Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Bionic Silk Fibroin Film Induces Morphological Changes and Differentiation of Tendon Stem/Progenitor Cells

Bionic Silk Fibroin Film Induces Morphological Changes and Differentiation of Tendon... Hindawi Applied Bionics and Biomechanics Volume 2020, Article ID 8865841, 10 pages https://doi.org/10.1155/2020/8865841 Research Article Bionic Silk Fibroin Film Induces Morphological Changes and Differentiation of Tendon Stem/Progenitor Cells 1 2 1 1 1 1 Kang Lu , Xiaodie Chen , Hong Tang , Mei Zhou , Gang He , Juan Liu, 1 1 1 1 2 1 Xuting Bian, Yupeng Guo, Fan Lai, Mingyu Yang, Zhisong Lu , and Kanglai Tang Department of Orthopedics/Sports Medicine Center, State Key Laboratory of Trauma, Burn and Combined Injury, Southwest Hospital, Army Medical University (Third Military Medical University), Chongqing 400038, China Institute for Clean Energy & Advanced Materials, School of Materials & Energy, Southwest University, Chongqing 400715, China Correspondence should be addressed to Zhisong Lu; zslu@swu.edu.cn and Kanglai Tang; tangkanglai@hotmail.com Received 30 August 2020; Revised 17 November 2020; Accepted 20 November 2020; Published 2 December 2020 Academic Editor: Jose Merodio Copyright © 2020 Kang Lu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Purpose. Tendon injuries are common musculoskeletal system disorders, but the ability for tendon regeneration is limited. Silk fibroin (SF) film may be suitable for tendon regeneration due to its excellent biocompatibility and physical properties. This study is aimed at evaluating the application value of bionic SF film in tendon regeneration. Methods. Tendon stem/progenitor cells (TSPCs) were isolated from rat Achilles tendon and characterized based on their surface marker expression and multilineage differentiation potential. SF films with smooth or bionic microstructure surfaces (5, 10, 15, 20 μm) were prepared. The morphology and mechanical properties of natural tendons and SF films were characterized. TSPCs were used as the seed cells, and the cell viability and cell adhesion morphology were analyzed. The tendongenesis-related gene expression of TSPCs was also evaluated using quantitative polymerase chain reaction. Results. Compared to the native tendon, only the 10, 15, and 20 μmSF film groups had comparable maximum loading and ultimate stress, with the exception of the breaking elongation rate. The 10 μmSF film group had the highest percentage of oriented cells and the most significant changes in cell morphology. The most significant upregulations in the expression of COL1A1, TNC, TNMD, and SCX were also observed in the 10 μmSF film group. Conclusion.SF film with a bionic microstructure can serve as a tissue engineering scaffold and provide biophysical cues for the use of TSPCs to achieve proper cellular adherence arrangement and morphology as well as promote the tenogenic differentiation of TSPCs, making it a valuable customizable biomaterial for future applications in tendon repair. 1. Introduction Silk fibroin- (SF-) based biomaterials have been applied for tissue regeneration recently due to their excellent biocom- Tendons play a vital role in the ankle movement. Acute and patibility, controllable mechanical properties, and ease of chronic sports-related tendon injuries are becoming more fre- processing [6–8]. SF biomaterials are available as films [9], quent in people of all ages, often leading to repeated pain and sponges [10], and hydrogels [11]. The Corneal tissue [12, 13] even disability [1, 2]. Scar formation is common after a tendon and articular cartilage [3] have been reconstructed with SF injury, limiting biological performance [3]. At present, tendon film. The fiber structure of SF is similar to that of type I colla- injury treatment remains challenging for clinicians. Primary gen [8], and the structure of SF film is similar to that of tendon treatments include autologous and allogeneic tendon trans- sheaths, which play a crucial role in tendon regeneration [14]. plantation or artificial tendon replacement. However, these The biological activity and physical properties of SF film are reconstructive techniques may cause loss of function at the suitable for tendon regrowth [15, 16]; however, the effect of SF film microstructures on tendon regeneration has not been donor site, infection, rejection, or poor graft integration [4]. Therefore, researchers have been developing new technologies thoroughly evaluated. fortendonregenerationinrecentyears. Tendontissueengi- Studies have shown that biomaterials with microstruc- neering has emerged as a promising treatment modality [5]. tures mimicking native structures would allow for early core 2 Applied Bionics and Biomechanics 2.4. Fabrication of SF Film with Smooth or Bionic cell adhesion and proper cell biological behavior for tendon regeneration [17–19]. The tendon tissue has parallel aligned Microstructure Surfaces. Silk solution extraction and SF film collagen fibers where tenocytes reside in the narrow space microstructure fabrication were completed as previously between collagen fibers [20, 21]. Tendon stem/progenitor described [26–29]. Briefly, protein extract from cocoons cells (TSPCs) are the precursor cells for tendon regeneration (supplied by State Key Laboratory of Silkworm Genome Biol- [22–24] and have been used as seed cells for tendon tissue ogy, Southwest University) was cut into three segments and engineering. In this study, we prepared SF films with different boiled in 0.02 M Na CO (Aladdin Reagent Co. Shanghai, 2 3 bionic microstructures and mechanical properties mimick- China) for 40 minutes. Next, the protein extract was rinsed ing healthy rat tendons and then investigated their biological in dH O for 20 minutes and dried overnight at room temper- effects on rat TSPCs to explore potential applications in ature. The protein extract was then dissolved in 9.3 M lithium human tendon regeneration. bromide (Aladdin Reagent Co. Shanghai, China) at room temperature and placed in a 50 C oven for five hours. Then, the solution was placed in cellulose dialysis membranes 2. Materials and Methods (Shanghai Tansoole Company, China) and dialyzed in water for 72 hours. Finally, the protein extract was centrifuged at 2.1. Animals. Animals were provided by the Animal Center 8000 r/min for 20 minutes to remove impurities. The result- of the Third Military Medical University. A total of 5 four- ing supernatant of aqueous silk solution had a final concen- week-old male Sprague–Dawley (SD) rats were sacrificed to tration of 4.5% wt./v. determined by gravimetric analysis extract TSPCs. Additionally, 10 eight-week-old male SD rats and was stored at 4 C. weighing 200-250 g were sacrificed for scanning electron Silicon wafers with parallel ridge widths and spacing of microscope (SEM) and tissue section staining. The Animal 5 μm, 10 μm, 15 μm, and 20 μm, and 5 μm groove depths Research Ethics Committee of the Third Military Medical (according to the data measured in step 2.3) were produced University approved all experimental procedures. using standard photolithography techniques [27]. Polydi- methylsiloxane (PDMS) molds were produced from these 2.2. Isolation and Characterization of Rat TSPCs. A total of 5 surfaces by casting 300 mL of a 10 : 1 mixture of potting to male four-week-old SD rats were sacrificed to isolate TSPCs, ° catalyst solution and then curing at 50 C for 4 hours. Smooth as previously described [23]. Briefly, Achilles tendons from PDMS base plates and smooth silicon wafers were prepared both hind feet were dissected after euthanasia. Only the as described previously [26–29]. mid-substance tendon tissue was harvested, and the periten- PDMS plates with either smooth or microstructure sur- dinous connective tissue was carefully removed. The har- faces were cut into 35 mm diameter casting surfaces, and vested tissue was minced in sterile phosphate-buffered 4 mL of silk solution was pipetted onto each surface. Post- saline (PBS) and digested in 3 mg/mL of type I collagenase casting, the SF films were water annealed for up to 100 (Sigma-Aldrich, St. Louis, MO) for 2.5 hours at 37 C. A ° minutes at 90 C as previously described [30, 31]. Afterward, 70 mm cell strainer (Becton Dickinson, Franklin Lakes, NJ) the SF films measuring 100 μm in thickness were removed was used to remove the undigested tissue. After three washes from their respective PDMS molds and sterilized by UV irra- with PBS, the released cells were resuspended in Dulbecco’s diation for 2 hours before seeding with TSPCs. Modified Eagle Media (DMEM) (Gibco, Carlsbad, CA) sup- plemented with 10% fetal bovine serum (FBS), 100 U/mL 2.5. Scanning Electron Microscopy (SEM). Five eight-week- penicillin, 100 mg/mL streptomycin, and 2 mmol/L L-gluta- old male SD rats weighing 200-250 g were sacrificed for mine (all from Invitrogen, Carlsbad, CA) and incubated at SEM. Rat Achilles tendons were isolated as described above. 37 C and 5% CO for 2 days. Nonadherent cells were The specimens were fixed with 3% glutaraldehyde for 2 hours removed using PBS. After 7 days, the cells were trypsinized and rinsed twice with 0.1 M PBS for 15 minutes each. The with Trypsin-EDTA solution (Sigma-Aldrich) and used as specimens were then dehydrated (15 minutes each) in a series passage 0 cells. Passages 3 (P3) cells were used for all subse- of ethanol solutions (50, 60, 70, 80, 90, 100%, and twice at quent experiments. 100%) and a series of tert-butanol solutions (50, 60, 70, 80, 90, 100%, and twice at 100%). The specimens were finally 2.3. Trilineage Differentiation Assay. TSPCs were incubated dried and placed on a sample stage. After drying, vacuum with adipogenic, osteogenic, and chondrogenic induction platinum plating was applied and observed with SEM medium as previously described to characterize their multili- (ZEISS-Crossbeam 304, ZEISS, Germany). neage differentiation potential [25]. Briefly, TSPCs were SF film samples were sputter-coated with gold for 60 sec- seeded in six-well plates at a cell density of 2×10 onds and observed under SEM (Phenom Prox, Phenom, cells/cm before inducing differentiation. Then, the TSPCs were cul- Netherlands) at 15 kV. The thickness of the SF films was tured in the appropriate induction medium and stained measured from their cross-sections, and the samples were according to the respective adipogenic (RASMX-90031, tiled to observe their surface morphology. The thickness, Cyagen, Guangzhou, China), chondrogenic (RASMX-9004, width, and spacing of the SF film bionic microstructure were Cyagen, Guangzhou, China), and osteogenic (RASTA- measured using ImageJ software. 