Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Cryptic Diversity in the Neotropical Gecko Genus Phyllopezus Peters, 1878 (Reptilia: Squamata: Phyllodactylidae): A New Species from Paraguay

Cryptic Diversity in the Neotropical Gecko Genus Phyllopezus Peters, 1878 (Reptilia: Squamata:... Hindawi International Journal of Zoology Volume 2018, Article ID 3958327, 14 pages https://doi.org/10.1155/2018/3958327 Research Article Cryptic Diversity in the Neotropical Gecko Genus Phyllopezus Peters, 1878 (Reptilia: Squamata: Phyllodactylidae): A New Species from Paraguay 1,2,3 1 4,5 1,2 Pier Cacciali , Sebastian Lotzkat, Tony Gamble, and Gunther Köhler Senckenberg Forschungsinstitut und Naturmuseum Frankfurt, Senckenberganlage 25, 60325 Frankfurt a.M., Germany Johann Wolfgang Goethe University, Institute for Ecology, Evolution & Diversity, Biologicum, Building C, Max-von-Laue-Straße 13, 60438 Frankfurt am Main, Germany Instituto de Investigacion ´ Biolo´gicadel Paraguay,Del Escudo 1607,1425Asuncio´n, Paraguay Department of Biological Sciences, Marquette University, Milwaukee, WI 53201, USA BellMuseum of NaturalHistory,UniversityofMinnesota,St. Paul,MN55108,USA Correspondence should be addressed to Pier Cacciali; pier cacciali@yahoo.com Received 28 January 2018; Accepted 6 June 2018; Published 16 July 2018 Academic Editor: Hynek Burda Copyright © 2018 Pier Cacciali et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The gecko genus Phyllopezus is distributed mainly along South America’s “Dry Diagonal” (Caatinga, Cerrado, and Chaco). The genus has been the subject of recent taxonomic analyses and includes four described species and seven candidate species referred to here as Phyllopezus pollicaris sensu lato. In Paraguay, Phyllopezus is known from the Chaco and Cerrado where it is abundant, andalsofromasmallisolatedpopulation from arockyhillformationnamed “CordilleradeLosAltos” (Los Altosmountainrange). Here we analyzed genetic samples from across its range, including new samples from Paraguay, using DNA barcoding analysis of the mitochondrial 16S gene and phylogenetic analyses using both Bayesian and Maximum Likelihood methods. We found genetic and morphological differences among geckos from the Los Altos mountain range and the remaining Phyllopezus populations. Using both molecular and morphological evidence we describe a new Phyllopezus species, sister to P. przewalskii. Genetic differentiation among described and putative Phyllopezus species is greater than their morphological differences, which likely accounts for these cryptic taxa remaining undescribed for so long. 1. Introduction phylogenetic lineages of reptiles in the Neotropics [9, 19]. A good example of this undescribed diversity involves lizards In South America, the so-called “Dry Diagonal” of dry of the genus Phyllopezus distributed mainly along the “Dry seasonal woodland formations stretches from eastern Brazil Diagonal” [10, 11]. to northern Argentina and includes the Caatinga, Cerrado, Phyllopezus is a genus of Neotropical geckos, which for andChacoecoregions.Theoriginofthese biomesandthe decades was considered as monotypic with two subspecies: evolution of their faunas have evoked much interest during P. pollicaris pollicaris (Spix, 1825) and P. p. przewalskii the past decades [1–4] and are still a significant topic for Koslowsky, 1895 [20, 21]. Later, P. periosus Rodrigues, 1986 understanding the evolution of the Neotropical biota [5–8]. was described from northeastern Brazil [22], and more As important as these “Dry Diagonal” ecoregions are, they recently P. maranjonensis Koch, Venegas & Bohme ¨ , 2006 remain poorly known with new species being described at from Peru [23]. Furthermore, a detailed phylogenetic study, an increasing rate [9–11]. Molecular data are now oen ft used based on a multilocus genetic approach, showed a deep for species identification [12–14] and species delimitation [15– phylogenetic nesting of Bogertia lutzae within Phyllopezus 18] helping taxonomists to improve the global knowledge of and accordingly placed that species in the genus Phyllopezus alpha taxonomy. This led to the recognition of many cryptic to reestablish monophyly [10]. 2 International Journal of Zoology Figure 1: Distribution of the genus Phyllopezus according to Koch et al. [23] and Werneck et al. [11] indicating collection localities of our specimens. Red oval: Tobat´ı (in Los Altos mountain range). Square: Estancia La Amistad. Triangle: Parque Nacional Cerro Cora. ´ Phyllopezus are among the largest geckos in South Amer- eTh distribution of Phyllopezus pollicaris sensu lato and icaand theyhave apattern ofblackorbrownspotsongray P. przewalskii includes the “Dry Diagonal” [11], Chaco, Cer- or also whitish background color with a high intraspecific rado, and Caatinga, as well as another biome recognized as variation. Based on genetic analyses of Phyllopezus specimens “Seasonally Dry Tropical Forest” [24]. In the last phylogenetic (referred to as P. pollicaris) from the Chaco, Cerrado, and study of the genus, three major genetic lineages of Phyllopezus Caatinga ecoregions, a previous study found a high degree pollicaris sensu lato were recognized [11]: a northeastern of genetic diversity in Cerrado and Caatinga (northeastern group from the Caatinga, a central clade from the Cerrado, populations) specimens [10], followed by another study that and a southwestern group whose distribution matches that of proposed species status for P. przewalskii and designated the Chaco sensu lato (Dry Chaco + Humid Chaco) (Figure 1). seven additional taxa (within P. pollicaris sensu lato) as In Paraguay P. przewalskii is known from the Chaco [25, 26], candidate species, thus, recognizing eleven tentative species- where the species is a common ground dweller but also level units within this genus [11]. inhabits human dwellings. Phyllopezus is also present in the International Journal of Zoology 3 Paraguayan Cerrado [25, 26], where it occurs in rocky hills. applications, the formats of the sequences were converted Furthermore, there is another isolated population inhabiting using the online server Alter [35]. The best substitution a rocky hill formation named “Cordillera de Los Altos” model for each gene (analyzed separately) of our dataset was (Los Altos mountain range) in the Departments of Paraguarı identified using PartitionFinder2 [36], with linked branch [27] and Cordillera [26], with an environment completely lengths (supported by most of the phylogenetic programs) via different to that of the Paraguayan Chaco or Cerrado (details PhyML 3.0 analysis [37]. Model selection was detected using of environments presented in Appendix S1). Populations thecorrected (forfinitesamplesize) AkaikeInformation from “Cordillera de Los Altos” and Paraguayan Cerrado have Criterion (AICc) [38]. Given the correlation between gamma not been included in previous genetic analyses. (+G) and invariant sites (+I) parameters, models that include In this work we rfi st explored the genetic distinctiveness both +G and +I are oen ft inadequate [39–41]. us, Th we did of Phyllopezus specimens from the “Cordillera de Los Altos” not use models that included both parameters together. In and the Paraguayan Cerrado within the framework of a all analyses, we used the Phyllodactylus unctus mitogenome project about barcoding of Paraguayan herpetofauna using (GenBank HQ896027) as an outgroup [42]. the mitochondrial 16S rRNA gene. Genetic data indicates Allofthefollowinganalyseswereconductedforeachgene that Phyllopezus from “Cordillera de Los Altos” constitute a individually, and the three genes concatenated. Sequences genetic lineage differentiated from the remaining Paraguayan were concatenated in Mega 7.0.26 [43]. We performed populations. Next, we incorporated additional mitochondrial Bayesian Inference analysis (BI) with MrBayes 3.2 [44, 45]. genes (Cytb and ND2) to our analyses in order to assess BI analyses were performed setting 5 runs with 8 chains dis- phylogenetic relationships of Phyllopezus from “Cordillera de carding the first 25% as the burn-in period and an initial set of Los Altos” with previously published congeneric data (cluster 1,000,000 generations for MCMC with a sampling frequency arrangement according to Werneck et al. [11]). of 500 generations, adding 500,000 generations until chains reached convergence. We considered convergence when the standard deviation of split frequencies was 0.015 or less. 2. Materials and Methods Additionally, convergence was diagnosed by PRSF (Potential We sampled Phyllopezus from three localities of Paraguay Scale Reduction Factor) which should approach 1.0 as runs (Figure 1) and sequenced fragments of the mitochondrial converge [46]. 16S rRNA gene (GenBank accession numbers provided in We used the IQTree webserver [47] to run a Maximum Likelihood (ML) analysis using 10,000 ultrafast Bootstrap Appendix S2) for comparison with sequences produced by Gamble et al. [10]. DNA was extracted from muscle stored approximation (UFBoot) replicates with 10,000 maximum in ethanol 98% at -27 C using the standard glass bfi er plate iterations and minimum correlation coefficient of 0.99 [48] protocol of Ivanova et al. [28]. Samples were washed for plus 10,000 replicates of Shimodaira-Hasegawa approximate about14hin50𝜇lofdilutedPBSbueff r(1:9of bueff rand likelihood ratio (SH-aLRT), which proved to be accurate with water, respectively). Tissues were digested with vertebrate a high statistical power [37]. We used FigTree 1.3.1 for tree lysis buffer (60 𝜇l per sample) and proteinase K (6 𝜇lper viewing (http://tree.bio.ed.ac.uk/software/figtree/). sample) at 56 C for around 14 h. After extraction, DNA We estimated evolutionary genetic divergence for the 16S gene among sequences, computing uncorrected pairwise samples were eluted in 50𝜇LTEbueff r.Amplicfi ationvia double-stranded PCR of mitochondrial 16S rRNA fragments distances with Mega 7.0.26 to assess the degree of intra- was performed using the Eurofins MWG Operon prim- and interspecific differences, using a Bootstrap estimation method of 10,000 replications. Data were compared with ers 16sar-L (forward: 5’–CGCCTGTTTATCAAAAACAT–3’, also referred to as L2510) and 16sbr-H (reverse: 5’– those available from Gamble et al. [10]. CCGGTCTGAACTCAGATCACGT–3’, also referred to as To assess the phylogenetic position of the “Cordillera de H3056) [29], in an Eppendorf Mastercycler pro. eTh PCR Los Altos” clade within Phyllopezus, we designed a species conditions were as follows: initial denaturation 2 min (94 C), treebasedonthethreemtDNAgene sequencesconcatenated, ∘ ∘ denaturation 35 sec (94 C)×40, hybridization 35 sec (48.5 C), using ∗BEAST [49] in BEAST 2.4.7 [50] under 1,000,000 ∘ ∘ elongation 60 sec (72 C), and n fi al elongation 10 min (72 C). generations for the mcmc model, visualizing the posterior Cycle-sequencing and sequencing (BigDye Terminator) probability in DensiTree 2.2.6 [51]. We performed an initial species delimitation analysis were performed with the same forward and reverse primers mentioned above. Partial sequences of mtDNA from cyto- by visualizing barcode gaps in the pairwise distribution of chrome b (Cytb) and NADH dehydrogenase subunit 2 (ND2) each mtDNA gene separately (excluding the outgroup), using the automatic barcode gap discovery (ABGD) approach [52] genes were amplified according to the procedures presented in Werneck et al. [11]. Inspection of DNA chromatograms through its webserver (http://wwwabi.snv.jussieu.fr/public/ and generation of consensus sequences were performed with abgd/abgdweb.html), setting the use of Simple Distance, SeqTrace 0.9.0 [30]. default values for Prior Intraspecific divergence, except for Sequences were aligned using MAFFT 7 [31, 32] through relative gap width (1.5) which does not work for some genes (as also noted by Kekkonen et al. [53]). Because high values the webserver (available at http://ma.cb fft rc.jp/alignment/ server/). We included the Q-INS-i search strategy for the in relative gap width tend to overly split species [54], we also secondary structure of 16S [33]. Results of alignment were used an intermediate value of 0.7. In addition to the molecular genetics, we measured the visualized and exported with MSA Viewer [34]. According to the respective requirements of the different software following morphological characters: snout–vent length (SVL) 4 International Journal of Zoology from the tip of the snout to the anterior edge of the cloaca; the remaining species within the genus. eTh Bayesian analysis head length (HL) from the tip of the snout to the anterior (Figures 2, S8) generally showed higher support values than edge of the ear opening; head width (HW) measured at the ML (Figure S9). eTh branches corresponding to P. pollicaris widest section of the head; nares–eye distance (NED) taken Clade I and P. pollicaris Clade II are clustered together. An from the posterior border of the nares to the anterior edge of important polyphyly is observed in P. pollicaris Clade III the eye; eye diameter (ED) measured at the widest section of which appears as the sister clade to P. pollicaris Clade IV + the eye; maximum diameter of the ear opening (EO) taken at P. przewalskii,andonesampleislocated asthesistergroup the widest point of the opening; minimum distance between to the cluster P. pollicaris CladeVI+ P. pollicaris Clade VII nares (DBN) measured from above; and tail diameter (TD) + P. pollicaris Clade VIII (Figure 2). Both hypotheses (BI taken at the base of the organ just posterior to the cloaca. and ML) suggest a branch with the southwestern taxa (Los Measurements were taken with digital calipers except SVL, Altos population + P. przewalskii + Phyllopezus pollicaris which was taken with a meter stick. Meristic characters Clade IV) differentiated from the remaining P. pollicaris included the number of supralabials (SL) from the first scale clades. eTh P. przewalskii clade shows specimens from the behind the rostral scale to the last in contact with the mouth Cerrado and from the Chaco separately; and specimens from