Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Bacteria Load Determination of the Intestinal Microbiota and Identification of Spiroplasma and Wolbachia in Anopheles gambiae

Bacteria Load Determination of the Intestinal Microbiota and Identification of Spiroplasma and... Hindawi International Journal of Zoology Volume 2022, Article ID 1491648, 9 pages https://doi.org/10.1155/2022/1491648 Research Article Bacteria Load Determination of the Intestinal Microbiota and Identification of Spiroplasma and Wolbachia in Anopheles gambiae 1 1,2 3 1 1 Haziz Sina , Kamirou Chabi-Sika, Razaki Osse, ` Akim Socohou, Ibrahim A. Abibou, 1 1 4 Hafiz Salami, Germain Gil Padonou, Adolphe Adjanonhoun, and Lamine Baba-Moussa Laboratory of Biology and Molecular Typing in Microbiology, Department of Biochemistry and Cellular Biology, Faculty of Sciences and Techniques, University of Abomey-Calavi, 05 BP 1604 Cotonou, Godomey, Benin Laboratory of Biochemistry and Food & Medicinal Formulations, National University of Sciences, Technologies, Engineering and Mathematics of Abomey, Abomey, Benin School of Management and Operation of Livestock Systems, National University of Agriculture, Ketou, Benin National Institute of Agronomic Research of Benin, Cotonou, Benin Correspondence should be addressed to Haziz Sina; sina.haziz@gmail.com Received 28 November 2021; Revised 31 May 2022; Accepted 2 July 2022; Published 19 July 2022 Academic Editor: Edson Gandiwa Copyright © 2022 Haziz Sina et al. �is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. �e gut microbiota of mosquitoes is composed of a range of microorganisms. Among its microorganisms, some a‚ect the vectorial capacity of mosquitoes. �e aim of this study was to characterize some bacteria of the intestinal microbiota in Anopheles gambiae (An. gambiae) females, a major vector of malaria transmission in Benin. �e symbiote bacteria of the microbiota of female laboratory An. gambiae and female wild An. gambiae were identi‡ed by the culture method. �e count was done on media plate count agar (PCA), and subsequently, the bacterial load was calculated. Comparison of batches bacterial load was carried out with the variance analysis test (ANOVA). Finally, polymerase chain reaction (PCR) was performed to investigate the presence of a few bacterial genera in‘uencing the vector capacity of An. gambiae. �e study found that the microbiota of female An. gambiae is home to the bacteria belonging to the Staphylococcus, Enterobacteriaceae, and other unidenti‡ed bacterial gene regardless of its nature and condition. Similarly, there was no statistically signi‡cant di‚erence between the bacterial load of the laboratory and wild mosquitoes depending on the parous and gorged states; on the other hand, there was a signi‡cant di‚erence between the bacterial loads of the laboratory and wild mosquitoes according to the nulliparous and nongorged states. �e search for a few bacterial genera in‘uencing the vector capacity of female An. gambiae has been negative for Spiroplasma bacteria regardless of its nature and condition. PCR revealed the presence of Wolbachia bacteria for only gorged Kisumu sensitive An. gambiae. Wol- bachia’s presence at An. gambiae suggests that this type of bacteria could be used to develop new e‚ective and sustainable approaches in the vector control. is the most common strategy in endemic countries [2]. 1. Introduction However, the heavy use of insecticides to carry out this Malaria remains a public health problem in many devel- strategy modi‡es the trophic behavior of the vectors [3]. �is oping countries, particularly in Sub-Saharan Africa [1]. �e has the consequence of negatively impacting the e‚ort to dynamics of malaria transmission depend on certain aspects reduce the burden of the disease due to malaria. As a result, of the physiology and ecology of their vectors, mosquitoes. new strategies are desperately needed to control mosquito To break the cycle of the disease transmission, vector control populations or their ability to transmit parasites. One of the 2 International Journal of Zoology promising strategies to reduce vector transmission is to 2. Materials and Methods involve bacterial symbionts which have the potential to 2.1. Sample Collection. Batches of mosquitoes (wild or decrease the vectorial capacity of their hosts [4]. Indeed, reared) were made