constructed phylogenetic trees and their distinctive clus- solute compatibility between taxonomic and molecular tering, when compared with their reference’s species in the identification, confirming that PCR is a complementary tool GenBank (Figure 14) revealed that it is similar to the African for the identification of mosquito species. 10 International Journal of Zoology Culex tritaeniorhynchus COI MF179221 Culex tritaeniorhynchus jazan Culex tritaeniorhynchus COI NIBGE DIP-00292 KF407889 (2) Culex tritaeniorhynchus COI NIBGE DIP-00292 KF407889 Culex tritaeniorhynchus COI 704TOK2011 AB738218 Culex tritaeniorhynchus COI 865YON2005 AB738250 Culex tritaeniorhynchus COI 544IRI2011 AB738194 Culex tritaeniorhynchus COI 420MIY2011 AB738167 Culex tritaeniorhynchus COI 835AMA2011 AB738247 Culex tritaeniorhynchus COI 976ISH2011 AB738269 Culex tritaeniorhynchus COI NIBGE DIP-00321 KF407841 Culex tritaeniorhynchus COI NIBGE DIP-00321 KF407841 (2) Culex tritaeniorhynchus COI MBIM1-A4 KJ012246 Culex tritaeniorhynchus COI MBIM1-A2 KJ012247 Culex tritaeniorhynchus COI MBIM1-A3 KJ012245 Culex tritaeniorhynchus COI MBIM1-A7 KJ012244 Figure 13: Evolutionary relationship of taxa of Culex tritaeniorhynchus identified in Jazan region using MEGA 5. Culex sitiens COI 600OKI2011 AB738201 Culex sitiens COI 606MIY2011 AB738205 54 Culex cf. sitiens MAFP8.E9 COI MAFP8.E9 MN552296 Culex sitiens cox1 92-B102975 51 MG712561 Culex sitiens cox1 92-B102974 50 MG712560 Culex sitiens COI NC-331 MN733803 Culex sitiens COI NC-341 MN733804 Culex sitiens COI MF179212 Culex sitiens COI NC-347 MN733805 Culex sitiens COI NC-926 MN733806 Culex sitiens Jazan Culex sitiens COI NC-324 MN733802 Culex sitiens COI FAH3 MK300241 Culex sitiens COI FA1 MK300239 Culex sitiens COI FCH7 MK300244 Figure 14: Evolutionary relationship of taxa of Culex sitiens identified in Jazan region using MEGA 5. 4. Conclusion Conflicts of Interest In this study, Culex tritaeniorhynchus was the predominant &e authors declare that they have no conflicts of interest. species in Jazan region, followed by Cx. quinquefasciatus, then Cx. sitiens, and Cx. pipiens. &e most infested areas by Culex mosquitoes in the region were Gizan and Sabya. References &e results showed the potentiality of integrating the [1] D. A. Warrell, “Leishmaniasis, malaria and schistosomiasis in morphological and molecular identification to refine the list Saudi Arabia,” Saudi Medical Journal, vol. 14, pp. 203–208, of Culex mosquito species and accurately document their geographical distribution in the Jazan region. &is inte- [2] A. M. Abdoon and A. M. Alshahrani, “Prevalence and dis- gration has the capacity to promote and enhance vector tribution of anopheline mosquitoes in malaria endemic areas surveillance and control programmes, as well as defining the of Asir region, Saudi Arabia,” Eastern Mediterranean Health genetic diversity of species in the region. Journal, vol. 9, no. 3, pp. 240–247, 2003. [3] F. Hawking, 7e Distribution of Human Filariases throughout the World, Mimeograph WHO/FIL/73.114, 1973. Data Availability [4] P. G. Jupp, A. Kemp, A. Grobbelaar et al., “&e 2000 epidemic &e data used in this study are included within the article. of Rift Valley fever in Saudi Arabia: mosquito vector studies,” International Journal of Zoology 11 Medical and Veterinary Entomology, vol. 16, no. 3, pp. 245– mosquito species in Singapore,” Parasites & Vectors, vol. 7, 252, 2002. no. 1, 2014. [5] M. Al-Hazmi, E. A. Ayoola, M. Abdurahman et al., “Epidemic [20] U. Jinbo, T. Kato, and M. Ito, “Current progress in DNA barcoding and future implications for entomology,” Ento- Rift Valley fever in Saudi Arabia: a clinical study of severe illness in humans,” Clinical Infectious Diseases, vol. 36, no. 3, mological Science, vol. 14, no. 2, pp. 107–124, 2011. pp. 245–252, 2003. [21] N. Shahhosseini, M. H. Kayedi, M. M. Sedaghat, T. Racine, [6] K. H. Al Ali, A. A. El-Badry, M. Al Ali, W. S. M. El-Sayed, and G. P. Kobinger, and S. H. Moosa-Kazemi, “DNA barcodes H. A. El-Beshbishy, “Phylogenetic analysis of Aedes aegypti corroborating identification of mosquito species and multi- based on mitochondrial ND4 gene sequences in Almadinah, plex real-time PCR differentiating Culex pipiens complex and Saudi Arabia,” Iranian Journal of Biotechnology, vol. 14, Culex torrentium in Iran,” PloS One, vol.13, no.11, Article ID Article ID e1329, 2016. e0207308, 2018. [7] M. Fakeeh and A. M. Zaki, “Virologic and serologic sur- [22] A. Stephen, M. B. Crabtree, and M. S. Harry, “Polymerase veillance for dengue fever in Jeddah, Saudi Arabia, chain reaction assay identifies culex nigripalpus: part of an 1994–1999,” 7e American Journal of Tropical Medicine and assay for molecular identification of the common culex (culex Hygiene, vol. 65, no. 6, pp. 764–767, 2001. mosquitoes of the eastern United States,” Journal of the [8] N. A. Khan, E. I. Azhar, S. El-Fiky et al., “Clinical profile and American Mosquito Control Association, vol. l9, no. 2, pp. 115–120, 2003. outcome of hospitalized patients during first outbreak of dengue in Makkah, Saudi Arabia,” Acta Tropica, vol. 105, [23] A. A. Alsheikh, “Larval habitat, ecology, seasonal abundance no. 1, pp. 39–44, 2008. and vectorial role in malaria transmission of Anopheles [9] M. Fakeeh and A. M. Zaki, “Dengue in Jeddah, Saudi Arabia, arabiensis in Jazan Region of Saudi Arabia,” Journal of the 1994–2002,” Dengue Bulletin, vol. 27, pp. 13–18, 2003. Egyptian Society of Parasitology, vol. 41, no. 3, pp. 615–634, [10] P. F. Mattingly and K. L. Knight, “&e mosquito of Arabia I,” 2011 Dec. Bulletin of the British Museum (Natural History), vol. 4, no. 3, [24] R. E. Harbach, “Pictorial keys to the genera of mosquitoes, pp. 91–141, 1956. subgenera of Culex and the species of Culex (Culex) occurring [11] M. A. R. Abdullah and A. I. Merdan, “Distribution and in southwestern Asia and Egypt, with a note on the subgeneric ecology of the mosquito fauna in the southwestern Saudi placement of Culex deserticola (Diptera: Culicidae),” Mos- Arabia,” Journal of the Egyptian Society of Parsitology, vol. 25, quito Systematics, vol. 17, pp. 83–107, 1985. no. 3, pp. 815–837, 1995. [25] S. Antunes-de Morais, C. Moratore, L. Suesdek, and [12] B. R. Miller, M. S. Godsey, M. B. Crabtree et al., “Isolation and M. T. Marrelli, “Genetic-morphometric variations in culex quinquefaciatus from Brazil and La Plata, Argentina,” genetic characterization of Rift Valley fever virus from Aedes vexans arabiensis, Kingdom of Saudi Arabia,” Emerging In- Memorias ´ do Instituto Oswaldo Cruz, vol. 105, no. 5, 2010. fectious Diseases, vol. 8, no. 12, pp. 1492–1494, 2002. [26] H. Dengham, S. H. Moosa-Kazemi, J. Sadraei, and [13] A. M. Alahmed, M. A. Al Kuriji, S. M. Kheir, S. A. Alahmedi, H. Soleimani, “&e ecological aspects of Culex pipens (Dip- M. J. Al Hatabbi, and M. A. Al Gashmari, “Mosquito fauna tera: Culicidae) in central Iran,” Journal of Arthropod-Borne (Diptera: Culicidae) and seasonal activity in Makkah Al Diseases, vol. 8, no. 1, pp. 35–42, 2014. Mukarramah Region, Saudi Arabia,” Journal of the Egyptian [27] R. A. Bram, “Contributions to the mosquito fauna of Society of Parasitology, vol. 39, pp. 991–1013, 2009. Southeast Asia—II. &e genus Culex in &ailand (Diptera: [14] A. M. Alahmed, M. A. Al Kuriji, S. M. Kheir, H. M. Al Haqawi, Culicidae),” Contributions of the American Entomological and E. A. A. Sultan, “Mosquito (Diptera: Culicidae) and their Institute, vol. 2, no. 1, pp. 1–296, 1967. seasonal activity