border; upper supralabial row (USL) from the first in contact “Cordillera de Los Altos” mountain range are recovered withposteriornasal andfirstSLtothe last scalebefore as a sister clade to P. przewalskii.Thefinalalignment and SL contact suboculars, infralabials (IL) from the first scale trees (along with methods and parameters) are stored in contacting the mental to the last in contact with the mouth TreeBASE (ID N 22091) available at https://treebase.org/ th th treebase-web/home.html. and5 digital pads from the border, and scales between4 th The highest intraclade pairwise distance reaches 6.65% first lateral scale of the 5 toe (the distalmost lateral n fi ger in Phyllopezus pollicaris Clade VII and 4.4% in P. przewalskii scale that is not situated on the raised portion of the terminal th (Appendix S3). eTh minimum pairwise distance between two phalanx) to the rfi st lateral scale of the 4 toe (Figure S1). clades usually is higher than 10% with the exception of the When variation in the bilateral symmetry of morphological minimum distances between P. pollicaris Clade IV and P. characters is present, a slash mark separates the respective przewalskii (9.9%), as well as between P. pollicaris Clade VIII values for left/right side. Measurements were always taken with P. przewalskii (10.4%), P. pollicaris Clade VI (8.2%), and by thesameperson(PC).In thecolordescriptions, the Clade VII (7.1%), respectively (Appendix S3). capitalized colors and the color codes (in parentheses) are Samples from Los Altos mountain range present high those of Koh ¨ ler [55]. Specimens used for morphological values for pairwise genetic distance, reaching a genetic comparison are listed in the Appendix. distance of 16.8% with P. periosus (Appendix S3). eTh smallest We also explored the value of diagnostic characters tra- genetic distance of the Los Altos mountain range population ditionally used to differentiate between Phyllopezus pollicaris is 11.8% with P. pollicaris Clade IV (Appendix S3). Genetic and P. przewalskii [20], which are postcloacal tubercles at the distances between the Los Altos population and its sister sides of the vent; number of lamellae under the fourth toe; clade, P. przewalskii, is 12.6–14.4%. and number of longitudinal rows of ventral scales (counted The species tree shows P. periosus, P. maranjonensis and transversally at midbody). To do this, we compared samples P. lutzae clustered together and sister to the remaining from Paraguayan Chaco and Cerrado (which belong to Phyllopezus (Figure 3). The highest support is observed in the P. przewalskii) with topotypes of P. pollicaris. Institutional clusters P. pollicaris Clade I + P. pollicaris Clade II, P. pollicaris acronyms follow Sabaj Per ´ ez [56]. CladeVI+ P. pollicaris Clade VII + P. pollicaris Clade VIII, The Secretar ıa del Ambiente in Paraguay authorized and P. przewalskii + Phyllopezus sp. (Figure 3). euthanizing and collecting specimens, through the permits ∘ ∘ ∘ Results from ABGD suggest the presence of a higher SEAM N 04/11, SEAM N 009/2014, and SEAM N 133/2015. diversity within Phyllopezus than currently recognized (Figure 4). The gene 16S seems to be the most conservative recognizing 11 different species (Clades II and III not included 3. Results given the lack of samples), while ND2 recognized 15 species, The final alignments of 16S, Cytb, and ND2 were of 498, and 18 species were recognized by Cytb (Figure 4). Full results 907, and 886 nucleotide positions, respectively, for 64 Phyl- of ABGD are found in Appendix S4. eTh mitochondrial lopezus samples plus Phyllodactylus unctus as an outgroup Cytb gene suggests a higher diversity especially in Clade VII. (Appendix S2). Partition schemes were recorded as follows: This gene, as well as ND2, distinguishes the sample MTR st nd rd 13452 (P. pollicaris Clade III) as a species separated from the 16S (GTR+G); Cytb (1 pos HKY+I|2 pos K81UF+I|3 pos GTR+I); ND2 (GTR+I| HKY+G| TIM+I). remaining Clade III. Finally, the three genes are concordant The trees obtained through BI and ML showed a high in the recognition of the samples from “Cordillera de Los degree of concordance at well-supported nodes, with some Altos” as a different taxon (Figure 4, Appendix S4). differences in branch arrangement at poorly supported nodes (Figures S2–S7). eTh clade from “Cordillera de Los Altos” 4. Taxonomic Implications always clustered as the sister taxon of P. przewalskii (Figures S2–S7). Based on the concatenated genes, P. maranjonensis eTh specimens from “Cordillera de Los Altos” mountain was the sister taxon to the remaining Phyllopezus taxa, range exhibit a high genetic differentiation from all other followed by P. lutzae,and P. periosus as the sister clade to studied populations of Phyllopezus. Moreover, the specimens International Journal of Zoology 5 Figure 2: Bayesian tree obtained from concatenated mitochondrial genes (16S, Cytb, and ND2) of the gecko genus Phyllopezus. Numbered clades of P. pollicaris represent the groups recognized by Werneck et al. [11]. Most of clades (with the exception of P. przewalskii)are collapsed. For details on specimens’ allocation see Figure S8. In red, there is a clade that appears to be polyphyletic. Samples from Dry Chaco are shown in a brown box, those from Cerrado are shown in a yellow box, and in a green box are specimens from “Cordillera de los Altos.” Only PP values higher than 0.9 are shown. Outgroup: Phyllodactylus unctus. from “Cordillera de Los Altos” are recovered as a clade Zoological Nomenclature. eTh Life Science Identifier (LSID) phylogenetically distinct from the other clades. Finally, the for this publication is as follows: urn:lsid:zoobank.org:pub: population from “Cordillera de Los Altos” can be differenti- 1AE503A1-8CE0-460F-B29C-90B722DF905D. The LSID reg- ated from the other species of this genus by subtle characters istrationand anyassociatedinformation canbeviewedina of coloration and scalation. eTh refore, applying the general web browser by adding the LSID to the prefix “http://zoobank lineage species concept [57], we recognize the Phyllopezus .org/.” population from the “Cordillera de Los Altos” as a separate species, described below. Phyllopezus heuteri sp. nov. This published work and the nomenclatural acts it con- Holotype. SMF 100494 (original eld fi number GK 3559), tains have been registered in Zoobank: urn:lsid:zoobank.org: act:9E9B8965-B517-49A0-84D9-F7BC57A85E33, and there- adult female (Figure 5), collected on 12 September 2016 by ∘ ∘ fore they are available under the International Code of G. Koh ¨ ler, at the Cerro de Tobat´ı(25.2797 S, 57.0925 W, 6 International Journal of Zoology Figure 3: Species tree inferred with ∗BEAST showing density of trees proportional to frequency of occurrence (thin lines) drawn in DensiTree and the consensus tree (blue lines) with the posterior probability for each node. 428 masl), in the Cordillera de Los Altos mountain range, of color pattern (versus well defined transversal bands in P. Cordillera Department, Paraguay (Figure 6). periosus), by spiny scales surrounding the ear opening (versus cycloid scales) (Figure S12), and by the contact between the Paratypes. MVZ 110967 (unidentified sex), collected on 7 two greatly enlarged postmentals (versus enlarged lateral October1972byPhilMyers,at1mi SofTobat´ı, Cordillera, postmentals separated by small median postmentals) (Figure Paraguay; UNNEC 1005 (unidentified sex), collected on 3 S13). Phyllopezus heuteri is distinguished from P. pollicaris by March1998byM.Culzzoni andB. Alvarez, at Chololo´ the presence of two to three larger scales (tubercle-shaped) at ∘ ∘ (25.55138 S, 57.0400 W, 272 masl), Paraguar´ı, Paraguay; the mouth commissure (versus small homogeneous scales at MNHNP 11975 (adult male), collected on November 2014 by the mouth commissure in P. pollicaris),lateralbodytubercles J. Mende ´ z, at Cerro de Tobat´ı, Cordillera, Paraguay; MNHNP reaching further downwards (lowermost tubercle at 6–8 12001(adultmale),collectedon23 April2013byJ.Mende ´ z, at lateral scales from ventrals versus 13–15), and presence of Cerro de Tobat´ı, Cordillera, Paraguay; MNHNP 12111 (adult more tubercles (five to eight) between eye and ear opening female) and MNHNP 12112 (adult male), collected on 27 (versus up to three) (Figure S14). Phyllopezus heuteri can be January 2012 by J. Mende ´ z, S. Escobar and T. Lop ´ ez, at Cerro distinguished from P. przewalskii by thepresenceoftubercles ∘ ∘ Hu( ˜ 25.6069 S, 57.1294 W, 365 masl), Paraguar´ı, Paraguay; on the prescapular region and sides of the neck (versus SMF 100696 (adult female) collected on 16 April 2016 by P. homogeneous scalation in P. przewalskii)(Figure S15),the th th Cacciali, F. Bauer and J. Mende ´ z, at Cerro de Tobat´ı(25.2854 presence of 36 to 39 scales between4 and5 toes (versus S, 57.0934 W, 157 masl), Cordillera, Paraguay. 33 to 36), and its large postmentals usually contacting only st nd the rst fi IL (versus contacting usually 1 and2 IL). Diagnosis. A medium-sized species of Phyllopezus with a color pattern consisting of irregular transversal bands or Description of the Holotype. SVL 74 mm, tail incomplete, HL reticulations of dark colors on a grayish background, and 19.1 mm, HW 14.1, NED 6.9 mm, ED 4.6 mm, EO 1.6 mm, large tubercles irregularly disposed on the body. Morpho- DBN 2.4 mm, and TD 7.5 mm; rostral wide, with a median logically P. heuteri canbedieff rentiated from P. lutzae by groove at the upper side of the scale; nares surrounded the irregular reticulated or banded coloration (versus dotted by rostral, nasorostral, supranasal, postnasal, and rfi st SL; pattern in P. lutzae) and by the presence of tubercles on SL: 10/11; USL: 15/13; upper surface of the muzzle with a thebody(versus absent)(FigureS10). Phyllopezus heuteri shallow median depression; lateral and upper surfaces of the is distinguished from P. maranjonensis by the smaller size head covered with granular juxtaposed scales, with scattered tubercles on the upper surface starting at the level of the (max. SVL 88 mm versus 115 mm in P. maranjonensis)and posterior edge of the eye; supraocular scales spine-shaped presence of tubercles on the lateral surfaces of the body as well posterior to the level of the center of the eye; IL: 9/10; mental as betweeneyesand earopening (versusabsentfromthese bell-shaped with the narrower part posteriorly; two greatly regions) (Figure S11) and spiny scales surrounding the ear enlarged postmentals contacting each other, the mental, the opening (versus cycloids) (Figure S12). Phyllopezus heuteri is first IL, and a small portion of the second IL; postmentals differentiated from P. periosus by irregularly shaped elements International Journal of Zoology 7 Figure 4: Results of ABGD analysis for each gene. Colors represent groups identified by ABGD for each gene, with group numbers presented at the right. As seen, not all samples were available for all genes. Group colors do not represent the same grouping among genes, except for samples from “Cordillera de Los Altos” which are identified with a cream colored box with a red central dot. Base phylogeny (at the left) is the same as for Figure 2. followed by a row of vfi e smaller scales; scales under the single slightly developed postcloacal tubercle on each side; head gradually reducing in size posteriorly; dorsal and lateral tail with imbricate, cycloid scales that are smaller on the partsoftheneckcoveredwithgranularjuxtaposedscaleswith dorsal and larger on the lateral surfaces, and an enlarged irregular rows of tubercles; throat region with juxtaposed median subcaudal row of scales covering most of the ventral and cycloid homogeneous scales; dorsum of the body with surface. granular scales and tubercles approximately 2.5 times the Coloration in Life. (Figure 7) dorsal ground color of body size of the surrounding granular scales, disposed in 8 or Pale Neutral Gray (296), with irregular transversal bands 9 irregular rows on each side reaching onto flanks; ventral scales cycloid and imbricate, arranged in 32 longitudinal grading from Brownish Olive (292) into Raw Umber (280), rows at midbody; limbs covered with granular juxtaposed bordered posteriorly by Cream White (52) and interrupted scales, except on the dorsal surface of the upper arms by a Beige (254) vertebral stripe. Lateral surfaces of the and thighs that present slightly imbricated scales; forelimbs body Pale Neutral Gray (296) with scattered Raw Umber more slender than hind limbs; infradigital lamellae of hands (280) speckling. Venter Cream White (52). Dorsal and lateral starting from pollex were recorded as follows: 5/6 - 10/9 - surfaces of the head Smoke Gray (267) with Cream White 10/11 - 10/10 - 9/8; infradigital lamellae of feet starting from (52) and Raw Umber (280) speckles more concentrated on the hallux were recorded as follow: 6/5 - 10/9 - 11/11 - 10/12 occipital area. Ventral surface of the head Cream White (52) - 8/9; claws enclosed by a sheath of six rows of scales; a with Hair Brown (227) stipples concentrated in the infralabial 8 International Journal of Zoology arms and Jet Black (300) on legs, and immaculate Smoky White(261) ontheventral surface. Ground colorofthetail (only original portion of the tail described) Pale Gray (262) with irregular dorsal (transverse) diffused Smoke Gray (266) bands reaching onto flanks grading into Vandyke Brown (282) posteriorly followed by Smoky White (261) halo. Ventral surface of the tail Smoky White (261) with lateral suffusions of Smoke Gray (207). Variation among the Paratypes. SVL ranging from 60 to 73 mm in males and 77 to 88 mm in females (mean SVL 72.8 mm for both sexes combined); None of the tails of our examined specimens is complete and original (being either regenerated or broken and incomplete); HL 16.5–21.8 mm (25.6–27.5 % of SVL in males and 24.4–25.8 % in females); HW 12.2–18.6 mm (0.65–0.82 proportion HW/HL in males and 0.73–0.85 in females); NED 6.1–8.3 mm; ED 3.8-5.0 mm (0.60–0.64 proportion ED/NED in males, and 0.59–0.66 in females); EO 1.6–2.0 mm (9.5–10.9 % of HL in males and 8.2–10.6 % in females); DBN 