Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/hindawi-publishing-corporation/cndp1-nos3-and-mnsod-polymorphisms-as-risk-factors-for-diabetic-LkDkO40gY5
References
References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.
- Publisher
- Hindawi Publishing Corporation
- Copyright
- Copyright © 2019 Mohd Jokha Yahya et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
- ISSN
- 2090-0724
- eISSN
- 2090-0732
- DOI
- 10.1155/2019/8736215
- Publisher site
- See Article on Publisher Site
Abstract
Hindawi Journal of Nutrition and Metabolism Volume 2019, Article ID 8736215, 13 pages https://doi.org/10.1155/2019/8736215 Research Article CNDP1, NOS3, and MnSOD Polymorphisms as Risk Factors for Diabetic Nephropathy amongType 2 DiabeticPatients in Malaysia 1 2 1 Mohd Jokha Yahya , Patimah Binti Ismail, Norshariza Binti Nordin , 1 3 3 Abdah Binti Md Akim, Wan Shaariah Binti Md Yusuf, Noor Lita Binti Adam, and Nurul Fasihah Zulkifli Department of Biomedical, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Seri Kembangan, Malaysia Department of Human Development and Growth, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Seri Kembangan, Malaysia Department of Medicine, Department of Medicine (Endocrinology & Nephrology), Hospital Tuanku Ja’afar, Seremban, Malaysia Correspondence should be addressed to Mohd Jokha Yahya; mohdjokhayahya@gmail.com Received 24 September 2018; Revised 13 November 2018; Accepted 26 November 2018; Published 3 January 2019 Academic Editor: Jose´ Mar´ıa Huerta Copyright © 2019 Mohd Jokha Yahya et al. /is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Type 2 diabetes mellitus (T2DM) is associated with a high incidence of nephropathy. /e aim of this study was to investigate the association of a genetic polymorphism of carnosinase (CNDP1-D18S880 and -rs2346061), endothelial nitric oxide synthase (NOS3-rs1799983), and manganese superoxide dismutase (MnSOD-rs4880) genes with the development of diabetic nephropathy among Malaysian type 2 diabetic patients. A case-control association study was performed using 652 T2DM patients comprising 227 Malays (without nephropathy � 96 and nephropathy � 131), 203 Chinese (without nephropathy � 95 and nephropathy � 108), and 222 Indians (without nephropathy � 136 and nephropathy � 86). DNA sequencing was performed for the D18S880 of CNDP1, while the rest were tested using DNA Sequenom MassARRAY to identify the polymorphisms. DNA was extracted from the secondary blood samples taken from the T2DM patients. /e alleles and genotypes were tested using four genetic models, and the best mode of inheritance was chosen based on the least p value. /e rs2346061 of CNDP1 was significantly associated with diabetic nephropathy among the Indians only with OR � 1.94 and 95% CI � (1.76–3.20) and fitted best the multiplicative model, while D18S880 was associated among all the three major races with the Malays having the strongest association with OR � 2.46 and 95% CI � (1.48–4.10), Chinese with OR � 2.26 and 95% CI � (1.34–3.83), and Indians with OR � 1.77 and 95% CI � (1.18–2.65) in the genotypic multiplicative model. /e best mode of inheritance for both MnSOD and NOS3 was the additive model. For MnSOD- rs4880, the Chinese had OR � 2.8 and 95% CI � (0.53–14.94), Indians had OR � 2.4 and 95% CI � (0.69–2.84), and Malays had OR � 2.16 and 95% CI � (0.54–8.65), while for NOS3-rs1799983, the Indians had the highest risk with OR � 3.16 and 95% CI � (0.52–17.56), followed by the Chinese with OR � 3.55 and 95% CI � (0.36–35.03) and the Malays with OR � 2.89 and 95% CI � (0.29–28.32). /e four oxidative stress-related polymorphisms have significant effects on the development of nephropathy in type 2 diabetes patients. /e genes may, therefore, be considered as risk factors for Malaysian subjects who are predisposed to T2DM nephropathy. DM patients in nearly all countries [2]. In Malaysia, the 1. Introduction dramatic prevalence leap for diabetes from 11.6% in 2006 [3] /e global obesity rates have reached an epidemic proportion to 22.9% in 2011 [4] has alarmingly exceeded the postulated [1] the same way diabetes mellitus (DM) has become a global level (13.4%) for the population for 2025 by the World Health health problem. /e continuously changing lifestyles which Organization diagnostic criteria [2]. have led to reduced physical activity and increased obesity are One of the microvascular complications of DM is di- mainly responsible for the significant increase in numbers of abetic nephropathy (DN) or diabetic kidney disease, a 2 Journal of Nutrition and Metabolism associated with diabetic nephropathy susceptibility are gene syndrome characterized by the presence of pathological quantities of urine albumin excretion, diabetic glomerular G894T missense mutation (rs1799983), a 27 bp repeat in intron 4, and the T786C single-nucleotide polymorphism lesions, and loss of glomerular filtration rate (GFR) in di- abetics [5, 6]. Unfortunately, detecting the early symptoms (SNP) in the promoter (rs2070744). Despite some contra- of nephropathy is almost impossible in diabetic patients dictions, G894T (rs1799983) is the most common poly- particularly when the onset of diabetes is unknown. /us, morphism to have an association with T2DM nephropathy, this may result in poor early patient management and especially among the East Asians [19]. Polymorphism of eventually cause rapid kidney deterioration. Usually, most G894T causes a missense substitution in exon 7 which patients are unaware of being diabetic and nephropathy has modifies the activity of eNOS. Manganese superoxide dismutase (MnSOD), also already manifested when they are diagnosed. /e exact etiology or biochemical pathology of type 2 diabetes mellitus known as superoxide dismutase 2 (SOD2), is a mito- chondrial protein. MnSOD is expressed by its genes which (T2DM) nephropathy is impossible to be determined im- mediately with the simple existing tests. are located in chromosome 6q25. /e SNP C to T, C47T, is registered as rs4880 in exon 2, resulting in MnSOD with an Furthermore, 91% of diabetic patients are diagnosed or have been diagnosed as diabetic nephropathy, and 50% of amino acid substitution of valine with alanine at position dialysis patients are a result of T2DM complications [7, 8]. 