90021, Cyagen, Guangzhou, China) induction differentiation protocols. The TSPCs were then observed under a light 2.6. Hematoxylin-Eosin (HE) Staining. Five eight-week-old microscope. male SD rats were sacrificed, and their Achilles tendons were Applied Bionics and Biomechanics 3 in 100 nM rhodamine phalloidin (Yeasen Biological Tech- harvested as described above. Tendon specimens were fixed in 10% formaldehyde for at least 24 hours at room tempera- nology Co, Shanghai China) for 30 minutes to stain the actin ture and dehydrated with an ascending alcohol gradient. cytoskeleton. Nuclei were counterstained with 100 nM DAPI Finally, the specimens were embedded in paraffin, which (Beyotime Biotech, Jiangsu, China) for 5 minutes. Images were cut into 3 μm sections and then stained according to were obtained with a laser scanning confocal microscope the manufacturer’s protocol. All of the sections were exam- (Zeiss lsm780, Germany) and analyzed with ImageJ software ined using a light microscope (Olympus, Japan). Three fields to measure the cell body aspect ratios (length/width), cell on each section were randomly selected to measure the diam- body major axis angles, and cell area [17, 24]. All measure- eter of the collagen fibers using ImageJ software. ments were obtained from 20 cells per image, and three images were analyzed from each group. 2.7. Mechanical Test. Mechanical testing of normal Achilles 2.10. Real-Time Quantitative Polymerase Chain Reaction tendons and different SF films was performed as previously (RT-qPCR). The mRNA expression levels of tendon-related described [32]. In brief, Achilles tendons with bony attach- genes of collagen type I alpha china (COL1A1), tenascin-C ments were isolated from five SD rats. The calcaneal and tib- (TNC), tenomodulin (TNMD), and scleraxis (SCX) were ial ends of the tendons were fixed to two serrated jaws determined using real-time quantitative polymerase chain (Supplementary Figure 1), which were connected to the reaction (RT-qPCR). One microgram of total RNA was testing machine (E1000, Instron, USA). The serrated jaws extracted from TSPCs using TRIzol reagent (TaKaRa, Dalian, could be adjusted using a grip to achieve stable fixation. China) according to the manufacturer’s protocol, and then Before testing, the SF films were water annealed at 90 C for 1 μg of RNA was converted to complementary DNA (cDNA) 100 minutes as previously described to improve their using a Superscript III First-Strand Synthesis Kit (TaKaRa). mechanical strength [31]. The cut SF film specimens were qPCR was performed using a SYBR Green RT-PCR kit rolled and gently pressed into flat strips with a similar (TaKaRa) and an ABI Prism 7900 Sequence Detection Sys- length, width, and thickness as the natural Achilles tendon tem (PE Applied Biosystems, Foster City, CA, USA). The (1 cm in length, 2 mm in width, and 1 mm in thickness) and housekeeping gene glyceraldehyde 3-phosphate dehydroge- then secured to the serrated jaws. The testing machine was nase (GAPDH) was used as an internal control to calculate used to evaluate the tensile stress-strain curves for all the relative expression level of the target gene. The PCR specimens as previously described [17, 33]. primer sequences are shown in Table 1. 2.8. Cell Viability Assay. TSPCs were cultured on tissue cul- 2.11. Statistical Analysis. Unless stated otherwise, all experi- ture plastic (TCP), smooth SF films, and SF films with differ- ments were performed in triplicate, and the data were pre- ent microstructure surfaces (5 μm, 10 μm, 15 μm, and 20 μm) sented as the mean ± standard deviation. Quantitative data 4 2 at a density of 1×10 cells/cm for 1, 2, and 3 days. Cell via- were analyzed using analysis of variance (ANOVA) with bility was measured with a Cell Counting KIT-8 (CCK-8, SPSS 22.0. A p value less than 0.05 was considered statistically Dojindo, Japan). Briefly, TSPC or SF film-TSPC constructs significant. were harvested at the designated time points. After incuba- tion with 10% CCK-8 solution at 37 C for 2 hours, 100 μL 3. Results of the solution was transferred to a new 96-well plate to mea- sure the absorbance at 450 nm using a microplate reader 3.1. Rat TSPC Multilineage Differentiation Potentials. At (Model 680, Bio-Rad, USA). lower density, the TSPCs exhibited fibroblast-like spindle shapes. At 80% to 90% confluence, the TSPCs exhibited a 2.9. Immunofluorescence of TSPCs and Measurement of Cell pebble-like morphology and developed tight colonies. Morphology. To characterize the surface marker expression Immunostaining of specific surface antigens (CD44, CD90, of the TSPCs, the specific expression levels of CD34 (Anti- CD3, and CD34) was used to characterize the newly isolated CD34 antibody, 1 : 200, ab81289, Abcam, Cambridge, UK), rat TSPCs. The TSPCs were positive for CD44 and CD90, but CD44 (Anti-CD44 antibody, 1 : 200,ab216647, Abcam, Cam- negative for the hematopoietic stem cell marker CD34 and bridge, UK), CD3 (Anti-CD3 antibody, 1 : 200, ab135372, the leukocyte marker CD3 (Figure 1(a)). Abcam, Cambridge, UK), and CD90 (Anti-CD90/Thy1 anti- TSPCs were incubated in specific lineage induction body, 1 : 200, ab225, Abcam, Cambridge, UK) were detected medium for 14 days to characterize their multilineage differ- by immunostaining. Cells were fixed with 4% paraformalde- entiation potentials (Figure 1(b)). The TSPCs were positive hyde (PFA), permeabilized with 0.1% Triton‐X and incu- for alizarin red S staining, indicating calcium deposition. bated with primary antibody (1 : 1000). An Alexa Fluor® The TSPCs also displayed round orange cytoplasmic droplets 488-conjugated goat anti‐rabbit IgG (ab150077) secondary upon oil red O staining, suggesting lipid droplet formation. antibody was used at a dilution of 1 : 1000. Stained cells were Additionally, blue-stained acidic glycosaminoglycans were observed under an inverted fluorescence microscope. observed, consistent with extracellular matrix formation dur- TSPC staining was completed as previously described ing chondrogenesis. [25]. Briefly, after adhering to TCP or the SF films for 24 hours, cells were fixed with 4% PFA for 20 minutes 3.2. SEM, HE Staining, and Biomechanical Testing of Rat at room temperature and then permeabilized with 0.5% Achilles Tendons. SEM was used to examine the morphology Triton X-100 for 5 minutes. Then, the cells were incubated of healthy rat Achilles tendons. Collagen fibers in native rat 4 Applied Bionics and Biomechanics Table 1: Primers used in qPCR analysis. Gene name Annealing temperature ( C) PCR product size (bp) F:TGTACTGGATCAATCCCACTCT TNMD 60 115 R:GCTCATTCGGGTCAATCCCCT F:CCTTCTGCCTCAGCAACCAG SCN 60 156 R:GGTAGTGGGGCTCTCCGTGACT F:GGCGGCCAGGGCTCCGACCC COL1A1 60 320 R:AATTCCTGGTCTGGGGCACC F:CAAGGGAGACAAGGAGAGTG TNC 60 159 R:AGGCTGTAGTTGAGGCGG F:GACTTCAACAGCAACTCCCAC GAPDH 60 125 R:TCCACCACCCTGTTGCTGTA Light microscope 100𝜇m CD44 CD90 Alizarin red S staining Oil red O staining 50𝜇m 50𝜇m 100𝜇m 100𝜇m CD3 CD34 Toluidine blue staining 100𝜇m 50𝜇m 50𝜇m (a) (b) Figure 1: Cell morphology of tendon stem and progenitor cells on tissue culture plates under light microscope and immunofluorescence staining of CD44, CD90, CD3, and CD34 markers (a). Alizarin red S, oil red O staining, and toluidine blue staining after induction of osteogenesis, adipogenesis, and chondrogenesis (b). Achilles tendons were arranged tightly in parallel with an To compare the mechanical properties between native even thickness (Figure 2(a)). A few visualized wavy colla- tendon and SF films, we performed mechanical tests includ- gen fiber bundles may have been secondary to a relaxed ing maximum loading, ultimate stress (N/mm ), and break- state. ing elongation (%) on native tendon (N), smooth SF film Native rat Achilles tendon tissue sections were stained (S), and SF films with different microstructure diameters with HE staining. The normal tendon structure demonstrated (5 μm, 10 μm, 15 μm, and 20 μm). SF films with microstruc- ordered arrangement of the collagen fibers (Figure 2(b)). ture diameters (10 μm, 15 μm, and 20 μm) exhibited compa- Collagen fiber diameters ranged from 5 to 20 μm, and about rable maximum loading and ultimate stress as the native 70% of the fibers had a diameter of 5-10 μm (Figure 2(c)). tendon, with the exception of the smooth and 5 μmSF film groups. As the width of the bionic groove increased, mechan- 3.3. Characterization of SF Films with Different Microstructures ical properties such as the maximum loading capacity Using SEM and Biomechanical Tests. SF film morphology was increased gradually. However, the native tendon group had characterized with SEM (Figure 3(a)). SF films successfully a significantly higher breaking elongation rate than the other replicated the features defined on the PDMS substrates as groups (Figures 3(b) and 3(c)). the microstructure pitch of the SF films ranged from 5 to 20 μm. In addition, there was ordered arrangement of the 3.4. Cell Viability and Morphology of TSPCs on SF Films. bionic structures on the SF film surface. CCK-8 was used to assess the cell viability of TSPCs grown Applied Bionics and Biomechanics 5 SEM 100 𝜇m 100 𝜇m 100 𝜇m (a) HE staining 100𝜇m 100𝜇m 100𝜇m (b) Diameter (𝜇m) 0-5 5-10 11-15 15-20 >20 (c) Figure 2: Fibrous structure of native Achilles tendon evaluated with scanning electron microscope (SEM) (a) (magnification at ×100, ×500, and ×500) and HE staining (b) (magnification at ×200). The fiber diameter distribution of native tendons was measured (c). on SF film at different time points. TSPCs adhered well to the aspect ratio, cell body major axis angle, and the smallest cell area (p <0:01 for all). These data suggest that SF films with surface of SF films with different microstructures and prolif- erated with time. No significant difference in cell viability was a bionic microstructure can alter cell orientation and mor- observed between the experimental groups and the control phology. The TSPCs had the best biologic effects on the group at each time point (Figure 4(a)). 