2.0–2.8 mm (14.5–18.8 % of HW in males and 14.2–17.0 % in females); TD 7.2–8.5 mm (11.6–12.0 % of SVL) in males, and 7.8–10.6 mm (10.1–12.0 % of SVL) in females; rostral scale always of a similar shape, but the median groove can extend more than half of the scale downwards; SL 9 or 10; USL from 10 to 15; IL 8 or 9; postmentals contacting only the first IL in all specimens except the holotype; one specimen (MNHNP 12001) with three large postmentals; 27 to 33 longitudinal rows of ventral scales at midbody; infradigital lamellar variation for hands and feet is presented in Table 1; postcloacal tubercles vary from two to three per side. The most remarkable aspects of variation in color pattern arevisibleonthedorsum. el Th argestexaminedspecimen Figure 5: Dorsal (above), lateral (middle), and ventral (below) views (MNHNP 12111) has no pattern other than the vertebral stripe oftheholotype(SMF100494)of Phyllopezus heuteri.Scale bars =10 present in all specimens. The remaining specimens show a mm. patterncomposedofbandssimilartothatoftheholotype, but the bands are formed by a mottling in MNHNP 11975, and two specimens exhibit only very diffuse bands. One specimen (MNHNP 12001) has a paler ground color, and another (SMF area. Limbs Pale Neutral Gray (296) with reticula of Raw 100696) exhibits a darker ground color. Umber (280) dorsally, and immaculate Cream White (52) ventrally. Groundcolorofthe tail(onlyoriginalportion Distribution. Phyllopezus heuteri is known from rocky out- of the tail described) Pale Gray (262) with irregular dorsal crops at three localities along the “Cordillera de Los (transverse) bands reaching onto flanks that are Light Drab Altos” formation (Figure 6) in the Paraguayan departments (269) grading into Raw Umber (280) posteriorly followed by Cordillera and Paraguar´ı, at 268–428 m above sea level. Smoky White (261) halo. Ventral surface of the tail Pale Horn Color (11). Natural History. Given the scarcity of records this gecko is not well known. It appears to be a nocturnal species Coloration in Preservative. (After vfi e years in ethanol 70%) foundonsandstone rockyhills.Itseeksshelterincaves dorsal ground color Medium Neutral Gray (298), with or cracks in the rocks. Its coloration is mimetic with the irregular transversal bands Vandyke Brown (282), posteriorly bordered by Lavender (202); interrupted by a Pale Mauve lichens and mosses that cover the rocks’ surfaces. eTh area (204) vertebral stripe. Lateral surfaces of the body Medium where Phyllopezus heuteri is present has a marked seasonality regarding rainfall and temperature (dry and cold season from Neutral Gray (298) with scattered Dusky Brown (285) speck- les. Venter Smoky White (261). Dorsal and lateral surfaces May to September) with an annual precipitation of about 1200 to 1300 mm. eTh vegetation associated with the rocky of the head Smoke Gray (267) with Pale Buff (1) and Raw environment is composed of thorny or thick plants such as Umber (280) speckles. Ventral surface of the head Smoky White (261) with Fawn Color (258) stipples concentrated Polycarpaea hassleriana, Cereus sp., and Bromelia sp. Nothing is known about its feeding or reproductive habits, or any other in the infralabials. Limbs Light Neutral Gray (297) with reticulum of Brownish Olive (292) on the dorsal side of aspects of its behavior. International Journal of Zoology 9 Table 1: Morphological variation among Phyllopezus heuteri, P. pollicaris,and P. przewalskii. Hands Feet 12 3 4 5 1 2 3 4 5 Vent Ppol 6–7 10–12 11 9–11 9–10 6–7 10–11 11–12 9–12 10–11 28–30 Pprz 5–6 8–9 9–11 9–11 8–9 5–6 8–10 10–12 10–11 8–10 24–33 Pheu 3–6 7–10 9–11 9–11 7–9 5–6 9–10 10–12 9–11 8–9 27–33 Infradigital lamellar variation (including holotype) of Phyllopezus heuteri (Pheu) and the most closely related species, P. pollicaris (Ppol) and P. przewalskii th th (Pprz). Variation is presented from the pollex (1) to the5 finger of the hands and from the hallux (1) to the 5 toe of the feet. Also presented is the range of longitudinal rows of ventral scales (Vent). Figure 6: Known records of Phyllopezus heuteri showing the type locality (black star) and additional localities (red dots). Capitalized names refer to Paraguayan Departments. Etymology. eTh specific name is a patronym for biologist Dr. Horst Heuter from Berlin, Germany, in recognition of the n fi ancial support of taxonomic research provided by Dr. Heuter through the BIOPAT initiative. 5. Discussion The fact that Phyllopezus przewalskii was long considered as asubspeciesof P. pollicaris canbeattributedtothelarge overlaps in all proposed diagnostic characters: number of lamellae under the fourth toe (9 to 13 in P. pollicaris,and 8to11in P. przewalskii), ventral scales at midbody (28 to 32 in P. pollicaris, and 26 to 29 in P. przewalskii), and postcloacal tubercles at the sides of the vent (always present in P. pollicaris, not always present in adults of P. przewalskii) Figure 7: Coloration in life of the holotype (SMF 100949) of [20, 21]. According to Werneck et al. [11] none of the P. Phyllopezus heuteri. 10 International Journal of Zoology Figure 8: Candidate species present in the Brazilian State of Bahia (type locality for P. pollicaris), considering current and old borders. pollicaris clades reaches Paraguay where only P. przewalskii is of the Phyllopezus clades of Werneck et al. ([11]: last page present, but the “diagnostic” characters of Paraguayan spec- of Supporting Information file) four candidate species are imens show a variation beyond those established for either present in the Brazilian State of Bahia: Phyllopezus pollicaris P. pollicaris or P. przewalskii (Table 1). Werneck et al. [11] clades I, III, VI, and VIII. Even though Bahia was much provided evidence that the genus Phyllopezus is composed of smaller at the time when the type specimen was collected, multiple cryptic lineages, several of which are not formally still three clades remain as possible candidates for the true described as species yet and therefore were not included P. pollicaris (Figure 8). in our morphological comparisons. The name P. pollicaris To avoid confusion and get as closely as possible to the cannot confidently be assigned to any of the Werneck et al. “real” P. pollicaris sensu stricto, our characterization of P. [11] clades because the type locality Thecadactylus pollicaris pollicaris is basedontwo paralectotypes thataccordingto (“sylvis interioris Bahiae campestribus”) (Spix 1825: 17 [58]) Mul ¨ ler and Brongersma [59] were part of the original type is not precise enough. According to the distribution map series that the description of Spix (1825 [58]) is based on and International Journal of Zoology 11 came from thesamelocalityasthelectotype(ZSM2510/0, considered lost, Michael Franzen comm. pers.). Nevertheless, paralectotypes have no legal status as name-bearing types, and therefore this issue remains to be solved. Similarly, the taxonomic status of Phyllopezus goyazensis (Peters 1878) also needs to be accounted for. eTh P. goyazensis type locality of is stated as “Goyaz” in Brazil [60], which, at the time, was larger than the current boundaries of the modern Goia´s state and included what is now Goias ´ and Tocantins. Three of the putative species from Werneck et al. [11] occur in this area, clades IV, VII, and VIII. Fortunately, the P. goyazensis type is still extant (ZMB 9079), which should make assigning that name easier than the aforementioned P. pollicaris problem. Morphological differences are slight among the closest relative species of Phyllopezus (P. pollicaris, P. przewalskii,and P. heuteri), rendering it a genus with remarkable morpho- logical crypsis. Nevertheless, Phyllopezus heuteri is relatively easily distinguishable from the phylogenetically most distant species: P. lutzae, P. maranjonensis,and P. periosus,showing more resemblance with P. pollicaris and P. przewalskii.We found high variation in traditional diagnostic characters for P. przewalskii (Table 1) which overlap with those proposed for P. pollicaris [20, 21]. Nevertheless, we found some characters in head and body scalation, which allow distinguishing P. heuteri and P. przewalskii,respectively,from P. pollicaris sensu stricto. Phyllopezus heuteri and P. przewalskii are morpholog- ically similar, but there are differences in the number of scales th th between4 and5 toes andintheshapeofscalesonthe sides of the neck as well as in the prescapular region (Figure S11). Additionally, P. przewalskii seems to have the cephalic tubercles more developed but we found some intraspecicfi variation in that character. With respect to coloration, like Figure 9: Differences in coloration of P. heuteri between animals on many other geckos, P. heuteri is capable of metachrosis, which light green lichens and pinkish rock substrates (above) and animals can cause it to mimic different substrates (Figure 9). on rocks fully covered by dark green lichens (below). Phyllopezus heuteri shows a high degree of genetic differ- entiation according to p-distances, having the lowest distance to its sister clade P. przewalskii (Appendix S3). Phyllopezus pollicaris Clade VII and P. pollicaris Clade VIII have the and the split between this species and P. przewalskii (its closest smallest distances (7.77–10.53%) among all pairs of clades. relative) occurred before the latter species colonized the xero- Werneck et al. [11] found higher genetic distances even at phytic Chaco. This paper represents another contribution the intraspecicfi level with values that reach 27.5% between oriented to resolving the taxonomy of the genus Phyllopezus, haploclades of P. pollicaris Clade VIII and genetic distances of andwehopethattheunnamedcladescanbemorphologically 16.9 to 24.6% between P. pollicaris Clade VII and P. pollicaris diagnosed in further studies. Clade VIII. 6. Conclusions Appendix For almost a century, the genus Phyllopezus was considered Examined Specimens as monotypic with two subspecies, until two more species were described and more recent works revealed an even Phyllopezus lutzae (3). Brazil: Bahia:Sao ˜ Salvador (AMNH higher species-level diversity [10, 11]. We add to this growing 65381, MCZ 46190 [Syntype], UMMZ 115644 [Syntype]). knowledge with the description of a new species from a poorly sampled area at the southern margin of the distribu- Phyllopezus maranjonensis (3). Peru: Amazonas: Quebrada tional range of the genus. We highlight the importance of Honda (ZFMK 84995–7 [Paratypes]). a morphological analysis that can put practicable names on the candidate species recognized by genetic data. Phyllopezus Phyllopezus periosus (3). Brazil: Para´ıba: Cabeceiras (AMNH heuteri is a rock dweller as many other members of the genus, 131825, MCZ 172929–30). 12 International Journal of Zoology Phyllopezus pollicaris (2). Brazil: Bahia (no more specific Paraguay,Paraguay),soPierCaccialigives himaspecial locality data) (ZSM 165/0/1–2 [Paralectotypes]). acknowledgment. This work is part of an ongoing project of Barcoding of Paraguayan Herpetofauna, as part of the Ph.D. Phyllopezus przewalskii (59). Argentina: Chaco:Fuerte work of Pier Cacciali, funded by the Deutscher Akademischer Esperanza (LJAMM-CNP 12094–5). Formosa:Ingeniero Austauschdienst (DAAD, Germany). Juar ´ ez (LJAMM-CNP 12071, 12084; MACN 3230). Santiago del Estero: Pampa de los Guanacos (MACN 4999). Supplementary Materials Bolivia: Santa Cruz: San Antonio de Parapeti (MACN 47006–7, 47009–10). Tarija: Villamontes (SMF 29259–64). Appendix S1: environmental traits of Phyllopezus habitats Paraguay: (No additional data) MNHNP 11174, 11176. in Paraguay. Appendix S2: GenBank accession numbers of Alto Paraguay:Bah´ıa Negra (MNHNP 10202, 11691); Colonia sequences used in this work. Appendix S3: pairwise genetic distances (16S). Appendix S4: results of the ABGD assess- Potrerito (MNHNP 3371); Parque Nacional Defensores del th th Chaco (MNHNP 2850, 4298); Puerto Ramos (MNHNP ment. Figure S1: scales between4 and5 digital pads. Figure 3243–6, 3248–9). Amambay: Parque Nacional Cerro Cora´ S2: phylogenetic tree inferred from 16S using BI approach. (MNHNP 6983, 7046, 7640–4, 11919). Boqueron ´ :Establec- Figure S3: phylogenetic tree inferred from 16S using ML approach. Figure S4: phylogenetic tree inferred from Cytb imiento Ko’e Pyahu (MNHNP 11069); Estancia Agropil S.A. using BI approach. Figure S5: phylogenetic tree inferred (MNHNP 8042); Estancia Amistad (SMF 100495–6); from Cytb using ML approach. Figure S6: phylogenetic tree Estancia Jabal´ı (MNHNP 8043–4, 8071); Estancia MbutuR ´ eta˜ inferred from ND2 using BI approach. Figure S7: phyloge- (MNHNP 3818); Filadelfia (MNHNP 2851); Parque Nacional netic tree inferred from ND2 using ML approach. Figure S8: Teniente Enciso (MNHNP 2853, 3253, 4300, 11797, 11847, phylogenetic tree inferred from concatenated genes, using 11857). Concepcion ´ :Vallem´ı(MACN 12860–6). BI approach. Figure S9: phylogenetic tree inferred from concatenated genes, using ML approach. Figure S10: dorsal Data Availability scalation. Figure S11: head and lateral body scalation. Figure S12: ear opening. Figure S13: mental scalation. Figure S14: Sequences used for this study are stored in GenBank. See lateral scalation of the head. Figure S15: prescapular scalation. Appendix for specifications. Sequence matrices and trees are ∘ (Supplementary Materials) deposited in TreeBASE ID N 22091. References Conflicts of Interest [1] P. E. Vanzolini and A. M. M. Ramos, “A new species of eTh authors declare that they have no conflicts of interest. Colobodactylus, with notes on the distribution of a group of stranded microteiid lizards (Sauria, Teiidae),” Papeis Avulsos de Zoologia,vol.31, pp.19–47,1977. Acknowledgments [2] E.H.Bucher, “Chaco andCaatinga-SouthAmericanArid ´ ´ eTh authors’ thanks go to F. Bauer, N. Mart ınez, J. Mendez, M. Savannas, Woodlands and Thickets,” in Ecology of Tropical Ruiz D´ıaz, E. Buongermini, and D. Vazq ´ uez for help during Savannas,B.J.HuntleyandB.H.Walker, Eds.,vol.42,pp.48– field work; also to M. Motte (MNHNP), L. Avila (LJAMM- 79, Springer-Verlag, Heidelberg, Berlin, Germany, 