in Jazan Region, Saudi Arabia,” Journal of the [28] B. P. Das, “Pictorial key to common species of Culex (Culex) mosquitoes associated with Japanese encephalitis virus in Saudi Society of Agricultural Sciences, vol. 9, pp. 136–138, 2010. India,” in Mosquito Vectors of Japanese Encephalitis Virus [15] A. M. Al Ahmad, M. F. Sallam, M. A. Khuriji, S. M. Kheir, and from Northern India, pp. 25–42, Springer India, New Delhi, S. Azari-Hamidian, “Checklist and pictorial key to fourth- India, 2013. instar larvae of mosquitoes (Diptera: Culicidae) of Saudi [29] U. P. K. Hettiaratchi, D. H. N. Munasingha, Arabia,” Journal of Medical Entomology, vol. 48, no. 4, N. V. Chandrasekharan, E. H. Karunanayake, and pp. 717–737, 2011. N. Jayasekera, “A polymerase chain reaction based method for [16] K. Al-Ghamdi, M. Alikhan, J. Mahyoub, and Z. I. Afifi, the detection of Culex quinquefasciatus (Diptera: Culicidae),” “Studies on identification and population dynamics of Bulletin of Entomological Research, vol. 90, no. 1, pp. 63–68, anopheline mosquitoes from Jeddah Province of Saudi Ara- 2000. bia,” Bioscience Biotechnology Research Communications, [30] O. Folmer, M. Black, W. Hoeh, R. Lutz, and R. Vrijenhoek, vol. 1, pp. 19–24, 2008. “DNA primers for amplification of mitochondrial cyto- [17] L. Delgado-Petrocelli, A. Camardiel, V. H. Aguilar, chrome c oxidase subunit I from diverse metazoan inverte- ´ brates,” Molecular Marine Biology and Biotechnology, vol. 3, N. Martinez, K. Cordova, and S. Ramos, “Geospatial tools for the identification of a malaria corridor in Estado Sucre, a no. 5, pp. 294–299, 1994. Venezuelan north-eastern state,” Geospatial Health, vol. 5, [31] S. F. Altschul, T. L. Madden, A. A. Schaffer ¨ et al., “Gapped no. 2, pp. 169–176, 2011. BLASTand PSI-BLAST: a new generation of protein database [18] M. Amini, A. A. Hanafi-Bojd, A. A. Aghapour, and Search programs,” Nucleic Acids Research, vol. 25, pp. 3389– A. R. Chavshin, “Larval habitats and species diversity of 3402, 1997. mosquitoes (Diptera: Culicidae) in West Azerbaijan Province, [32] A. A. Alsheikh, M. H. Zafer, A. G. Anaami et al., “Potential Northwestern Iran,” BMC Ecology, vol. 20, no. 1, p. 60, 2020. mosquito vectors of arboviral diseases in Jazan Region, Saudi [19] A. Chan, L.-P. Chiang, H. C. Hapuarachchi et al., “DNA Arabia,” Bioscience Biotechnology Research Communications, barcoding: complementing morphological identification of vol. 6, no. 2, pp. 142–149, 2013. 12 International Journal of Zoology [33] R. Bakr, M. Nassar, N. El-Barky, T. Kotb, H. Badrawy, and [47] S. J. Carpenter and W. J. LaCasse, Mosquitoes of North M. Abdeldayem, “Prevalence of mosquitoes in Jazan Province, America (North of Mexico), University of California Press, Saudi Arabia,” Egyptian Academic Journal of Biological Sci- Berkeley, Los Angeles, 1955. [48] M. S. Omar, “A survey of bancroftian filariasis among South ences. A, Entomology, vol. 7, no. 2, pp. 15–27, 2014. [34] E. I. Khater, M. M. Sowilem, M. F. Sallam, and East Asian expatriate workers in Saudi Arabia,” Tropical A. M. Alahmed, “Ecology and habitat characterization of Medicine and International Health, vol. 1, no. 2, pp. 155–160, mosquitoes in Saudi Arabia,” Tropical Biomedicine, vol. 30, 1996. no. 3, pp. 409–427, 2013. [49] T. S. Alghamdi, Study of the Seasonal Fluctuation of Mos- [35] T. A. Al-Azraqi, A. A. El Mekki, and A. A. Mahfouz, quitoes Population with Evaluation of the Effectiveness of the “Seroprevalence of dengue virus infection in Aseer and Jizan Insecticides Used against the Dominant Species in Baljurashi regions, Southwestern Saudi Arabia,” Transactions of 7e Province, Ph.D. &esis, Faculty of Sciences King Abdulaziz Royal Society of Tropical Medicine and Hygiene, vol.107, no. 6, University, Jeddah, Saudi Arabia, 2018. pp. 368–371, 2013. [50] S. T. Alerwi, N. Alkenani, J. A. Mahyoub, A. Alghamdi, [36] M. E. Sinka, Y. Rubio-Palis, S. Manguin et al., “&e dominant S. A. Hanan, Y. Anwar et al., “Molecular identification and Anopheles vectors of human malaria in the Americas: oc- bio-control of Culex quinquefasciatus from Yanbu region,” currence data, distribution maps and bionomic precis,” ´ Journal of Entomology and Zoology Studies, vol. 7, no. 6, pp. 1081–1086, 2019. Parasites Vectors, vol. 3, 2010. [37] A. M. Alahmed, K. Munawar, S. M. S. Khalil, R. E. Harbach, [51] M. F. Sallam, A. M. Al Ahmed, M. S. Abdel-Dayem, and and R. E. Harbach, “Assessment and an updated list of the M. A. R. Abdullah, “Ecological niche modeling and land cover mosquitoes of Saudi Arabia,” Parasites and Vectors, vol. 12, risk areas for rift valley fever vector, Culex tritaeniorhynchus no. 1, p. 356, 2019. giles in jazan, Saudi Arabia,” PLoS One, vol. 8, no. 6, Article ID [38] T. V. Gaffigan, R. C. Wilkerson, J. E. Pecor, J. A. Stoffer, and e65786, 2013. T. Anderson, Systematic Catalog of Culicidae Suitland, Walter [52] S. Prummongkol, C. Panasoponkul, C. Apiwathnasorn, and Reed Biosystematics Unit, Museum Support Center, Smith- U. Lek-Uthai, “Biology of Culex sitiens, a predominant sonian Institution, Suitland, MD, USA, 2019, http://www. mosquito in Phang Nga, &ailand after a tsunami,” Journal of mosquitocatalog.org/. Insect Science, vol. 12, pp. 1–8, 2012. [39] J. T. Michael, “Members of the Culex pipiens complex as vectors of viruses,” Journal of the American Mosquito Control Association, vol. 28, no. 4s, pp. 123–126, 2012. [40] S. R. Irish, H. M. Al-Amin, H. N. Paulin et al., “Molecular xenomonitoring for Wuchereria bancrofti in Culex quin- quefasciatus in two districts in Bangladesh supports trans- mission assessment survey findings,” PLOS Neglected Tropical Diseases, vol. 12, no. 7, Article ID e0006574, 2018. [41] R. E. Harbach, “&e mosquitoes of the subgenus Culex in southwestern Asia and Egypt (Diptera: Culicidae),” Contri- butions of the American Entomological Institute, vol. 24, no. 1, pp. 1–236, 1988. [42] A. Diaz-Badillo, B. G. Bolling, G. Perez-Ramirez et al., “&e distribution of potential West Nile virus vectors, Culex pipiens pipiens and Culex pipiens quinquefasciatus (Diptera: Culi- cidae), in Mexico City,” Parasites and Vectors, vol. 4, no. 1, p. 70, 2011. [43] B. O. Motayo, B. A. Onoja, A. O. Faneye, and J. A. Adeniji, “Seasonal abundance and molecular identification of West Nile virus vectors, Culex pipens and Culex quinquefasciatus (diptera: culicidae) in Abeokuta, South-West, Nigeria,” Af- rican Health Sciences, vol. 16, no. 1, pp. 135–140, 2016. [44] M. H. Kayedi, F. Sepahvand, E. Mostafavi et al., “Morpho- logical and molecular identification of Culicidae mosquitoes (Diptera: Culicidae) in Lorestan province, Western Iran,” Heliyon, vol. 6, no. 8, Article ID e04480, 2020. [45] S. Sirivanakarn, “Medical entomology studies-III. A revision of the subgenus Culex in the Oriental region (Diptera: Culicidae),” Contributions of the American Entomological Institute, vol. 12, no. 2, pp. 1–272, 1976. [46] M. I. Hassan, H. A. Al Ashry, M. Shobrak, and M. A. Kenawy, “Seasonal abundance of the common mosquitoes: Culex pipiens, Cx. quinquefasciatus and Cx. sitiens (Diptera: Culi- cidae) in the western coast of Saudi Arabia,” Egyptian Aca- demic Journal of Biological Sciences E Medical Entomology and Parasitology, vol. 8, no. 1, pp. 13–22, 2016. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png International Journal of Zoology Hindawi Publishing Corporation

Culex (Diptera: Culicidae) Mosquitoes in Jazan Region, Saudi Arabia, and Their Molecular Identification

Loading next page...