16 (Val16Ala). MnSOD protects cells from oxidative stress /e rise of the T2DM is due to an increase in overweight and that can cause damage by scavenging free radicals. /e obesity factors as a result of an unhealthy lifestyle. Various genetic variation of rs4880 SNP has been associated with strategies have thus been established by the Malaysian diabetes and some of its complications such as cardio- government to overcome the increasing number of diabetes vascular disease, nephropathy, neuropathy, and retinopa- thy [20, 21]. cases by focusing particularly on healthy lifestyle pro- motions and screening for diabetes and complications in the /e aim of this study was, therefore, to investigate the association of a genetic polymorphism of CNDP1-D18S880 population [9]. Dyslipidemia, hypertension, and glycemic control are and -rs2346061, NOS3-rs1799983, and MnSOD-rs4880 genes with the development of diabetic nephropathy among generally modifiable risk factors for most chronic diseases, while the main unmodifiable risk factors are age, race, and Malaysian type 2 diabetic patients. genetic profile [10–12]. /erefore, DN is more likely to develop in patients with a family history of DN. A meta- 2. Materials and Methods analysis has also identified 24 genetic variants in 16 genes as being associated with DN [5]. T2DM has also become the A case-control association study between cases with ne- most prevalent metabolic disease globally being a multi- phropathy and controls without nephropathy of T2DM factorial disorder as a result of the interaction of the en- patients was used. /e study conforms to the items of the vironmental factors with the individual’s genetic Declaration of Helsinki and was approved by the National background [13]. Some common examples of genes which Medical Research Register (NMRR) of Ministry of Health link oxidative stress to diabetic nephropathy are carnosinase, Malaysia (KKM) with reference number (2) DLM.KKM/ endothelial nitric oxide synthase, and manganese superoxide NIHSEC/08/0804/P12-519. A written and signed informed dismutase genes. consent was obtained from all the nephrotic T2DM sub- Carnosinase dipeptidase 1 (CNDP1) and carnosinase jects (cases), while consent forms were also obtained from dipeptidase 2 (CNDP2) genes lie adjacently in chromosome all of the nonnephrotic T2DM subjects (controls) who 18 at 18q22.3. CNDP1 encodes for carnosinase dipeptidase 1 enrolled in the current study. /is study was carried out on that specifically degrades carnosine to β-alanine and T2DM Malaysian subjects from three major ethnic groups, L-histidine in the serum, while CNDP2 encodes for a namely, Malays, Chinese, and Indians. Both case and nonspecific carnosinase in the tissue [14]. Carnosine control subjects were recruited from the outpatients of the (β-alanyl-L-histidine) acts as a protector to renal against Medical Clinic of Hospital Tuanku Ja’afar Seremban nephropathy among diabetic patients by scavenging oxygen (HTJS), Negeri Sembilan, Malaysia. Patients were from species. One of the major causes of vascular pathology in nearby states such as Melaka, Negeri Sembilan, Southern diabetes, however, is mitochondrial overproduction of ROS Selangor, and also Kuala Lumpur. [15]. /us, carnosine helps to lower ROS levels which inhibit the formation of AGEs and reduce production of TGFβ, thereby preventing the risk of nephropathy among the 2.1. Sampling Method. More than 1000 T2DM patients’ T2DM patients [16]. Another polymorphism that had shown records were screened from the medical outpatient de- association with nephropathy is at the promoter region of partment in HTJS. A total of 820 were found to be suitable CNDP1 identified as rs2346061 [17]. and available for the research, but only 652 were actually NO is an important product of endothelium cells syn- tested belonging to the three different ethnic groups in thesized by the enzymatic reaction and catalyzed by the Malaysia: the Chinese, 203 samples; Malays, 227 samples; endothelial nitric oxide synthase (eNOS) from L-arginine. and Indians, 222 samples. Either the remaining 178 in- eNOS is expressed by the eNOS gene which is located in dividuals were not interested to be part of the research or the chromosome 7q35-q36 and contains 26 exons with a total quality of the blood samples collected or the DNA extracted length of 21 kB [18]. /e three polymorphisms found to be was compromised. /e selection of the samples was based on Journal of Nutrition and Metabolism 3 the inclusion and exclusion criteria for nephropathy (case) 3. Results and nonnephropathy (control) as shown in Table 1 and also 3.1. Characteristics of T2DM Sampling Subjects. /e subjects on expert opinions of the specialists in the endocrinology comprised 227 Malays, 203 Chinese, and 222 Indians from a and nephrology clinics. Only interested patients with signed total of 652 T2DM patients. /e number of samples was consents were allowed to participate in this research. Pa- almost evenly distributed among the three races, although tients were allowed to withdraw from the research if they the figures do not reflect the true sociodemographic dis- wanted to. tribution of the ethnics in the population. /e number of samples was to fulfill the requirement for the statistical analysis. /e age range of the Malay T2DM subjects was 2.2. DNA Extraction and Genotyping. /e blood samples between 32 and 83 years, with a mean of 59.0 ± 8.23; the used were secondary samples taken from the laboratory Chinese was between 36 and 89 years, with a mean of 63.28± tested for HbA1C for T2DM patients who came for their 11.56; and the Indians was between 35 and 86 years, with a routine visits. /e samples were with ethylenediamine mean of 61.33 ± 10.1. A majority of the subjects were aged tetraacetic acid (EDTA) anticoagulant Vacutainer tubes between 58 and 64 years (77.5%). Furthermore, there were and stored at −20 C for DNA extraction and analysis. 121 (53.3%) Malay males and 106 (46.7%) females; 107 Patients’ most recent biochemical results were obtained (52.7%) Chinese males and 96 (47.3%) females; and 113 from the laboratory information system (LIS) in the De- (50.9%) Indian males and 109 (49.1%) females. T2DM ne- partment of Pathology. /e laboratory is accredited and phropathy patients were selected basically by the AER more certified under MS ISO 15189. /e patients’ demography than 300 mg/24 h. Samples with less than 300 mg/24 h AER was obtained from the patients’ records. Genomic DNA were not considered. Patients were not staged according to was extracted using a commercial DNA extraction kit the development of nephropathy as the aim of this study was (QIAGEN, USA). DNA genotyping included the DNA to observe the effects of polymorphism as risk factors. /e extraction, quantification, impurity testing, and amplifi- patients’ biochemical level retrieved from the laboratory cation. /e SNP genotyping was carried out using the information system was to avoid bias in the sampling. /e Sequenom MassARRAY iPLEX platform, while sequence biochemistry of the patients is described in Table 3. analysis was done using Sanger sequencing to detect the five CTG repeats on CNDP1-D18S880 only. /e primer was derived by Ahluwalia et al. [17]. /e sequence of primers 3.2. Demographic Characteristics of the Study Subjects. and size of the PCR products used for the genotyping are /e clinical demographics of the subjects in this study are listed in Table 2. shown in Table 3. Although all the races showed similar characteristics, there were, however, significant differences (p< 0.05) between cases and controls in AER, total cho- 2.3. Statistical Analysis. All statistical genetic analyses were lesterol, and HDL. However, no significant difference performed using the Statistical Package for the Social (p> 0.05) was observed in the duration of diabetes, glycated Sciences version 17.0 (SPSS v17.0). /e frequencies of hemoglobin concentration, fasting blood glucose, LDL, and alleles and genotypes were studied by means of descriptive triglycerides level in the T2DM cases and