1982. CNP),J.Faivovich (MACN),B. Alvarez (UNNEC), C. [3] M.A.Mares,M.R.Willig,and T.E. Lacher,“eTh Brazilian Caatinga in South American Zoogeography: Tropical Mammals Spencer (MVZ), D. Rodder ¨ (ZFMK), F. Glaw (ZSM), R. Nuss- in a Dry Region,” Journal of Biogeography,vol.12, no.1,pp. 57– baum (UMMZ), and D. Kizirian (AMNH) for letting them 69, 1985. analyze specimens under their care; to C. Per ´ ez (LJAMM- [4] D. E. Prado and P. E. Gibbs, “Patterns of Species Distributions CNP), A. Mar´ın (LJAMM-CNP), S. Nenda (MACN), S. in the Dry Seasonal Forests of South America,” Annals of the Palomas (UNNEC), C. Koch (ZFMK), M. Franzer (ZSM), Missouri Botanical Garden,vol.80,no.4,pp. 902–927, 1993. G. Schneider (UMMZ), L. Mogk (SMF), C. Zimmer (SMF), [5] F. Mayle, “The Late Quaternary Biogeographical History of and E. Buongermini (Subtropica, Paraguay), for help and SouthAmericanSeasonallyDry TropicalForests:Insights assistance during specimens’ revision; and to H. Kappes from Palaeo-Ecological Data,” in Neotropical Savannas and (Grunelius-Mol ¨ lgaard Labor, SMF) and B. J. Pinto (MU) for Seasonally Dry Forests: Plant Diversity, Biogeography, and Con- assistance with laboratory work. eTh Consejo Nacional de servation, R. T. Pennington, G. P. Lewis, and J. A. Ratter, Eds., Ciencia y Tecnolog´ıa (CONACYT) from Paraguay, through pp. 395–416, CRC Press, Boca Raton, Florida, 2006. the “Programa Nacional de Incentivo a los Investigadores” [6] E. E. Gutier ´ rez, R. P. Anderson, R. S. Voss, J. Ochoa-G., M. (PRONII) program, funded Pier Cacciali for fieldwork. Also, Aguilera, and S. A. Jansa, “Phylogeography of Marmosa robin- AMERISUR Paraguay provided financial support for revision soni: insights into the biogeography of dry forests in northern of scientific collections. Pier Cacciali also is grateful to South America,” Journal of Mammalogy,vol.95, no.6,pp. 1175– “Iki” (S. Saldivar) and “Chori” (V. Martınez) for delivering 1188, 2014. fieldwork equipment supplied by Idea Wild. Also thanks are [7] D. M. Neves, K. G. Dexter, R. T. Pennington, M. L. Bueno, and due to N. C. Haase for the revision of an early draft of the A. T. Oliveira Filho, “Environmental and historical controls of manuscript. This paper arose six years ago from an early floristic composition across the South American Dry Diagonal,” idea, strongly encouraged by A. Yanosky (Asociacion ´ Guyra Journal of Biogeography,vol.42, no.8,pp.1566–1576,2015. International Journal of Zoology 13 [8] F. P. Werneck, “Biogeografia Molecular e Reconstruc ¸oes ˜ Gekkonidae: Phyllopezus) from northwestern Peru,” Salaman- Espac¸o-temporais Aplicadas aos Estudo da Diversificac¸ao ˜ da dra,vol.42, no.2/3,pp.145–150,2006. BiotadaDiagonaldeFormac¸oes ˜ Abertas e Zonas de Transic¸ao ˜ ,” [24] D. E. Prado, “Seasonally dry forests of tropical South America: in Biogeografia da Am er ´ ica do Sul: Ana´lisedeTempo,Espa¸o c e From forgotten ecosystems to a new phytogeographic unit,” Forma,C.J.B.deCarvalhoand E. A.B.Almeida, Eds.,pp.141– Edinburgh Journal of Botany,vol.57,no.3,pp.437–461,2000. 156, Roca, Rio de Janeiro, 2nd edition, 2016. [25] A. L. Aquino, N. Scott, and M. Motte, “Lista de los anfibios y [9] C. E. Guarnizo, F. P. Werneck, L. G. Giugliano et al., “Cryptic lin- reptiles del Museo Nacional de Historia Natural del Paraguay,” eages and diversification of an endemic anole lizard (Squamata, in Colecciones de Fauna y Flora del Museo Nacional de Historia Dactyloidae) of the Cerrado hotspot,” Molecular Phylogenetics Natural del Paraguay,O.RomeroMart´ınez,Ed.,pp.331–400, and Evolution,vol.94, pp.279–289,2016. ´ ´ Ministerio de Agricultura y Ganaderıa, Asuncion, Paraguay, [10] T.Gamble,G.R.Colli,M.T.Rodrigues,F.P.Werneck,andA. 1996. M. Simons, “Phylogeny and cryptic diversity in geckos (Phyl- [26] P. Cacciali, N. Scott, A. L. Aquino, L. A. Fitzgerald, and P. lopezus; Phyllodactylidae; Gekkota) from South America’s open Smith, “eTh Reptiles of Paraguay: literature, distribution, and biomes,” Molecular Phylogenetics and Evolution,vol.62,no.3, an annotated taxonomic checklist,” Special Publications of the pp. 943–953, 2012. Museum of Southwestern Biology,vol.11, pp.1–373,2016. [11] F. P. Werneck, T. Gamble, G. R. Colli, M. T. Rodrigues, and J. [27] M. Culzzoni and B. B. Alvarez, “Phyllopezuspollicarisprzewal- Sites, “Deep diversification and long-term persistence in the skyi (Brazilian Gecko),” Geographic distribution. Herpetological South American “Dry Diagonal”: integrating continent-wide Review, vol. 27, p. 211, 1996. phylogeography and distribution modeling of geckos,” Evolu- [28] N. V. Ivanova, J. R. Dewaard, and P. D. N. Hebert, “An inexpen- tion,vol.66, no.10, pp.3014–3034, 2012. sive, automation-friendly protocol for recovering high-quality [12] S. R. Palumbi and F. Cipriano, “Species identification using DNA,” Molecular Ecology Notes,vol.6,no.4,pp.998–1002,2006. genetic tools: eTh value of nuclear and mitochondrial gene [29] S. Palumbi, A. Martin, S. Romano, WO. McMillan, L. Stice, sequences in whale conservation,” Journal of Heredity,vol.89, and G. Grabowski, The simple fools guide to PCR, Version 2 , no. 5, pp. 459–464, 1998. Honolulu, University of Hawaii, 2002. [13] J. A. Rudnick, T. E. Katzner, E. A. Bragin, and J. A. DeWoody, [30] B. J. Stucky, “SeqTrace: A Graphical Tool for Rapidly Processing “Species identification of birds through genetic analysis of DNA Sequencing Chromatograms,” Journal of Biomolecular naturally shed feathers,” Molecular Ecology Resources,vol.7,no. Techniques : JBT,vol.23, no.3,pp. 90–93, 2012. 5, pp. 757–762, 2007. [31] K. Katoh, K. Misawa, K. Kuma, and T. Miyata, “MAFFT: a novel [14] L. Yang, Z. Tan, D. Wang et al., “Species identification through method for rapid multiple sequence alignment based on fast mitochondrial rRNA genetic analysis,” Scienticfi Reports ,vol.4, Fourier transform,” Nucleic Acids Research,vol.30, no.14, pp. no. 1, article no. 4089, 2015. 3059–3066, 2002. [15] J. Sites and J. C. Marshall, “Delimiting species: a renaissance [32] K. Katoh and D. M. Standley, “MAFFT multiple sequence issueinsystematicbiology,” Trends in Ecology and Evolution, alignment software version 7: improvements in performance vol.18,no.9, pp.462–470,2003. and usability,” Molecular Biology and Evolution,vol.30,no.4, [16] J. H. Pinzon ´ and T. C. Lajeunesse, “Species delimitation of pp. 772–780, 2013. common reef corals in the genus Pocilloporausing nucleotide [33] K. Katoh and H. Toh, “Improved accuracy of multiple ncRNA sequence phylogenies, population genetics and symbiosis ecol- alignment by incorporating structural information into a ogy,” Molecular Ecology,vol.20, no.2,pp.311–325,2011. MAFFT-based framework,” BMC Bioinformatics,vol.9,article [17] S. Khodami, P. Martinez Arbizu, S. Sto¨hr, and S. Laakmann, no. 212, 2008. “Molecular Species Delimitation of Icelandic Brittle Stars [34] G. Yachdav, S. Wilzbach, B. Rauscher et al., “MSAViewer: Inter- (Ophiuroidea),” Polish Polar Research,vol.35,no.2,pp.243– active JavaScript visualization of multiple sequence alignments,” 260, 2014. Bioinformatics,vol.32,no.22, pp.3501–3503,2016. [18] F. Leliaert, H. Verbruggen, P. Vanormelingen et al., “DNA-based [35] D. Glez-Pena, ˜ D. Gomez-B ´ lanco, M. Reboiro-Jato, F. Fdez- species delimitation in algae,” European Journal of Phycology, Riverola, and D. Posada, “ALTER: program-oriented format vol.49,no. 2,pp.179–196,2014. conversion of DNA and protein alignments,” Nucleic Acids [19] L. G. Giugliano, C. de Campos Nogueira, P. H. Valdujo, R. G. Research, vol. 38, pp. 14–18, 2010. Collevatti, and G. R. Colli, “Cryptic diversity in South American [36] R. Lanfear, P. B. Frandsen, A. M. Wright, T. Senfeld, and B. Teiinae (Squamata, Teiidae) lizards,” Zoologica Scripta,vol.42, Calcott, “PartitionFinder 2: new methods for selecting parti- no. 5, pp. 473–487, 2013. tioned models of evolution formolecular and morphological [20] P. E. Vanzolini, “Sobre o gener ˆ o Phyllopezus Peters (Sauria, phylogenetic analyses,” Molecular Biology and Evolution,vol.34, Gekkonidae),” Papeis ´ Avulsos de Zoologia,vol.11, pp.353–369, no.3,pp. 772-773, 2016. [37] S. Guindon, J. Dufayard, V. Lefort, M. Anisimova, W. Hordijk, [21] J. A. Peters and R. Donoso-Barros, “Catalogue of the Neotrop- and O. Gascuel, “New algorithms and methods to estimate ical Squamata, Part. II; lizards and amphisbaenians,” Bulletin of maximum-likelihood phylogenies: assessing the performance the United States National Museum,no.297, pp.1–293,1970. of PhyML 3.0,” Systematic Biology,vol.59, no.3,pp.307–321, [22] M. T. Rodrigues, “Uma nova espece do genero Phyllopezus de Cabaceiras: Paraiba: Brasil; com comentarios sobre a fauna de [38] K. P. Burnham and D. R. Anderson, Model Selection and Mul- lagartos da area (Sauria Gekkonidae),” Papeis ´ Avulsos de Zoolo- timodel Inference: A Practical Information-eor Th etic Approach , gia, vol. 36, pp. 237–250, 1986. Springer-Verlag, NY, USA, 2nd edition, 2002. [23] C. Koch,P.J.Venegas,andW. Bohme ¨ , “A remarkable dis- [39] J.Sullivan,D.L.Swooff rd,andG. J. P. Naylor,“eTh eeff ctof covery: description of a big-growing new gecko (Squamata: taxon sampling on estimating rate heterogeneity parameters 14 International Journal of Zoology of maximum-likelihood models,” Molecular Biology and Evolu- [57] K. de Queiroz, eTh general lineage concept of species, species tion,vol.16,no.10, pp.1347–1356,1999. criteria, and the process of speciation,D.J.Howardand H.B. Stewart, Eds., Oxford University Press, 1998. [40] I. Mayrose, N. Friedman, and T. Pupko, “A gamma mixture model better accounts for among site rate heterogeneity,” [58] J. B. Spix, “Animalia nova sive species nova lacertarum quas in itinere per Brasiliam annis MDCCCXVII-MDCCCXX jussu et Bioinformatics, vol. 21, no. 2, pp. ii151–ii158, 2005. auspiciis Maximiliani Josephi I Bavariae Regis suscepto collegit [41] Z. Yang, Computational Molecular Evolution. Oxford Series in et descripsit Dr. J. B. de Spix. Monacco,” 1825. Ecology and Evolution,2006. [59] L. Muller ¨ and L. D. Brongersma, “Ueber die Identitat ¨ von [42] J.Yan,C. Tian,L.Lv, A.M. Bauer, andK.Zhou,“Complete eTh cadactylus pollicaris Spix 1825 mit Phyllopezus goyazensis mitochondrial genome of the San Lucan gecko, Phyllodactylus Peters 1877,” Zoologische Mededelingen,vol.15,pp.156–161,1933. unctus (Sauria, Gekkota, Phyllodactylidae), in comparison with [60] W. Peters, “Herpetologische Notizen. II. Bemerkungen ub ¨ er Tarentola mauritanica,” Mitochondrial DNA,vol.25, no.3,pp. neue oder weniger bekannte Amphibien,” Monatsberichte der 202-203, 2014. Kon ¨ iglich Preussischen Akademie der Wissenschaen ft zu Berlin , [43] S. Kumar, G. Stecher, and K. Tamura, “MEGA7: Molecular pp.415–423,1878. Evolutionary Genetics Analysis version 7.0 for bigger datasets,” Molecular Biology and Evolution,vol.33, no.7,pp.1870–1874, [44] J. P. Huelsenbeck and F. Ronquist, “MrBayes: Bayesian inference of phylogenetic trees,” Bioinformatics,vol.17, no.8,pp.754-755, [45] F.Ronquist andJ.P.Huelsenbeck,“MrBayes3:bayesianphylo- genetic inference under mixed models,” Bioinformatics,vol.19, no. 12, pp. 1572–1574, 2003. [46] A. G. Gelman and D. B. Rubin, “Inference from iterative simulation using multiple sequences,” Statistical Science,vol.7, no. 4, pp. 457–472, 1992. [47] J. Trifinopoulos, L.-T. Nguyen, A. von Haeseler, and B. Q. Minh, “W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis,” Nucleic Acids Research,vol.44, no.1,pp. W232–W235, 2016. [48] B.Q.Minh,M.A.T.Nguyen, andA.vonHaeseler,“Ultrafast approximation for phylogenetic bootstrap,” Molecular Biology and Evolution,vol.30, no.5,pp. 1188–1195,2013. [49] A. J. Drummond, M. A. Suchard, D. Xie, and A. Rambaut, “Bayesian phylogenetics with BEAUti and the BEAST 1.7,” Molecular Biology and Evolution,vol.29,no.8,pp.1969–1973, [50] H. A. Ogilvie, R. R. Bouckaert, and A. J. Drummond, “Star- BEAST2 brings faster species tree inference and accurate estimates of substitution rates,” Molecular Biology and Evolution, vol.34,no. 8,pp.2101–2114,2017. [51] R. R. Bouckaert and J. Heled, “DensiTree 2: Seeing trees through the forest,” BioRxiv,2014. [52] N. Puillandre, A. Lambert, S. Brouillet, and G. Achaz, “ABGD, Automatic Barcode Gap Discovery for primary species delimi- tation,” Molecular Ecology,vol.21, no.8,pp.1864–1877,2012. [53] M. Kekkonen,M.Mutanen,L.Kaila,M.Nieminen,and P. D. N. Hebert, “Delineating species with DNA barcodes: A case of Taxon dependent method performance in moths,” PLoS ONE, vol. 10, no. 4, Article ID e0122481, 2015. [54] Z. Yang, J.-F. Landry, and P. D. N. Hebert, “A DNA bar- code library for North American Pyraustinae (Lepidoptera: Pyraloidea: Crambidae),” PLoS ONE,vol.11, no.10, ArticleID e0161449, 2016. [55] G. Kohler, ColorCatalogue forFieldBiologists,Herpeton, Offenbach, Germany, 2012. [56] M. H. Sabaj Per ´ ez, Standard symbolic codes for institutional resource collections in herpetology and ichthyology: an Online Reference. Version 5.0, American Society of Ichthyologists and Herpetologists, 2014, http://www.asih.org/, Accessed 10 Apr 2017. International Journal of Journal of Nucleic Acids Peptides The Scientific International Journal of International Journal of World Journal Cell Biology Microbiology Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi Hindawi http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Anatomy Biochemistry Research International Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com Advances in Genetics Bioinformatics Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Advances in International Journal of International Journal of Stem Cells BioMed Zoology Virolog y Genomics International Research International Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Neuroscience Journal Enzyme Journal of Journal of Research Parasitology Research Marine Biology Archaea Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png International Journal of Zoology Hindawi Publishing Corporation

Cryptic Diversity in the Neotropical Gecko Genus Phyllopezus Peters, 1878 (Reptilia: Squamata: Phyllodactylidae): A New Species from Paraguay

Loading next page...