 
/lp/hindawi-publishing-corporation/culex-diptera-culicidae-mosquitoes-in-jazan-region-saudi-arabia-and-9F5vIAusCp
Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2021 Elsiddig Noureldin et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8477
eISSN
1687-8485
DOI
10.1155/2021/5563916
Publisher site
See Article on Publisher Site

Abstract

Hindawi International Journal of Zoology Volume 2021, Article ID 5563916, 12 pages https://doi.org/10.1155/2021/5563916 Research Article Culex (Diptera: Culicidae) Mosquitoes in Jazan Region, Saudi Arabia, and Their Molecular Identification Elsiddig Noureldin , Ommer Dafalla , Abdualziz Hakami, Mohammed Jubran, Ahmed Alzhrani, Muhannad Mujally, Othman Shajari, Ali Khardali, and Zaki Eisa Saudi Center for Disease Control and Prevention (SCDC), P.O. Box 716, Jazan 45142, Saudi Arabia Correspondence should be addressed to Elsiddig Noureldin; elsiddigha@moh.gov.sa Received 8 February 2021; Accepted 27 June 2021; Published 8 July 2021 Academic Editor: Marco Cucco Copyright © 2021 Elsiddig Noureldin et al. &is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Morphological characteristics have been the gold standard method to identify mosquito species. However, morphological identification has many limitations including lack of expertise and damaging of external characters due to improper specimen handling. &erefore, we used the polymerase chain reaction technique (PCR) as an integrated tool to identify Culex mosquito species to establish a more precise and reliable identification system related to their spatial distribution in Jazan region. We identified Culex mosquito species and subspecies using taxonomic keys, and then we used the polymerase chain reaction technique (PCR) as an integrated tool to confirm and refine the list of Culex mosquito species in the region. Phylogenetic trees were constructed for the identified species, and their distinctive clustering was compared with their reference’s species in the GenBank. We identified 7026 adult Culex mosquitoes belonging to 4 species. Culex tritaeniorhynchus was the predominant species (45%), followed by Cx. quinquefasciatus (32%), then Culex sitiens (20%), and Cx. pipiens (3%). &e most infested areas by Culex in the region were Gizan and Sabya. &e PCR achieved 100% success in identifying the four Culex mosquito species. We also report the molecular identification of Cx. quinquefasciatus and Cx. pipiens species for the first time in Jazan region while the molecular identification of Cx. tritaeniorhynchus and Cx. sitiens was reported for the first time in Jazan region and the whole Saudi Arabia. &is study utilized for the first time PCR to identify Culex mosquito species in Jazan region. &e PCR is a complementary and integrated taxonomy-based identification tool for mosquito species. &is integration has the capacity to promote and enhance vector surveillance and control programs, as well as defining the genetic diversity of species in the region. host availability, climatic conditions, especially rain and 1. Introduction temperature, human mobility and activities, and land cover Mosquito-borne diseases, i.e., malaria [1, 2], filariasis [3], Rift [17]. &ese factors have a potential impact on the vectorial Valley fever [4, 5], West Nile virus [6], dengue, and others capacity of mosquitoes for disease transmission. [7, 8], pose potential public health threats in Saudi Arabia. &e accurate identification of mosquito vector species and knowledge of their biology, ecology, and geographical Several authors have investigated the distribution of mosquito species in Saudi Arabia [1–16]. distribution are considered important factors for surveil- Most of these studies reported the predominance of lance and control of vectors and mosquito-borne diseases Culex mosquitoes over other species. Within Culex species [18]. reported by these studies, Culex quinquefasciatus, Culex Morphological identification is the gold standard and the tritaeniorhynchus, and Cx. pipiens were the most dominant conventional method to identify mosquito species Culex mosquitoes in Saudi Arabia and Jazan region. depending on their external characters [19]. &e abundance and distribution of mosquito fauna are However, morphological identification is highly time influenced by many factors including, but not limited to, consuming and requires experienced taxonomists. 2 International Journal of Zoology Furthermore, improper handling of specimen damage is bifurcation of R2+3 veins, as described by some taxonomic often occurred to some important characteristics such as pictorial keys [24–26]. For the Females of Culex tritaeniorhynchus and Culex bristles and scales leads to incomplete identification. Ad- ditionally, the similarity of shared morphological features by sitiens, relevant pictorial keys were used [24, 27, 28]. species complexes’ members makes identification based on taxonomic keys alone a difficult task [20]. Polymerase chain reaction (PCR) is becoming a popular 2.4. Molecular Identification of Culex Species. Previously identified Culex mosquitoes of individual species by technique for mosquitoes identification based on their DNA sequencing and the fact that every species has its own genetic morphometric methods were selected according to their location of capture. identity [19]. Molecular techniques to differentiate between Cx. DNA was extracted from the stored homogenate using GeneJET Genomic DNA Purification Kit (&ermo Scien- pipiens complex or/and other Culex species, or to differ- tific) following the manufacturer’s recommendations: For entiate between the Cx. pipiens complex biotypes, are based every individual mosquito, legs were homogenized in a on gel electrophoretic analysis of certain DNA fragments mortar and pestle (mini borosilicate glass chamber length amplified by PCR [21]. PCR assay identifies Cx. pipiens, Cx. quinquefasciatus, and their hybrids based on the nucleotide 60mm/pestle diameter 9.0mm, 3.0Ml, Fisherbrand) in 150 μL of digestion solution and then the homogenate was sequence differences in the acetylcholinesterase gene Ace.2 [22]. transferred to 1.5 tubes. Twenty microliters of Proteinase K Solution was added and mixed thoroughly by vortexing to &e aim of this study was to determine fauna of adult Culex mosquitoes (Diptera: Culicidae) and to produce obtain a uniform suspension and incubated in the thermo shaker for 30 minutes at 56 C, 1300rpm. Twenty microliters precise and refine records of their species and their distri- bution in Jazan region based on morphological and genomic of RNase A Solution which was added and mixed by vor- texing and incubated for 10min at room temperature, then (molecular) identification. To the best of our knowledge, this is the first study in Jazan region to use molecular charac- 200 μL of lysis solution was added and mixed thoroughly by vortexing for 15s until a homogeneous mixture is obtained. teristics to identify Culex species and their genetic diversity. After adding 400 μL of 50% ethanol and mixed by vortexing the prepared lysate was transferred to a GeneJET Genomic 2. Materials and Methods DNA Purification Column inserted in a collection tube and 2.1. Study Area. Jazan area is about 22,000km and with 1.6 centrifuged for 1min at 8000rpm. &e GeneJET Genomic ° ° million population, lies between 16 –12 and 18 –25, latitude DNA Purification Column was placed into a new 2mL north, and located in the subtropical zone, southwestern of collection tube and 500 μL of wash buffer 1 was added and Saudi Arabia, with a coastal boundary of 250km along the centrifuged for 1min