10 μm microstructure SF films. We performed immunostaining of cytoskeletal proteins We also evaluated the tendon-related gene expression of F-actin and counterstained with DAPI for nuclei to further TSPCs in different groups using qRT-PCR. At 3 days, the characterize the morphology of TSPCs on different SF films. early expression of the tendongenesis marker SCX was signif- The TSPCs exhibited a polygonal shape when grown on the icantly higher than that in the control and other SF films surface of smooth SF films and on ordinary cell culture groups, and COL1A1 was also significantly higher in the plates, but demonstrated an elongated cell morphology on 5 μm and 10 μm groups (p <0:01). At 7 days, other than SF films with different microstructure surfaces. The TSPCs COL1A1, the expression levels of tendon-specific markers exhibited a similar cell arrangement and morphology as in TNC and TNMD were also significantly higher in the 5 μm normal tendons, especially in the 10 μmSF film group and 10 μm groups. The 10 μm group had the highest expres- (Figure 4(b)). sion among all the groups (p <0:01) (Figure 4(d)). We further quantified the morphological changes in TSPCs on different SF film surfaces using the ratio of aligned 4. Discussion cells (%), cell body aspect ratios (length/width), cell body major axis angle (degree), and total cell area (μm ) Although various biomaterials have been evaluated for ten- (Figure 4(c)). Compared with the control group and the don regeneration, the regenerated SF film is the most prom- smooth SF film group, TSPCs grown on the bionic micro- ising thus far [15, 29, 34–36]. In this study, we first isolated structure SF film demonstrated an oriented arrangement and characterized TSPCs from the native tendon of SD rats. and slender cell morphology. Among the four different We also evaluated the structure and mechanical properties microstructure sizes, cells grown on the 10 μm microstruc- of native tendon using SEM and HE staining. We then pre- ture surface had the highest ratio of aligned cells, cell body pared SF films with different bionic microstructure sizes Ratio (%) 6 Applied Bionics and Biomechanics 100𝜇 m 100𝜇 m 100𝜇 m 100𝜇 m (a) 80 40 60 60 ⁎ 30 ⁎ ⁎ 40 20 20 10 0 0 0 N 5𝜇m10 𝜇m15 𝜇m20 𝜇m N 5𝜇m10 𝜇m15 𝜇m20 𝜇m N 5𝜇m10 𝜇m15 𝜇m20 𝜇m (b) 020 40 60 80 100 Strain (%) N 10𝜇m S 15𝜇m 5𝜇m 20𝜇m (c) Figure 3: SEM images of SF films with bionic microstructures at 5, 10, 15, and 20 μm, respectively (magnification at ×1000) (a). The maximum loading, ultimate stress (N/mm ), and breaking elongation (%) of SF film groups and native tendon were measured (b). The strain-stress curves of samples in different groups (c). Group N was the native tendon group, group S was the SF film group with a smooth surface, and the other groups were SF film groups with different microstructure sizes (5, 10, 15, and 20 μm). indicates p <0:05. based on the parameters of the native tendon and evaluated tures on the surface to better understand the influence of SF and its microstructure on cells. the cell viability, cell morphology, and tendon marker gene expression of rat TSPCs. Our results demonstrate that SF film Biomaterials play a pivotal role in providing a mechanical can mimic the structure of native tendon and has no cell tox- framework for promoting soft tissue healing [35, 40, 41]. icity. The 10 μmSF film group had the highest percentage of Thus, SF films should have similar mechanical properties as oriented TSPCs and the most significant effect on cell mor- the native tendon tissue to promote tendon regeneration. phology and also induced the highest expression of tendon- However, typical SF films have high water solubility and genesis markers. low mechanical properties due to their α-helix predomi- Previous studies have investigated SF for tendon repair, nance, which is not optimal for tendon regeneration. Accord- mostly by mixing it with other materials (such as PLA) and ing to previous studies [27, 30, 31], the β-sheet content can be using electrospinning technology to prepare electrodischarge increased through water annealing treatment, improving the fibers [37–39]. However, the degradation and biocompatibil- mechanical properties of SF film. In this study, water anneal- ity of mixed materials are not as good as those of pure SF, and ing treatment was applied at 95 C for 100 minutes. The final the impact on the biological behavior of cells is volatile. We mechanical properties of SF films with a thickness of 100 μm prepared pure SF films and accurately prepared microstruc- were comparable to those of native rat Achilles tendon. SF Maximum loading (N) Stress (N/mm ) Ultimate stress (N/mm ) Breaking elongation (%) Applied Bionics and Biomechanics 7 2.0 Cell viability 1.5 1.0 0.5 0.0 1day 2days 3days C 10𝜇m S 15𝜇m 5𝜇m 20𝜇m (a) C S 5𝜇m 10𝜇m15𝜇m20𝜇m 100 𝜇m 100 𝜇m 100 𝜇m 100 𝜇m 100 𝜇m 100 𝜇m (b) ⁎⁎ 100 ⁎⁎ 150 15000 ⁎⁎ 100 10000 50 5000 ⁎⁎ 20 5 0 0 0 0 CS 5𝜇m10 𝜇m15 𝜇m20 𝜇m CS 5𝜇m10 𝜇m15 𝜇m20 𝜇m CS 5𝜇m10 𝜇m15 𝜇m20 𝜇m CS 5𝜇m10 𝜇m15 𝜇m20 𝜇m (c) 3days 7days ⁎⁎ 4 4 ⁎⁎ ⁎⁎ 3 3 ⁎⁎ ⁎⁎ ⁎⁎ ⁎⁎ 2 2 1 1 0 0 SCX TNC TNMD COL-I SCX TNC TNMD COL-I S 15 (d) Figure 4: Cell viability on days 1, 2, and 3 was detected using the CCK-8 assay in different groups (a). Cytoskeleton and nucleus staining of TSPCs on different SF film groups and control group and also the distribution of normal tendon fibers and tendon cells (b). Quantitative analysis of the ratio of oriented aligned cells, cell body aspect, major axis angle, and cell area of TSPCs in different groups (c). Comparison of the expression levels of tendon-related genes after 3 days and 7 days (d). Group C was the normal culture plate group, group S was the SF film group with a smooth surface, and the other groups were SF film groups with different microstructure sizes (5, 10, 15 and ∗ ∗∗ 20 μm). indicates p <0:05, indicates p <0:01. films provide mechanical support to reduce minor secondary role in tissue engineering [45, 46]. In this study, TSPCs, damage caused by local instability and can be used for tendon which are stem and progenitor cells within the tendon tissue regeneration [40, 42]. [23], were used as seed cells to evaluate the biological effects Previous studies have used bone marrow-derived stem of SF film on tendon regeneration. Compared to BMSCs, cells (BMSCs) [35, 43, 44] as seed cells, which play a crucial TSPCs have a higher tendon differentiation potential and Ratio of aligned cells (%) Relative expression Cell body aspet (ratio) OD Cell body major axis angle (degree) Relative expression Cell area (m ) 8 Applied Bionics and Biomechanics are the primary functional cells in tendon reconstruction Conflicts of Interest [22, 23]. Thus, TSPCs may simulate cell-material interac- The authors declare that they have no conflicts of interest. tions in vivo and can be used to assess the biological perfor- mance of SF film in tendon regeneration more accurately. In previous studies, growth factors and chemical groups Acknowledgments were added to biomaterials to regulate the biological behavior of cells, but they were easily inactivated and the effects were The authors would like to thank Xiaobai Li from the Institute unstable [47, 48]. In this study, microstructures were con- for Clean Energy & Advanced Materials, School of Materials structed on the SF film surface to provide physical stimula- & Energy, Southwest University, and the staff at the Medical tion signals for the TSPCs, and the resulting biological Research Center of Southwest Hospital, Army Medical Uni- effect was more stable and controllable. Biomaterials interact versity for the technical support. The research was supported with seed cells, causing morphological changes and changes by grants from the National Natural Science Foundation of in the cell function [29, 49, 50]. Our study indicates that China (NSFC, No. 81572133), the National Key Research the bionic microstructure of SF films can affect cell morphol- and Development of China (No. 2016YFC1100500), State ogy and arrangement. As previously demonstrated, elon- Key Laboratory of Trauma, Burn, and Combined Injury gated cell morphology and oriented cell arrangement are (No. SKLRCJF04), and the National Key Research and Devel- conducive to the tendon differentiation of TSPCs and opment of China (No. 4174DH). ordered deposition of the extracellular matrix [17, 44]. As such, the use of SF films for tendon regeneration may be more effective with the construction of bionic microstruc- Supplementary Materials tures according to the native tendon fiber sizes. By interact- Supplementary Figure 1: serrated jaw of the testing machine: ing with bionic microstructures on the SF films, TSPCs the serrated jaw was connected to the end of sample; the grip exhibited directional alignment and a narrow cell morphol- was adjusted a to achieve stable fixation. (Supplementary ogy similar to normal tendon cells and unlike the behavior Materials) of the control and smooth SF film groups. Not surprisingly, the results of qRT-PCR also corrobo- References rated our cell morphology observations. The 10 μmSF film group promoted the expression of early tendon differentia- [1] S. B. Adams Jr., M. A. Thorpe, B. G. Parks, G. Aghazarian, tion markers including transcription regulators scleraxis E. Allen, and L. C. Schon, “Stem cell-bearing suture improves and type I collagen, while the expression levels of tenescin- Achilles tendon healing in a rat model,” Foot & Ankle Interna- C and tenomodulin increased in both the 5 μm and 10 μm tional, vol. 35, no. 3, pp. 293–299, 2014. SF films groups at a later stage of differentiation [25]. Based [2] M. Kauwe, “Acute Achilles tendon rupture: clinical evaluation, on morphological analysis, we postulated that the varying conservative management, and early active rehabilitation,” effects on differentiation regulation were mainly due to Clinics in Podiatric Medicine and Surgery, vol. 34, no. 2, changes in cell morphology. The 10 μmSF films had the most pp. 229–243, 2017. dramatic effect on the spatial arrangement and morphology [3] Y. Wang, G. He, H. Tang et al., “Aspirin inhibits inflammation of TSPCs. and scar formation in the injury tendon healing through regu- SF films have good biological activity and mechanical lating JNK/STAT-3 signalling pathway,” Cell Proliferation, vol. 52, article e12650, 2019. properties. The presence of bionic microstructures on their [4] V. Gulati, M. Jaggard, S. S. Al-Nammari et al., “Management of surfaces enabled them to provide significant biological guid- achilles tendon injury: a current concepts systematic review,” ance for TSPCs and to serve as a potential material for ten- World Journal of Orthopedics, vol. 6, no. 4, pp. 380–386, 2015. don repair. However, this study was limited to rat tendons. [5] V. Sahni, S. Tibrewal, L. Bissell, and W. S. Khan, “The role of Future studies should focus on optimizing the bionic micro- tissue engineering in achilles tendon repair: a review,” Current structure size for repairing human tendon injuries. Stem Cell Research & Therapy, vol. 10, pp. 31–36, 2015. [6] S. D. Wang, Q. Ma, K. Wang, and P. B. Ma, “Strong and bio- compatible three-dimensional porous silk fibroin/graphene 5. Conclusions oxide scaffold prepared by phase separation,” International Journal of Biological Macromolecules, vol. 111, pp. 237–246, Our study confirmed