controls. /ere was and inferential statistics to compare between cases and a significant difference (p< 0.01) only in the glycated he- controls. One-way analysis of variance (ANOVA) was used moglobin (HbA1C) concentration and glycemic control in to test the differences between the clinical data. Pearson’s comparison of the biochemical parameters among the races chi-square goodness-of-fit test was used to test whether the using one-way ANOVA (data not shown). /e Chinese, controls were in a Hardy–Weinberg equilibrium (HWE) however, had the worst glycemic control in both cases and and also to test the distribution of the variants. /e ge- controls. notype frequencies for each SNP were tested using con- ventional Pearson’s chi-square test for independence with df � 2 to determine the association with T2DM ne- 3.3. Genotyping of Polymorphisms. /ere were only two phropathy. A p< 0.05 (two-tailed) was considered as the variables: 5CTG and 6CTG repeats, found in the entire criterion of statistical significance. /e Fisher exact test 2 × population, and the distribution of the genotype was in 3 was performed when more than 20% of the cells had patterns of 5-5, 5-6, and 6-6. /e other polymorphisms expected values less than 5, while test 2 × 2 was performed were tested by the MassARRAY, and the homozygous and when more than 20% of the cells had expected values less heterozygous genotypes were interpreted by the observa- than 10. /e significant SNPs were further tested using 3 tion of peaks produced in the chromatogram. /e results types of the model using chi-square with df � 1. Further are shown in Table 4 (Supplementary Materials (available testing was done using the Cochran–Armitage trend test. here)). /e strength of association or the risk of developing di- abetic nephropathy was determined by the odds ratio (OR) with corresponding 95% confidence interval (CI). /e OR 3.4. Chi-Square Test of Genotype and Allele Association. is calculated using VassarStats, an online statistical com- In this study, all controls were tested for HWE, and the results putation website. /e mode of inheritance was determined showed that all the controls were in the HWE with p> 0.05 as by choosing the model with the least p value. shown in Table 5. For the carnosinase gene (CNDP1), 4 Journal of Nutrition and Metabolism Table 1: Inclusion and exclusion criteria. Inclusion criteria of without nephropathy No. Inclusion criteria of nephropathy group Exclusion criteria group 1 Biologically unrelated Biologically unrelated Biologically related 2 Age onset ≥ 35 years Age onset ≥ 35 years Age onset ≤ 35 years 3 Diabetes duration ≥ 10 years Diabetes duration ≥ 10 years Diabetes duration ≤ 10 years 4 Fasting plasma glucose ≥ 7.0 mmol/L Fasting plasma glucose ≥ 7.0 mmol/L Normal fasting glucose level 5 Albumin excretion rate > 300 mg/24 h Albumin excretion rate < 30 mg/24 h Nondiabetic and normal rate Albumin creatinine ratio is >3.5 mg/mmol Albumin creatinine ratio is <3.5 mg/mmol Patients without renal symptoms with a for women and >2.5 mg/mmol for men for women and <2.5 mg/mmol for men duration of <10 years of diabetes Unclear of renal damage and ESRD or non- 7 ESRD of T2D patients Non-ESRD of T2DM patients ESRD of T1DM patients 8 Glycated hemoglobin (HbA1c) > 6.6% Glycated hemoglobin (HbA1c) ≤ 6.5% Glycated hemoglobin (HbA1c) < 6.5% ESRD � end-stage renal disease; T2DM � type 2 diabetes mellitus; T1DM � type 1 diabetes mellitus. Table 2: Sequence of primers and size of the PCR products used for the genotyping. PCR No. SNP Forward Reverse products ( C) (bp) 1 rs2346061 ACGTTGGATGTGATGTTCTCCCTGTGTATG ACGTTGGATGATGGACCCCTGATTACACAC 100 46.8 2 rs4880 ACGTTGGATGTTCTGCCTGGAGCCCAGATA ACGTTGGATGGGCTGTGCTTTCTCGTCTTC 93 54.5 3 rs1799983 ACGTTGGATGTGCATTCAGCACGGCTGGAC ACGTTGGATGGGGCAGAAGGAAGAGTTC 119 59.9 Table 3: Clinical and demographic characteristics of type 2 diabetic patient samples. Malays (n � 227) Chinese (n � 203) Indians (n � 222) Characteristic With Without With Without With Without p value p value p value nephropathy nephropathy nephropathy nephropathy nephropathy nephropathy Number of samples 131 (57.7%) 96 (42.3%) — 108 (53.2%) 95 (46.8%) — 86 (38.7%) 136 (61.3%) — Duration of 16.1 ± 6.8 15.5 ± 5.1 0.061 16.6 ± 6.7 16.8 ± 6.6 0.060 17 ± 5.1 16.8 ± 5.0 0.070 diabetes (years) Albumin excretion 1363.18 ± 1952.50 ± 1756 ± ∗ ∗ ∗ 25.83 ± 2.10 <0.005 23.00 ± 5.70 <0.005 26.67 ± 1.9 <0.005 rate (g/24 h) 136.00 144.30 155.44 Glycated 8.67 ± 2.34 9.07 ± 1.97 0.087 9.19 ± 2.31 9.45 ± 2.56 0.176 7.79 ± 2.08 8.30 ± 1.63 0.192 hemoglobin (%) Fasting blood 9.91 ± 3.3 9.86 ± 3.70 0.327 9.60 ± 2.10 8.6 ± 3.70 0.251 9.8 ± 0.137 8.78 ± 3.69 0.137 glucose (mmol/L) Total cholesterol ∗ ∗ ∗ 6.42 ± 1.37 4.84 ± 1.01 0.002 6.58 ± 1.19 4.26 ± 1.13 0.003 6.48 ± 1.42 4.74 ± 1.23 0.004 (mmol/L) HDL cholesterol ∗ ∗ ∗ 1.02 ± 0.39 1.22 ± 0.26 0.001 1.01 ± 0.24 1.11 ± 0.24 0.003 1.16 ± 0.25 1.29 ± 0.26 0.001 (mmol/L) LDL cholesterol 2. 45 ± 1.25 2.82 ± 1.10 0.732 2.69 ± 1.05 2.53 ± 0.90 0.491 2.61 ± 1.25 2.60 ± 1.06 0.626 (mmol/L) Triglycerides 1.85 ± 0.80 2.07 ± 1.81 0.168 1.72 ± 0.64 1.36 ± 0.80 0.844 1.55 ± 0.67 1.87 ± 0.87 0.393 (mmol/L) p< 0.05 shows a significant difference. −5 D18S880 genotype associated with nephropathy in the Malays Chinese only (p � 7.4 × 10 ), and rs4073 has a significant (p � 0.026), Chinese (p � 0.0171), and Indians (p � 0.0095) difference in the Indians only; for the genotype (p � 0.0200), (Table 6), as supported by the alleles in Malays (p � 0.0004), the Indians (p � 0.0047) and Chinese (p � 0.0033) showed a Chinese (p � 0.0019), and Indians (p � 0.0055). On the genotypic significant difference for rs17576 but the Malays did contrary, for rs2346061 of the same gene, only the Indians not. /e allele had a significant difference among the Chinese showed association (p � 0.0488). /e rs4880 showed geno- (p � 0.0013) and Indians (p � 0.0033). typic association among the Malays (p � 0.0450), Chinese −5 (p � 0.0380), and Indians (p � 49.2 × 10 ) with nephropa- thy. As for rs1799983, it showed significant association of 3.5. Dominant and Recessive Models. /e association of the genotypes among the Malays (p � 0.0158), Chinese genotypes was then stratified against the dominant and (p � 0.0146), and Indians (p � 0.6174). /e rs1799987 ge- recessive models as shown in Table 6. /e genotypic var- notype was observed to have a significant difference in the iants showed a significant association of nephropathy with Journal of Nutrition and Metabolism 5 Table 4: Differences in the frequencies of allele distribution among the races. Control Case SNP p value p value Malays Chinese Indians Malays Chinese Indians 2 2 (χ , df � 2) (χ , df � 2) A � A � C � A � A � C � A � C � C � ∗ ∗ CNDP1 C � 31 C � 41 0.028 A � 94 0.042 161 140 50 187 213 49 161 49 40 rs2346061 (83.9) (16.1) (73.7) (26.3) (82.0) (18.0) 7.1 (81.3) (18.7) (76.7) (23.3) (70.1) (29.9) 6.32 6 � 6 � 6 � 6 � 6 � 6 � ∗ ∗ CNDP1 5 � 45 5 � 43 5 � 118 <0.05 5 � 29 5 � 27 5 � 52 <0.001 147 147 154 233 209 120 D18S880 (23.4) (76.6) (22.6) (77.4) (43.4) (56.6) 30.51 (11.1) (88.9) (11.4) (88.6) (30.2) (69.8) 34.1 C � T � C � T � C � C � C � C � MnSOD T � 38 0.920 