for this study. *e reared mosquitoes’ these symbionts are maintained by maternal transmission batches (Kisumu and Kdr) come from the Centre de and can therefore spread within populations. With these Recherche en Entomologie de Cotonou (CREC) insecta- characteristics, the symbionts appear to be a much more rium. *e parity parameters (parous and nulliparous) and sustainable and cost-effective strategy for controlling the nutritional status (gorged and not gorged) were considered transmission of vector-borne diseases such as malaria [5]. for the constitution of the batches. *us, for Kisumu’s and *ese microorganisms, including bacteria, viruses, fungi, Kdr, four batches (parous, nulliparous, gorged, and not protozoa, nematodes, and mites, are more or less stable in gorged) were made up. Each batch of mosquitoes consisted the exoskeleton, intestine, hemocoel, and/or in mosquito of five randomly selected individuals from the same clutch cells [6]. and were stored in a 1.5 ml Eppendorf tube at 4 C for later To advance the prospect of a symbiont-based malaria microbiological analysis. control strategy, it will be important to continue to For wild mosquitoes, they were captured by the pyre- identify, generate, and study a wide range of anopheles- thrum spray catches (PSC) technique as described in the symbiont systems. *e mosquito microbiota is of par- Manual of Malaria Entomology and Vector Control [16]. ticular interest because of its influence on certain factors Before performing the PSC, all large pieces of furniture were determining the mosquito’s ability to transmit pathogens removed, and the floor was covered with white bed sheets. such as immunity, longevity, fertility, and metabolism [6]. Insecticide was first sprayed from the outside of the house *ey can be pathogens, commensals, or mutualists and onto the windows and the doors before spraying on the rely on vertical or horizontal transmission [7]. In addi- inside of the house. All doors and windows remained closed tion, the symbiont bacteria are functionally diverse, for about 10 min to induce mosquito knockdown [17]. After exhibiting a wide range of infection and transmission exposition time (10 minutes), mosquitoes knocked down strategies. *e mosquito gut is naturally inhabited by a were collected, and a preliminary sorting was done on the community of bacteria that can disrupt the development basis of macroscopic observation. *e identification of the of human parasites such as Plasmodium [8]. In some species An. gambiae was made according to the taxonomic mosquitoes, as in many species of arthropods, two major key [17, 18] using the stereo microscope ez4 w binocular taxa of facultative endosymbionts have been identified, (Leica, Germany). *e wild mosquitoes were also divided Wolbachia and Spiroplasma. Since these bacteria are into four batches (parous, nulliparous, gorged, and not transmitted vertically from the mother, they have ac- gorged) in different 1.5 ml Eppendorf tubes. quired the particularity of modifying the reproduction of their host, thus increasing their spread, by mechanisms that vary according to the species of arthropod and the bacterial strain [6]. 2.2. Microbial Analysis. Five mosquitoes were randomly Wolbachia has recently been reported in low per- selected from each category (parous, nulliparous, gorged, centages in some populations of Anopheles coluzzi and and not gorged), from each batch of An. gambiae female Anopheles gambiae [9]. Wolbachia appears to induce cy- (Kisumu, Kdr, and wild). Each mosquito abdomen was toplasmic incompatibility since spermatozoa from the separated from the thorax using a sterile scalpel for each infected males could not fertilize oocytes from the unin- sample. *e abdomens of selected mosquitoes from the same fected females. *is promotes the reproduction of infected batches were rinsed in sterile water and then was sterilized in females over uninfected females in a population. *ese 70% ethanol (1 minute). *us, each abdomen batches were bacteria can also increase the proportion of females in a crushed [19] into 1.5 ml Eppendorf tube containing 500 μl of population by the induction of parthenogenesis, by male- sterile saline solution to have the stock solution. Finally, 25 μl specific lethality during development or by feminization of was taken from each stock solution in order to carry out − 7 males [10]. In addition, Spiroplasmas are “specialists” in successive decimal dilutions up to 10 . arthropods, and all known species have some form of Eosin-methylene blue (EMB), Muller Hinton (MH), and interaction with this clade [11], and they can confer a Chapman agars were used for seeding the stock solutions, in variety of resistant insect hosts on a range of eukaryotic tight streaks on the first half of the agar, and wide streaks on parasites, including nematodes, parasitoids, and patho- the second half so as to obtain the isolated colonies. All the genic fungi [12, 13]. *erefore, they are a good candidate inoculated dishes were incubated at 30 C overnight. A first for a symbiont which could be useful for the control of layer of the plate count agar (PCA) was poured into the Plasmodium. kneaded dishes, then 25 μl of each successive dilution serving Some studies on the microbiome of anopheles have as an inoculum was transferred into the precast dishes, and identified Spiroplasma from pathogenic clades [14, 15]. then homogenized correctly. *e second layer was poured as However, in Benin, we have very little data on the bacterial soon as the homogenate started to solidify. *e cast boxes symbionts of the major vector of malaria transmission. It is were placed in an oven at 37 C for 72 hours. *e inoculated in this dynamic that fits this study that aim to investigate this boxes were read after 72 hours. microbial diversity, focusing on some bacteria, of the in- Since the PCA agar is a nutrient medium, it was used to testinal microbiota in female An. gambiae. enumerate the total aerobic-mesophilic flora of the International Journal of Zoology 3 ° ° abdominal microbiota of each mosquito. Only dishes with a denaturation (95 C for 30 s), hybridization (60 C for 30 s), number of colonies greater than or equal to 30 and less than and elongation (72 C for 30 s), followed by final elongation 300 are taken into account for the enumeration. To deter- (72 C for 10 minutes). mine the bacterial load of the microbiota of each mosquito, For each gene, the reaction was performed in a 20 μl mix the standard formula used is as follows: bacterial containing 10x Eurogentec buffer (2 μl), dNTP (0.2 μl), load � number of colonies counted × seeded vol- 10 μM of each primer (1 μl), MgCl (1.2 μl), Taq DNA po- ume × dilution factor [20]. lymerase (0.2 μl), and DNA (3 μl). *e DNA extracted from mosquitoes was used as a negative control. *e amplification products were migrated on a 1.5% agarose gel containing 2.3. Molecular Analysis ethidium bromide at 110 V for 30 minutes. 2.3.1. DNA Extraction. Deoxyribose nucleic acid (DNA) extraction was performed from a pool of mosquitoes using 2.4. Data Analysis. *e data collected was entered into an the QIAamp DNA Mini Kit (Quiagen, Germany). *e Excel 2016 spreadsheet and then was analyzed with the extraction protocol provided by the manufacturer with the Minitab R 18 software. *e following steps were taken after kit was strictly followed. *us, in brief, the abdomens of the information was collected: (i) checking the normality of each mosquito were pooled in a 1.5 ml Eppendorf and the data and the homogeneity of variances, (ii) calculation of filled with 180 (microliter/microliter) μl of ALT buf- means, variances, sum of squares, degree of freedom, mean fer + proteinase K. *e homogenized mixture was incu- of squares, and of the value of the probability, and (iii) bated in the oven at 56 C for about 3 hours. After comparisons of the bacterial load of An. gambiae batches. incubation, the mixture was supplemented with 200 μl of *e one-way analysis of the variance and the Fisher test were buffer AL and was homogenized carefully for 15 seconds. used to compare the means. *e test is considered statis- Incubated in the oven at 70 C for 10 minutes, the tubes tically significant when p< 0.05. were centrifuged briefly to remove any drops from the lid. After homogenization of the mixture for 15 s, 200 μl of 3. Results ethanol (96%) was added, briefly centrifuged, and the supernatant was transferred to the QIAamp Mini ex- 3.1. Bacterial Loads of Anopheles gambiae Samples. traction columns for another centrifugation (8000 rpm for Anopheles gambiae females had a high bacterial load re- 1 minute). *e QIAamp Mini Spin extraction column was gardless of the pool and category of mosquito (Figure 