 
/lp/hindawi-publishing-corporation/cryptic-diversity-in-the-neotropical-gecko-genus-phyllopezus-peters-UaIpKYucxy
Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2018 Pier Cacciali et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8477
eISSN
1687-8485
DOI
10.1155/2018/3958327
Publisher site
See Article on Publisher Site

Abstract

Hindawi International Journal of Zoology Volume 2018, Article ID 3958327, 14 pages https://doi.org/10.1155/2018/3958327 Research Article Cryptic Diversity in the Neotropical Gecko Genus Phyllopezus Peters, 1878 (Reptilia: Squamata: Phyllodactylidae): A New Species from Paraguay 1,2,3 1 4,5 1,2 Pier Cacciali , Sebastian Lotzkat, Tony Gamble, and Gunther Köhler Senckenberg Forschungsinstitut und Naturmuseum Frankfurt, Senckenberganlage 25, 60325 Frankfurt a.M., Germany Johann Wolfgang Goethe University, Institute for Ecology, Evolution & Diversity, Biologicum, Building C, Max-von-Laue-Straße 13, 60438 Frankfurt am Main, Germany Instituto de Investigacion ´ Biolo´gicadel Paraguay,Del Escudo 1607,1425Asuncio´n, Paraguay Department of Biological Sciences, Marquette University, Milwaukee, WI 53201, USA BellMuseum of NaturalHistory,UniversityofMinnesota,St. Paul,MN55108,USA Correspondence should be addressed to Pier Cacciali; pier cacciali@yahoo.com Received 28 January 2018; Accepted 6 June 2018; Published 16 July 2018 Academic Editor: Hynek Burda Copyright © 2018 Pier Cacciali et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The gecko genus Phyllopezus is distributed mainly along South America’s “Dry Diagonal” (Caatinga, Cerrado, and Chaco). The genus has been the subject of recent taxonomic analyses and includes four described species and seven candidate species referred to here as Phyllopezus pollicaris sensu lato. In Paraguay, Phyllopezus is known from the Chaco and Cerrado where it is abundant, andalsofromasmallisolatedpopulation from arockyhillformationnamed “CordilleradeLosAltos” (Los Altosmountainrange). Here we analyzed genetic samples from across its range, including new samples from Paraguay, using DNA barcoding analysis of the mitochondrial 16S gene and phylogenetic analyses using both Bayesian and Maximum Likelihood methods. We found genetic and morphological differences among geckos from the Los Altos mountain range and the remaining Phyllopezus populations. Using both molecular and morphological evidence we describe a new Phyllopezus species, sister to P. przewalskii. Genetic differentiation among described and putative Phyllopezus species is greater than their morphological differences, which likely accounts for these cryptic taxa remaining undescribed for so long. 1. Introduction phylogenetic lineages of reptiles in the Neotropics [9, 19]. A good example of this undescribed diversity involves lizards In South America, the so-called “Dry Diagonal” of dry of the genus Phyllopezus distributed mainly along the “Dry seasonal woodland formations stretches from eastern Brazil Diagonal” [10, 11]. to northern Argentina and includes the Caatinga, Cerrado, Phyllopezus is a genus of Neotropical geckos, which for andChacoecoregions.Theoriginofthese biomesandthe decades was considered as monotypic with two subspecies: evolution of their faunas have evoked much interest during P. pollicaris pollicaris (Spix, 1825) and P. p. przewalskii the past decades [1–4] and are still a significant topic for Koslowsky, 1895 [20, 21]. Later, P. periosus Rodrigues, 1986 understanding the evolution of the Neotropical biota [5–8]. was described from northeastern Brazil [22], and more As important as these “Dry Diagonal” ecoregions are, they recently P. maranjonensis Koch, Venegas & Bohme ¨ , 2006 remain poorly known with new species being described at from Peru [23]. Furthermore, a detailed phylogenetic study, an increasing rate [9–11]. Molecular data are now oen ft used based on a multilocus genetic approach, showed a deep for species identification [12–14] and species delimitation [15– phylogenetic nesting of Bogertia lutzae within Phyllopezus 18] helping taxonomists to improve the global knowledge of and accordingly placed that species in the genus Phyllopezus alpha taxonomy. This led to the recognition of many cryptic to reestablish monophyly [10]. 2 International Journal of Zoology Figure 1: Distribution of the genus Phyllopezus according to Koch et al. [23] and Werneck et al. [11] indicating collection localities of our specimens. Red oval: Tobat´ı (in Los Altos mountain range). Square: Estancia La Amistad. Triangle: Parque Nacional Cerro Cora. ´ Phyllopezus are among the largest geckos in South Amer- eTh distribution of Phyllopezus pollicaris sensu lato and icaand theyhave apattern ofblackorbrownspotsongray P. przewalskii includes the “Dry Diagonal” [11], Chaco, Cer- or also whitish background color with a high intraspecific rado, and Caatinga, as well as another biome recognized as variation. Based on genetic analyses of Phyllopezus specimens “Seasonally Dry Tropical Forest” [24]. In the last phylogenetic (referred to as P. pollicaris) from the Chaco, Cerrado, and study of the genus, three major genetic lineages of Phyllopezus Caatinga ecoregions, a previous study found a high degree pollicaris sensu lato were recognized [11]: a northeastern of genetic diversity in Cerrado and Caatinga (northeastern group from the Caatinga, a central clade from the Cerrado, populations) specimens [10], followed by another study that and a southwestern group whose distribution matches that of proposed species status for P. przewalskii and designated the Chaco sensu lato (Dry Chaco + Humid Chaco) (Figure 1). seven additional taxa (within P. pollicaris sensu lato) as In Paraguay P. przewalskii is known from the Chaco [25, 26], candidate species, thus, recognizing eleven tentative species- where the species is a common ground dweller but also level units within this genus [11]. inhabits human dwellings. Phyllopezus is also present in the International Journal of Zoology 3 Paraguayan Cerrado [25, 26], where it occurs in rocky hills. applications, the formats of the sequences were converted Furthermore, there is another isolated population inhabiting using the online server Alter [35]. The best substitution a rocky hill formation named “Cordillera de Los Altos” model for each gene (analyzed separately) of our dataset was (Los Altos mountain range) in the Departments of Paraguarı identified using PartitionFinder2 [36], with linked branch [27] and Cordillera [26], with an environment completely lengths (supported by most of the phylogenetic programs) via different to that of the Paraguayan Chaco or Cerrado (details PhyML 3.0 analysis [37]. Model selection was detected using of environments presented in Appendix S1). Populations thecorrected (forfinitesamplesize) AkaikeInformation from “Cordillera de Los Altos” and Paraguayan Cerrado have Criterion (AICc) [38]. Given the correlation between gamma not been included in previous genetic analyses. (+G) and invariant sites (+I) parameters, models that include In this work we rfi st explored the genetic distinctiveness both +G and +I are oen ft inadequate [39–41]. us, Th we did of Phyllopezus specimens from the “Cordillera de Los Altos” not use models that included both parameters together. In and the Paraguayan Cerrado within the framework of a all analyses, we used the Phyllodactylus unctus mitogenome project about barcoding of Paraguayan herpetofauna using (GenBank HQ896027) as an outgroup [42]. the mitochondrial 16S rRNA gene. Genetic data indicates Allofthefollowinganalyseswereconductedforeachgene that Phyllopezus from “Cordillera de Los Altos” constitute a individually, and the three genes concatenated. Sequences genetic lineage differentiated from the remaining Paraguayan were concatenated in Mega 7.0.26 [43]. We performed populations. Next, we incorporated additional mitochondrial Bayesian Inference analysis (BI) with MrBayes 3.2 [44, 45]. genes (Cytb and ND2) to our analyses in order to assess BI analyses were performed setting 5 runs with 8 chains dis- phylogenetic relationships of Phyllopezus from “Cordillera de carding the first 25% as the burn-in period and an initial set of Los Altos” with previously published congeneric data (cluster 1,000,000 generations for MCMC with a sampling frequency arrangement according to Werneck et al. [11]). of 500 generations, adding 500,000 generations until chains reached convergence. We considered convergence when the standard deviation of split frequencies was 0.015 or less. 2. Materials and Methods Additionally, convergence was diagnosed by PRSF (Potential We sampled Phyllopezus from three localities of Paraguay Scale Reduction Factor) which should approach 1.0 as runs (Figure 1) and sequenced fragments of the mitochondrial converge [46]. 16S rRNA gene (GenBank accession numbers provided in We used the IQTree webserver [47] to run a Maximum Likelihood (ML) analysis using 10,000 ultrafast Bootstrap Appendix S2) for comparison with sequences produced by Gamble et al. [10]. DNA was extracted from muscle stored approximation (UFBoot) replicates with 10,000 maximum in ethanol 98% at -27 C using the standard glass bfi er plate iterations and minimum correlation coefficient of 0.99 [48] protocol of Ivanova et al. [28]. Samples were washed for plus 10,000 replicates of Shimodaira-Hasegawa approximate about14hin50𝜇lofdilutedPBSbueff r(1:9of bueff rand likelihood ratio (SH-aLRT), which proved to be accurate with water, respectively). Tissues were digested with vertebrate a high statistical power [37]. We used FigTree 1.3.1 for tree lysis buffer (60 𝜇l per sample) and proteinase K (6 𝜇lper viewing (http://tree.bio.ed.ac.uk/software/figtree/). sample) at 56 C for around 14 h. After extraction, DNA We estimated evolutionary genetic divergence for the 16S gene among sequences, computing uncorrected pairwise samples were eluted in 50𝜇LTEbueff r.Amplicfi ationvia double-stranded PCR of mitochondrial 16S rRNA fragments distances with Mega 7.0.26 to assess the degree of intra- was performed using the Eurofins MWG Operon prim- and interspecific differences, using a Bootstrap estimation method of 10,000 replications. Data were compared with ers 16sar-L (forward: 5’–CGCCTGTTTATCAAAAACAT–3’, also referred to as L2510) and 16sbr-H (reverse: 5’– those available from Gamble et al. [10]. CCGGTCTGAACTCAGATCACGT–3’, also referred to as To assess the phylogenetic position of the “Cordillera de H3056) [29], in an Eppendorf Mastercycler pro. eTh PCR Los Altos” clade within Phyllopezus, we designed a species conditions were as follows: initial denaturation 2 min (94 C), treebasedonthethreemtDNAgene sequencesconcatenated, ∘ ∘ denaturation 35 sec (94 C)×40, hybridization 35 sec (48.5 C), using ∗BEAST [49] in BEAST 2.4.7 [50] under 1,000,000 ∘ ∘ elongation 60 sec (72 C), and n fi al elongation 10 min (72 C). generations for the mcmc model, visualizing the posterior Cycle-sequencing and sequencing (BigDye Terminator) probability in DensiTree 2.2.6 [51]. We performed an initial species delimitation analysis were performed with the same forward and reverse primers mentioned above. Partial sequences of mtDNA from cyto- by visualizing barcode gaps in the pairwise distribution of chrome b (Cytb) and NADH dehydrogenase subunit 2 (ND2) each mtDNA gene separately (excluding the outgroup), using the automatic barcode gap discovery (ABGD) approach [52] genes were amplified according to the procedures presented in Werneck et al. [11]. Inspection of DNA chromatograms through its webserver (http://wwwabi.snv.jussieu.fr/public/ and generation of consensus sequences were performed with abgd/abgdweb.html), setting the use of Simple Distance, SeqTrace 0.9.0 [30]. default values for Prior Intraspecific divergence, except for Sequences were aligned using MAFFT 7 [31, 32] through relative gap width (1.5) which does not work for some genes (as also noted by Kekkonen et al. [53]). Because high values the webserver (available at http://ma.cb fft rc.jp/alignment/ server/). We included the Q-INS-i search strategy for the in relative gap width tend to overly split species [54], we also secondary structure of 16S [33]. Results of alignment were used an intermediate value of 0.7. In addition to the molecular genetics, we measured the visualized and exported with MSA Viewer [34]. According to the respective requirements of the different software following morphological characters: snout–vent length (SVL) 4 International Journal of Zoology from the tip of the snout to the anterior edge of the cloaca; the remaining species within the genus. eTh Bayesian analysis head length (HL) from the tip of the snout to the anterior (Figures 2, S8) generally showed higher support values than edge of the ear opening; head width (HW) measured at the ML (Figure S9). eTh branches corresponding to P. pollicaris widest section of the head; nares–eye distance (NED) taken Clade I and P. pollicaris Clade II are clustered together. An from the posterior border of the nares to the anterior edge of important polyphyly is observed in P. pollicaris Clade III the eye; eye diameter (ED) measured at the widest section of which appears as the sister clade to P. pollicaris Clade IV + the eye; maximum diameter of the ear opening (EO) taken at P. przewalskii,andonesampleislocated asthesistergroup the widest point of the opening; minimum distance between to the cluster P. pollicaris CladeVI+ P. pollicaris Clade VII nares (DBN) measured from above; and tail diameter (TD) + P. pollicaris Clade VIII (Figure 2). Both hypotheses (BI taken at the base of the organ just posterior to the cloaca. and ML) suggest a branch with the southwestern taxa (Los Measurements were taken with digital calipers except SVL, Altos population + P. przewalskii + Phyllopezus pollicaris which was taken with a meter stick. Meristic characters Clade IV) differentiated from the remaining P. pollicaris included the number of supralabials (SL) from the first scale clades. eTh P. przewalskii clade shows specimens from the behind the rostral scale to the last in contact with