T � 59 T � 47 T � 41 0.942 166 26 167 23 232 203 153 131 rs4880 (86.5) (13.5) (87.9) (12.1) (85.93) (14.07) 0.01 (77.5) (22.5) (78.2) (21.8) (76.2) (23.8) 0.12 G � T � G � T � G � G � G � G � NOS3 T � 38 0.842 T � 57 T � 51 T � 41 0.878 166 26 166 26 236 202 165 131 rs1799983 (86.5) (13.5) (86.5) (13.5) (85.5) (14.5) 0.04 (78.0) (22.0) (76.4) (23.6) (76.2) (23.8) 0.26 p< 0.05 indicates the significant difference in allele distribution in the population. the D18S880 recessive model among Malays (p � 0.0006), for a variant v and 2r for vv. /e characteristics could be Chinese (p � 0.0075), and Indians (p � 0.0132). On the observed in the odds ratio calculated as in Table 7. contrary, the dominant model did not show any association among the Malays (p � 0.1302) and Chinese (p � 0.0540) but not among the Indians (p � 0.0132), as in DN as 3.7. Strength of Association. It was observed that rs2346061 was associated with the Indians only. /e best mode of in- compared in cases and controls. /e rs17576 showed an heritance is multiplicative with OR � 1.94 and 95% CI � association with nephropathy among the Chinese (p � 0.002) and Indians (p � 0.0169) using the recessive (1.76–3.20) tested with the Cochran–Armitage trend. For the CNDP1-D18S880 among the three races, the Malays had the model. In the dominant model, the Chinese (p � 0.0221) showed an association, but the Indians did not strongest association with OR � 2.46 and 95% CI � (1.48– 4.10), followed by the Chinese with OR � 2.26 and 95% CI � (p � 0.0512). Meanwhile, rs1799987 showed significant −5 association in both dominant (p � 9.2 × 10 ) and recessive (1.34–3.83) and the Indians with OR � 1.70 and 95% CI � (1.18–2.65), as in the genotypic multiplicative model. /is (p � 0.0021) models among the Chinese only. As for rs4073, it did not show any association in both recessive could be observed from Table 7 where the Malays showed the strongest association of variants towards nephropathy in (p � 0.678) and dominant (p � 0.876) models among the T2DM patients. /e same could be observed in the recessive Indians. model, in Malays with OR � 2.76 and 95% CI � (1.53–4.99), Indians with OR � 1.25 and 95% CI � (0.65–2.40), and 3.6. Cochran–Armitage’s Trend Test. For best understanding Chinese with OR � 1.07 and 95% CI � (0.63–1.83). of the mode of inheritance and to calculate the additive /e recessive model does not represent D18S880 asso- model association, the association was tested for the trend ciation well due to the weaker strength of the association using Cochran–Armitage’s trend test (C-ATT). From shown. On the contrary, good representation of OR could be Table 7, it can be seen that the best model fit for D18S880 observed in the dominant model among Malays with OR � was multiplicative for all the races: Malays (p � 0.0004), 2.84 and 95% CI � (1.16–3.75) and Indians with OR � 3.74 Chinese (p � 0.0019), and Indians (p � 0.005). For other and 95% CI � (1.24–11.32) but not for the Chinese where OR variants, the best model was the additive. /e best model � 1.90 and 95% CI � (0.49–7.39). /e additive model was not applicable to this variant as the chi value was negative. was chosen based on the least p value compared to the other models. For the MnSOD-rs4880 variant, the best model that fits the association was additive to the Malays having OR � 1.037 /e D18S880 showed that the variants (6CTG) behaved dominantly (p � 0.0006) than recessively (p � 0.1309), but and 95% CI � (0.24–4.43) per copy of T and OR � 2.16 and by using C-ATT, the variant behaved more towards being 95% CI � (0.54–8.65) as the copy doubled. /e Chinese multiplicative with p � 0.0004. /e same model behavior showed a strong association in the additive model with OR � could be observed in Chinese and Indians. /e same was 1.28 and 95% CI � (0.23–7.25) per copy of T and OR � 2.8 observed for rs2346061 and the mode of inheritance that best and 95% CI � (0.53–14.94) as the copy doubled. Meanwhile, suited was multiplicative with p � 0.0396, while the other the Indians additive model showed association strength with models were not showing association with nephropathy. As OR � 1.16 and 95% CI � (0.32–4.23) per copy of T and OR � for the rest of the variants, the model that best suited the 2.4 and 95% CI � (0.69–8.24) as the copy doubled. From Table 7, it can be seen that the Chinese have the strongest association was an additive model. /e polymorphisms obeyed the additive genetic model and increased the risk of r association of rs4880 followed by the Indians and Malays. 6 Journal of Nutrition and Metabolism Table 5: Hardy–Weinberg equilibrium test for the controls and cases. Malays Chinese Indians Control Statistic Control Statistic Control Statistic SNP Major/ Major/ Minor/ p Major/ Major/ Minor/ p Major/ Major/ Minor/ p 2 2 2 χ df χ df χ df major minor minor value major minor minor value major minor minor value Control CNDP1 AA � 68 CA � 25 CC � 3 AA � 53 CA � 34 CC � 8 AA � 74 CA � 37 CC � 2 0.140 0.7083 1 3.370 0.0664 1 1.185 0.2763 1 rs2346061 (70.8) (26.0) (3.1) (55.8) (35.8) (8.4) (65.5) (32.7) (1.8) CNDP1 5-5 � 6 6-5 � 33 6-6 � 57 5-5 � 8 6-5 � 27 6-6 � 60 5-5 � 21 6-5 � 76 6-6 � 39 0.171 0.6792 1 3.372 0.0663 1 2.574 0.1086 1 D18S880 (6.2) (34.4) (59.4) (8.4) (28.4) (63.2) (15.4) (55.9) (28.7) MnSOD CC � 73 TC � 20 TT � 3 CC � 74 TC � 19 TT � 2 CC � 102 TC � 28 TT � 5 1.168 0.2798 1 0.439 0.5076 1 2.740 0.0979 1 rs4880 (76.0) (20.8) (3.2) (77.9) (20.0) (2.1) (75.6) (20.7) (3.7) NOS3 GG � 71 GT � 24 TT � 1 GG � 71 GT � 24 TT � 1 GG � 101 GT � 34 TT � 2 0.439 0.5076 1 1.904 0.1676 1 0.206 0.6499 1 rs1799983 (74.0) (33.0) (1.0) (74.0) (25.0) (1.0) (73.7) (24.8) (1.5) Case CNDP1 AA � 87 CA � 39 CC � 5 AA � 61 CA � 39 CC � 5 AA � 33 CA � 30 CC � 4 0.057 0.8102 1 0.152 0.6958 1 0.697 0.4039 1 rs2346061 (66.4) (29.8) (3.8) (58.1) (36.2) (8.9) (49.2) (44.8) (6.0) CNDP1 5-5 � 3 6-5 � 23 6-6 � 105 5-5 � 3 6-5 � 21 6-6 � 94 5-5 � 4 6-5 � 44 6-6 � 38 1.533 0.2156 1 1.749 0.1860 1 3.895 0.0484 1 D18S880 (2.3) (17.6) (80.1) (2.5) (17.8) (79.7) (4.7) (51.2) (41.1) MnSOD CC � 79 TT � 45 TT � 7 CC � 66 TC � 37 TT � 5 CC � 51 TC � 29 TT � 6 0.032 0.8582 1 0.004 0.9490 1 0.4373 0.5084 1 rs4880 (60.3) (34.3) (5.4) (61.1) (34.3) (4.6) (59.3) (33.7) (5.8) NOS3 GG � 74 GT � 54 TT � 3 GG � 60 GT � 45 TT � 3 GG � 48 GT � 35 TT � 3 3.668 0.0555 1 0.9091 0.3404 1 1.256 0.2625 1 rs1799983 (56.5) (41.2) (2.3) (55.6) (41.7) (2.7) (58.8) (40.7) (3.5) p> 0.05 shows consistency with HWE. Genotype data are presented as a number of subjects (%). Journal of Nutrition and Metabolism 7 Table 6: Association of polymorphism in T2DM with and without nephropathy. Malays Chinese Indians Multiplicative Multiplicative Multiplicative Dominant Recessive Dominant Recessive Dominant Recessive 2 model model model model model model model model model CNDP1 χ Minor/ rs2346061 Major/major Genotype Allele Major/major vs. Minor/minor vs. Genotype Allele Major/major vs. Minor/minor vs. Genotype Allele minor vs. vs. others (df � 2) (df � 1) others (df � 1) others (df � 1) (df � 2) (df � 1) others (df � 1) others (df � 1) (df � 2) (df � 1) others (df � 1) (df � 1) CNDP1 χ — 0.499 0.566 — 1.242 0.476 0.325 1.099 — 6.844 4.597 — ∗ ∗ ∗ rs2346061 p 0.7883 0.4799 0.4518 0.5410 0.5374 0.4902 0.5686 0.2944 0.0488 0.0089 0.0320 0.1390 CNDP1 χ 11.894 12.425 2.282 11.704 8.141 9.600 3.714 7.157 9.318 7.711 6.138 6.138 ∗ ∗ ∗ ∗ ∗ ∗ ∗ ∗ ∗ ∗ D18S880 p 0.0026 0.0004 0.1302 0.0006 0.0171 0.0019 0.0540 0.0075 0.0095 0.0055 0.0132 0.0132 MnSOD χ 6.203 5.868 6.201 0.647 — 6.603 0.967 8.423 15.235 16.301 10.689 7.238 49.2 × 5.4 × ∗ ∗ ∗ ∗ ∗ ∗ ∗ ∗ rs4880 p 0.0450 0.0154 0.0128 0.4210 0.0380 0.0101 0.3254 0.0037 0.0011 0.0071 25 25 ∗ ∗ 10 10 NOS3 χ — 5.263 0.499 — — 6.731 7.490 — — 7.204 7.642 — ∗ ∗ ∗ ∗ ∗ ∗ ∗ ∗ rs1799983 p 0.0158 0.0218 0.4799 0.4350 0.0146 0.0095 0.0062 0.6667 0.0174 0.0073 0.0057 0.4518 p< 0.05 indicates an association of polymorphisms and disease in a different mode of inheritance. 