the feasibility of mimicking the proper- ties of the native tendon tissue through the fabrication of SF [7] H. Nalvuran, A. E. Elcin, and Y. M. Elcin, “Nanofibrous silk films with bionic microstructures, providing a promising bio- fibroin/reduced graphene oxide scaffolds for tissue engineer- material for tendon tissue engineering and regeneration. ing and cell culture applications,” International Journal of Bio- logical Macromolecules, vol. 114, pp. 77–84, 2018. [8] M. Farokhi, F. Mottaghitalab, S. Samani et al., “Silk fibroin/hy- Data Availability droxyapatite composites for bone tissue engineering,” Biotech- nology Advances, vol. 36, no. 1, pp. 68–91, 2018. The datasets generated and analyzed during the present [9] B. Yi, H. Zhang, Z. Yu, H. Yuan, X. Wang, and Y. Zhang, “Fab- study are available from the corresponding author upon rea- rication of high performance silk fibroin fibers via stable jet sonable request. electrospinning for potential use in anisotropic tissue Applied Bionics and Biomechanics 9 [25] Y. Shi, K. Zhou, W. Zhang et al., “Microgrooved topographical regeneration,” Journal of Materials Chemistry B, vol. 6, no. 23, pp. 3934–3945, 2018. surface directs tenogenic lineage specificdifferentiation of mouse tendon derived stem cells,” Biomedical Materials, [10] C. Zhang, H. Shao, J. Luo, X. Hu, and Y. Zhang, “Structure and vol. 12, article 015013, 2017. interaction of silk fibroin and graphene oxide in concentrated solution under shear,” International Journal of Biological Mac- [26] B. D. Lawrence, J. K. Marchant, M. A. Pindrus, F. G. Ome- romolecules, vol. 107, pp. 2590–2597, 2018. netto, and D. L. Kaplan, “Silk film biomaterials for cornea tis- sue engineering,” Biomaterials, vol. 30, no. 7, pp. 1299–1308, [11] M. Floren, C. Migliaresi, and A. Motta, “Processing techniques and applications of silk hydrogels in bioengineering,” Journal of functional biomaterials, vol. 7, no. 3, p. 26, 2016. [27] B. D. Lawrence, Z. Pan, A. Liu, D. L. Kaplan, and M. I. Rosen- blatt, “Human corneal limbal epithelial cell response to vary- [12] W. Abdel-Naby, B. Cole, A. Liu et al., “Silk-derived protein ing silk film geometric topography in vitro,” Acta enhances corneal epithelial migration, adhesion, and prolifer- Biomaterialia, vol. 8, no. 10, pp. 3732–3743, 2012. ation,” Investigative Ophthalmology & Visual Science, vol. 58, no. 3, pp. 1425–1433, 2017. [28] E. S. Gil, S. H. Park, J. Marchant, F. Omenetto, and D. L. Kaplan, “Response of human corneal fibroblasts on silk film [13] K. B. Kang, B. D. Lawrence, X. R. Gao et al., “Micro- and nano- surface patterns,” Macromolecular Bioscience, vol. 10, no. 6, scale topographies on silk regulate gene expression of human pp. 664–673, 2010. corneal epithelial cells,” Investigative Ophthalmology & Visual Science, vol. 58, no. 14, pp. 6388–6398, 2017. [29] Y. Ni, Y. Jiang, K. Wang et al., “Chondrocytes cultured in silk- based biomaterials maintain function and cell morphology,” [14] H. Yadav, S. Nho, A. Romeo, and J. D. MacGillivray, “Rotator The International Journal of Artificial Organs, vol. 42, cuff tears: pathology and repair,” Knee Surgery, Sports Trau- pp. 31–41, 2018. matology, Arthroscopy, vol. 17, no. 4, pp. 409–421, 2009. [30] K. B. Kang, B. D. Lawrence, X. R. Gao, V. H. Guaiquil, A. Liu, [15] S. Yao, Y. Xie, L. Xiao, L. Cai, and Z. Ma, “Porous and nonpo- and M. I. Rosenblatt, “The effect of micro- and nanoscale sur- rous silk fibroin (SF) membranes wrapping for Achilles tendon face topographies on silk on human corneal limbal epithelial (AT) repair: which one is a better choice?,” Journal of Biomed- cell differentiation,” Scientific Reports, vol. 9, no. 1, p. 1507, ical Materials Research. Part B, Applied Biomaterials, vol. 107, no. 3, pp. 733–740, 2019. [31] X. Hu, K. Shmelev, L. Sun et al., “Regulation of silk material [16] J. G. Snedeker and J. Foolen, “Tendon injury and repair - a per- structure by temperature-controlled water vapor annealing,” spective on the basic mechanisms of tendon disease and future Biomacromolecules, vol. 12, no. 5, pp. 1686–1696, 2011. clinical therapy,” Acta Biomaterialia, vol. 63, pp. 18–36, 2017. [32] Y. Wang, G. He, H. Tang et al., “Aspirin promotes tenogenic [17] S. Yang, X. Shi, X. Li, J. Wang, Y. Wang, and Y. Luo, “Oriented differentiation of tendon stem cells and facilitates tendinopa- collagen fiber membranes formed through counter-rotating thy healing through regulating the GDF7/Smad1/5 signaling extrusion and their application in tendon regeneration,” Bio- pathway,” Journal of Cellular Physiology, vol. 235, pp. 4778– materials, vol. 207, pp. 61–75, 2019. 4789, 2020. [18] S. W. Tang, W. Y. Tong, W. Shen, K. W. Yeung, and Y. W. [33] S. Yang, J. Wang, Y. Wang, and Y. Luo, “Key role of collagen Lam, “Stringent requirement for spatial arrangement of extra- fibers orientation in casing-meat adhesion,” Food Research cellular matrix in supporting cell morphogenesis and differen- International, vol. 89, Part 1, pp. 439–447, 2016. tiation,” BMC Cell Biology, vol. 15, no. 1, p. 10, 2014. [19] A. Ramírez-Torres, R. Penta, R. Rodríguez-Ramos et al., [34] F. Wu, M. Nerlich, and D. Docheva, “Tendon injuries: basic science and new repair proposals,” EFORT open reviews, “Three scales asymptotic homogenization and its application to layered hierarchical hard tissues,” International Journal of vol. 2, no. 7, pp. 332–342, 2017. Solids and Structures, vol. 130, pp. 190–198, 2018. [35] D. Ma, Y. Wang, and W. Dai, “Silk fibroin-based biomaterials [20] M. L. Killian, L. Cavinatto, L. M. Galatz, and S. Thomopoulos, for musculoskeletal tissue engineering,” Materials Science & Engineering. C, Materials for Biological Applications, vol. 89, “The role of mechanobiology in tendon healing,” Journal of Shoulder and Elbow Surgery, vol. 21, no. 2, pp. 228–237, 2012. pp. 456–469, 2018. [21] A. Ramírez-Torres, R. Penta, R. Rodríguez-Ramos et al., [36] A. Baba, S. Matsushita, K. Kitayama et al., “Silk fibroin pro- “Homogenized out-of-plane shear response of three-scale duced by transgenic silkworms overexpressing the Arg-Gly- fiber-reinforced composites,” Computing and Visualization asp motif accelerates cutaneous wound healing in mice,” Jour- in Science, vol. 20, no. 3-6, pp. 85–93, 2019. nal of Biomedical Materials Research. Part B, Applied Biomate- rials, vol. 107, pp. 97–103, 2019. [22] M. Ni, P. P. Lui, Y. F. Rui et al., “Tendon-derived stem cells [37] S. Sahoo, L. T. Ang, J. Cho-Hong Goh, and S. L. Toh, “Bio- (TDSCs) promote tendon repair in a rat patellar tendon win- dow defect model,” Journal of Orthopaedic Research, vol. 30, active nanofibers for fibroblastic differentiation of mesenchy- no. 4, pp. 613–619, 2012. mal precursor cells for ligament/tendon tissue engineering applications,” Differentiation, vol. 79, no. 2, pp. 102–110, [23] Y. Wang, G. He, Y. Guo et al., “Exosomes from tendon stem cells promote injury tendon healing through balancing synthe- sis and degradation of the tendon extracellular matrix,” Jour- [38] E. Naghashzargar, S. Farè, V. Catto et al., “Nano/micro hybrid scaffold of PCL or P3HB nanofibers combined with silk fibroin nal of Cellular and Molecular Medicine, vol. 23, no. 8, pp. 5475–5485, 2019. for tendon and ligament tissue engineering,” Journal of applied biomaterials & functional materials, vol. 13, no. 2, pp. e156– [24] T. Harvey, S. Flamenco, and C. M. Fan, “A Tppp3(+)Pdgfra(+) e168, 2015. tendon stem cell population contributes to regeneration and reveals a shared role for PDGF signalling in regeneration and [39] C. H. Chen, S. H. Chen, C. Y. Kuo, M. L. Li, and J. P. Chen, fibrosis,” Nature Cell Biology, vol. 21, no. 12, pp. 1490–1503, “Response of dermal fibroblasts to biochemical and physical 2019. cues in aligned polycaprolactone/silk fibroin nanofiber 10 Applied Bionics and Biomechanics scaffolds for application in tendon tissue engineering,” Nano- materials, vol. 7, no. 8, p. 219, 2017. [40] G. Depres-Tremblay, A. Chevrier, M. Snow, M. B. Hurtig, S. Rodeo, and M. D. Buschmann, “Rotator cuff repair: a review of surgical techniques, animal models, and new technologies under development,” Journal of Shoulder and Elbow Surgery, vol. 25, no. 12, pp. 2078–2085, 2016. [41] A. M. Murthi and M. Lankachandra, “Technologies to aug- ment rotator cuff repair,” The Orthopedic Clinics of North America, vol. 50, no. 1, pp. 103–108, 2019. [42] D. Deng, W. Liu, F. Xu et al., “Engineering human neo-tendon tissue in vitro with human dermal fibroblasts under static mechanical strain,” Biomaterials, vol. 30, no. 35, pp. 6724– 6730, 2009. [43] R. You, X. Li, Z. Luo, J. Qu, and M. Li, “Directional cell elon- gation through filopodia-steered lamellipodial extension on patterned silk fibroin films,” Biointerphases, vol. 10, no. 1, arti- cle 011005, 2015. [44] T. K. Teh, S. L. Toh, and J. C. Goh, “Aligned fibrous scaffolds for enhanced mechanoresponse and tenogenesis of mesenchy- mal stem cells,” Tissue Engineering. Part A, vol. 19, no. 11-12, pp. 1360–1372, 2013. [45] M. Ermis, E. Antmen, and V. Hasirci, “Micro and nanofabrica- tion methods to control cell-substrate interactions and cell behavior: a review from the tissue engineering perspective,” Bioactive materials, vol. 3, no. 3, pp. 355–369, 2018. [46] N. Sevivas, F. G. Teixeira, R. Portugal et al., “Mesenchymal stem cell secretome improves tendon cell viability in vitro and tendon-bone healing in vivo when a tissue engineering strategy is used in a rat model of chronic massive rotator cuff tear,” The American Journal of Sports Medicine, vol. 46, pp. 449–459, 2017. [47] S. Sahoo, S. L. Toh, and J. C. Goh, “A bFGF-releasing silk/PLGA-based biohybrid scaffold for ligament/tendon tis- sue engineering using mesenchymal progenitor cells,” Bioma- terials, vol. 31, no. 11, pp. 2990–2998, 2010. [48] Y. J. Zhang, X. Chen, G. Li et al., “Concise review: stem cell fate guided by bioactive molecules for tendon regeneration,” Stem Cells Translational Medicine, vol. 7, no. 5, pp. 404–414, 2018. [49] X. Li, Q. Huang, T. A. Elkhooly et al., “Effects of titanium sur- face roughness on the mediation of osteogenesis via modulat- ing the immune response of macrophages,” Biomedical Materials, vol. 13, article 045013, 2018. [50] E. Sayin, E. T. Baran, and V. Hasirci, “Osteogenic differentia- tion of adipose derived stem cells on high and low aspect ratio micropatterns,” Journal of Biomaterials Science. Polymer Edi- tion, vol. 26, no. 18, pp. 1402–1424, 2015. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Applied Bionics and Biomechanics Hindawi Publishing Corporation

Bionic Silk Fibroin Film Induces Morphological Changes and Differentiation of Tendon Stem/Progenitor Cells

Loading next page...