1). It placed in a new 2 ml collection tube and 500 μl of buffer was noted that the wild, nongorged female An. gambiae had AW1 was added before centrifugation at 8000 rpm for 1 the highest bacterial load, while the wild nulliparous female minute, and the collection tube was discarded. *e An. gambiae mosquitoes had the lowest bacterial load. *e QIAamp Mini extraction column was placed again in a sensitive nongorged Kisumu also had a high bacterial load, 2 ml collection tube and then 500 μl of buffer AW2 was whereas gorged Kisumu had the lowest bacterial load. Fi- added. *e mixture was centrifuged at 14,000 rpm for 3 nally, An. gambiae Kdr parous had a high bacterial load as minutes. *e QIAamp Mini Extraction column was placed opposed to nulliparous Kisumu which had the lowest in a new 2 ml collection tube and was centrifuged at full bacterial load. speed for 1 minute to eliminate the risk of possible car- Based on one-way analysis of the variance (ANOVA), ryover of Buffer AW2. To end, 200 μl of AE buffer was used the value for the probability (0.095) was greater than 0.05 for DNA elution in a new 1.5 ml Eppendorf tube and (Table 1). *erefore, there was no statistically significant maintained at 4 C. difference between the bacterial load of An. gambiae mos- quitoes from laboratory and wild batches in the parous 2.3.2. Search for Alleles of Genes Use for the Identification of category at 0.05 level. Spiroplasma and Wolbachia. For the identification of Spi- Figure 2 shows the difference in bacterial loads, two by roplasma, the DnaA genetic determinant was the target [21]. two of the different pool of mosquitoes studied in the parous *e primers used for this purpose were DnaA109F: category. *is difference in bacterial load is represented on 5′TTAAGAGCAGTTTCAAAATCGGG3′ and DnaA246R: the graph by a confidence interval. It can be seen that all the 5′-CAAACAAATTGTTATTACTTC-3′. *e PCR reactions intervals contain the value zero. *erefore, considering the parous category, there was no statistically significant dif- were performed using the thermal cycler under the following conditions: a cycle of initial denaturation (95 C for 10 ference between the bacterial load of mosquitoes from laboratory and wild’s (Figure 2). Fisher’s test therefore minutes), followed by 35 cycles of denaturation (95 C for ° ° 30 s), hybridization (55 C for 30 s), and elongation (72 C for confirms the result obtained from the ANOVA test. 30 s), followed by a final elongation (72 C for 10 minutes). Based on one-way analysis of the variance (ANOVA), *e molecular identification of Wolbachia was made the value of the probability of 0.048 was less than 0.05. *ere targeting ftsZ [22]. For this, the used primers were ftsZf1 5′- was a significant difference between the bacterial load of GTTGTCGCAAATACCGATGC-3′ and ftsZr1 5′- female An. gambiae mosquitoes from laboratory and wilds in CTTAAGTAAGCTGGTATATC-3′. In this case, the am- the nongorged category (p< 0.05) (Table 2). plification conditions were the following: initial denatur- Figure 3 shows the difference in the bacterial loads two ation (95 C for 10 minutes), followed by 40 cycles of by two of the different pool of mosquitoes studied in the 4 International Journal of Zoology 1.00E+08 1.00E+07 1.00E+06 1.00E+05 1.00E+04 1.00E+03 1.00E+02 1.00E+01 1.00E+00 Wild Sensitive Kisumu Kdr resistant Kisumu Parous Gorged Nulliparous Non-gorged Figure 1: Di‚erent pool of Anopheles gambiae according to their bacterial loads. Table 1: Results of the analysis of the variance test of the di‚erent batches of Anopheles gambiae mosquito in the parous category. Source of variations Sum of squares Degree of freedom Average of squares F Probability (%) Critical value for F 14 13 Between pools 1.89 ×10 2 9.46 ×10 3.574 9.50 5.143 14 13 Inside the pools 1.59 ×10 6 2.65 ×10 Total 3.48 ×10 8 -5000000 -10000000 -15000000 -20000000 -25000000 parous ssv-kis- parous wild- parous wild- parous Kdr-kis parous Kdr-kis parous ssv-kis ssv = sensitive Kis = Kisumu Figure 2: Graph resulting from Fisher’s test of parous mosquitoes. Table 2: Results of the analysis of the variance test of the di‚erent pools of Anopheles gambiae in the nongorged category. Source of variations Sum of squares Degree of freedom Average of squares F Probability Critical value for F +15 +15 Between pools 4.06 ×10 2 2.03 ×10 5.27 +15 +14 Inside the