8 Journal of Nutrition and Metabolism Table 7: Cochran–Armitage trend testing. Malays Chinese Indians Multiplicative Additive Dominant Recessive Multiplicative Additive Dominant Recessive Multiplicative Additive Dominant Recessive (df � 1) (df � 1) (df � 1) (df � 1) (df � 1) (df � 1) (df � 1) (df � 1) (df � 1) (df � 1) (df � 1) (df � 1) CNDP1 χ 4.233 0.944 0.608 0.1887 — — — — — — — — rs2346061 p 0.0396 0.3313 0.4355 0.6640 CNDP1 χ 12.425 −8.3667 11.704 2.282 9.600 −8.042 7.157 3.714 7.711 −10.552 5.594 6.138 ∗ ∗ ∗ ∗ ∗ ∗ ∗ D18S880 p 0.0004 — 0.0006 0.1309 0.0019 — 0.0074 0.0540 0.0055 — 0.0180 0.0132 MnSOD χ 5.868 6.569 0.647 6.201 6.603 7.336 0.967 6.652 6.823 7.208 1.189 6.514 ∗ ∗ ∗ ∗ ∗ ∗ ∗ ∗ ∗ rs4880 p 0.0154 0.0104 0.4210 0.0128 0.0102 0.0068 0.3254 0.0099 0.0090 0.0073 0.2755 0.0107 NOS3 χ 5.263 7.879 0.499 7.328 6.731 8.323 0.797 7.490 7.204 8.542 0.992 7.642 ∗ ∗ ∗ ∗ ∗ ∗ ∗ ∗ ∗ rs1799983 p 0.0217 0.0050 0.4799 0.0068 0.0220 0.0039 0.3720 0.0062 0.0073 0.0035 0.3193 0.0057 /e mode of inheritance is best presented with the least p value . Journal of Nutrition and Metabolism 9 /e recessive model showed that the Indians have high as- additive model among the Indians. /is finding is similar to sociation with OR � 2.77 and 95% CI � (1.49–5.15), followed the study of Ahluwalia et al. on T2DM patients in Sweden (OR � 1.25 and 95% CI � (1.1–1.4) in the additive model) by the Chinese with OR � 2.26 and 95% CI � (0.43–11.92) and the Malays with OR � 1.75 and 95% CI � (0.44–6.95). For the [17]. On the contrary, however, Kurashige et al. [23] did not multiplicative model, Malay subjects with OR � 1.86 and 95% find any association in the Japanese women, and the same CI � (1.12–3.08) have the weakest association compared to the finding was also observed from a study on the African Chinese with OR � 2.02 and 95% CI � (1.17–3.47) and Indians American T2DM patients [24]. Meanwhile, a study on type with OR � 2.22 and 95% CI � (1.50–3.28). 1 diabetic Europeans also showed no association too [25]. For the NOS3-rs1799983, however, the additive model In this study, the Malays and Chinese do not show any has the least p value for the association of nephropathy and association, indicating different rs2346061 effects among T2DM, compared to the other models in this variant. /us, the ethnic groups. According to Ahluwalia et al. [17], SNP it is the best model to represent the variant behavior. /e rs2346061 had no association with kidney function but Chinese showed the strongest association with OR � 1.60 would only increase the risk of albuminuria and not the progression of kidney disease. /is was explained by ob- and 95% CI � (0.16–16.23) per copy of T and OR � 3.55 and 95% CI � (0.36–35.03) for double copy of T, compared to serving the neutral effect of rs2346061 on eGFR. /e variant the Indians with OR � 1.46 and 95% CI � (0.23–9.27) per did not directly affect the kidney function. SNP rs2346061 is copy of T and OR � 3.16 and 95% CI � (0.52–17.56) for located at CNDP1 which is primarily in distal tubules. double copy of Tand the Malays with OR � 1.33 and 95% CI CNDP1 is expressed mainly in the brain (particularly in � (0.13–13.48) per copy of T and OR � 2.89 and 95% CI � pyramidal cells of the hippocampus) and liver, not in the (0.29–28.32) for double copy of T. /e Chinese also showed kidney [26]. As the association of rs2346061 is quite weak in the strongest association with nephropathy development some population, sampling more samples would benefit the for this polymorphism observed in the recessive model analysis because rs2346061 also increases the expression of with OR � 2.71 and 95% CI � (0.28–26.54), followed by the carnosinase variant of 5 CTG repeats among the ne- Indians with OR � 2.44 and 95% CI � (0.39–14.91) and phrotic samples which affect the overall eGFR value. /e number of samples was calculated by assuming the strength Malays with OR � 2.23 and 95% CI � (0.23–2.75). As for the allele minor versus major, the Indians scored OR � 2.433 of the variants is medium (OR > 2.5) when associated with and 95% CI � (1.458–4.066), followed by the Chinese nephropathy and that would give the error of at least 20%. scoring OR � 2.137 and 95% CI � (3.634–1.280) and lastly /is type of error occurred during sampling. Increasing the the Malays scoring OR � 1.8 and 95% CI � (1.080–2.999). number of samples will minimize the error. /e low /e same pattern of strong association in the dominant number or frequency of allele carriers would require a model was found where the Chinese had OR � 2.27 and larger number of samples. Now the distribution or expo- 95% CI � (1.26–4.11), followed by the Indians having OR � sure of the risk allele SNP rs2346061 is known, and a 2.22 and 95% CI � (1.26–3.93) and the Malays having OR � suitable number of samples could be calculated correctly 0.44 and 95% CI � (0.25–0.78). On the contrary, in the for future studies. multiplicative model, the Indians showed the highest as- Diabetic patients with the lowest number of leucine sociation with OR � 1.94 and 95% CI � (1.19–3.17), while repeats are less susceptible to DN. Individuals with ho- the Malays with OR � 1.80 and 95% CI � (1.08–3.00) and mozygous or heterozygous allele for more than 5 leucine the Chinese with OR � 1.80 and 95% CI � (1.08–2.99) repeats have reduced serum carnosine concentration [27]. showed the same strength of association. Carnosine (β-alanyl-L-histidine) has been reported to have served as an oxygen-free radical scavenger [28], natural ACE inhibitor, and cleave advanced glycation end 4. Discussion product [29, 30]. /ese can only be achieved if the con- In this study, four polymorphisms of three different genes centration level of renal carnosine is sustained at its were tested to confirm variants that might be the risk protective level. Janssen et al. [31] had observed that the factors that increase the susceptibility to DN among addition of carnosine in renal cell lines could markedly Malaysians. All four are related to oxidative stress and have reduce the synthesis of matrix components and TGFβ2 in renal cell lines, which thus prevents further development significant relations with nephropathy development in all of the Malaysian subjects. /e oxidative stress due to of nephropathy. Immunostaining techniques revealed and proved that CNDP1 is present in the human kidney tissue. mitochondrial overproduction of