at 8000 RPM, then the column was Red Sea and a 120km border with the Republic of Yemen placed into a new collection tube and 500 μL of wash buffer 2 (Figure 1). &is region includes over 3000 villages scattered was added and centrifuged for 3min at 13,000rpm. DNA along the area and about 100 islands located in the Red Sea, Purification Column was transferred to a sterile 1.5mL including the Farasan islands. It is surrounded by the Red microcentrifuge tube, and 200 μL of elution buffer was added Sea from the west and by Arabic Republic of Yemen from the to the center of the column membrane to elute genomic south and east and Asir region from the north ([23]; DNA. Incubated for 2min at room temperature and GASTAT 2017: https://www.stats.gov.sa/en/5655). centrifuged for 1min at 8000rpm. &e molecular identification of Culex species was per- formed by polymerase chain reaction technique (PCR) 2.2. Mosquito Collection. CDCminiaturelighttraps wereused following the described procedure and using the primers for the adult mosquitos’ collection from different parts of Jazan provided in (Table 2.) [22, 29]. region from February 2018 to December 2019 (Table 1). Ten &e PCR was carried out in a total volume of 50 μL using light traps were installed once per month in each of the houses, Dream Tag Green Master Mix (&ermo Scientific) con- animals’ shelters, wild vegetation, near wadies, sewerage plants, taining 25 μL master mix ready to use, 1 μL (10pmol) of each dams, and ponds from 1800 to 0600hr. reverse and species-specific forward primers, 5 μL of DNA For outdoor collections, a 2 kilogram block of dry ice template, and 18 μL nuclease-free water. &e mix was (CO2) was wrapped in a Hessian bag above the trap. To subjected to initial denaturation at 94 C for 3 minutes, 30 minimize the mortality of the collected mosquitoes due to ° ° cycles of denaturation (94 C, 60s), primer annealing (51 C), desiccation, damp cotton pads were kept in the collection primer extension (72 C, 60s), and final extension for 5 cups. Collected mosquitoes were brought to the insectary of minutes. In each run, negative and positive controls were the Saudi Center for Disease Prevention and Control in included. &e PCR products amplifications were analyzed by Gizan city for morphological and genetic identification. gel electrophoresis (1.5 agarose in Tris-Acetate EDTA buffer) staining with ethidium bromide. &e visualization was carried out using Gel Doc XR Imaging System (Bio-Rad). 2.3. Mosquito Morphological Identification. Female Culex pipens and Culex quinquefasciatus mosquitoes were mor- Universal primers [30], LCO1490 and HCO2198 (Ta- ble 2), were used for the PCR amplification of a 710-bp phologically identified and differentiated by using wing measurements of intersection of costa, subcosta, and fragment of the mitochondrial cytochrome oxidase subunit I International Journal of Zoology 3 W E Al-Shaqeq Al-Darb Al-Raith Al-Haqo Haroob Al-Daer Baish 1 centimeter = 7,215 meters Al-Aeidabi Al-Alia Sabya Faifa Quz Al Jaafra Damad Al-Ariddah Wadi Jizan Jizan Abuareesh Farasan Islands Farasan Islands Farasan Islands Al-khoba Ahad Almasarha Al-Madaia Farasan Islands Farasan Islands Al-Qofl Samttah Al-Sehi Al Tawal Al-Moasam Miles 12.5 25 50 75 100 Figure 1: Boundaries of the different study areas in Jazan Region, southwest of Saudi Arabia. gene (COI) for the samples not identified by the species- 3. Results and Discussion specific primers follow the same previous PCR procedure. Results of the identification and counts of Culex species mosquitoes are shown in Table 1. Seven thousand twenty-six 2.5. Sequencing. Purification and standard sequencing for adult Culex mosquitoes were collected from 25 different PCR products were performed by Macrogen Company areas of Jazan region during 2018 and 2019 (Figure 1). (Seoul, Korea). Sequencing reactions were performed in an Clearly, the number of mosquito specimens was rela- ABI PRISM 3730XL Analyzer (96 capillary type) using an tively low compared to the period of study (around 2 years). ABI PRISM BigDyeTM Terminator Cycle Sequencing Kit &is is may be attributed to the fact that effective and ex- with AmpliTaq DNA polymerase (FS enzyme) (Applied tensive vector control activities were taken place during the Biosystems), following the protocols supplied by the man- last 5 years in the region to combat malaria, dengue, and rift ufacturer. Single-pass sequencing was performed on each valley, the most prevalent vector-borne diseases in the template using LCO1490 primer. Gel elution was performed region. using MG Gel Extraction SV (MD007) kit (MGmed), fol- In this study, four Culex species were present in the lowing the protocols supplied by the manufacturer. region, namely; Culex tritaeniorhynchus, Cx. quinque- fasciatus, Cx. sitiens, and Cx. pipiens. &eir respective per- &e sequences were searched for sequence similarity through Basic local Alignment Search Tool (BLAST) (http:// centages of occurrence were 45%, 32%, 20%, and 3%. www.ncbi.nlm.nih.gov/BLAST/) [31] and compared to Culex tritaeniorhynchus was the most abundant species reference sequences of Culex species detected in BLASTand encountered in 23 areas out of 25, followed by Cx. quin- downloaded from GenBank (http://www.ncbi.nlm.nih.gov/ quefasciatus and Cx. sitiens which occurred in 14 areas, and genbank/). Cx. pipiens in 4 areas. Evolutionary relationship of taxa tree was constructed &ese results are in accordance with the findings of Al for each of the Culex species using the Molecular Evolu- Ahmad et al. [15] who indicated that Culex tritaeniorhynchus tionary Genetic Analysis (MEGA 5 software). is a common widespread species in Saudi Arabia and has 4 International Journal of Zoology Table 1: Culex species in Jazan region. Area Cx. tritaeniorhynchus Cx. quinquefasciatus Cx. pipiens Cx. sitiens Total Gizan 750 904 173 333 2160 Al-shegairy 243 102 0 24 369 Ahad Almasarha 0 0 0 29 29 Sabya (Qaem jaaferi) 817 0 0 450 1267 Sabya (Wadi sabya) 37 0 0 3 40 Samtah 0 235 7 0 242 Damad 53 0 0 204 257 Baish 406 208 25 114 753 Aboareesh 119 310 0 0 429 Al-tawal 13 0 0 65 78 Al-madhaya 229 0 0 0 229 Al-darb 67 0 0 0 67 Al-ariddah (Batin asar) 48 93 0 2 143 Haroob 3 61 0 0 64 Al-shegaig 84 0 0 0 84 Haroob (Wadi wasea) 15 0 0 0 15 Faifa 96 1 0 0 97 Al-gofl 61 32 13 84 190 Al-dhabia 0 54 0 2 56 Al-horath 18 0 0 61 79 Al-sehi 0 109 0 0 109 Al-aeidabi 16 15 0 11 42 Al-aeidabi (Wadi qessi) 25 0 0 9 34 Aiban 8 18 0 0 26 Belgazzi 12 103 0 0 115 Total 3144 2266 218 1398 7026 % 45 32 3 20 Table 2: Primers used for molecular identification of Culex species. Consensus CPI6 R GCGGGTACCATGCTTAAATTTAGGGGTA Culex pipiens complex PQIO F CCTATGTCCGCGTATACTA 698bp Cx. restuans R6 F CCAAACACCGGTACCCAA 506bp Cx. salinarius S20F TGAGAATACATACCACTGCT 175bp Cx. nigripalpus N90I F ATACCCATGCGAAAGCATAC 404bp Cx. nigripalpus NRI080R GTACCGCGACCACACGACTT Cx. quinquefasciatus FCQ GGT CGT ATC AAC AAA GTC CA 500bp Cx. quinquefasciatus RCQ ATG GAT ACG GAC TAC ACT GG COI (LCO1490) GGTCAACAAATCATAAAGATATTGG 740bp COI (HC02198) TAAACTTCAGGGTGACCAAAAAATCA been recorded from Jazan and other 14 provinces out of 15. formation of small stagnant water collections following Similar results were also reported by Alsheikh et al. [32], who rainfall and/or water pipe leakage in their urban areas [35]. found Cx. tritaeniorhynchus to be the most predominant &e prevalence of the Culex species in those areas could be species in the Red Sea coastal plain of Jazan region, followed attributed also to their wide suitability to different breeding by Cx. quinquefasciatus. &e findings are