pools 2.31 × 10 6 3.81 × 10 4.77% 5.14 Total 6.36 ×10 8 parous category. �is di‚erence in bacterial loads two by two zero. Consequently, there is a statistically signi‡cant dif- was represented on the graph by a con‡dence interval. It can ference between the bacterial load of mosquitoes from be seen that at least one interval does not contain the value laboratory and wild batches in the nongorged category International Journal of Zoology 5 -50000000 -100000000 N-ES-kis-N-E Kdr-Kis N-E Wild-N-ES-Kis N-E Wild-N-E Kdr-Kis N-E = Non gorged S = sensitive Kis = Kisumu Figure 3: Graph results of Fisher’s test of nongorged mosquitoes. (Figure 3). Fisher’s test therefore con‡rms the result ob- independently to the pools of mosquito. However, it can be observed in a diversity of mosquitoes’ microbiota, whatever tained from the ANOVA test. Based on the one-way analysis of variance (ANOVA), is the batch and the category of the mosquito. �us, bacteria there is no statistically signi‡cant di‚erence between the belonging to Enterobacteriacea, Staphylococcus spp. and bacterial load of mosquitoes from laboratory pools and wilds other bacterial genera are found in the abdomen of the in the gorged category (Table 3). analyzed female. However, the nulliparous kdr do not have Figure 4 shows the di‚erence in bacterial loads of two by bacteria belonging to the genus Enterobacteriaceae, while two of the di‚erent pools of mosquitoes studied in the sensitive parous Kisumu do not have bacteria belonging to gorged category. �is di‚erence in bacterial loads two by two the genus Staphylococcus. is represented on the graph by a con‡dence interval. It can be seen that all the intervals contain the value zero. Conse- 3.3. Con‘rmation of the Presence of Spiroplasma and quently, there is no statistically signi‡cant di‚erence be- Wolbachia. �e anopheline DNA extracted from batches of tween the bacterial load of mosquitoes from laboratory and female An. gambiae mosquitoes (laboratory and wild) was wild batches in the gorged category (Figure 4). Fisher’s test used to test for the presence or absence of Wolbachia and therefore con‡rms the result obtained from the ANOVA Spiroplasma. None of the pools displays the presence of test. According to the one-way analysis of variance Spiroplasma spp. As for the search for the Wolbachia gene, it (ANOVA), there is a statistically signi‡cant di‚erence be- was detected among a sample of laboratory An. gambiae tween the bacterial load of mosquitoes from laboratory lots (sensitive gorged Kisumu) (Table 6). and wilds in the nulliparous category (Table 4). Figure 5 shows the di‚erence in bacterial loads two by 4. Discussion two of the di‚erent batches of mosquitoes studied in the nulliparous category. �is di‚erence in bacterial loads two Bacteria belonging to the Enterobacteriaceae and Staphy- by two is represented on the graph by a con‡dence interval. lococcus group were identi‡ed from An. gambiae samples It can be seen that at least one interval does not contain the collected. �e Gram staining of the di‚erent colonies value zero. Consequently, there is a statistically signi‡cant revealed the presence of Gram-positive bacilli, Gram-neg- di‚erence between the bacterial load of mosquitoes from ative bacilli, and Gram-positive cocci. �e presence of laboratory and wild batches in the nulliparous category Gram-negative bacilli and Gram-positive cocci then con- (Figure 5). Fisher’s test therefore con‡rms the result ob- ‡rms the results of the inoculation. In addition, the presence tained from the ANOVA test. of Gram-positive bacilli suggests the presence of other bacterial genera not identi‡ed in this study. �ere was 3.2. Microbiological Diversity of the Microbiota. �e analysis similarity between the bacterial community of the laboratory of Table 5 reveals the presence of the di‚erent components of mosquitoes (Kdr and sensitive Kisumu) compared to the the bacterial microbiota in the abdomen of the female An. wild considering the category (parous, nulliparous, gorged, gambiae from the di‚erent batches (wild and laboratory) and non-gorged). Regarding the bacterial genus Staphylo- and in relation to the category (parous, nulliparous, gorged, coccus identi‡ed during our research, these results are and nongorged). It can be seen that the results are similar contrary to that of a study carried out in India in 