 
/lp/hindawi-publishing-corporation/bionic-silk-fibroin-film-induces-morphological-changes-and-4Yzu0JCILR
Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2020 Kang Lu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1176-2322
eISSN
1754-2103
DOI
10.1155/2020/8865841
Publisher site
See Article on Publisher Site

Abstract

Hindawi Applied Bionics and Biomechanics Volume 2020, Article ID 8865841, 10 pages https://doi.org/10.1155/2020/8865841 Research Article Bionic Silk Fibroin Film Induces Morphological Changes and Differentiation of Tendon Stem/Progenitor Cells 1 2 1 1 1 1 Kang Lu , Xiaodie Chen , Hong Tang , Mei Zhou , Gang He , Juan Liu, 1 1 1 1 2 1 Xuting Bian, Yupeng Guo, Fan Lai, Mingyu Yang, Zhisong Lu , and Kanglai Tang Department of Orthopedics/Sports Medicine Center, State Key Laboratory of Trauma, Burn and Combined Injury, Southwest Hospital, Army Medical University (Third Military Medical University), Chongqing 400038, China Institute for Clean Energy & Advanced Materials, School of Materials & Energy, Southwest University, Chongqing 400715, China Correspondence should be addressed to Zhisong Lu; zslu@swu.edu.cn and Kanglai Tang; tangkanglai@hotmail.com Received 30 August 2020; Revised 17 November 2020; Accepted 20 November 2020; Published 2 December 2020 Academic Editor: Jose Merodio Copyright © 2020 Kang Lu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Purpose. Tendon injuries are common musculoskeletal system disorders, but the ability for tendon regeneration is limited. Silk fibroin (SF) film may be suitable for tendon regeneration due to its excellent biocompatibility and physical properties. This study is aimed at evaluating the application value of bionic SF film in tendon regeneration. Methods. Tendon stem/progenitor cells (TSPCs) were isolated from rat Achilles tendon and characterized based on their surface marker expression and multilineage differentiation potential. SF films with smooth or bionic microstructure surfaces (5, 10, 15, 20 μm) were prepared. The morphology and mechanical properties of natural tendons and SF films were characterized. TSPCs were used as the seed cells, and the cell viability and cell adhesion morphology were analyzed. The tendongenesis-related gene expression of TSPCs was also evaluated using quantitative polymerase chain reaction. Results. Compared to the native tendon, only the 10, 15, and 20 μmSF film groups had comparable maximum loading and ultimate stress, with the exception of the breaking elongation rate. The 10 μmSF film group had the highest percentage of oriented cells and the most significant changes in cell morphology. The most significant upregulations in the expression of COL1A1, TNC, TNMD, and SCX were also observed in the 10 μmSF film group. Conclusion.SF film with a bionic microstructure can serve as a tissue engineering scaffold and provide biophysical cues for the use of TSPCs to achieve proper cellular adherence arrangement and morphology as well as promote the tenogenic differentiation of TSPCs, making it a valuable customizable biomaterial for future applications in tendon repair. 1. Introduction Silk fibroin- (SF-) based biomaterials have been applied for tissue regeneration recently due to their excellent biocom- Tendons play a vital role in the ankle movement. Acute and patibility, controllable mechanical properties, and ease of chronic sports-related tendon injuries are becoming more fre- processing [6–8]. SF biomaterials are available as films [9], quent in people of all ages, often leading to repeated pain and sponges [10], and hydrogels [11]. The Corneal tissue [12, 13] even disability [1, 2]. Scar formation is common after a tendon and articular cartilage [3] have been reconstructed with SF injury, limiting biological performance [3]. At present, tendon film. The fiber structure of SF is similar to that of type I colla- injury treatment remains challenging for clinicians. Primary gen [8], and the structure of SF film is similar to that of tendon treatments include autologous and allogeneic tendon trans- sheaths, which play a crucial role in tendon regeneration [14]. plantation or artificial tendon replacement. However, these The biological activity and physical properties of SF film are reconstructive techniques may cause loss of function at the suitable for tendon regrowth [15, 16]; however, the effect of SF film microstructures on tendon regeneration has not been donor site, infection, rejection, or poor graft integration [4]. Therefore, researchers have been developing new technologies thoroughly evaluated. fortendonregenerationinrecentyears. Tendontissueengi- Studies have shown that biomaterials with microstruc- neering has emerged as a promising treatment modality [5]. tures mimicking native structures would allow for early core 2 Applied Bionics and Biomechanics 2.4. Fabrication of SF Film with Smooth or Bionic cell adhesion and proper cell biological behavior for tendon regeneration [17–19]. The tendon tissue has parallel aligned Microstructure Surfaces. Silk solution extraction and SF film collagen fibers where tenocytes reside in the narrow space microstructure fabrication were completed as previously between collagen fibers [20, 21]. Tendon stem/progenitor described [26–29]. Briefly, protein extract from cocoons cells (TSPCs) are the precursor cells for tendon regeneration (supplied by State Key Laboratory of Silkworm Genome Biol- [22–24] and have been used as seed cells for tendon tissue ogy, Southwest University) was cut into three segments and engineering. In this study, we prepared SF films with different boiled in 0.02 M Na CO (Aladdin Reagent Co. Shanghai, 2 3 bionic microstructures and mechanical properties mimick- China) for 40 minutes. Next, the protein extract was rinsed ing healthy rat tendons and then investigated their biological in dH O for 20 minutes and dried overnight at room temper- effects on rat TSPCs to explore potential applications in ature. The protein extract was then dissolved in 9.3 M lithium human tendon regeneration. bromide (Aladdin Reagent Co. Shanghai, China) at room temperature and placed in a 50 C oven for five hours. Then, the solution was placed in cellulose dialysis membranes 2. Materials and Methods (Shanghai Tansoole Company, China) and dialyzed in water for 72 hours. Finally, the protein extract was centrifuged at 2.1. Animals. Animals were provided by the Animal Center 8000 r/min for 20 minutes to remove impurities. The result- of the Third Military Medical University. A total of 5 four- ing supernatant of aqueous silk solution had a final concen- week-old male Sprague–Dawley (SD) rats were sacrificed to tration of 4.5% wt./v. determined by gravimetric analysis extract TSPCs. Additionally, 10 eight-week-old male SD rats and was stored at 4 C. weighing 200-250 g were sacrificed for scanning electron Silicon wafers with parallel ridge widths and spacing of microscope (SEM) and tissue section staining. The Animal 5 μm, 10 μm, 15 μm, and 20 μm, and 5 μm groove depths Research Ethics Committee of the Third Military Medical (according to the data measured in step 2.3) were produced University approved all experimental procedures. using standard photolithography techniques [27]. Polydi- methylsiloxane (PDMS) molds were produced from these 2.2. Isolation and Characterization of Rat TSPCs. A total of 5 surfaces by casting 300 mL of a 10 : 1 mixture of potting to male four-week-old SD rats were sacrificed to isolate TSPCs, ° catalyst solution and then curing at 50 C for 4 hours. Smooth as previously described [23]. Briefly, Achilles tendons from PDMS base plates and smooth silicon wafers were prepared both hind feet were dissected after euthanasia. Only the as described previously [26–29]. mid-substance tendon tissue was harvested, and the periten- PDMS plates with either smooth or microstructure sur- dinous connective tissue was carefully removed. The har- faces were cut into 35 mm diameter casting surfaces, and vested tissue was minced in sterile phosphate-buffered 4 mL of silk solution was pipetted onto each surface. Post- saline (PBS) and digested in 3 mg/mL of type I collagenase casting, the SF films were water annealed for up to 100 (Sigma-Aldrich, St. Louis, MO) for 2.5 hours at 37 C. A ° minutes at 90 C as previously described [30, 31]. Afterward, 70 mm cell strainer (Becton Dickinson, Franklin Lakes, NJ) the SF films measuring 100 μm in thickness were removed was used to remove the undigested tissue. After three washes from their respective PDMS molds and sterilized by UV irra- with PBS, the released cells were resuspended in Dulbecco’s diation for 2 hours before seeding with TSPCs. Modified Eagle Media (DMEM) (Gibco, Carlsbad, CA) sup- plemented with 10% fetal bovine serum (FBS), 100 U/mL 2.5. Scanning Electron Microscopy (SEM). Five eight-week- penicillin, 100 mg/mL streptomycin, and 2 mmol/L L-gluta- old male SD rats weighing 200-250 g were sacrificed for mine (all from Invitrogen, Carlsbad, CA) and incubated at SEM. Rat Achilles tendons were isolated as described above. 37 C and 5% CO for 2 days. Nonadherent cells were The specimens were fixed with 3% glutaraldehyde for 2 hours removed using PBS. After 7 days, the cells were trypsinized and rinsed twice with 0.1 M PBS for 15 minutes each. The with Trypsin-EDTA solution (Sigma-Aldrich) and used as specimens were then dehydrated (15 minutes each) in a series passage 0 cells. Passages 3 (P3) cells were used for all subse- of ethanol solutions (50, 60, 70, 80, 90, 100%, and twice at quent experiments. 100%) and a series of tert-butanol solutions (50, 60, 70, 80, 90, 100%, and twice at 100%). The specimens were finally 2.3. Trilineage Differentiation Assay. TSPCs were incubated dried and placed on a sample stage. After drying, vacuum with adipogenic, osteogenic, and chondrogenic induction platinum plating was applied and observed with SEM medium as previously described to characterize their multili- (ZEISS-Crossbeam 304, ZEISS, Germany). neage differentiation potential [25]. Briefly, TSPCs were SF film samples were sputter-coated with gold for 60 sec- seeded in six-well plates at a cell density of 2×10 onds and observed under SEM (Phenom Prox, Phenom, cells/cm before inducing differentiation. Then, the TSPCs were cul- Netherlands) at 15 kV. The thickness of the SF films was tured in the appropriate induction medium and stained measured from their cross-sections, and the samples were according to the respective adipogenic (RASMX-90031, tiled to observe their surface morphology. The thickness, Cyagen, Guangzhou, China), chondrogenic (RASMX-9004, width, and spacing of the SF film bionic microstructure were Cyagen, Guangzhou, China), and osteogenic (RASTA- measured using ImageJ software. 