also in line with sites and variable extreme climatic factors prevailing there [11]. those of Al Ahmad et al.and Bakr et al. [14, 33] who reported the same four Culex species from Jazan region. Culex tri- &ree of the Culex species reported in the present study are considered important disease vectors, namely Culex taeniorhynchus, Cx. quinquefasciatus, and Cx. sitiens have also been reported from different parts of Jazan region with tritaeniorhynchus, Cx. quinquefasciatus, and Cx. pipiens. the predominance of Culex tritaeniorhynchus over other Characterizations of dominant mosquito vectors include Culex species [34]. well adaptation to a wide range of climatic conditions and In the present study, the most infested areas by Culex habitats, high anthropophilic propensity, and variable adult mosquitoes in Jazan region were Gizan (2160 specimens), resting behaviour [36]. Sabya (1267), Baish (753), and Aboareesh (429) (Table 1). Mosquito fauna and their distribution in Saudi Arabia &is may be due to the nature of those areas, which are had been widely investigated by many authors. For example, highly populated and relatively flat and permit for the forty-nine mosquito species belonging to seven genera from International Journal of Zoology 5 working with Culex in Saudi Arabia have rarely, if not ever, 1956 to 2017 (18 Anophelines and 31 Culicines) have been listed [37]. used male genitalia diagnostic features to confirm identifi- cation of the two species [37]. Out of the 31 Culicines, 19 species were belonging to the genus Culex Linnaeus (1758): one species under the sub- &is was the reason why we adopted the molecular genus Barraudius Edwards, 1921, Cx. (Barraudius) pusillus; technique, which is known to be highly specific and sensitive one species under subgenus Culiciomyia &eobald, 1907, Cx. for the identification of Culex species complex and their (Culiciomyia) nebulosus; one species under subgenus Ocu- hybrids [42, 43]. In addition, new methods of genomic leomyia &eobald, 1907, Cx. (Oculeomyia) bitaeniorhynchus; (molecular) identification of species, subspecies, races, two species under subgenus Maillotia &eobald, 1907, Cx. biotypes, and forms are more reliable and precise than older morphological identification methods of species complexes (Maillotia) arbieeni and Cx. (Maillotia) salisburiensis; and fourteen species under subgenus Culex Linnaeus, 1758: Cx. [44]. (Culex) decens, Cx. (Culex) duttoni, Cx. (Culex) laticinctus, Cx. (Culex) mattinglyi, Cx. (Culex) mimeticus, Cx. (Culex) 3.1. Culex quinquefasciatus (Figure 2). Larvae of Cx. quin- perexiguus, Cx. (Culex) pipiens, Cx. (Culex) quinquefasciatus, quefasciatus breed in water bodies with a high degree of Cx. (Culex) simpsoni, Cx. (Culex) sinaiticus, Cx. (Culex) organic pollution and close to human habitats. Females are sitiens, Cx. (Culex) theileri, Cx. (Culex) tritaeniorhynchus, nocturnal and enter houses and bite the man in preference to and Cx. (Culex) univittatus. other mammals [45]. Likewise, 7 species of Culex had also been identified in Cx. quinquefasciatus was found breeding all year round Jazan region: (1) Culex pipiens from Gizan City, Alariddah, with peaks during winter in Taif, Jeddah, and Tabuk of Saudi Baish, Ahad Almasarha, Samtah, Eldarab, Haroob, Bani Arabia [46]. In Jazan region, this species was collected from Malik, and Farasan Islands; (2) Culex quinquefasciatus from rocky pits and streams. It was found together with Anopheles Gizan City, Alariddah, Baish, Ahad Almasarha and Farasan arabiensis and Cx. tritaeniorhynchus at the ratio of 1:4: 1:3 Islands; (3) Culex tritaeniorhynchus from Gizan City, [34]. Alariddah, Baish, Ahad almasarha, Samtah, Eldarab, Har- &e species is a primary vector of Wuchereria bancrofti, oob, and Bani Malik; (4) Culex sitiens from Gizan City, vector of avian malaria, western equine encephalomyelitis, Alariddah, Baish, Ahad almasarha, Samtah, Wadi Jazan, and and St. Louis encephalitis. It was implicated as a vector of Farasan Islands; (5) Cx. Sinaiticus; (6) Cx. decens; (7) Cx. dog heartworm [45, 47]. bitaeniorhynchus [33]. Cx. quinquefasciatus and Cx. pipiens, which are the main On the other hand, another 10 species have been vectors of bancroftian filariasis, Wuchereria bancrofti identified from different areas of Jazan region including Cx. worldwide including the Middle East countries, have been tritaeniorhynchus, Cx. laticinctus, Cx. pipiens, Cx. quin- reported from the south-western districts of Saudi Arabia quefasciatus, Cx. sinaiticus, Cx. simpsoni, Cx. torrentium, Cx. [6]. sitiens, Cx. univittatus, and Cx. tigripes [14]. Similarly, seven species were recorded from different parts of Jazan region including Culex tritaeniorhynchus, Cx. 3.2. Culex pipiens (Figure 3). Larvae of Culex pipiens breed in quinquefasciatus, Cx. Sinaiticus, Cx. sitiens, Culex duttoni, various places ranging from highly polluted sewages and Cx. Arbieeni, and Cx. mimeticus [34]. cesspits to clear pools and containers. It breeds in stagnant Cx. (Culex) perexiguus &eobald, 1903, and Cx. pusillus water in shaded or unshaded habitats. Females bite the man (Macquart) have been reported from the region [24, 38]. outdoors and indoors [41]. Consequently, 18 Culex species so far have been reported Cx. pipiens larvae were reported all year round in Taif, from Jazan region, namely: Culex tritaeniorhynchus, Cx. Jeddah, and Tabuk. &e peak was at autumn while high laticinctus, Cx. pipiens, Cx. quinquefasciatus, Cx. sinaiticus, density was in summer when temperature is high [46]. Cx. pipiens is a primary vector of periodic Bancroftian Cx. univittatus, Cx. (Culex) perexiguus, Cx. pusillus, Cx. simpsoni, Cx. torrentium, Cx. sitiens, Cx. decens, Cx. bitae- filariasis. It has been naturally infected with West Nile and Sindbis viruses in Israel, while it was infected with Rift Valley niorhynchus, Cx. theileri, Cx. tigripes, Cx. duttoni, Cx. arbieeni, and Cx. mimeticus [37]. Fever virus and West Nile virus in Egypt [41]. Culex mosquitoes are proven or suspected vectors of W. bancrofti has been identified within foreign workers West Nile, and Rift Valley fever viruses, microfilariae, and a from five South-East Asian countries in Abha, southwest of variety of encephalitis [39, 40]. the Saudi Arabia. Cx. pipiens may act as a potential vector of It has been stated that Cx. quinquefasciatus occurs more Bancroftian filariasis in Saudi Arabia [48]. in the south of the Arabian Peninsula with isolated occurring Culex pipiens complex has occurred in different climatic of Cx. pipiens in the southwestern mountains [41]. and habitat zones, particularly temperate and temperate- Due to the close similarity of Cx. pipiens and Cx. humid regions of the world [44]. It is always difficult and problematic to differentiate quinquefasciatus, many of their occurrences and morpho- logical identifications in Saudi Arabia are problematic, es- morphologically between adults of Cx. quinquefasciatus and Culex pipiens especially females. Nonetheless, taxonomists pecially females [37]. Considerable discrepancies in the larval and adult stages used to differentiate between the two species by wing ve- are exhibited between the two species, and it is difficult to nations where the intersection of the vein subcosta with distinguish them morphologically. Additionally, researchers costa is before the level of furcation of R in the case of Cx. 1+2 6 International Journal of Zoology Costa Subcosta 1+2 1 2 3 5 4 6 7 8 9 10 11 12 13 14 15 Figure 2: Wing of Culex quinquefasciatus showing the intersection of the vein subcosta with costa before the level of furcation of R . 