2009 on the 6 International Journal of Zoology Table 3: Results of the analysis of the variance test of the di‚erent batches of Anopheles gambiae mosquito in the gorged category. Source of variations Sum of squares Degree of freedom Average of squares F Probability (%) Critical value for F 12 11 Between pools 1.31 × 10 2 6.54 ×10 5.14 1.185 12 11 Inside the pools 3.31 × 10 6 5.52 ×10 36.83 Total 4.62 ×10 8 -1000000 -2000000 gorged ssv-kis- gorged wild- gorged wild- gorged Kdr-Kis- gorged Kdr-kis gorged ssv-kis ssv = sensitive Kis = Kisumu Figure 4: Graph of Fisher’s test results of gorged mosquitoes. Table 4: Results of the analysis of variance test for di‚erent Anopheles gambiae according to the category of nulliparous. Source of variations Sum of squares Degree of freedom Average of squares F Probability (%) Critical value for F 14 14 Between pools 4 ×10 2 2 ×10 13 12 Inside the pools 1.3 ×10 6 2.17 ×10 92.04 0.003 5.14 Total 4.13 ×10 8 -10000000 -20000000 nulliparous Kdr-kis- nulliparous wild- nulliparous wild- nulliparous ssv-Kis nulliparous Kdr-Kis nulliparous ssv-kis ssv = sensitive Kis = Kisumu Figure 5: Graph of Fisher’s test results for nulliparous mosquitoes. International Journal of Zoology 7 Table 5: Microbiological diversity of the microbiota according to batches of mosquitoes. Pools Categories Enterobacteria Staphylococcus Other genera Gram Nongorged + + + B− , B+, C+ Parous + + + B− , B+, C+ Kdr Gorged + + + B− , B+, C+ Nulliparous - + + B− , B+, C+ Nongorged + + + B− , B+, C+ Parous + - + B− , B+, C+ Kiss Gorged + + + B− , B+, C+ Nulliparous + + + B− , B+, C+ Nongorged + + + B− , B+, C+ Parous + + + B− , B+, C+ Wild Gorged + + + B− , B+, C+ Nulliparous + + + B− , B+, C+ + � presence; − � absence; B+ � Gram-positive bacillus; B+ � Gram-negative bacillus; C+ � Gram-positive cocci; Kdr � Kdr resistant; kiss � sensitive kisumu. Table 6: Search for Wolbachia ssp and Spiroplama ssp genes. particular [24]. Concerning the comparison of the bacterial load, it was observed that there is no significant difference Pools Categories Wolbachia gene Spiroplasma gene between the bacterial load of the laboratory and wild Parous − − mosquitoes in the gorged and nulliparous category. In ad- Nulliparous − − Kdr dition, there is a significant difference between the bacterial Gorged − − load of the laboratory and wild mosquitoes among the Nongorged − − nulliparous and nongorged). *e gorged and parous labo- Parous − − ratory mosquitoes (Kdr and sensitive Kisumu) and the wild Nulliparous − − Kisumu Gorged − − ones have in common the taking of blood meals. Vertebrate Nongorged − − blood generally contains very few or no germs [27]. Several Parous − − studies show that the consumption of a blood meal per- Nulliparous − − sistently or transiently modifies the composition of the Wild Gorged − − intestinal microbiota through alterations in redox status or Nongorged − − metabolism [28,29]. Does the blood test also change the + � positive; − � negative. bacterial load? or is it a coincidence? Environmental factors [30], and diet [24], must be considered having an impact on the load and composition of mosquito bacteria. field and laboratory populations of the malaria vector *e research of bacterial genera influencing the An. gambiae vectorial capacity revealed the presence of Wol- Anopheles stephensi which revealed the presence of bacteria from the genera Bacillus and Staphylococcus in males [23]. bachia in sensitive gorged Kisumu which are mosquitoes reared in the laboratory. Indeed, several studies have *is difference may be related to the sex of the mosquitoes, the species of the mosquito, and the living environment. revealed the presence of Wolbachia in the population of wild mosquitoes, major vectors of malaria transmission, An. Regarding the Enterobacteriaceae family found in our study, our results are similar to those of a study conducted in gambiae’s head and thorax in Mali [31] and ovaries in Kenya [24],but their work does not take to account Burkina Faso [8], and An. gambiae and An. coluzzii in Gabon Staphylococcus. *is difference observed from the present [32]. *ese results are contrary to those provided by this study could be explained by the difference in sample size or study. *is difference can be explained by the limited size of by the ecosystem of rearing laboratory mosquitoes or har- the samples