ROS has been demon- strated to be the factor in the vascular pathobiology of Carnosinase secretion encoded from the CNDP1 gene is significantly greater in podocytes and renal parietal epi- diabetic microvascular complications [15]. Oxidative stress activates other related pathophysiologies in T2DM thelial cells from the subjects with DN, with variants, more [22]. than 5 CTG repeats, compared with healthy renal tissue /e activity of carnosinase was expected to be increased with variants 5 CTG repeats or less. /e location of (CTG) by rs2346061 due to the location of the SNP in the regu- n repeat is on the hydrophobic core of the signal peptide, and 5 CTG repeats provide a low signal, causing in- latory or promoter region of CNDP1 and CNDP2. SNP rs2346061 alters the activity of carnosinase by controlling efficiency for excretion compared to CTG with n > 5 repeats [32]. /is study reports that CNDP1 poly- and modulating the expression of CNDP1 and CNDP2. In this research, SNP rs2346061 associated weakly with the morphism distribution in three ethnic groups in Malaysia 10 Journal of Nutrition and Metabolism shows a significant association of reduced risk of 5/5 reaction may cause oxidative damage in the kidney at an homozygous genotypes. In the control group, the fre- early stage of diabetes. /e frequency of the genotype TT is very low: 3.2%, 2.1%, and 3.7% in Malays, Chinese, and quency of 5/5 homozygous genotypes is very low: 6.2% in Malays, 8.4% in Chinese, and 15.4% in Indians. /is may Indians, from the controls. /e frequency of T allele be the cause of the high occurrence of nephropathy in carriers in the case group is 22.5% among Malays, 21.8% T2DM in the Malaysian population. /e mutant allele among Chinese, and 23.8% among Indians, which does carriers of the case are very high in Malaysian population not seem to be significantly different between the groups with Malays � 88.9%, Chinese � 88.6%, and Indians � (p> 0.05). 69.8%, which may also explain the reason why 90% of the /e association was demonstrated in all of the models T2DM patients are having nephropathy. /e lower fre- for the Indians, but for the Malays, it was not significant in quency of 5-5 homozygous genotypes has led to higher the recessive model, while among the Chinese, it was not carnosinase activity levels among Malaysians, therefore significant in the dominant model. /e Cochran– decreasing the carnosine level and resulting in oxidative Armitage trend testing proves that the T allele behaved more towards being additive compared to the others, stress and its effects. /e lowest frequency of 5-5 homo- zygous genotypes ever reported was among the Japanese suggesting that the C allele has a reduced risk of T2DM population <0.1% [23]. Chinese peritoneal dialysis pa- nephropathy. In the additive model, the odds ratio tients were about 0.9% [33], and South Asian Surinamese showed the same moderate strength of association in the was 23.0% [34]. From the Malaysian data given above, it is Malays and Indians but showed quite strong strength of expected that the Indians are more protected compared to association among the Chinese, as observed in single and other races. /e odds ratio of the Indians is the least in all double copy alleles in the forest plot with the estimates of the models except in the dominant model. Overall, the odds ratios and 95% confidence intervals. A significant odds ratio among the races ranged from 1.70–2.46 caused association was also observed among the Koreans [41], by D18S880 polymorphism and was considered as a French [42], and Mexicans [43], but negative association moderate association or less risk. /ere was, however, no was observed among the Slovenians (Caucasians) [44]. A meta-analysis found that rs4880 showed a significant association in D18S880 polymorphism among the African Americans [24, 34, 35], Scandinavians [17] for T2DM, and correlation between nephropathy in both T1DM and Europeans for T1DM [25], thus showing that there are T2DM [45], suggesting that the C allele of a C47T other possible variants involved in the development of polymorphism in the SOD2 gene had significant pro- nephropathy in T2DM. tective effects on the risk of DN. Normally, mitochondrial ROS is one of the defense In this research, there was a significant association mechanisms against bacteria in the human system [36]. among the Malaysian population in all models except for /e normal level of mitochondrial ROS needs to be the recessive model among the Chinese and Indians. As maintained optimally by decreasing the excess which is for the Malays, all models showed association except in scavenged by MnSOD for cell survival [37, 38]. MnSOD the dominant model. /e additive model has the least p or SOD2 gene encodes for the iron/manganese super- value from the Cochran–Armitage trend test, indicating oxide dismutase family, a mitochondrial protein that the SNP was having the additive mode of inheritance. /e forms a homotetramer and binds one manganese ion per Chinese had the strongest association. /e frequencies of subunit. /is protein binds to the superoxide by-products the T allele carrier in the nonnephrotic samples were only of oxidative phosphorylation and converts them to hy- 13.5% to 14.5%, but the OR value is high suggesting a drogen peroxide and diatomic oxygen. SNP rs4880 C > T moderate-to-strong association of the variant to develop in this gene has been associated with T2DM nephropathy. nephropathy among T2DM patients. /is is because the th /e rs4880 (V16A) is identified at the 16 amino acid various functions of NOS3 are affected due to the missense position of MnSOD [21], altering the structure of resulted from Glu to Asp substitution at residue 298 of MnSOD. /e C allele codes for a partial alpha-helix in the NOS3. /e missense lowered NOS3 activity; thus, NO production is affected. /e low level of NO fails to sup- Ala variant to a beta-sheet but once substituted for T allele, it codes for a beta-sheet in the Val variant, causing press oxidative stress, platelet aggregation, leukocyte adhesion, and smooth muscle cell proliferation, triggering less efficient transport of MnSOD into the mitochondrial matrix and becoming 30–40% weaker antioxidant for many pathways which lead to the development of DN [46]. /e T allele was found to be associated with T2DM mitochondrial ROS [39]. In the hyperglycemic atmo- sphere, mitochondrial ROS is induced abundantly by nephropathy in most Asian populations such as the activation of the electron transport system [40], causing Japanese [47–49], Koreans [50], Indonesians [51], North an imbalance between endogenous prooxidative and Indians [52], and Tunisians [53]. On the contrary, Zint- antioxidative systems. As hyperglycemia persists, it can zaras et al. [54] found that the T allele is shown to have a also contribute to the progression as well as initiation of weak association with T2DM patients but strong associ- diabetic microvascular complications. During this con- ation with diabetes leading to severe nephropathy in East Asians. However, the GG genotype seemed to increase the dition, the liver and kidney are the two organs that have high mitochondrial