1+2 R Subcosta Costa 1+2 Figure 4: PCR amplified 700bp DNA bands using consensus CPI6 R and Cx. pipiens complex PQIO F primers. Lane 1: 100bp ladder, lanes 2–15 tested samples. (Figure 10(b)), whereas the furcation of R is proximal to 2+3 the furcation of M (Figure 11(b)). 1+2 Figure 3: Wing of Culex pipiens showing the intersection of the Larvae of Cx tritaeinorhynchus are found in many vein subcosta with costa at the level of furcation of R . 1+2 habitats that are sunlit and contain vegetation like the temporary, semi-permanent, and permanent ground water habitats, low-salinity tidal marshes, streams, ground pools, quinquefasciatus (Figure 2), while this intersection is at or and swamps. Females feed primarily on pigs and cattle, but beyond the level of furcation of R in the case of Cx. pipiens 1+2 in their absence will feed on men [27]. It has been reported (Figure 3) [24]. However, this is readily achieved by mo- that larvae of Cx. tritaeniorhynchus preferred aquatic hab- lecular characteristics. itats with wet muddy substrate and low total dissolved salts Molecular identification of both Cx. pipiens (Figures 4 and (TDS). &ose areas are found in eastern Sarwat Mountain 5) and Cx. quinquefasciatus (Figures 6 and 7) confirmed their range near the cities in Ahd almasarha, Eleidabi, Sabya, Al- initial morphological identification. Phylogenetic trees were Ariddah, and Abuareesh [51]. constructed for Cx. pipiens and Cx. quinquefasciatus, and their Cx. tritaeniorhynchus was found in all types of breeding distinctive clustering was compared with their reference’s sites in the Red Sea coastal plain of Jazan region (man-made speciesintheGenBankasshowninFigures5and7.Itisworthy pools, especially turbid ones, rain pools, dams, rock pools, to mention that the molecular characteristics of Cx. pipiens and domestic water tanks). It was also noticed to share when compared with the records of the gene bank showed its breeding sites with Anopheles arabiensis, the main malaria similarity to those of Egypt, Kenya (100%) and very close to vector in the region [23]. those of Iran (99.85%) (Table 3). While the molecular iden- Cx. tritaeinorhynchus is a primary vector of Japanese B tification revealed one species of Cx. quinquefasciatus that is encephalitis in the oriental region [27] and Rift valley virus similar to the Turkish species (100%), and one subspecies of Cx. in Jazan region of Saudi Arabia with a biting preference for pipiens quinquefasciatus (Q primers 500bp) is similar to the Sri humans and sheep [4]. In the present study, the molecular Lankan subspecies (100%) (Table 3). identification of Cx. tritaeniorhynchus using the universal In Baljurashi Province of Saudi Arabia, the results of primer COI (Figure 12), along with the constructed phy- molecular identification of Cx. pipiens using PCR technique logenetic trees and their distinctive clustering, was com- revealed that the Cx. pipiens cf-3 strain was the accurate pared with their reference’s species in the GenBank definition after initial morphological identification of the (Figure 13) and showed that it is quite similar to the species species [49]. Likewise, the molecular characteristics of Cx. of USA, Japan, and China (100% similarity, Table 3). quinquefasciatus samples from Yanbu Province of Saudi Arabia indicated that they were very close to those found in Pakistan, Brazil, and India (GenBank references; 3.4. Culex sitiens (Figure 8(a)). &e main morphological KF406862.1, MK575480.1, MH538709.1, and MH538707.1.) features of the proboscis indicate that the median pale ring is [50]. present, but not extending proximally to the ventral surface as in Cx. tritaeinorhynchus (Figure 9(a)); the fore and 3.3. Culex tritaeniorhynchus (Figure 8(b)). &e main mor- midfemora are speckled (Figure 10(a)). On the other hand, phological features found in Cx. tritaeniorhynchus are the the furcation of R is distal to the furcation of M 2+3 1+2 presence of a median pale ring in the proboscis that extends (Figure 11(a)). proximally to the ventral surface of the proboscis Bionomics of Cx. sitiens showed various breeding (Figure 9(b)), and the fore and midfemora are entirely black habitats including fresh ground water, salt, brackish, and International Journal of Zoology 7 Culex pipiens COI S41 MK713990 Culex pipiens COI S67 MK714012 Culex pipiens COI NAH4 MK300247 Culex pipiens COI FCH8 MK300245 Culex pipiens COI S46 MK713995 Culex pipiens COI stin.cpip contig781 KP293425 Culex pipiens COI boli.cpip contig1851 KP293419 Culex pipiens COX1 Cx pip Port-2169 LC102133 Culex pipiens COI cf-3 JQ958371 Culex pipiens Jazan Culex pipiens COI Col3 MN299023 Culex pipiens COI MK347224 Culex pipiens pipiens pipiens HQ724614 Culex pipiens COI Cx.Pipiens 2013 No5 KJ401311 Culex pipiens COI Mm-128 MK533637 Figure 5: Evolutionary relationship of taxa of Culex pipiens identified in Jazan region using MEGA 5. 6 15 2 3 45 7 8 10 11 12 13 14 1 9 Figure 6: PCR amplified 500bp DNA bands using Cx. quinquefasciatus specific primers. Lane 1:100bp ladder, lane 2: positive control, lane 3: negative control, lane 4: negative sample, lanes 5–15 positive samples. Culex pipiens COI NAH4 MK300247 Culex quinquefasciatus COI S44 MK713993 (2) Culex quinquefasciatus COI S44 MK713993 Culex quinquefasciatus COI NC-216 MN733799 Culex quinquefasciatus COI NC-429 MN733800 Culex quinquefasciatus Jazan Culex pipiens COI Col3 MN299023 Culex quinquefasciatus cox1 92-B103165 47 MG712557 Culex quinquefasciatus cox1 92-B103169 48 MG712558 Culex quinquefasciatus MK575480 95 Culex quinquefasciatus GU188856 Culex quinquefasciatus COI Hydarabad12 FN395201 Culex quinquefasciatus cox1 92-B103132 46 MG712556 Culex quinquefasciatus COI NC-952 MN733801 Culex quinquefasciatus COI BUZOOS-Cq MH538709 100 Culex quinquefasciatus COI MB10499 MF172300 Figure 7: Evolutionary relationship of taxa of Culex quinquefasciatus identified in Jazan region using MEGA 5. 8 International Journal of Zoology Table 3: Similarity of Culex species in Jazan Region related to gene bank references. Culex species Gene bank accession no. Similarity (%) Country KJ012245.1 100 USA Culex tritaeniorhynchus AB738247.1 100 Japan MF179221 100 China MT199095 100 Egypt Culex pipiens MK300250 100 Kenya JQ958371 99.85 Iran Culex quinquefasciatus MK713993.1 100 Turkey Culex pipiens quinquefasciatus (Q primers 500bp) AF089002.1 100 Sri Lanka MN552296 100 Guinea Culex sitiens MK300241 100 Kenya MF179212 100 China (a) (b) Figure 8: Culex sitiens (a) and Culex tritaeniorhynchus (b). (a) (b) Figure 9: Proboscis of Culex sitiens (a) and Culex tritaeniorhynchus (b). artificial containers in coastal, urban, and suburban areas and birds, but will also bite men. It is an implicated vector of Japanese B encephalitis [41]. [41]. It can also be found in almost every stagnant brackish In Jeddah, Saudi Arabia, the density of Cx. sitiens was waters with full sunlight [52]. Females feed primarily on pigs directly related to temperature. Its peak of density is in International Journal of Zoology 9 (a) (b) Figure 10: Fore and midfemora of Cx. sitiens (speckled) (a) and (entirely black) Cx. tritaeniorhynchus (b). R M R M 2+3 1+2 2+3 1+2 (a) (b) Figure 11: Furcation of R of Cx. sitiens (distal to furcation of M ) (a) and (proximal to furcation of M ) Cx. tritaeniorhynchus (b). 