90021, Cyagen, Guangzhou, China) induction differentiation protocols. The TSPCs were then observed under a light 2.6. Hematoxylin-Eosin (HE) Staining. Five eight-week-old microscope. male SD rats were sacrificed, and their Achilles tendons were Applied Bionics and Biomechanics 3 in 100 nM rhodamine phalloidin (Yeasen Biological Tech- harvested as described above. Tendon specimens were fixed in 10% formaldehyde for at least 24 hours at room tempera- nology Co, Shanghai China) for 30 minutes to stain the actin ture and dehydrated with an ascending alcohol gradient. cytoskeleton. Nuclei were counterstained with 100 nM DAPI Finally, the specimens were embedded in paraffin, which (Beyotime Biotech, Jiangsu, China) for 5 minutes. Images were cut into 3 μm sections and then stained according to were obtained with a laser scanning confocal microscope the manufacturer’s protocol. All of the sections were exam- (Zeiss lsm780, Germany) and analyzed with ImageJ software ined using a light microscope (Olympus, Japan). Three fields to measure the cell body aspect ratios (length/width), cell on each section were randomly selected to measure the diam- body major axis angles, and cell area [17, 24]. All measure- eter of the collagen fibers using ImageJ software. ments were obtained from 20 cells per image, and three images were analyzed from each group. 2.7. Mechanical Test. Mechanical testing of normal Achilles 2.10. Real-Time Quantitative Polymerase Chain Reaction tendons and different SF films was performed as previously (RT-qPCR). The mRNA expression levels of tendon-related described [32]. In brief, Achilles tendons with bony attach- genes of collagen type I alpha china (COL1A1), tenascin-C ments were isolated from five SD rats. The calcaneal and tib- (TNC), tenomodulin (TNMD), and scleraxis (SCX) were ial ends of the tendons were fixed to two serrated jaws determined using real-time quantitative polymerase chain (Supplementary Figure 1), which were connected to the reaction (RT-qPCR). One microgram of total RNA was testing machine (E1000, Instron, USA). The serrated jaws extracted from TSPCs using TRIzol reagent (TaKaRa, Dalian, could be adjusted using a grip to achieve stable fixation. China) according to the manufacturer’s protocol, and then Before testing, the SF films were water annealed at 90 C for 1 μg of RNA was converted to complementary DNA (cDNA) 100 minutes as previously described to improve their using a Superscript III First-Strand Synthesis Kit (TaKaRa). mechanical strength [31]. The cut SF film specimens were qPCR was performed using a SYBR Green RT-PCR kit rolled and gently pressed into flat strips with a similar (TaKaRa) and an ABI Prism 7900 Sequence Detection Sys- length, width, and thickness as the natural Achilles tendon tem (PE Applied Biosystems, Foster City, CA, USA). The (1 cm in length, 2 mm in width, and 1 mm in thickness) and housekeeping gene glyceraldehyde 3-phosphate dehydroge- then secured to the serrated jaws. The testing machine was nase (GAPDH) was used as an internal control to calculate used to evaluate the tensile stress-strain curves for all the relative expression level of the target gene. The PCR specimens as previously described [17, 33]. primer sequences are shown in Table 1. 2.8. Cell Viability Assay. TSPCs were cultured on tissue cul- 2.11. Statistical Analysis. Unless stated otherwise, all experi- ture plastic (TCP), smooth SF films, and SF films with differ- ments were performed in triplicate, and the data were pre- ent microstructure surfaces (5 μm, 10 μm, 15 μm, and 20 μm) sented as the mean ± standard deviation. Quantitative data 4 2 at a density of 1×10 cells/cm for 1, 2, and 3 days. Cell via- were analyzed using analysis of variance (ANOVA) with bility was measured with a Cell Counting KIT-8 (CCK-8, SPSS 22.0. A p value less than 0.05 was considered statistically Dojindo, Japan). Briefly, TSPC or SF film-TSPC constructs significant. were harvested at the designated time points. After incuba- tion with 10% CCK-8 solution at 37 C for 2 hours, 100 μL 3. Results of the solution was transferred to a new 96-well plate to mea- sure the absorbance at 450 nm using a microplate reader 3.1. Rat TSPC Multilineage Differentiation Potentials. At (Model 680, Bio-Rad, USA). lower density, the TSPCs exhibited fibroblast-like spindle shapes. At 80% to 90% confluence, the TSPCs exhibited a 2.9. Immunofluorescence of TSPCs and Measurement of Cell pebble-like morphology and developed tight colonies. Morphology. To characterize the surface marker expression Immunostaining of specific surface antigens (CD44, CD90, of the TSPCs, the specific expression levels of CD34 (Anti- CD3, and CD34) was used to characterize the newly isolated CD34 antibody, 1 : 200, ab81289, Abcam, Cambridge, UK), rat TSPCs. The TSPCs were positive for CD44 and CD90, but CD44 (Anti-CD44 antibody, 1 : 200,ab216647, Abcam, Cam- negative for the hematopoietic stem cell marker CD34 and bridge, UK), CD3 (Anti-CD3 antibody, 1 : 200, ab135372, the leukocyte marker CD3 (Figure 1(a)). Abcam, Cambridge, UK), and CD90 (Anti-CD90/Thy1 anti- TSPCs were incubated in specific lineage induction body, 1 : 200, ab225, Abcam, Cambridge, UK) were detected medium for 14 days to characterize their multilineage differ- by immunostaining. Cells were fixed with 4% paraformalde- entiation potentials (Figure 1(b)). The TSPCs were positive hyde (PFA), permeabilized with 0.1% Triton‐X and incu- for alizarin red S staining, indicating calcium deposition. bated with primary antibody (1 : 1000). An Alexa Fluor® The TSPCs also displayed round orange cytoplasmic droplets 488-conjugated goat anti‐rabbit IgG (ab150077) secondary upon oil red O staining, suggesting lipid droplet formation. antibody was used at a dilution of 1 : 1000. Stained cells were Additionally, blue-stained acidic glycosaminoglycans were observed under an inverted fluorescence microscope. observed, consistent with extracellular matrix formation dur- TSPC staining was completed as previously described ing chondrogenesis. [25]. Briefly, after adhering to TCP or the SF films for 24 hours, cells were fixed with 4% PFA for 20 minutes 3.2. SEM, HE Staining, and Biomechanical Testing of Rat at room temperature and then permeabilized with 0.5% Achilles Tendons. SEM was used to examine the morphology Triton X-100 for 5 minutes. Then, the cells were incubated of healthy rat Achilles tendons. Collagen fibers in native rat 4 Applied Bionics and Biomechanics Table 1: Primers used in qPCR analysis. Gene name Annealing temperature ( C) PCR product size (bp) F:TGTACTGGATCAATCCCACTCT TNMD 60 115 R:GCTCATTCGGGTCAATCCCCT F:CCTTCTGCCTCAGCAACCAG SCN 60 156 R:GGTAGTGGGGCTCTCCGTGACT F:GGCGGCCAGGGCTCCGACCC COL1A1 60 320 R:AATTCCTGGTCTGGGGCACC F:CAAGGGAGACAAGGAGAGTG TNC 60 159 R:AGGCTGTAGTTGAGGCGG F:GACTTCAACAGCAACTCCCAC GAPDH 60 125 R:TCCACCACCCTGTTGCTGTA Light microscope 100𝜇m CD44 CD90 Alizarin red S staining Oil red O staining 50𝜇m 50𝜇m 100𝜇m 100𝜇m CD3 CD34 Toluidine blue staining 100𝜇m 50𝜇m 50𝜇m (a) (b) Figure 1: Cell morphology of tendon stem and progenitor cells on tissue culture plates under light microscope and immunofluorescence staining of CD44, CD90, CD3, and CD34 markers (a). Alizarin red S, oil red O staining, and toluidine blue staining after induction of osteogenesis, adipogenesis, and chondrogenesis (b). Achilles tendons were arranged tightly in parallel with an To compare the mechanical properties between native even thickness (Figure 2(a)). A few visualized wavy colla- tendon and SF films, we performed mechanical tests includ- gen fiber bundles may have been secondary to a relaxed ing maximum loading, ultimate stress (N/mm ), and break- state. ing elongation (%) on native tendon (N), smooth SF film Native rat Achilles tendon tissue sections were stained (S), and SF films with different microstructure diameters with HE staining. The normal tendon structure demonstrated (5 μm, 10 μm, 15 μm, and 20 μm). SF films with microstruc- ordered arrangement of the collagen fibers (Figure 2(b)). ture diameters (10 μm, 15 μm, and 20 μm) exhibited compa- Collagen fiber diameters ranged from 5 to 20 μm, and about rable maximum loading and ultimate stress as the native 70% of the fibers had a diameter of 5-10 μm (Figure 2(c)). tendon, with the exception of the smooth and 5 μmSF film groups. As the width of the bionic groove increased, mechan- 3.3. Characterization of SF Films with Different Microstructures ical properties such as the maximum loading capacity Using SEM and Biomechanical Tests. SF film morphology was increased gradually. However, the native tendon group had characterized with SEM (Figure 3(a)). SF films successfully a significantly higher breaking elongation rate than the other replicated the features defined on the PDMS substrates as groups (Figures 3(b) and 3(c)). the microstructure pitch of the SF films ranged from 5 to 20 μm. In addition, there was ordered arrangement of the 3.4. Cell Viability and Morphology of TSPCs on SF Films. bionic structures on the SF film surface. CCK-8 was used to assess the cell viability of TSPCs grown Applied Bionics and Biomechanics 5 SEM 100 𝜇m 100 𝜇m 100 𝜇m (a) HE staining 100𝜇m 100𝜇m 100𝜇m (b) Diameter (𝜇m) 0-5 5-10 11-15 15-20 >20 (c) Figure 2: Fibrous structure of native Achilles tendon evaluated with scanning electron microscope (SEM) (a) (magnification at ×100, ×500, and ×500) and HE staining (b) (magnification at ×200). The fiber diameter distribution of native tendons was measured (c). on SF film at different time points. TSPCs adhered well to the aspect ratio, cell body major axis angle, and the smallest cell area (p <0:01 for all). These data suggest that SF films with surface of SF films with different microstructures and prolif- erated with time. No significant difference in cell viability was a bionic microstructure can alter cell orientation and mor- observed between the experimental groups and the control phology. The TSPCs had the best biologic effects on the group at each time point (Figure 4(a)). 