ROS levels raised abruptly, but the risk in T2DM patients with chronic renal insufficiency among the South Indian population but not among the MnSOD level was observed to increase in the liver only. /is may suggest that the mitochondrial oxidative North Indians [55]. Journal of Nutrition and Metabolism 11 polymorphism and the risk of diabetic nephropathy in type 2 5. Conclusion diabetes mellitus: a meta-analysis,” Meta Gene, vol. 2, All four genes carnosinase (CNDP1-D18S880 and pp. 50–62, 2014. [7] M. Mafauzy, Z. Hussein, and S. P. Chan, “/e status of di- -rs2346061), endothelial nitric oxide synthase (NOS3- abetes control in Malaysia: results of DiabCare 2008,” Medical rs1799983), and manganese superoxide dismutase (MnSOD- Journal of Malaysia, vol. 66, no. 3, pp. 175–181, 2011. rs4880) with oxidative stress-related polymorphisms have [8] T. P. Peacock, Z. K. Shihabi, A. J. Bleyer et al., “Comparison of significant effects on the development of nephropathy in glycated albumin and hemoglobin A1c levels in diabetic Malaysian type 2 diabetes patients. /e genes may, therefore, subjects on hemodialysis,” Kidney International, vol. 73, no. 9, be considered as risk factors for Malaysian subjects who are pp. 1062–1068, 2008. predisposed to T2DM nephropathy although differing [9] H. Russell, T. Sri Wahyu, G. S. Harvinder Kaur, and among the three races. Based on the least p value compared C. S. S. Winnie, “Diabetes care in Malaysia: problems, new to the other models, the best model fit for D18S880 was models, and solutions,” Annals of Global Health, vol. 81, no. 6, multiplicative for all the races: Malays (p � 0.0004), Chinese pp. 851–862, 2015. (p � 0.0019), and Indians (p � 0.005), while for the other [10] I. A. Ahmed, M. A. Mikail, and M. Ibrahim, “Baccaurea variants, the best model was additive. angulata fruit juice ameliorates altered hematological and biochemical biomarkers in diet-induced hypercholesterol- Data Availability emic rabbits,” Nutrition Research, vol. 42, pp. 31–42, 2017. [11] M. Ibrahim, I. A. Ahmed, M. A. Mikail et al., “Baccaurea /e data used to support the findings of this study are in- angulata fruit juice reduces atherosclerotic lesions in diet- cluded within the article. induced Hypercholesterolemic rabbits,” Lipids in Health and Disease, vol. 16, no. 1, p. 134, 2017. [12] M. Ibrahim, M. A. Mikail, I. A. Ahmed et al., “Comparison of Conflicts of Interest the effects of three different Baccaurea angulata whole fruit /e authors declare that they have no conflicts of interest. juice doses on plasma, aorta and liver MDA levels, antioxidant enzymes and total antioxidant capacity,” European Journal of Nutrition, vol. 57, no. 5, pp. 1817–1828, 2017. Acknowledgments [13] L. Zhu, Q. Huang, Z. Xie et al., “PPARGC1A rs3736265 G>A polymorphism is associated with decreased risk of type 2 We appreciate the Ministry of Health Malaysia for the re- diabetes mellitus and fasting plasma glucose level,” Onco- search grant and the Department of Pathology, Blood Bank, target, vol. 8, no. 23, pp. 37308–37320, 2017. Medical Clinic of Hospital Tuanku Ja’afar, for the technical [14] M. Teufel, V. Saudek, J.-P. Ledig et al., “Sequence identifi- support. We would also like to extend our appreciation to cation and characterization of human carnosinase and a the Faculty of Medical and Health Sciences of Universiti closely related non-specific dipeptidase,” Journal of Biological Putra Malaysia. Chemistry, vol. 278, no. 8, pp. 6521–6531, 2002. [15] M. Smirnova, “Biochemistry and molecular cell biology of Supplementary Materials diabetic complications,” Nature, vol. 414, no. 6865, pp. 813– 820, 2001. Table S1: genotype distribution and frequencies in cases and [16] K. Menon, A. Mousa, and B. de Courten, “Effects of sup- controls. Table S2: allele distribution and frequencies in cases plementation with carnosine and other histidine-containing and controls. (Supplementary Materials) dipeptides on chronic disease risk factors and outcomes: protocol for a systematic review of randomised controlled References trials,” BMJ Open, vol. 8, no. 3, 2018. [17] T. S. Ahluwalia, E. Lindholm, and L. C. Groop, “Common [1] E. T. Callcott, A. B. Santhakumar, J. Luo, and C. L. Blanchard, variants in CNDP1 and CNDP2, and risk of nephropathy in “/erapeutic potential of rice-derived polyphenols on type 2 diabetes,” Diabetologia, vol. 54, no. 9, pp. 2295–2302, obesity-related oxidative stress and inflammation,” Journal of Applied Biomedicine, vol. 16, no. 4, pp. 255–262, 2018. [18] B. Dellamea, C. Leitão, R. Friedman, and L. Canani, “Nitric [2] J. E. Shaw, R. A. Sicree, and P. Z. Zimmet, “Global estimates of oxide system and diabetic nephropathy,” Diabetology & the prevalence of diabetes for 2010 and 2030,” Diabetes re- Metabolic Syndrome, vol. 6, p. 17, 2014. search and clinical practice, vol. 87, no. 1, pp. 4–14, 2010. [19] S. Rizvi, S. T. Raza, and F. Mahdi, “Association of genetic [3] G. R. Letchuman, W. M. Wan Nazaimoon, W. B. Wan variants with diabetic nephropathy,” World Journal of Di- Mohamad et al., “Prevalence of diabetes in the Malaysian abetes, vol. 5, no. 6, pp. 809–816, 2014. national health morbidity survey III 2006,” Medical Journal of [20] M. Abbasi, M. S. Daneshpour, M. Hedayati, A. Mottaghi, Malaysia, vol. 65, no. 3, pp. 180–186, 2010. K. Pourvali, and F. Azizi, “/e relationship between MnSOD [4] W. M. Ahmad Faudzi, S. H. Md Isa, W. B. Wan Mohamad Val16Ala gene polymorphism and the level of serum total et al., “Prevalence of diabetes in Malaysia and usefulness of antioxidant capacity with the risk of chronic kidney disease in HbA1cas a diagnostic criterion,” Diabetic Medicine, vol. 30, type 2 diabetic patients: a nested case-control study in the no. 7, pp. 825–828, 2013. Tehran lipid glucose study,” Nutrition & Metabolism, vol. 15, [5] A. Ali, “Diabetic nephropathy–complications and treatment,” no. 1, p. 25, 2018. International Journal of Nephrology and Renovascular Disease, vol. 7, pp. 361–381, 2014. [21] K. Pourvali, M. Abbasi, and A. Mottaghi, “Role of superoxide dismutase 2 gene Ala16Val polymorphism and total antiox- [6] Z.-j. Ma, R. Chen, H.-z. Ren, X. Guo, J. G. Chen, and L.-m. Chen, “Endothelial nitric oxide synthase (eNOS) 4b/a idant capacity in diabetes and its complications,” Avicenna 12 Journal of Nutrition and Metabolism Journal of Medical Biotechnology (AJMB), vol. 8, no. 2, stage renal disease in European Americans,” Nephrology pp. 48–56, 2016. Dialysis Transplantation, vol. 22, no. 4, pp. 1131–1135, 2007. [22] M. Brownlee, “/e pathobiology of diabetic complications: a [36] J. Lu and A. Holmgren, “/e thioredoxin antioxidant system,” unifying mechanism,” Diabetes, vol. 54, no. 6, pp. 1615–1625, Free Radical Biology and Medicine, vol. 66, pp. 75–87, 2014. 2005. [37] D. Candas and J. J. Li, “MnSOD in oxidative stress response- [23] M. Kurashige, M. Imamura, S.