the mouth Cerrado and from the Chaco separately; and specimens from border; upper supralabial row (USL) from the first in contact “Cordillera de Los Altos” mountain range are recovered withposteriornasal andfirstSLtothe last scalebefore as a sister clade to P. przewalskii.Thefinalalignment and SL contact suboculars, infralabials (IL) from the first scale trees (along with methods and parameters) are stored in contacting the mental to the last in contact with the mouth TreeBASE (ID N 22091) available at https://treebase.org/ th th treebase-web/home.html. and5 digital pads from the border, and scales between4 th The highest intraclade pairwise distance reaches 6.65% first lateral scale of the 5 toe (the distalmost lateral n fi ger in Phyllopezus pollicaris Clade VII and 4.4% in P. przewalskii scale that is not situated on the raised portion of the terminal th (Appendix S3). eTh minimum pairwise distance between two phalanx) to the rfi st lateral scale of the 4 toe (Figure S1). clades usually is higher than 10% with the exception of the When variation in the bilateral symmetry of morphological minimum distances between P. pollicaris Clade IV and P. characters is present, a slash mark separates the respective przewalskii (9.9%), as well as between P. pollicaris Clade VIII values for left/right side. Measurements were always taken with P. przewalskii (10.4%), P. pollicaris Clade VI (8.2%), and by thesameperson(PC).In thecolordescriptions, the Clade VII (7.1%), respectively (Appendix S3). capitalized colors and the color codes (in parentheses) are Samples from Los Altos mountain range present high those of Koh ¨ ler [55]. Specimens used for morphological values for pairwise genetic distance, reaching a genetic comparison are listed in the Appendix. distance of 16.8% with P. periosus (Appendix S3). eTh smallest We also explored the value of diagnostic characters tra- genetic distance of the Los Altos mountain range population ditionally used to differentiate between Phyllopezus pollicaris is 11.8% with P. pollicaris Clade IV (Appendix S3). Genetic and P. przewalskii [20], which are postcloacal tubercles at the distances between the Los Altos population and its sister sides of the vent; number of lamellae under the fourth toe; clade, P. przewalskii, is 12.6–14.4%. and number of longitudinal rows of ventral scales (counted The species tree shows P. periosus, P. maranjonensis and transversally at midbody). To do this, we compared samples P. lutzae clustered together and sister to the remaining from Paraguayan Chaco and Cerrado (which belong to Phyllopezus (Figure 3). The highest support is observed in the P. przewalskii) with topotypes of P. pollicaris. Institutional clusters P. pollicaris Clade I + P. pollicaris Clade II, P. pollicaris acronyms follow Sabaj Per ´ ez [56]. CladeVI+ P. pollicaris Clade VII + P. pollicaris Clade VIII, The Secretar ıa del Ambiente in Paraguay authorized and P. przewalskii + Phyllopezus sp. (Figure 3). euthanizing and collecting specimens, through the permits ∘ ∘ ∘ Results from ABGD suggest the presence of a higher SEAM N 04/11, SEAM N 009/2014, and SEAM N 133/2015. diversity within Phyllopezus than currently recognized (Figure 4). The gene 16S seems to be the most conservative recognizing 11 different species (Clades II and III not included 3. Results given the lack of samples), while ND2 recognized 15 species, The final alignments of 16S, Cytb, and ND2 were of 498, and 18 species were recognized by Cytb (Figure 4). Full results 907, and 886 nucleotide positions, respectively, for 64 Phyl- of ABGD are found in Appendix S4. eTh mitochondrial lopezus samples plus Phyllodactylus unctus as an outgroup Cytb gene suggests a higher diversity especially in Clade VII. (Appendix S2). Partition schemes were recorded as follows: This gene, as well as ND2, distinguishes the sample MTR st nd rd 13452 (P. pollicaris Clade III) as a species separated from the 16S (GTR+G); Cytb (1 pos HKY+I|2 pos K81UF+I|3 pos GTR+I); ND2 (GTR+I| HKY+G| TIM+I). remaining Clade III. Finally, the three genes are concordant The trees obtained through BI and ML showed a high in the recognition of the samples from “Cordillera de Los degree of concordance at well-supported nodes, with some Altos” as a different taxon (Figure 4, Appendix S4). differences in branch arrangement at poorly supported nodes (Figures S2–S7). eTh clade from “Cordillera de Los Altos” 4. Taxonomic Implications always clustered as the sister taxon of P. przewalskii (Figures S2–S7). Based on the concatenated genes, P. maranjonensis eTh specimens from “Cordillera de Los Altos” mountain was the sister taxon to the remaining Phyllopezus taxa, range exhibit a high genetic differentiation from all other followed by P. lutzae,and P. periosus as the sister clade to studied populations of Phyllopezus. Moreover, the specimens International Journal of Zoology 5 Figure 2: Bayesian tree obtained from concatenated mitochondrial genes (16S, Cytb, and ND2) of the gecko genus Phyllopezus. Numbered clades of P. pollicaris represent the groups recognized by Werneck et al. [11]. Most of clades (with the exception of P. przewalskii)are collapsed. For details on specimens’ allocation see Figure S8. In red, there is a clade that appears to be polyphyletic. Samples from Dry Chaco are shown in a brown box, those from Cerrado are shown in a yellow box, and in a green box are specimens from “Cordillera de los Altos.” Only PP values higher than 0.9 are shown. Outgroup: Phyllodactylus unctus. from “Cordillera de Los Altos” are recovered as a clade Zoological Nomenclature. eTh Life Science Identifier (LSID) phylogenetically distinct from the other clades. Finally, the for this publication is as follows: urn:lsid:zoobank.org:pub: population from “Cordillera de Los Altos” can be differenti- 1AE503A1-8CE0-460F-B29C-90B722DF905D. The LSID reg- ated from the other species of this genus by subtle characters istrationand anyassociatedinformation canbeviewedina of coloration and scalation. eTh refore, applying the general web browser by adding the LSID to the prefix “http://zoobank lineage species concept [57], we recognize the Phyllopezus .org/.” population from the “Cordillera de Los Altos” as a separate species, described below. Phyllopezus heuteri sp. nov. This published work and the nomenclatural acts it con- Holotype. SMF 100494 (original eld fi number GK 3559), tains have been registered in Zoobank: urn:lsid:zoobank.org: act:9E9B8965-B517-49A0-84D9-F7BC57A85E33, and there- adult female (Figure 5), collected on 12 September 2016 by ∘ ∘ fore they are available under the International Code of G. Koh ¨ ler, at the Cerro de Tobat´ı(25.2797 S, 57.0925 W, 6 International Journal of Zoology Figure 3: Species tree inferred with ∗BEAST showing density of trees proportional to frequency of occurrence (thin lines) drawn in DensiTree and the consensus tree (blue lines) with the posterior probability for each node. 428 masl), in the Cordillera de Los Altos mountain range, of color pattern (versus well defined transversal bands in P. Cordillera Department, Paraguay (Figure 6). periosus), by spiny scales surrounding the ear opening (versus cycloid scales) (Figure S12), and by the contact between the Paratypes. MVZ 110967 (unidentified sex), collected on 7 two greatly enlarged postmentals (versus enlarged lateral October1972byPhilMyers,at1mi SofTobat´ı, Cordillera, postmentals separated by small median postmentals) (Figure Paraguay; UNNEC 1005 (unidentified sex), collected on 3 S13). Phyllopezus heuteri is distinguished from P. pollicaris by March1998byM.Culzzoni andB. Alvarez, at Chololo´ the presence of two to three larger scales (tubercle-shaped) at ∘ ∘ (25.55138 S, 57.0400 W, 272 masl), Paraguar´ı, Paraguay; the mouth commissure (versus small homogeneous scales at MNHNP 11975 (adult male), collected on November 2014 by the mouth commissure in P. pollicaris),lateralbodytubercles J. Mende ´ z, at Cerro de Tobat´ı, Cordillera, Paraguay; MNHNP reaching further downwards (lowermost tubercle at 6–8 12001(adultmale),collectedon23 April2013byJ.Mende ´ z, at lateral scales from ventrals versus 13–15), and presence of Cerro de Tobat´ı, Cordillera, Paraguay; MNHNP 12111 (adult more tubercles (five to eight) between eye and ear opening female) and MNHNP 12112 (adult male), collected on 27 (versus up to three) (Figure S14). Phyllopezus heuteri can be January 2012 by J. Mende ´ z, S. Escobar and T. Lop ´ ez, at Cerro distinguished from P. przewalskii by thepresenceoftubercles ∘ ∘ Hu( ˜ 25.6069 S, 57.1294 W, 365 masl), Paraguar´ı, Paraguay; on the prescapular region and sides of the neck (versus SMF 100696 (adult female) collected on 16 April 2016 by P. homogeneous scalation in P. przewalskii)(Figure S15),the th th Cacciali, F. Bauer and J. Mende ´ z, at Cerro de Tobat´ı(25.2854 presence of 36 to 39 scales between4 and5 toes (versus S, 57.0934 W, 157 masl), Cordillera, Paraguay. 33 to 36), and its large postmentals usually contacting only st nd the rst fi IL (versus contacting usually 1 and2 IL). Diagnosis. A medium-sized species of Phyllopezus with a color pattern consisting of irregular transversal bands or Description of the Holotype. SVL 74 mm, tail incomplete, HL reticulations of dark colors on a grayish background, and 19.1 mm, HW 14.1, NED 6.9 mm, ED 4.6 mm, EO 1.6 mm, large tubercles irregularly disposed on the body. Morpho- DBN 2.4 mm, and TD 7.5 mm; rostral wide, with a median logically P. heuteri canbedieff rentiated from P. lutzae by groove at the upper side of the scale; nares surrounded the irregular reticulated or banded coloration (versus dotted by rostral, nasorostral, supranasal, postnasal, and rfi st SL; pattern in P. lutzae) and by the presence of tubercles on SL: 10/11; USL: 15/13; upper surface of the muzzle with a thebody(versus absent)(FigureS10). Phyllopezus heuteri shallow median depression; lateral and upper surfaces of the is distinguished from P. maranjonensis by the smaller size head covered with granular juxtaposed scales, with scattered tubercles on the upper surface starting at the level of the (max. SVL 88 mm versus 115 mm in P. maranjonensis)and posterior edge of the eye; supraocular scales spine-shaped presence of tubercles on the lateral surfaces of the body as well posterior to the level of the center of the eye; IL: 9/10; mental as betweeneyesand earopening (versusabsentfromthese bell-shaped with the narrower part posteriorly; two greatly regions) (Figure S11) and spiny scales surrounding the ear enlarged postmentals contacting each other, the mental, the opening (versus cycloids) (Figure S12). Phyllopezus heuteri is first IL, and a small portion of the second IL; postmentals differentiated from P. periosus by irregularly shaped elements International Journal of Zoology 7 Figure 4: Results of ABGD analysis for each gene. Colors represent groups identified by ABGD for each gene, with group numbers presented at the right. As seen, not all samples were available for all genes. Group colors do not represent the same grouping among genes, except for samples from “Cordillera de Los Altos” which are identified with a cream colored box with a red central dot. Base phylogeny (at the left) is the same as for Figure 2. followed by a row of vfi e smaller scales; scales under the single slightly developed postcloacal tubercle on each side; head gradually reducing in size posteriorly; dorsal and lateral tail with imbricate, cycloid scales that are smaller on the partsoftheneckcoveredwithgranularjuxtaposedscaleswith dorsal and larger on the lateral surfaces, and an enlarged irregular rows of tubercles; throat region with juxtaposed median subcaudal row of scales covering most of the ventral and cycloid homogeneous scales; dorsum of the body with surface. granular scales and tubercles approximately 2.5 times the Coloration in Life. (Figure 7) dorsal ground color of body size of the surrounding granular scales, disposed in 8 or Pale Neutral Gray (296), with irregular transversal bands 9 irregular rows on each side reaching onto flanks; ventral scales cycloid and imbricate, arranged in 32 longitudinal grading from Brownish Olive (292) into Raw Umber (280), rows at midbody; limbs covered with granular juxtaposed bordered posteriorly by Cream White (52) and interrupted scales, except on the dorsal surface of the upper arms by a Beige (254) vertebral stripe. Lateral surfaces of the and thighs that present slightly imbricated scales; forelimbs body Pale Neutral Gray (296) with scattered Raw Umber more slender than hind limbs; infradigital lamellae of hands (280) speckling. Venter Cream White (52). Dorsal and lateral starting from pollex were recorded as follows: 5/6 - 10/9 - surfaces of the head Smoke Gray (267) with Cream White 10/11 - 10/10 - 9/8; infradigital lamellae of feet starting from (52) and Raw Umber (280) speckles more concentrated on the hallux were recorded as follow: 6/5 - 10/9 - 11/11 - 10/12 occipital area. Ventral surface of the head Cream White (52) - 8/9; claws enclosed by a sheath of six rows of scales; a with Hair Brown (227) stipples concentrated in the infralabial 8 International Journal of Zoology arms and Jet Black (300) on legs, and immaculate Smoky White(261) ontheventral surface. Ground colorofthetail (only original portion of the tail described) Pale Gray (262) with irregular dorsal (transverse) diffused Smoke Gray (266) bands reaching onto flanks grading into Vandyke Brown (282) posteriorly followed by Smoky White (261) halo. Ventral surface of the tail Smoky White (261) with lateral suffusions of Smoke Gray (207). Variation among the Paratypes. SVL ranging from 60 to 73 mm in males and 77 to 88 mm in females (mean SVL 72.8 mm for both sexes combined); None of the tails of our examined specimens is complete and original (being either regenerated or broken and incomplete); HL 16.5–21.8 mm (25.6–27.5 % of SVL in males and 24.4–25.8 % in females); HW 12.2–18.6 mm (0.65–0.82 proportion HW/HL in males and 0.73–0.85 in females); NED 6.1–8.3 mm; ED 3.8-5.0 mm (0.60–0.64 proportion ED/NED in males, and 