2+3 1+2 1+2 1 2 3 4 56 7 8 Figure 12: PCR amplified 745bp DNA bands using COI primers to identify Culex tritaeniorhynchus and Culex sitiens. Lane 1:100bp ladder, lane 2: positive control, lanes 3–7: tested samples, lane 8: negative control. summer, and it is highly abundant in spring, while it breeds species of Guinea and Kenya (100%) and China (100%) throughout the year [46]. (Table 3). Cx. sitiens molecular identification in the present study All mosquito species identified morphologically in this using the universal primer COI (Figure 12), along with the study have also been molecularly identified, assuring ab- constructed phylogenetic trees and their distinctive clus- solute compatibility between taxonomic and molecular tering, when compared with their reference’s species in the identification, confirming that PCR is a complementary tool GenBank (Figure 14) revealed that it is similar to the African for the identification of mosquito species. 10 International Journal of Zoology Culex tritaeniorhynchus COI MF179221 Culex tritaeniorhynchus jazan Culex tritaeniorhynchus COI NIBGE DIP-00292 KF407889 (2) Culex tritaeniorhynchus COI NIBGE DIP-00292 KF407889 Culex tritaeniorhynchus COI 704TOK2011 AB738218 Culex tritaeniorhynchus COI 865YON2005 AB738250 Culex tritaeniorhynchus COI 544IRI2011 AB738194 Culex tritaeniorhynchus COI 420MIY2011 AB738167 Culex tritaeniorhynchus COI 835AMA2011 AB738247 Culex tritaeniorhynchus COI 976ISH2011 AB738269 Culex tritaeniorhynchus COI NIBGE DIP-00321 KF407841 Culex tritaeniorhynchus COI NIBGE DIP-00321 KF407841 (2) Culex tritaeniorhynchus COI MBIM1-A4 KJ012246 Culex tritaeniorhynchus COI MBIM1-A2 KJ012247 Culex tritaeniorhynchus COI MBIM1-A3 KJ012245 Culex tritaeniorhynchus COI MBIM1-A7 KJ012244 Figure 13: Evolutionary relationship of taxa of Culex tritaeniorhynchus identified in Jazan region using MEGA 5. Culex sitiens COI 600OKI2011 AB738201 Culex sitiens COI 606MIY2011 AB738205 54 Culex cf. sitiens MAFP8.E9 COI MAFP8.E9 MN552296 Culex sitiens cox1 92-B102975 51 MG712561 Culex sitiens cox1 92-B102974 50 MG712560 Culex sitiens COI NC-331 MN733803 Culex sitiens COI NC-341 MN733804 Culex sitiens COI MF179212 Culex sitiens COI NC-347 MN733805 Culex sitiens COI NC-926 MN733806 Culex sitiens Jazan Culex sitiens COI NC-324 MN733802 Culex sitiens COI FAH3 MK300241 Culex sitiens COI FA1 MK300239 Culex sitiens COI FCH7 MK300244 Figure 14: Evolutionary relationship of taxa of Culex sitiens identified in Jazan region using MEGA 5. 4. Conclusion Conflicts of Interest In this study, Culex tritaeniorhynchus was the predominant &e authors declare that they have no conflicts of interest. species in Jazan region, followed by Cx. quinquefasciatus, then Cx. sitiens, and Cx. pipiens. &e most infested areas by Culex mosquitoes in the region were Gizan and Sabya. References &e results showed the potentiality of integrating the [1] D. A. Warrell, “Leishmaniasis, malaria and schistosomiasis in morphological and molecular identification to refine the list Saudi Arabia,” Saudi Medical Journal, vol. 14, pp. 203–208, of Culex mosquito species and accurately document their geographical distribution in the Jazan region. &is inte- [2] A. M. Abdoon and A. M. Alshahrani, “Prevalence and dis- gration has the capacity to promote and enhance vector tribution of anopheline mosquitoes in malaria endemic areas surveillance and control programmes, as well as defining the of Asir region, Saudi Arabia,” Eastern Mediterranean Health genetic diversity of species in the region. Journal, vol. 9, no. 3, pp. 240–247, 2003. [3] F. Hawking, 7e Distribution of Human Filariases throughout the World, Mimeograph WHO/FIL/73.114, 1973. Data Availability [4] P. G. Jupp, A. Kemp, A. Grobbelaar et al., “&e 2000 epidemic &e data used in this study are included within the article. of Rift Valley fever in Saudi Arabia: mosquito vector studies,” International Journal of Zoology 11 Medical and Veterinary Entomology, vol. 16, no. 3, pp. 245– mosquito species in Singapore,” Parasites & Vectors, vol. 7, 252, 2002. no. 1, 2014. [5] M. Al-Hazmi, E. A. Ayoola, M. Abdurahman et al., “Epidemic [20] U. Jinbo, T. Kato, and M. Ito, “Current progress in DNA barcoding and future implications for entomology,” Ento- Rift Valley fever in Saudi Arabia: a clinical study of severe illness in humans,” Clinical Infectious Diseases, vol. 36, no. 3, mological Science, vol. 14, no. 2, pp. 107–124, 2011. pp. 245–252, 2003. [21] N. Shahhosseini, M. H. Kayedi, M. M. Sedaghat, T. Racine, [6] K. H. Al Ali, A. A. El-Badry, M. Al Ali, W. S. M. El-Sayed, and G. P. Kobinger, and S. H. Moosa-Kazemi, “DNA barcodes H. A. El-Beshbishy, “Phylogenetic analysis of Aedes aegypti corroborating identification of mosquito species and multi- based on mitochondrial ND4 gene sequences in Almadinah, plex real-time PCR differentiating Culex pipiens complex and Saudi Arabia,” Iranian Journal of Biotechnology, vol. 14, Culex torrentium in Iran,” PloS One, vol.13, no.11, Article ID Article ID e1329, 2016. e0207308, 2018. [7] M. Fakeeh and A. M. Zaki, “Virologic and serologic sur- [22] A. Stephen, M. B. Crabtree, and M. S. Harry, “Polymerase veillance for dengue fever in Jeddah, Saudi Arabia, chain reaction assay identifies culex nigripalpus: part of an 1994–1999,” 7e American Journal of Tropical Medicine and assay for molecular identification of the common culex (culex Hygiene, vol. 65, no. 6, pp. 764–767, 2001. mosquitoes of the eastern United States,” Journal of the [8] N. A. Khan, E. I. Azhar, S. El-Fiky et al., “Clinical profile and American Mosquito Control Association, vol. l9, no. 2, pp. 115–120, 2003. outcome of hospitalized patients during first outbreak of dengue in Makkah, Saudi Arabia,” Acta Tropica, vol. 105, [23] A. A. Alsheikh, “Larval habitat, ecology, seasonal abundance no. 1, pp. 39–44, 2008. and vectorial role in malaria transmission of Anopheles [9] M. Fakeeh and A. M. Zaki, “Dengue in Jeddah, Saudi Arabia, arabiensis in Jazan Region of Saudi Arabia,” Journal of the 1994–2002,” Dengue Bulletin, vol. 27, pp. 13–18, 2003. Egyptian Society of Parasitology, vol. 41, no. 3, pp. 615–634, [10] P. F. Mattingly and K. L. Knight, “&e mosquito of Arabia I,” 2011 Dec. Bulletin of the British Museum (Natural History), vol. 4, no. 3, [24] R. E. Harbach, “Pictorial keys to the genera of mosquitoes, pp. 91–141, 1956. subgenera of Culex and the species of Culex (Culex) occurring [11] M. A. R. Abdullah and A. I. Merdan, “Distribution and in southwestern Asia and Egypt, with a note on the subgeneric ecology of the mosquito fauna in the southwestern Saudi placement of Culex deserticola (Diptera: Culicidae),” Mos- Arabia,” Journal of the Egyptian Society of Parsitology, vol. 25, quito Systematics, vol. 17, pp. 83–107, 1985. no. 3, pp. 815–837, 1995. [25] S. Antunes-de Morais, C. Moratore, L. Suesdek, and [12] B. R. Miller, M. S. Godsey, M. B. Crabtree et al., “Isolation and M. T. Marrelli, “Genetic-morphometric variations in culex quinquefaciatus from Brazil and La Plata, Argentina,” genetic characterization of Rift Valley fever virus from Aedes vexans arabiensis, Kingdom of Saudi Arabia,” Emerging In- Memorias ´ do Instituto Oswaldo Cruz, vol. 105, no. 5, 2010. fectious Diseases, vol. 8, no. 12, pp. 1492–1494, 2002. [26] H. Dengham, S. H. Moosa-Kazemi, J. Sadraei, and [13] A. M. Alahmed, M. A. Al Kuriji, S. M. Kheir, S. A. Alahmedi, H. Soleimani, “&e ecological aspects of Culex pipens (Dip- M. J. Al Hatabbi, and M. A. Al Gashmari, “Mosquito fauna tera: Culicidae) in central Iran,” Journal of Arthropod-Borne (Diptera: Culicidae) and seasonal activity in Makkah Al Diseases, vol. 8, no. 1, pp. 35–42, 2014. Mukarramah Region, Saudi Arabia,” Journal of the Egyptian [27] R. A. Bram, “Contributions to the mosquito fauna of Society of Parasitology, vol. 39, pp. 991–1013, 2009. Southeast Asia—II. &e genus Culex in &ailand (Diptera: [14] A. M. Alahmed, M. A. Al Kuriji, S. M. Kheir, H. M. Al Haqawi, Culicidae),” Contributions of the American Entomological and E. A. A. Sultan, “Mosquito (Diptera: Culicidae) and their Institute, vol. 2, no. 1, pp. 1–296, 1967. seasonal activity in Jazan Region, Saudi Arabia,” Journal of the [28] B. P. Das, “Pictorial key to common species of Culex (Culex) mosquitoes associated with Japanese encephalitis virus in Saudi Society of Agricultural Sciences, vol. 9, pp. 136–138, 2010. India,” in Mosquito Vectors of Japanese Encephalitis Virus [15] A. M. Al Ahmad, M. F. Sallam, M. A. Khuriji, S. M. Kheir, and from Northern India, pp. 25–42, Springer India, New Delhi, S. Azari-Hamidian, “Checklist and pictorial key to fourth- India, 2013. instar larvae of mosquitoes (Diptera: Culicidae) of Saudi [29] U. P. K. Hettiaratchi, D. H. N. Munasingha, Arabia,” Journal of Medical Entomology, vol. 48, no. 4, N. V. Chandrasekharan, E. H. Karunanayake, and pp. 717–737, 2011. N. Jayasekera, “A polymerase chain reaction based method for [16] K. Al-Ghamdi, M. Alikhan, J. Mahyoub, and Z. I. Afifi, the detection of Culex quinquefasciatus (Diptera: Culicidae),” “Studies on identification and population dynamics of Bulletin of Entomological Research, vol. 90, no. 1, pp. 63–68, anopheline mosquitoes from Jeddah Province of Saudi Ara- 2000. bia,” Bioscience Biotechnology Research Communications, [30] O. Folmer, M. Black, W. Hoeh, R. Lutz, and R. Vrijenhoek, vol. 1, pp. 19–24, 2008. “DNA primers for amplification of mitochondrial cyto- [17] L. Delgado-Petrocelli, A. Camardiel, V. H. Aguilar, chrome c oxidase subunit I from diverse metazoan inverte- ´ brates,” Molecular Marine Biology and Biotechnology, vol. 3, N. Martinez, K. Cordova, and S. Ramos, “Geospatial tools for the identification of a malaria corridor in Estado Sucre, a no. 5, pp. 294–299, 1994. Venezuelan north-eastern state,” Geospatial Health, vol. 5, [31] S. F. Altschul, T. L. Madden, A. A. Schaffer ¨ et al., “Gapped no. 2, pp. 169–176, 2011. BLASTand PSI-BLAST: a new generation of protein database [18] M. Amini, A. A. Hanafi-Bojd, A. A. Aghapour, and Search programs,” Nucleic Acids Research, vol. 25, pp. 3389– A. R. Chavshin, “Larval habitats and species diversity of 3402, 1997. mosquitoes (Diptera: Culicidae) in West Azerbaijan Province, [32] A. A. Alsheikh, M. H. Zafer, A. G. Anaami et al., “Potential Northwestern Iran,” BMC Ecology, vol. 20, no. 1, p. 60, 2020. mosquito vectors of arboviral diseases in Jazan Region, Saudi [19] A. Chan, L.-P. Chiang, H. C. Hapuarachchi et al., “DNA Arabia,” Bioscience Biotechnology Research Communications, barcoding: complementing morphological identification of vol. 6, no. 2, pp. 142–149, 2013. 12 International Journal of Zoology [33] R. Bakr, M. Nassar, N. El-Barky, T. Kotb, H. Badrawy, and [47] S. J. Carpenter and W. J. LaCasse, Mosquitoes of North M. Abdeldayem, “Prevalence of mosquitoes in Jazan Province, America (North of Mexico), University of California Press, Saudi Arabia,” Egyptian Academic Journal of Biological Sci- Berkeley, Los Angeles, 1955. [48] M. S. Omar, “A survey of bancroftian filariasis among South ences. A, Entomology, vol. 7, no. 2, pp. 15–27, 2014. [34] E. I. Khater, M. M. Sowilem, M. F. Sallam, and East Asian expatriate workers in Saudi Arabia,” Tropical A. M. Alahmed, “Ecology and habitat characterization of Medicine and International Health, vol. 1, no. 2, pp. 155–160, mosquitoes in Saudi Arabia,” Tropical Biomedicine, vol. 30, 1996. no. 3, pp. 409–427, 2013. [49] T. S. Alghamdi, Study of the Seasonal Fluctuation of Mos- [35] T. A. Al-Azraqi, A. A. El Mekki, and A. A. Mahfouz, quitoes Population with Evaluation of the Effectiveness of the “Seroprevalence of dengue virus infection in Aseer and Jizan Insecticides Used against the Dominant Species in Baljurashi regions, Southwestern Saudi Arabia,” Transactions of 7e Province, Ph.D. &esis, Faculty of Sciences King Abdulaziz Royal Society of Tropical Medicine and Hygiene, vol.107, no. 6, University, Jeddah, Saudi Arabia, 2018. pp. 368–371, 2013. [50] S. T. Alerwi, N. Alkenani, J. A. Mahyoub, A. Alghamdi, [36] M. E. Sinka, Y. Rubio-Palis, S. Manguin et al., “&e dominant S. A. Hanan, Y. Anwar et al., “Molecular identification and Anopheles vectors of human malaria in the Americas: oc- bio-control of Culex quinquefasciatus from Yanbu region,” currence data, distribution maps and bionomic precis,” ´ Journal of Entomology and Zoology Studies, vol. 7, no. 6, pp. 1081–1086, 2019. Parasites Vectors, vol. 3, 2010. [37] A. M. Alahmed, K. Munawar, S. M. S. Khalil, R. E. Harbach, [51] M. F. Sallam, A. M. Al Ahmed, M. S. Abdel-Dayem, and and R. E. Harbach, “Assessment and an updated list of the M. A. R. Abdullah, “Ecological niche modeling and land cover mosquitoes of Saudi Arabia,” Parasites and Vectors, vol. 12, risk areas for rift valley fever vector, Culex tritaeniorhynchus no. 1, p. 356, 2019. giles in jazan, Saudi Arabia,” PLoS One, vol. 8, no. 6, Article ID [38] T. V. Gaffigan, R. C. Wilkerson, J. E. Pecor, J. A. Stoffer, and e65786, 2013. T. Anderson, Systematic Catalog of Culicidae Suitland, Walter [52] S. Prummongkol, C. Panasoponkul, C. Apiwathnasorn, and Reed Biosystematics Unit, Museum Support Center, Smith- U. Lek-Uthai, “Biology of Culex sitiens, a predominant sonian Institution, Suitland, MD, USA, 2019, http://www. mosquito in Phang Nga, &ailand after a tsunami,” Journal of mosquitocatalog.org/. Insect Science, vol. 12, pp. 1–8, 2012. [39] J. T. Michael, “Members of the Culex pipiens complex as vectors of viruses,” Journal of the American Mosquito Control Association, vol. 28, no. 4s, pp. 123–126, 2012. [40] S. R. Irish, H. M. Al-Amin, H. N. Paulin et al., “Molecular xenomonitoring for Wuchereria bancrofti in Culex quin- quefasciatus in two districts in Bangladesh supports trans- mission assessment survey findings,” PLOS Neglected Tropical Diseases, vol. 12, no. 7, Article ID e0006574, 2018. [41] R. E. Harbach, “&e mosquitoes of the subgenus Culex in southwestern Asia and Egypt (Diptera: Culicidae),” Contri- butions of the American Entomological Institute, vol. 24, no. 1, pp. 1–236, 1988. [42] A. Diaz-Badillo, B. G. Bolling, G. Perez-Ramirez et al., “&e distribution of potential West Nile virus vectors, Culex pipiens pipiens and Culex pipiens quinquefasciatus (Diptera: Culi- cidae), in Mexico City,” Parasites and Vectors, vol. 4, no. 1, p. 70, 2011. [43] B. O. Motayo, B. A. Onoja, A. O. Faneye, and J. A. Adeniji, “Seasonal abundance and molecular identification of West Nile virus vectors, Culex pipens and Culex quinquefasciatus (diptera: culicidae) in Abeokuta, South-West, Nigeria,” Af- rican Health Sciences, vol. 16, no. 1, pp. 135–140, 2016. [44] M. H. Kayedi, F. Sepahvand, E. Mostafavi et al., “Morpho- logical and molecular identification of Culicidae mosquitoes (Diptera: Culicidae) in Lorestan province, Western Iran,” Heliyon, vol. 6, no. 8, Article ID e04480, 2020. [45] S. Sirivanakarn, “Medical entomology studies-III. A revision of the subgenus Culex in the Oriental region (Diptera: Culicidae),” Contributions of the American Entomological Institute, vol. 12, no. 2, pp. 1–272, 1976. [46] M. I. Hassan, H. A. Al Ashry, M. Shobrak, and M. A. Kenawy, “Seasonal abundance of the common mosquitoes: Culex pipiens, Cx. quinquefasciatus and Cx. sitiens (Diptera: Culi- cidae) in the western coast of Saudi Arabia,” Egyptian Aca- demic Journal of Biological Sciences E Medical Entomology and Parasitology, vol. 8, no. 1, pp. 13–22, 2016.

Journal

International Journal of ZoologyHindawi Publishing Corporation

Published: Jul 8, 2021

References