-I. Araki et al., “/e influence of potential regulation via mitochondrial protein influx,” An- a single nucleotide polymorphism within CNDP1 on sus- tioxidants & Redox Signaling, vol. 20, no. 10, pp. 1599–1617, ceptibility to diabetic nephropathy in Japanese women with 2014. type 2 diabetes,” PLoS One, vol. 8, no. 1, Article ID e54064, [38] D. B. Zorov, M. Juhaszova, and S. J. Sollott, “Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS re- [24] C. W. McDonough, P. J. Hicks, L. Lu, C. D. Langefeld, lease,” Physiological Reviews, vol. 94, no. 3, pp. 909–950, 2014. B. I. Freedman, and D. W. Bowden, “/e influence of car- [39] A. Sutton, H. Khoury, C. Prip-Buus, C. Cepanec, D. Pessayre, nosinase gene polymorphisms on diabetic nephropathy risk in and F. Degoul, “/e Ala16Val genetic dimorphism modulates the import of human manganese superoxide dismutase into African-Americans,” Human Genetics, vol. 126, no. 2, pp. 265–275, 2009. rat liver mitochondria,” Pharmacogenetics, vol. 13, no. 3, [25] K. Wanic, G. Placha, J. Dunn, A. Smiles, J. H. Warram, and pp. 145–157, 2003. A. S. Krolewski, “Exclusion of polymorphisms in carnosinase [40] S. Fakhruddin, W. Alanazi, and K. E. Jackson, “Diabetes- genes (CNDP1 and CNDP2) as a cause of diabetic ne- induced reactive oxygen species: mechanism of their gener- phropathy in type 1 diabetes: results of large case-control and ation and role in renal injury,” Journal of Diabetes Research, follow-up studies,” Diabetes, vol. 57, no. 9, pp. 2547–2551, vol. 2017, Article ID 8379327, 30 pages, 2017. [41] S. J. Lee, M. G. Choi, D.-S. Kim, and T. W. Kim, “Manganese [26] V. Pandya, M. K. Ekka, R. K. Dutta, and S. Kumaran, “Mass superoxide dismutase gene polymorphism (V16A) is asso- spectrometry assay for studying kinetic properties of di- ciated with stages of albuminuria in Korean type 2 diabetic peptidases: characterization of human and yeast di- patients,” Metabolism, vol. 55, no. 1, pp. 1–7, 2006. [42] K. Mohammedi, N. Bellili-Muñoz, F. Driss et al., “Manganese peptidases,” Analytical Biochemistry, vol. 418, no. 1, superoxide dismutase (SOD2) polymorphisms, plasma ad- pp. 134–142, 2011. [27] T. Albrecht, S. Zhang, J. D. Braun et al., “/e CNDP1 (CTG) 5 vanced oxidation protein products (AOPP) concentration and polymorphism is associated with biopsy-proven diabetic risk of kidney complications in subjects with type 1 diabetes,” nephropathy, time on hemodialysis, and diabetes duration,” PLoS One, vol. 9, no. 5, Article ID e96916, 2014. Journal of Diabetes Research, vol. 2017, Article ID 9506730, [43] I. de Jesus ´ Ascencio-Montiel, E. J. Parra, A. Valladares-Sal- 11 pages, 2017. gado et al., “SOD2 gene Val16Ala polymorphism is associated [28] M. J. Cripps, K. Hanna, C. Lavilla et al., “Carnosine scav- with macroalbuminuria in Mexican type 2 diabetes patients: a enging of glucolipotoxic free radicals enhances insulin se- comparative study and meta-analysis,” BMC Medical Ge- cretion and glucose uptake,” Scientific Reports, vol. 7, no. 1, netics, vol. 14, no. 1, p. 110, 2013. article 13313, 2017. [44] J. Makuc and D. Petrovic, “Diabetic nephropathy in type 2 [29] N. S. Elbarbary, E. A. R. Ismail, A. R. El-Naggar, diabetes: MPO T-764C genotype is associated with oxidative M. H. Hamouda, and M. El-Hamamsy, “/e effect of 12 weeks stress,” Open Life Sciences, vol. 7, no. 6, pp. 964–972, 2012. carnosine supplementation on renal functional integrity and [45] C. Tian, S. Fang, X. Du, and C. Jia, “Association of the C47T oxidative stress in pediatric patients with diabetic nephrop- polymorphism in SOD2 with diabetes mellitus and diabetic athy: a randomized placebo-controlled trial,” Pediatric Di- microvascular complications: a meta-analysis,” Diabetologia, vol. 54, no. 4, pp. 803–811, 2010. abetes, vol. 19, no. 3, pp. 470–477, 2017. [30] H. Yapislar and E. Taskin, “L-carnosine alters some hemor- [46] R. J. Pickering, C. J. Rosado, A. Sharma, S. Buksh, M. Tate, and heologic and lipid peroxidation parameters in nephrectom- J. B. de Haan, “Recent novel approaches to limit oxidative stress and inflammation in diabetic complications,” Clinical & ized rats,” Medical Science Monitor, vol. 20, pp. 399–405, 2014. [31] B. Janssen, D. Hohenadel, P. Brinkkoetter et al., “as a pro- Translational Immunology, vol. 7, no. 4, article e1016, 2018. tective factor in diabetic nephropathy: association with a [47] S. Nagase, H. Suzuki, Y. Wang et al., “Association of ecNOS leucine repeat of the carnosinase gene CNDP1,” Diabetes, gene polymorphisms with end stage renal diseases,” in Guanidino Compounds in Biology and Medicine, pp. 113–118, vol. 54, no. 8, pp. 2320–2327, 2005. [32] E. Riedl, H. Koeppel, P. Brinkkoetter et al., “A CTG poly- Springer, Berlin, Germany, 2003. morphism in the CNDP1 gene determines the secretion of [48] E. Noiri, H. Satoh, J.-i. Taguchi et al., “Association of eNOS Glu298Asp polymorphism with end-stage renal disease,” serum carnosinase in cos-7 transfected cells,” Diabetes, vol. 56, no. 9, pp. 2410–2413, 2007. Hypertension, vol. 40, no. 4, pp. 535–540, 2002. [33] P. Y.-K. van der Woude, C.-C. Szeto, B. C.-H. Kwan, [49] H. Tokunaga, S. Nagase, S. Kikuchi, Y. Wang, and A. Koyama, K.-M. Chow, and P. K.-T. Li, “Relationship between carno- “Association of a missense Glu298Asp mutation of the en- sinase gene CNDP1 leucine repeat polymorphism and the dothelial nitric oxide synthase gene with end stage renal clinical outcome of Chinese PD patients,” Clinical Nephrology, disease,” Clinical chemistry, vol. 46, no. 11, pp. 1858–1860, vol. 74, no. 5, pp. 343–345, 2010. 2000. [34] A. L. Mooyaart, I. G. M. van Valkengoed, P. K. C. Shaw et al., [50] Y. S. Shin, S. H. Baek, K. Y. Chang et al., “Relations between “Lower frequency of the 5/5 homozygous CNDP1 genotype in eNOS Glu298Asp polymorphism and progression of diabetic South Asian Surinamese,” Diabetes Research and Clinical nephropathy,” Diabetes research and clinical practice, vol. 65, Practice, vol. 85, no. 3, pp. 272–278, 2009. no. 3, pp. 257–265, 2004. [35] B. I. Stronks, P. J. Hicks, M. M. Sale et al., “leucine repeat in [51] M. /aha, M. Pranawa, M. Yogiantoro et al., “Association of the carnosinase gene CNDP1 is associated with diabetic end- endothelial nitric oxide synthase Glu298Asp polymorphism Journal of Nutrition and Metabolism 13 with end-stage renal disease,” Clinical nephrology, vol. 70, no. 2, pp. 144–154, 2008. [52] T. S. Ahluwalia, M. Ahuja, T. S. Rai et al., “Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians,” Molecular and cellular biochemistry, vol. 314, no. 1-2, pp. 9–17, 2008. [53] I. Ezzidi, N. Mtiraoui, M. B. H. Mohamed, T. Mahjoub, M. Kacem, and W. Y. Almawi, “Association of endothelial nitric oxide synthase Glu298Asp, 4b/a, and −786T>C gene variants with diabetic nephropathy,” Journal of Diabetes and its Complications, vol. 22, no. 5, pp. 331–338, 2008. [54] E. Zintzaras, A. A. Papathanasiou, and I. Stefanidis, “Endo- thelial nitric oxide synthase gene polymorphisms and diabetic nephropathy: a HuGE review and meta-analysis,” Genetics in Medicine, vol. 11, no. 10, pp. 695–706, 2009. [55] A. K. Tiwari, P. Prasad, B. K. /elma et al., “Oxidative stress pathway genes and chronic renal insufficiency in Asian In- dians with Type 2 diabetes,” Journal of Diabetes and its Complications, vol. 23, no. 2, pp. 102–111, 2009. MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018
Journal
Journal of Nutrition and Metabolism – Hindawi Publishing Corporation
Published: Jan 3, 2019