0.59–0.66 in females); EO 1.6–2.0 mm (9.5–10.9 % of HL in males and 8.2–10.6 % in females); DBN 2.0–2.8 mm (14.5–18.8 % of HW in males and 14.2–17.0 % in females); TD 7.2–8.5 mm (11.6–12.0 % of SVL) in males, and 7.8–10.6 mm (10.1–12.0 % of SVL) in females; rostral scale always of a similar shape, but the median groove can extend more than half of the scale downwards; SL 9 or 10; USL from 10 to 15; IL 8 or 9; postmentals contacting only the first IL in all specimens except the holotype; one specimen (MNHNP 12001) with three large postmentals; 27 to 33 longitudinal rows of ventral scales at midbody; infradigital lamellar variation for hands and feet is presented in Table 1; postcloacal tubercles vary from two to three per side. The most remarkable aspects of variation in color pattern arevisibleonthedorsum. el Th argestexaminedspecimen Figure 5: Dorsal (above), lateral (middle), and ventral (below) views (MNHNP 12111) has no pattern other than the vertebral stripe oftheholotype(SMF100494)of Phyllopezus heuteri.Scale bars =10 present in all specimens. The remaining specimens show a mm. patterncomposedofbandssimilartothatoftheholotype, but the bands are formed by a mottling in MNHNP 11975, and two specimens exhibit only very diffuse bands. One specimen (MNHNP 12001) has a paler ground color, and another (SMF area. Limbs Pale Neutral Gray (296) with reticula of Raw 100696) exhibits a darker ground color. Umber (280) dorsally, and immaculate Cream White (52) ventrally. Groundcolorofthe tail(onlyoriginalportion Distribution. Phyllopezus heuteri is known from rocky out- of the tail described) Pale Gray (262) with irregular dorsal crops at three localities along the “Cordillera de Los (transverse) bands reaching onto flanks that are Light Drab Altos” formation (Figure 6) in the Paraguayan departments (269) grading into Raw Umber (280) posteriorly followed by Cordillera and Paraguar´ı, at 268–428 m above sea level. Smoky White (261) halo. Ventral surface of the tail Pale Horn Color (11). Natural History. Given the scarcity of records this gecko is not well known. It appears to be a nocturnal species Coloration in Preservative. (After vfi e years in ethanol 70%) foundonsandstone rockyhills.Itseeksshelterincaves dorsal ground color Medium Neutral Gray (298), with or cracks in the rocks. Its coloration is mimetic with the irregular transversal bands Vandyke Brown (282), posteriorly bordered by Lavender (202); interrupted by a Pale Mauve lichens and mosses that cover the rocks’ surfaces. eTh area (204) vertebral stripe. Lateral surfaces of the body Medium where Phyllopezus heuteri is present has a marked seasonality regarding rainfall and temperature (dry and cold season from Neutral Gray (298) with scattered Dusky Brown (285) speck- les. Venter Smoky White (261). Dorsal and lateral surfaces May to September) with an annual precipitation of about 1200 to 1300 mm. eTh vegetation associated with the rocky of the head Smoke Gray (267) with Pale Buff (1) and Raw environment is composed of thorny or thick plants such as Umber (280) speckles. Ventral surface of the head Smoky White (261) with Fawn Color (258) stipples concentrated Polycarpaea hassleriana, Cereus sp., and Bromelia sp. Nothing is known about its feeding or reproductive habits, or any other in the infralabials. Limbs Light Neutral Gray (297) with reticulum of Brownish Olive (292) on the dorsal side of aspects of its behavior. International Journal of Zoology 9 Table 1: Morphological variation among Phyllopezus heuteri, P. pollicaris,and P. przewalskii. Hands Feet 12 3 4 5 1 2 3 4 5 Vent Ppol 6–7 10–12 11 9–11 9–10 6–7 10–11 11–12 9–12 10–11 28–30 Pprz 5–6 8–9 9–11 9–11 8–9 5–6 8–10 10–12 10–11 8–10 24–33 Pheu 3–6 7–10 9–11 9–11 7–9 5–6 9–10 10–12 9–11 8–9 27–33 Infradigital lamellar variation (including holotype) of Phyllopezus heuteri (Pheu) and the most closely related species, P. pollicaris (Ppol) and P. przewalskii th th (Pprz). Variation is presented from the pollex (1) to the5 finger of the hands and from the hallux (1) to the 5 toe of the feet. Also presented is the range of longitudinal rows of ventral scales (Vent). Figure 6: Known records of Phyllopezus heuteri showing the type locality (black star) and additional localities (red dots). Capitalized names refer to Paraguayan Departments. Etymology. eTh specific name is a patronym for biologist Dr. Horst Heuter from Berlin, Germany, in recognition of the n fi ancial support of taxonomic research provided by Dr. Heuter through the BIOPAT initiative. 5. Discussion The fact that Phyllopezus przewalskii was long considered as asubspeciesof P. pollicaris canbeattributedtothelarge overlaps in all proposed diagnostic characters: number of lamellae under the fourth toe (9 to 13 in P. pollicaris,and 8to11in P. przewalskii), ventral scales at midbody (28 to 32 in P. pollicaris, and 26 to 29 in P. przewalskii), and postcloacal tubercles at the sides of the vent (always present in P. pollicaris, not always present in adults of P. przewalskii) Figure 7: Coloration in life of the holotype (SMF 100949) of [20, 21]. According to Werneck et al. [11] none of the P. Phyllopezus heuteri. 10 International Journal of Zoology Figure 8: Candidate species present in the Brazilian State of Bahia (type locality for P. pollicaris), considering current and old borders. pollicaris clades reaches Paraguay where only P. przewalskii is of the Phyllopezus clades of Werneck et al. ([11]: last page present, but the “diagnostic” characters of Paraguayan spec- of Supporting Information file) four candidate species are imens show a variation beyond those established for either present in the Brazilian State of Bahia: Phyllopezus pollicaris P. pollicaris or P. przewalskii (Table 1). Werneck et al. [11] clades I, III, VI, and VIII. Even though Bahia was much provided evidence that the genus Phyllopezus is composed of smaller at the time when the type specimen was collected, multiple cryptic lineages, several of which are not formally still three clades remain as possible candidates for the true described as species yet and therefore were not included P. pollicaris (Figure 8). in our morphological comparisons. The name P. pollicaris To avoid confusion and get as closely as possible to the cannot confidently be assigned to any of the Werneck et al. “real” P. pollicaris sensu stricto, our characterization of P. [11] clades because the type locality Thecadactylus pollicaris pollicaris is basedontwo paralectotypes thataccordingto (“sylvis interioris Bahiae campestribus”) (Spix 1825: 17 [58]) Mul ¨ ler and Brongersma [59] were part of the original type is not precise enough. According to the distribution map series that the description of Spix (1825 [58]) is based on and International Journal of Zoology 11 came from thesamelocalityasthelectotype(ZSM2510/0, considered lost, Michael Franzen comm. pers.). Nevertheless, paralectotypes have no legal status as name-bearing types, and therefore this issue remains to be solved. Similarly, the taxonomic status of Phyllopezus goyazensis (Peters 1878) also needs to be accounted for. eTh P. goyazensis type locality of is stated as “Goyaz” in Brazil [60], which, at the time, was larger than the current boundaries of the modern Goia´s state and included what is now Goias ´ and Tocantins. Three of the putative species from Werneck et al. [11] occur in this area, clades IV, VII, and VIII. Fortunately, the P. goyazensis type is still extant (ZMB 9079), which should make assigning that name easier than the aforementioned P. pollicaris problem. Morphological differences are slight among the closest relative species of Phyllopezus (P. pollicaris, P. przewalskii,and P. heuteri), rendering it a genus with remarkable morpho- logical crypsis. Nevertheless, Phyllopezus heuteri is relatively easily distinguishable from the phylogenetically most distant species: P. lutzae, P. maranjonensis,and P. periosus,showing more resemblance with P. pollicaris and P. przewalskii.We found high variation in traditional diagnostic characters for P. przewalskii (Table 1) which overlap with those proposed for P. pollicaris [20, 21]. Nevertheless, we found some characters in head and body scalation, which allow distinguishing P. heuteri and P. przewalskii,respectively,from P. pollicaris sensu stricto. Phyllopezus heuteri and P. przewalskii are morpholog- ically similar, but there are differences in the number of scales th th between4 and5 toes andintheshapeofscalesonthe sides of the neck as well as in the prescapular region (Figure S11). Additionally, P. przewalskii seems to have the cephalic tubercles more developed but we found some intraspecicfi variation in that character. With respect to coloration, like Figure 9: Differences in coloration of P. heuteri between animals on many other geckos, P. heuteri is capable of metachrosis, which light green lichens and pinkish rock substrates (above) and animals can cause it to mimic different substrates (Figure 9). on rocks fully covered by dark green lichens (below). Phyllopezus heuteri shows a high degree of genetic differ- entiation according to p-distances, having the lowest distance to its sister clade P. przewalskii (Appendix S3). Phyllopezus pollicaris Clade VII and P. pollicaris Clade VIII have the and the split between this species and P. przewalskii (its closest smallest distances (7.77–10.53%) among all pairs of clades. relative) occurred before the latter species colonized the xero- Werneck et al. [11] found higher genetic distances even at phytic Chaco. This paper represents another contribution the intraspecicfi level with values that reach 27.5% between oriented to resolving the taxonomy of the genus Phyllopezus, haploclades of P. pollicaris Clade VIII and genetic distances of andwehopethattheunnamedcladescanbemorphologically 16.9 to 24.6% between P. pollicaris Clade VII and P. pollicaris diagnosed in further studies. Clade VIII. 6. Conclusions Appendix For almost a century, the genus Phyllopezus was considered Examined Specimens as monotypic with two subspecies, until two more species were described and more recent works revealed an even Phyllopezus lutzae (3). Brazil: Bahia:Sao ˜ Salvador (AMNH higher species-level diversity [10, 11]. We add to this growing 65381, MCZ 46190 [Syntype], UMMZ 115644 [Syntype]). knowledge with the description of a new species from a poorly sampled area at the southern margin of the distribu- Phyllopezus maranjonensis (3). Peru: Amazonas: Quebrada tional range of the genus. We highlight the importance of Honda (ZFMK 84995–7 [Paratypes]). a morphological analysis that can put practicable names on the candidate species recognized by genetic data. Phyllopezus Phyllopezus periosus (3). Brazil: Para´ıba: Cabeceiras (AMNH heuteri is a rock dweller as many other members of the genus, 131825, MCZ 172929–30). 12 International Journal of Zoology Phyllopezus pollicaris (2). Brazil: Bahia (no more specific Paraguay,Paraguay),soPierCaccialigives himaspecial locality data) (ZSM 165/0/1–2 [Paralectotypes]). acknowledgment. This work is part of an ongoing project of Barcoding of Paraguayan Herpetofauna, as part of the Ph.D. Phyllopezus przewalskii (59). Argentina: Chaco:Fuerte work of Pier Cacciali, funded by the Deutscher Akademischer Esperanza (LJAMM-CNP 12094–5). Formosa:Ingeniero Austauschdienst (DAAD, Germany). Juar ´ ez (LJAMM-CNP 12071, 12084; MACN 3230). Santiago del Estero: Pampa de los Guanacos (MACN 4999). Supplementary Materials Bolivia: Santa Cruz: San Antonio de Parapeti (MACN 47006–7, 47009–10). Tarija: Villamontes (SMF 29259–64). Appendix S1: environmental traits of Phyllopezus habitats Paraguay: (No additional data) MNHNP 11174, 11176. in Paraguay. Appendix S2: GenBank accession numbers of Alto Paraguay:Bah´ıa Negra (MNHNP 10202, 11691); Colonia sequences used in this work. Appendix S3: pairwise genetic distances (16S). Appendix S4: results of the ABGD assess- Potrerito (MNHNP 3371); Parque Nacional Defensores del th th Chaco (MNHNP 2850, 4298); Puerto Ramos (MNHNP ment. Figure S1: scales between4 and5 digital pads. Figure 3243–6, 3248–9). Amambay: Parque Nacional Cerro Cora´ S2: phylogenetic tree inferred from 16S using BI approach. (MNHNP 6983, 7046, 7640–4, 11919). Boqueron ´ :Establec- Figure S3: phylogenetic tree inferred from 16S using ML approach. Figure S4: phylogenetic tree inferred from Cytb imiento Ko’e Pyahu (MNHNP 11069); Estancia Agropil S.A. using BI approach. Figure S5: phylogenetic tree inferred (MNHNP 8042); Estancia Amistad (SMF 100495–6); from Cytb using ML approach. Figure S6: phylogenetic tree Estancia Jabal´ı (MNHNP 8043–4, 8071); Estancia MbutuR ´ eta˜ inferred from ND2 using BI approach. Figure S7: phyloge- (MNHNP 3818); Filadelfia (MNHNP 2851); Parque Nacional netic tree inferred from ND2 using ML approach. Figure S8: Teniente Enciso (MNHNP 2853, 3253, 4300, 11797, 11847, phylogenetic tree inferred from concatenated genes, using 11857). Concepcion ´ :Vallem´ı(MACN 12860–6). BI approach. Figure S9: phylogenetic tree inferred from concatenated genes, using ML approach. Figure S10: dorsal Data Availability scalation. Figure S11: head and lateral body scalation. Figure S12: ear opening. Figure S13: mental scalation. Figure S14: Sequences used for this study are stored in GenBank. See lateral scalation of the head. Figure S15: prescapular scalation. Appendix for specifications. Sequence matrices and trees are ∘ (Supplementary Materials) deposited in TreeBASE ID N 22091. References Conflicts of Interest [1] P. E. Vanzolini and A. M. M. Ramos, “A new species of eTh authors declare that they have no conflicts of interest. Colobodactylus, with notes on the distribution of a group of stranded microteiid lizards (Sauria, Teiidae),” Papeis Avulsos de Zoologia,vol.31, pp.19–47,1977. Acknowledgments [2] E.H.Bucher, “Chaco andCaatinga-SouthAmericanArid ´ ´ eTh authors’ thanks go to F. Bauer, N. Mart ınez, J. Mendez, M. Savannas, Woodlands and Thickets,” in Ecology of Tropical Ruiz D´ıaz, E. Buongermini, and D. Vazq ´ uez for help during Savannas,B.J.HuntleyandB.H.Walker, Eds.,vol.42,pp.48– field