10 μm microstructure SF films. We performed immunostaining of cytoskeletal proteins We also evaluated the tendon-related gene expression of F-actin and counterstained with DAPI for nuclei to further TSPCs in different groups using qRT-PCR. At 3 days, the characterize the morphology of TSPCs on different SF films. early expression of the tendongenesis marker SCX was signif- The TSPCs exhibited a polygonal shape when grown on the icantly higher than that in the control and other SF films surface of smooth SF films and on ordinary cell culture groups, and COL1A1 was also significantly higher in the plates, but demonstrated an elongated cell morphology on 5 μm and 10 μm groups (p <0:01). At 7 days, other than SF films with different microstructure surfaces. The TSPCs COL1A1, the expression levels of tendon-specific markers exhibited a similar cell arrangement and morphology as in TNC and TNMD were also significantly higher in the 5 μm normal tendons, especially in the 10 μmSF film group and 10 μm groups. The 10 μm group had the highest expres- (Figure 4(b)). sion among all the groups (p <0:01) (Figure 4(d)). We further quantified the morphological changes in TSPCs on different SF film surfaces using the ratio of aligned 4. Discussion cells (%), cell body aspect ratios (length/width), cell body major axis angle (degree), and total cell area (μm ) Although various biomaterials have been evaluated for ten- (Figure 4(c)). Compared with the control group and the don regeneration, the regenerated SF film is the most prom- smooth SF film group, TSPCs grown on the bionic micro- ising thus far [15, 29, 34–36]. In this study, we first isolated structure SF film demonstrated an oriented arrangement and characterized TSPCs from the native tendon of SD rats. and slender cell morphology. Among the four different We also evaluated the structure and mechanical properties microstructure sizes, cells grown on the 10 μm microstruc- of native tendon using SEM and HE staining. We then pre- ture surface had the highest ratio of aligned cells, cell body pared SF films with different bionic microstructure sizes Ratio (%) 6 Applied Bionics and Biomechanics 100𝜇 m 100𝜇 m 100𝜇 m 100𝜇 m (a) 80 40 60 60 ⁎ 30 ⁎ ⁎ 40 20 20 10 0 0 0 N 5𝜇m10 𝜇m15 𝜇m20 𝜇m N 5𝜇m10 𝜇m15 𝜇m20 𝜇m N 5𝜇m10 𝜇m15 𝜇m20 𝜇m (b) 020 40 60 80 100 Strain (%) N 10𝜇m S 15𝜇m 5𝜇m 20𝜇m (c) Figure 3: SEM images of SF films with bionic microstructures at 5, 10, 15, and 20 μm, respectively (magnification at ×1000) (a). The maximum loading, ultimate stress (N/mm ), and breaking elongation (%) of SF film groups and native tendon were measured (b). The strain-stress curves of samples in different groups (c). Group N was the native tendon group, group S was the SF film group with a smooth surface, and the other groups were SF film groups with different microstructure sizes (5, 10, 15, and 20 μm). indicates p <0:05. based on the parameters of the native tendon and evaluated tures on the surface to better understand the influence of SF and its microstructure on cells. the cell viability, cell morphology, and tendon marker gene expression of rat TSPCs. Our results demonstrate that SF film Biomaterials play a pivotal role in providing a mechanical can mimic the structure of native tendon and has no cell tox- framework for promoting soft tissue healing [35, 40, 41]. icity. The 10 μmSF film group had the highest percentage of Thus, SF films should have similar mechanical properties as oriented TSPCs and the most significant effect on cell mor- the native tendon tissue to promote tendon regeneration. phology and also induced the highest expression of tendon- However, typical SF films have high water solubility and genesis markers. low mechanical properties due to their α-helix predomi- Previous studies have investigated SF for tendon repair, nance, which is not optimal for tendon regeneration. Accord- mostly by mixing it with other materials (such as PLA) and ing to previous studies [27, 30, 31], the β-sheet content can be using electrospinning technology to prepare electrodischarge increased through water annealing treatment, improving the fibers [37–39]. However, the degradation and biocompatibil- mechanical properties of SF film. In this study, water anneal- ity of mixed materials are not as good as those of pure SF, and ing treatment was applied at 95 C for 100 minutes. The final the impact on the biological behavior of cells is volatile. We mechanical properties of SF films with a thickness of 100 μm prepared pure SF films and accurately prepared microstruc- were comparable to those of native rat Achilles tendon. SF Maximum loading (N) Stress (N/mm ) Ultimate stress (N/mm ) Breaking elongation (%) Applied Bionics and Biomechanics 7 2.0 Cell viability 1.5 1.0 0.5 0.0 1day 2days 3days C 10𝜇m S 15𝜇m 5𝜇m 20𝜇m (a) C S 5𝜇m 10𝜇m15𝜇m20𝜇m 100 𝜇m 100 𝜇m 100 𝜇m 100 𝜇m 100 𝜇m 100 𝜇m (b) ⁎⁎ 100 ⁎⁎ 150 15000 ⁎⁎ 100 10000 50 5000 ⁎⁎ 20 5 0 0 0 0 CS 5𝜇m10 𝜇m15 𝜇m20 𝜇m CS 5𝜇m10 𝜇m15 𝜇m20 𝜇m CS 5𝜇m10 𝜇m15 𝜇m20 𝜇m CS 5𝜇m10 𝜇m15 𝜇m20 𝜇m (c) 3days 7days ⁎⁎ 4 4 ⁎⁎ ⁎⁎ 3 3 ⁎⁎ ⁎⁎ ⁎⁎ ⁎⁎ 2 2 1 1 0 0 SCX TNC TNMD COL-I SCX TNC TNMD COL-I S 15 (d) Figure 4: Cell viability on days 1, 2, and 3 was detected using the CCK-8 assay in different groups (a). Cytoskeleton and nucleus staining of TSPCs on different SF film groups and control group and also the distribution of normal tendon fibers and tendon cells (b). Quantitative analysis of the ratio of oriented aligned cells, cell body aspect, major axis angle, and cell area of TSPCs in different groups (c). Comparison of the expression levels of tendon-related genes after 3 days and 7 days (d). Group C was the normal culture plate group, group S was the SF film group with a smooth surface, and the other groups were SF film groups with different microstructure sizes (5, 10, 15 and ∗ ∗∗ 20 μm). indicates p <0:05, indicates p <0:01. films provide mechanical support to reduce minor secondary role in tissue engineering [45, 46]. In this study, TSPCs, damage caused by local instability and can be used for tendon which are stem and progenitor cells within the tendon tissue regeneration [40, 42]. [23], were used as seed cells to evaluate the biological effects Previous studies have used bone marrow-derived stem of SF film on tendon regeneration. Compared to BMSCs, cells (BMSCs) [35, 43, 44] as seed cells, which play a crucial TSPCs have a higher tendon differentiation potential and Ratio of aligned cells (%) Relative expression Cell body aspet (ratio) OD Cell body major axis angle (degree) Relative expression Cell area (m ) 8 Applied Bionics and Biomechanics are the primary functional cells in tendon reconstruction Conflicts of Interest [22, 23]. Thus, TSPCs may simulate cell-material interac- The authors declare that they have no conflicts of interest. tions in vivo and can be used to assess the biological perfor- mance of SF film in tendon regeneration more accurately. In previous studies, growth factors and chemical groups Acknowledgments were added to biomaterials to regulate the biological behavior of cells, but they were easily inactivated and the effects were The authors would like to thank Xiaobai Li from the Institute unstable [47, 48]. In this study, microstructures were con- for Clean Energy & Advanced Materials, School of Materials structed on the SF film surface to provide physical stimula- & Energy, Southwest University, and the staff at the Medical tion signals for the TSPCs, and the resulting biological Research Center of Southwest Hospital, Army Medical Uni- effect was more stable and controllable. Biomaterials interact versity for the technical support. The research was supported with seed cells, causing morphological changes and changes by grants from the National Natural Science Foundation of in the cell function [29, 49, 50]. Our study indicates that China (NSFC, No. 81572133), the National Key Research the bionic microstructure of SF films can affect cell morphol- and Development of China (No. 2016YFC1100500), State ogy and arrangement. As previously demonstrated, elon- Key Laboratory of Trauma, Burn, and Combined Injury gated cell morphology and oriented cell arrangement are (No. SKLRCJF04), and the National Key Research and Devel- conducive to the tendon differentiation of TSPCs and opment of China (No. 4174DH). ordered deposition of the extracellular matrix [17, 44]. As such, the use of SF films for tendon regeneration may be more effective with the construction of bionic microstruc- Supplementary Materials tures according to the native tendon fiber sizes. By interact- Supplementary Figure 1: serrated jaw of the testing machine: ing with bionic microstructures on the SF films, TSPCs the serrated jaw was connected to the end of sample; the grip exhibited directional alignment and a narrow cell morphol- was adjusted a to achieve stable fixation. (Supplementary ogy similar to normal tendon cells and unlike the behavior Materials) of the control and smooth SF film groups. Not surprisingly, the results of qRT-PCR also corrobo- References rated our cell morphology observations. The 10 μmSF film group promoted the expression of early tendon differentia- [1] S. B. Adams Jr., M. A. Thorpe, B. G. Parks, G. Aghazarian, tion markers including transcription regulators scleraxis E. Allen, and L. C. Schon, “Stem cell-bearing suture improves and type I collagen, while the expression levels of tenescin- Achilles tendon healing in a rat model,” Foot & Ankle Interna- C and tenomodulin increased in both the 5 μm and 10 μm tional, vol. 35, no. 3, pp. 293–299, 2014. SF films groups at a later stage of differentiation [25]. Based [2] M. Kauwe, “Acute Achilles tendon rupture: clinical evaluation, on morphological analysis, we postulated that the varying conservative management, and early active rehabilitation,” effects on differentiation regulation were mainly due to Clinics in Podiatric Medicine and Surgery, vol. 34, no. 2, changes in cell morphology. The 10 μmSF films had the most pp. 229–243, 2017. dramatic effect on the spatial arrangement and morphology [3] Y. Wang, G. He, H. Tang et al., “Aspirin inhibits inflammation of TSPCs. and scar formation in the injury tendon healing through regu- SF films have good biological activity and mechanical lating JNK/STAT-3 signalling pathway,” Cell Proliferation, vol. 52, article e12650, 2019. properties. The presence of bionic microstructures on their [4] V. Gulati, M. Jaggard, S. S. Al-Nammari et al., “Management of surfaces enabled them to provide significant biological guid- achilles tendon injury: a current concepts systematic review,” ance for TSPCs and to serve as a potential material for ten- World Journal of Orthopedics, vol. 6, no. 4, pp. 380–386, 2015. don repair. However, this study was limited to rat tendons. [5] V. Sahni, S. Tibrewal, L. Bissell, and W. S. Khan, “The role of Future studies should focus on optimizing the bionic micro- tissue engineering in achilles tendon repair: a review,” Current structure size for repairing human tendon injuries. Stem Cell Research & Therapy, vol. 10, pp. 31–36, 2015. [6] S. D. Wang, Q. Ma, K. Wang, and P. B. Ma, “Strong and bio- compatible three-dimensional porous silk fibroin/graphene 5. Conclusions oxide scaffold