work; also to M. Motte (MNHNP), L. Avila (LJAMM- 79, Springer-Verlag, Heidelberg, Berlin, Germany, 1982. CNP),J.Faivovich (MACN),B. Alvarez (UNNEC), C. [3] M.A.Mares,M.R.Willig,and T.E. Lacher,“eTh Brazilian Caatinga in South American Zoogeography: Tropical Mammals Spencer (MVZ), D. Rodder ¨ (ZFMK), F. Glaw (ZSM), R. Nuss- in a Dry Region,” Journal of Biogeography,vol.12, no.1,pp. 57– baum (UMMZ), and D. Kizirian (AMNH) for letting them 69, 1985. analyze specimens under their care; to C. Per ´ ez (LJAMM- [4] D. E. Prado and P. E. Gibbs, “Patterns of Species Distributions CNP), A. Mar´ın (LJAMM-CNP), S. Nenda (MACN), S. in the Dry Seasonal Forests of South America,” Annals of the Palomas (UNNEC), C. Koch (ZFMK), M. Franzer (ZSM), Missouri Botanical Garden,vol.80,no.4,pp. 902–927, 1993. G. Schneider (UMMZ), L. Mogk (SMF), C. Zimmer (SMF), [5] F. Mayle, “The Late Quaternary Biogeographical History of and E. Buongermini (Subtropica, Paraguay), for help and SouthAmericanSeasonallyDry TropicalForests:Insights assistance during specimens’ revision; and to H. Kappes from Palaeo-Ecological Data,” in Neotropical Savannas and (Grunelius-Mol ¨ lgaard Labor, SMF) and B. J. Pinto (MU) for Seasonally Dry Forests: Plant Diversity, Biogeography, and Con- assistance with laboratory work. eTh Consejo Nacional de servation, R. T. Pennington, G. P. Lewis, and J. A. Ratter, Eds., Ciencia y Tecnolog´ıa (CONACYT) from Paraguay, through pp. 395–416, CRC Press, Boca Raton, Florida, 2006. the “Programa Nacional de Incentivo a los Investigadores” [6] E. E. Gutier ´ rez, R. P. Anderson, R. S. Voss, J. Ochoa-G., M. (PRONII) program, funded Pier Cacciali for fieldwork. Also, Aguilera, and S. A. Jansa, “Phylogeography of Marmosa robin- AMERISUR Paraguay provided financial support for revision soni: insights into the biogeography of dry forests in northern of scientific collections. Pier Cacciali also is grateful to South America,” Journal of Mammalogy,vol.95, no.6,pp. 1175– “Iki” (S. Saldivar) and “Chori” (V. Martınez) for delivering 1188, 2014. fieldwork equipment supplied by Idea Wild. Also thanks are [7] D. M. Neves, K. G. Dexter, R. T. Pennington, M. L. Bueno, and due to N. C. Haase for the revision of an early draft of the A. T. Oliveira Filho, “Environmental and historical controls of manuscript. This paper arose six years ago from an early floristic composition across the South American Dry Diagonal,” idea, strongly encouraged by A. Yanosky (Asociacion ´ Guyra Journal of Biogeography,vol.42, no.8,pp.1566–1576,2015. International Journal of Zoology 13 [8] F. P. Werneck, “Biogeografia Molecular e Reconstruc ¸oes ˜ Gekkonidae: Phyllopezus) from northwestern Peru,” Salaman- Espac¸o-temporais Aplicadas aos Estudo da Diversificac¸ao ˜ da dra,vol.42, no.2/3,pp.145–150,2006. BiotadaDiagonaldeFormac¸oes ˜ Abertas e Zonas de Transic¸ao ˜ ,” [24] D. E. Prado, “Seasonally dry forests of tropical South America: in Biogeografia da Am er ´ ica do Sul: Ana´lisedeTempo,Espa¸o c e From forgotten ecosystems to a new phytogeographic unit,” Forma,C.J.B.deCarvalhoand E. A.B.Almeida, Eds.,pp.141– Edinburgh Journal of Botany,vol.57,no.3,pp.437–461,2000. 156, Roca, Rio de Janeiro, 2nd edition, 2016. [25] A. L. Aquino, N. Scott, and M. Motte, “Lista de los anfibios y [9] C. E. Guarnizo, F. P. Werneck, L. G. Giugliano et al., “Cryptic lin- reptiles del Museo Nacional de Historia Natural del Paraguay,” eages and diversification of an endemic anole lizard (Squamata, in Colecciones de Fauna y Flora del Museo Nacional de Historia Dactyloidae) of the Cerrado hotspot,” Molecular Phylogenetics Natural del Paraguay,O.RomeroMart´ınez,Ed.,pp.331–400, and Evolution,vol.94, pp.279–289,2016. ´ ´ Ministerio de Agricultura y Ganaderıa, Asuncion, Paraguay, [10] T.Gamble,G.R.Colli,M.T.Rodrigues,F.P.Werneck,andA. 1996. M. Simons, “Phylogeny and cryptic diversity in geckos (Phyl- [26] P. Cacciali, N. Scott, A. L. Aquino, L. A. Fitzgerald, and P. lopezus; Phyllodactylidae; Gekkota) from South America’s open Smith, “eTh Reptiles of Paraguay: literature, distribution, and biomes,” Molecular Phylogenetics and Evolution,vol.62,no.3, an annotated taxonomic checklist,” Special Publications of the pp. 943–953, 2012. Museum of Southwestern Biology,vol.11, pp.1–373,2016. [11] F. P. Werneck, T. Gamble, G. R. Colli, M. T. Rodrigues, and J. [27] M. Culzzoni and B. B. Alvarez, “Phyllopezuspollicarisprzewal- Sites, “Deep diversification and long-term persistence in the skyi (Brazilian Gecko),” Geographic distribution. Herpetological South American “Dry Diagonal”: integrating continent-wide Review, vol. 27, p. 211, 1996. phylogeography and distribution modeling of geckos,” Evolu- [28] N. V. Ivanova, J. R. Dewaard, and P. D. N. Hebert, “An inexpen- tion,vol.66, no.10, pp.3014–3034, 2012. sive, automation-friendly protocol for recovering high-quality [12] S. R. Palumbi and F. Cipriano, “Species identification using DNA,” Molecular Ecology Notes,vol.6,no.4,pp.998–1002,2006. genetic tools: eTh value of nuclear and mitochondrial gene [29] S. Palumbi, A. Martin, S. Romano, WO. McMillan, L. Stice, sequences in whale conservation,” Journal of Heredity,vol.89, and G. Grabowski, The simple fools guide to PCR, Version 2 , no. 5, pp. 459–464, 1998. Honolulu, University of Hawaii, 2002. [13] J. A. Rudnick, T. E. Katzner, E. A. Bragin, and J. A. DeWoody, [30] B. J. Stucky, “SeqTrace: A Graphical Tool for Rapidly Processing “Species identification of birds through genetic analysis of DNA Sequencing Chromatograms,” Journal of Biomolecular naturally shed feathers,” Molecular Ecology Resources,vol.7,no. Techniques : JBT,vol.23, no.3,pp. 90–93, 2012. 5, pp. 757–762, 2007. [31] K. Katoh, K. Misawa, K. Kuma, and T. Miyata, “MAFFT: a novel [14] L. Yang, Z. Tan, D. Wang et al., “Species identification through method for rapid multiple sequence alignment based on fast mitochondrial rRNA genetic analysis,” Scienticfi Reports ,vol.4, Fourier transform,” Nucleic Acids Research,vol.30, no.14, pp. no. 1, article no. 4089, 2015. 3059–3066, 2002. [15] J. Sites and J. C. Marshall, “Delimiting species: a renaissance [32] K. Katoh and D. M. Standley, “MAFFT multiple sequence issueinsystematicbiology,” Trends in Ecology and Evolution, alignment software version 7: improvements in performance vol.18,no.9, pp.462–470,2003. and usability,” Molecular Biology and Evolution,vol.30,no.4, [16] J. H. Pinzon ´ and T. C. Lajeunesse, “Species delimitation of pp. 772–780, 2013. common reef corals in the genus Pocilloporausing nucleotide [33] K. Katoh and H. Toh, “Improved accuracy of multiple ncRNA sequence phylogenies, population genetics and symbiosis ecol- alignment by incorporating structural information into a ogy,” Molecular Ecology,vol.20, no.2,pp.311–325,2011. MAFFT-based framework,” BMC Bioinformatics,vol.9,article [17] S. Khodami, P. Martinez Arbizu, S. Sto¨hr, and S. Laakmann, no. 212, 2008. “Molecular Species Delimitation of Icelandic Brittle Stars [34] G. Yachdav, S. Wilzbach, B. Rauscher et al., “MSAViewer: Inter- (Ophiuroidea),” Polish Polar Research,vol.35,no.2,pp.243– active JavaScript visualization of multiple sequence alignments,” 260, 2014. Bioinformatics,vol.32,no.22, pp.3501–3503,2016. [18] F. Leliaert, H. Verbruggen, P. Vanormelingen et al., “DNA-based [35] D. Glez-Pena, ˜ D. Gomez-B ´ lanco, M. Reboiro-Jato, F. Fdez- species delimitation in algae,” European Journal of Phycology, Riverola, and D. Posada, “ALTER: program-oriented format vol.49,no. 2,pp.179–196,2014. conversion of DNA and protein alignments,” Nucleic Acids [19] L. G. Giugliano, C. de Campos Nogueira, P. H. Valdujo, R. G. Research, vol. 38, pp. 14–18, 2010. Collevatti, and G. R. Colli, “Cryptic diversity in South American [36] R. Lanfear, P. B. Frandsen, A. M. Wright, T. Senfeld, and B. Teiinae (Squamata, Teiidae) lizards,” Zoologica Scripta,vol.42, Calcott, “PartitionFinder 2: new methods for selecting parti- no. 5, pp. 473–487, 2013. tioned models of evolution formolecular and morphological [20] P. E. Vanzolini, “Sobre o gener ˆ o Phyllopezus Peters (Sauria, phylogenetic analyses,” Molecular Biology and Evolution,vol.34, Gekkonidae),” Papeis ´ Avulsos de Zoologia,vol.11, pp.353–369, no.3,pp. 772-773, 2016. [37] S. Guindon, J. Dufayard, V. Lefort, M. Anisimova, W. Hordijk, [21] J. A. Peters and R. Donoso-Barros, “Catalogue of the Neotrop- and O. Gascuel, “New algorithms and methods to estimate ical Squamata, Part. II; lizards and amphisbaenians,” Bulletin of maximum-likelihood phylogenies: assessing the performance the United States National Museum,no.297, pp.1–293,1970. of PhyML 3.0,” Systematic Biology,vol.59, no.3,pp.307–321, [22] M. T. Rodrigues, “Uma nova espece do genero Phyllopezus de Cabaceiras: Paraiba: Brasil; com comentarios sobre a fauna de [38] K. P. Burnham and D. R. Anderson, Model Selection and Mul- lagartos da area (Sauria Gekkonidae),” Papeis ´ Avulsos de Zoolo- timodel Inference: A Practical Information-eor Th etic Approach , gia, vol. 36, pp. 237–250, 1986. Springer-Verlag, NY, USA, 2nd edition, 2002. [23] C. Koch,P.J.Venegas,andW. Bohme ¨ , “A remarkable dis- [39] J.Sullivan,D.L.Swooff rd,andG. J. P. Naylor,“eTh eeff ctof covery: description of a big-growing new gecko (Squamata: taxon sampling on estimating rate heterogeneity parameters 14 International Journal of Zoology of maximum-likelihood models,” Molecular Biology and Evolu- [57] K. de Queiroz, eTh general lineage concept of species, species tion,vol.16,no.10, pp.1347–1356,1999. criteria, and the process of speciation,D.J.Howardand H.B. Stewart, Eds., Oxford University Press, 1998. [40] I. Mayrose, N. Friedman, and T. Pupko, “A gamma mixture model better accounts for among site rate heterogeneity,” [58] J. B. Spix, “Animalia nova sive species nova lacertarum quas in itinere per Brasiliam annis MDCCCXVII-MDCCCXX jussu et Bioinformatics, vol. 21, no. 2, pp. ii151–ii158, 2005. auspiciis Maximiliani Josephi I Bavariae Regis suscepto collegit [41] Z. Yang, Computational Molecular Evolution. Oxford Series in et descripsit Dr. J. B. de Spix. Monacco,” 1825. Ecology and Evolution,2006. [59] L. Muller ¨ and L. D. Brongersma, “Ueber die Identitat ¨ von [42] J.Yan,C. Tian,L.Lv, A.M. Bauer, andK.Zhou,“Complete eTh cadactylus pollicaris Spix 1825 mit Phyllopezus goyazensis mitochondrial genome of the San Lucan gecko, Phyllodactylus Peters 1877,” Zoologische Mededelingen,vol.15,pp.156–161,1933. unctus (Sauria, Gekkota, Phyllodactylidae), in comparison with [60] W. Peters, “Herpetologische Notizen. II. Bemerkungen ub ¨ er Tarentola mauritanica,” Mitochondrial DNA,vol.25, no.3,pp. neue oder weniger bekannte Amphibien,” Monatsberichte der 202-203, 2014. Kon ¨ iglich Preussischen Akademie der Wissenschaen ft zu Berlin , [43] S. Kumar, G. Stecher, and K. Tamura, “MEGA7: Molecular pp.415–423,1878. Evolutionary Genetics Analysis version 7.0 for bigger datasets,” Molecular Biology and Evolution,vol.33, no.7,pp.1870–1874, [44] J. P. Huelsenbeck and F. Ronquist, “MrBayes: Bayesian inference of phylogenetic trees,” Bioinformatics,vol.17, no.8,pp.754-755, [45] F.Ronquist andJ.P.Huelsenbeck,“MrBayes3:bayesianphylo- genetic inference under mixed models,” Bioinformatics,vol.19, no. 12, pp. 1572–1574, 2003. [46] A. G. Gelman and D. B. Rubin, “Inference from iterative simulation using multiple sequences,” Statistical Science,vol.7, no. 4, pp. 457–472, 1992. [47] J. Trifinopoulos, L.-T. Nguyen, A. von Haeseler, and B. Q. Minh, “W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis,” Nucleic Acids Research,vol.44, no.1,pp. W232–W235, 2016. [48] B.Q.Minh,M.A.T.Nguyen, andA.vonHaeseler,“Ultrafast approximation for phylogenetic bootstrap,” Molecular Biology and Evolution,vol.30, no.5,pp. 1188–1195,2013. [49] A. J. Drummond, M. A. Suchard, D. Xie, and A. Rambaut, “Bayesian phylogenetics with BEAUti and the BEAST 1.7,” Molecular Biology and Evolution,vol.29,no.8,pp.1969–1973, [50] H. A. Ogilvie, R. R. Bouckaert, and A. J. Drummond, “Star- BEAST2 brings faster species tree inference and accurate estimates of substitution rates,” Molecular Biology and Evolution, vol.34,no. 8,pp.2101–2114,2017. [51] R. R. Bouckaert and J. Heled, “DensiTree 2: Seeing trees through the forest,” BioRxiv,2014. [52] N. Puillandre, A. Lambert, S. Brouillet, and G. Achaz, “ABGD, Automatic Barcode Gap Discovery for primary species delimi- tation,” Molecular Ecology,vol.21, no.8,pp.1864–1877,2012. [53] M. Kekkonen,M.Mutanen,L.Kaila,M.Nieminen,and P. D. N. Hebert, “Delineating species with DNA barcodes: A case of Taxon dependent method performance in moths,” PLoS ONE, vol. 10, no. 4, Article ID e0122481, 2015. [54] Z. Yang, J.-F. Landry, and P. D. N. Hebert, “A DNA bar- code library for North American Pyraustinae (Lepidoptera: Pyraloidea: Crambidae),” PLoS ONE,vol.11, no.10, ArticleID e0161449, 2016. [55] G. Kohler, ColorCatalogue forFieldBiologists,Herpeton, Offenbach, Germany, 2012. [56] M. H. Sabaj Per ´ ez, Standard symbolic codes for institutional resource collections in herpetology and ichthyology: an Online Reference. Version 5.0, American Society of Ichthyologists and Herpetologists, 2014, http://www.asih.org/, Accessed 10 Apr 2017. International Journal of Journal of Nucleic Acids Peptides The Scientific International Journal of International Journal of World Journal Cell Biology Microbiology Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi Hindawi http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Anatomy Biochemistry Research International Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com Advances in Genetics Bioinformatics Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Advances in International Journal of International Journal of Stem Cells BioMed Zoology Virolog y Genomics International Research International Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Neuroscience Journal Enzyme Journal of Journal of Research Parasitology Research Marine Biology Archaea Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal

International Journal of ZoologyHindawi Publishing Corporation

Published: Jul 16, 2018

References