prepared by phase separation,” International Journal of Biological Macromolecules, vol. 111, pp. 237–246, Our study confirmed the feasibility of mimicking the proper- ties of the native tendon tissue through the fabrication of SF [7] H. Nalvuran, A. E. Elcin, and Y. M. Elcin, “Nanofibrous silk films with bionic microstructures, providing a promising bio- fibroin/reduced graphene oxide scaffolds for tissue engineer- material for tendon tissue engineering and regeneration. ing and cell culture applications,” International Journal of Bio- logical Macromolecules, vol. 114, pp. 77–84, 2018. [8] M. Farokhi, F. Mottaghitalab, S. Samani et al., “Silk fibroin/hy- Data Availability droxyapatite composites for bone tissue engineering,” Biotech- nology Advances, vol. 36, no. 1, pp. 68–91, 2018. The datasets generated and analyzed during the present [9] B. Yi, H. Zhang, Z. Yu, H. Yuan, X. Wang, and Y. Zhang, “Fab- study are available from the corresponding author upon rea- rication of high performance silk fibroin fibers via stable jet sonable request. electrospinning for potential use in anisotropic tissue Applied Bionics and Biomechanics 9 [25] Y. Shi, K. Zhou, W. Zhang et al., “Microgrooved topographical regeneration,” Journal of Materials Chemistry B, vol. 6, no. 23, pp. 3934–3945, 2018. surface directs tenogenic lineage specificdifferentiation of mouse tendon derived stem cells,” Biomedical Materials, [10] C. Zhang, H. Shao, J. Luo, X. Hu, and Y. Zhang, “Structure and vol. 12, article 015013, 2017. interaction of silk fibroin and graphene oxide in concentrated solution under shear,” International Journal of Biological Mac- [26] B. D. Lawrence, J. K. Marchant, M. A. Pindrus, F. G. Ome- romolecules, vol. 107, pp. 2590–2597, 2018. netto, and D. L. Kaplan, “Silk film biomaterials for cornea tis- sue engineering,” Biomaterials, vol. 30, no. 7, pp. 1299–1308, [11] M. Floren, C. Migliaresi, and A. Motta, “Processing techniques and applications of silk hydrogels in bioengineering,” Journal of functional biomaterials, vol. 7, no. 3, p. 26, 2016. [27] B. D. Lawrence, Z. Pan, A. Liu, D. L. Kaplan, and M. I. Rosen- blatt, “Human corneal limbal epithelial cell response to vary- [12] W. Abdel-Naby, B. Cole, A. Liu et al., “Silk-derived protein ing silk film geometric topography in vitro,” Acta enhances corneal epithelial migration, adhesion, and prolifer- Biomaterialia, vol. 8, no. 10, pp. 3732–3743, 2012. ation,” Investigative Ophthalmology & Visual Science, vol. 58, no. 3, pp. 1425–1433, 2017. [28] E. S. Gil, S. H. Park, J. Marchant, F. Omenetto, and D. L. Kaplan, “Response of human corneal fibroblasts on silk film [13] K. B. Kang, B. D. Lawrence, X. R. Gao et al., “Micro- and nano- surface patterns,” Macromolecular Bioscience, vol. 10, no. 6, scale topographies on silk regulate gene expression of human pp. 664–673, 2010. corneal epithelial cells,” Investigative Ophthalmology & Visual Science, vol. 58, no. 14, pp. 6388–6398, 2017. [29] Y. Ni, Y. Jiang, K. Wang et al., “Chondrocytes cultured in silk- based biomaterials maintain function and cell morphology,” [14] H. Yadav, S. Nho, A. Romeo, and J. D. MacGillivray, “Rotator The International Journal of Artificial Organs, vol. 42, cuff tears: pathology and repair,” Knee Surgery, Sports Trau- pp. 31–41, 2018. matology, Arthroscopy, vol. 17, no. 4, pp. 409–421, 2009. [30] K. B. Kang, B. D. Lawrence, X. R. Gao, V. H. Guaiquil, A. Liu, [15] S. Yao, Y. Xie, L. Xiao, L. Cai, and Z. Ma, “Porous and nonpo- and M. I. Rosenblatt, “The effect of micro- and nanoscale sur- rous silk fibroin (SF) membranes wrapping for Achilles tendon face topographies on silk on human corneal limbal epithelial (AT) repair: which one is a better choice?,” Journal of Biomed- cell differentiation,” Scientific Reports, vol. 9, no. 1, p. 1507, ical Materials Research. Part B, Applied Biomaterials, vol. 107, no. 3, pp. 733–740, 2019. [31] X. Hu, K. Shmelev, L. Sun et al., “Regulation of silk material [16] J. G. Snedeker and J. Foolen, “Tendon injury and repair - a per- structure by temperature-controlled water vapor annealing,” spective on the basic mechanisms of tendon disease and future Biomacromolecules, vol. 12, no. 5, pp. 1686–1696, 2011. clinical therapy,” Acta Biomaterialia, vol. 63, pp. 18–36, 2017. [32] Y. Wang, G. He, H. Tang et al., “Aspirin promotes tenogenic [17] S. Yang, X. Shi, X. Li, J. Wang, Y. Wang, and Y. Luo, “Oriented differentiation of tendon stem cells and facilitates tendinopa- collagen fiber membranes formed through counter-rotating thy healing through regulating the GDF7/Smad1/5 signaling extrusion and their application in tendon regeneration,” Bio- pathway,” Journal of Cellular Physiology, vol. 235, pp. 4778– materials, vol. 207, pp. 61–75, 2019. 4789, 2020. [18] S. W. Tang, W. Y. Tong, W. Shen, K. W. Yeung, and Y. W. [33] S. Yang, J. Wang, Y. Wang, and Y. Luo, “Key role of collagen Lam, “Stringent requirement for spatial arrangement of extra- fibers orientation in casing-meat adhesion,” Food Research cellular matrix in supporting cell morphogenesis and differen- International, vol. 89, Part 1, pp. 439–447, 2016. tiation,” BMC Cell Biology, vol. 15, no. 1, p. 10, 2014. [19] A. Ramírez-Torres, R. Penta, R. Rodríguez-Ramos et al., [34] F. Wu, M. Nerlich, and D. Docheva, “Tendon injuries: basic science and new repair proposals,” EFORT open reviews, “Three scales asymptotic homogenization and its application to layered hierarchical hard tissues,” International Journal of vol. 2, no. 7, pp. 332–342, 2017. Solids and Structures, vol. 130, pp. 190–198, 2018. [35] D. Ma, Y. Wang, and W. Dai, “Silk fibroin-based biomaterials [20] M. L. Killian, L. Cavinatto, L. M. Galatz, and S. Thomopoulos, for musculoskeletal tissue engineering,” Materials Science & Engineering. C, Materials for Biological Applications, vol. 89, “The role of mechanobiology in tendon healing,” Journal of Shoulder and Elbow Surgery, vol. 21, no. 2, pp. 228–237, 2012. pp. 456–469, 2018. [21] A. Ramírez-Torres, R. Penta, R. Rodríguez-Ramos et al., [36] A. Baba, S. Matsushita, K. Kitayama et al., “Silk fibroin pro- “Homogenized out-of-plane shear response of three-scale duced by transgenic silkworms overexpressing the Arg-Gly- fiber-reinforced composites,” Computing and Visualization asp motif accelerates cutaneous wound healing in mice,” Jour- in Science, vol. 20, no. 3-6, pp. 85–93, 2019. nal of Biomedical Materials Research. Part B, Applied Biomate- rials, vol. 107, pp. 97–103, 2019. [22] M. Ni, P. P. Lui, Y. F. Rui et al., “Tendon-derived stem cells [37] S. Sahoo, L. T. Ang, J. Cho-Hong Goh, and S. L. Toh, “Bio- (TDSCs) promote tendon repair in a rat patellar tendon win- dow defect model,” Journal of Orthopaedic Research, vol. 30, active nanofibers for fibroblastic differentiation of mesenchy- no. 4, pp. 613–619, 2012. mal precursor cells for ligament/tendon tissue engineering applications,” Differentiation, vol. 79, no. 2, pp. 102–110, [23] Y. Wang, G. He, Y. Guo et al., “Exosomes from tendon stem cells promote injury tendon healing through balancing synthe- sis and degradation of the tendon extracellular matrix,” Jour- [38] E. Naghashzargar, S. Farè, V. Catto et al., “Nano/micro hybrid scaffold of PCL or P3HB nanofibers combined with silk fibroin nal of Cellular and Molecular Medicine, vol. 23, no. 8, pp. 5475–5485, 2019. for tendon and ligament tissue engineering,” Journal of applied biomaterials & functional materials, vol. 13, no. 2, pp. e156– [24] T. Harvey, S. Flamenco, and C. M. Fan, “A Tppp3(+)Pdgfra(+) e168, 2015. tendon stem cell population contributes to regeneration and reveals a shared role for PDGF signalling in regeneration and [39] C. H. Chen, S. H. Chen, C. Y. Kuo, M. L. Li, and J. P. Chen, fibrosis,” Nature Cell Biology, vol. 21, no. 12, pp. 1490–1503, “Response of dermal fibroblasts to biochemical and physical 2019. cues in aligned polycaprolactone/silk fibroin nanofiber 10 Applied Bionics and Biomechanics scaffolds for application in tendon tissue engineering,” Nano- materials, vol. 7, no. 8, p. 219, 2017. [40] G. Depres-Tremblay, A. Chevrier, M. Snow, M. B. Hurtig, S. Rodeo, and M. D. Buschmann, “Rotator cuff repair: a review of surgical techniques, animal models, and new technologies under development,” Journal of Shoulder and Elbow Surgery, vol. 25, no. 12, pp. 2078–2085, 2016. [41] A. M. Murthi and M. Lankachandra, “Technologies to aug- ment rotator cuff repair,” The Orthopedic Clinics of North America, vol. 50, no. 1, pp. 103–108, 2019. [42] D. Deng, W. Liu, F. Xu et al., “Engineering human neo-tendon tissue in vitro with human dermal fibroblasts under static mechanical strain,” Biomaterials, vol. 30, no. 35, pp. 6724– 6730, 2009. [43] R. You, X. Li, Z. Luo, J. Qu, and M. Li, “Directional cell elon- gation through filopodia-steered lamellipodial extension on patterned silk fibroin films,” Biointerphases, vol. 10, no. 1, arti- cle 011005, 2015. [44] T. K. Teh, S. L. Toh, and J. C. Goh, “Aligned fibrous scaffolds for enhanced mechanoresponse and tenogenesis of mesenchy- mal stem cells,” Tissue Engineering. Part A, vol. 19, no. 11-12, pp. 1360–1372, 2013. [45] M. Ermis, E. Antmen, and V. Hasirci, “Micro and nanofabrica- tion methods to control cell-substrate interactions and cell behavior: a review from the tissue engineering perspective,” Bioactive materials, vol. 3, no. 3, pp. 355–369, 2018. [46] N. Sevivas, F. G. Teixeira, R. Portugal et al., “Mesenchymal stem cell secretome improves tendon cell viability in vitro and tendon-bone healing in vivo when a tissue engineering strategy is used in a rat model of chronic massive rotator cuff tear,” The American Journal of Sports Medicine, vol. 46, pp. 449–459, 2017. [47] S. Sahoo, S. L. Toh, and J. C. Goh, “A bFGF-releasing silk/PLGA-based biohybrid scaffold for ligament/tendon tis- sue engineering using mesenchymal progenitor cells,” Bioma- terials, vol. 31, no. 11, pp. 2990–2998, 2010. [48] Y. J. Zhang, X. Chen, G. Li et al., “Concise review: stem cell fate guided by bioactive molecules for tendon regeneration,” Stem Cells Translational Medicine, vol. 7, no. 5, pp. 404–414, 2018. [49] X. Li, Q. Huang, T. A. Elkhooly et al., “Effects of titanium sur- face roughness on the mediation of osteogenesis via modulat- ing the immune response of macrophages,” Biomedical Materials, vol. 13, article 045013, 2018. [50] E. Sayin, E. T. Baran, and V. Hasirci, “Osteogenic differentia- tion of adipose derived stem cells on high and low aspect ratio micropatterns,” Journal of Biomaterials Science. Polymer Edi- tion, vol. 26, no. 18, pp. 1402–1424, 2015.

Journal

Applied Bionics and BiomechanicsHindawi Publishing Corporation

Published: Dec 2, 2020

References