processed or by the fact that the extraction was vesting wild mosquitoes. However, several studies using done only from the abdomen of the mosquitoes in our case. *is difference can also be explained by the environment or metagenomics provide more comprehensive information on the composition of the mosquito midgut microbiota [25,26]. the season of collecting samples from the wild mosquitoes. In addition, the fragments obtained in the present study are *e enumeration of the total mesophilic aerobic flora reveals their presence in both laboratory and wild An. around 500 bp, which suggests a species of Wolbachia dif- gambiae. It has been found that regardless of the nature and ferent from the others obtained in some works. Interestingly, category of the mosquitoes, the bacterial load is high. A this study shows that, in addition to wild An. gambiae, the study conducted in the United States to better understand laboratory ones also harbor Wolbachia. *e presence of the potential fluctuations in the microbial load and species Wolbachia has been identified in sensitive gorged An. composition between laboratory-reared mosquitoes of dif- gambiae Kisumu line. So, this presence could be by blood ferent generations and within the same generation also supply or a natural presence within the microbiota. Until showed that the bacterial load is high [8]. Similarly, a study now, few studies mention the presence of Wolbachia in the blood of vertebrates; however, a study carried out in France carried out in Kenya indicates that, during the life of an adult, a sharp increase in the bacterial load is observed in shows that the presence of Wolbachia pipientis in ticks, 8 International Journal of Zoology [3] F. G. Kabbale, A. M. Akol, J. B. Kaddu, and A. W. Onapa, already reported in various publications, was in fact due to “Biting patterns and seasonality of Anopheles gambiae sensu the cryptic presence of the endo-parasitoid hymenoptera lato and Anopheles funestus mosquitoes in Kamuli district, Ixodiphagus hookeri [33]. *is association has remained Uganda,” Parasites & Vectors, vol. 6, no. 1, p. 340, 2013. unsuspected until now because parasitoids cannot be de- [4] I. Iturbe-Ormaetxe, T. Walker, and S. L. O’Neill, “Wolbachia tected until the tick nymphs become gorged with blood [33]. and the biological control of mosquito-borne disease,” EMBO In addition, natural infections by Wolbachia have been Reports, vol. 12, no. 6, pp. 508–518, 2011. detected in several species of Anopheles. For example, in An. [5] E. A. McGraw and S. L. O’Neill, “Beyond insecticides: new gambiae in Mali [31] and in An. gambiae and An. coluzzii in thinking on an ancient problem,” Nature Reviews Microbi- Gabon [32]. However, Wolbachia being transmitted verti- ology, vol. 11, no. 3, pp. 181–193, 2013. cally by the mother has acquired the particularity of mod- [6] K. Heu and M. Gendrin, “Le microbiote de moustique et son ifying the reproduction of its host. *us, Wolbachia induces influence sur la transmission vectorielle,” Biologie Aujourd’- cytoplasmic incompatibility [10]. For example, the intro- hui, vol. 212, no. 3-4, pp. 119–136, 2018. duction of Wolbachia to Aedes aegypti, not only leads to a [7] L. B. Regassa and G. E. Gasparich, “Spiroplasmas: evolu- decrease in infection with pathogens transmissible to tionary relationships and biodiversity,” Frontiers in Biosci- humans but can also induce cytoplasmic incompatibility ence, vol. 11, no. 1, p. 2983, 2006. [8] Y. Dong, F. Manfredini, and G. Dimopoulos, “Implication of [34]. Some experiments have shown that infection of the mosquito midgut microbiota in the defense against mosquitoes with Wolbachia is not a threat to humans. *is malaria parasites,” PLoS Pathogens, vol. 5, no. 5, Article ID bacterium is too large to pass through the salivary duct of e1000423, 2009. mosquitoes into human blood. *is makes this bacterium a [9] F. Baldini, N. Segata, J. Pompon et al., “Evidence of natural good candidate for vector control of malaria. Wolbachia infections in field populations of Anopheles As for the bacterial genera Spiroplasma, the research by gambiae,” Nature Communications, vol. 5, no. 1, p. 3985, 2014. the technique of PCR was negative for An. gambiae for all [10] J. H. Werren, L. Baldo, and M. E. Clark, “Wolbachia: master our samples. However, an investigation of midgut bacteria in manipulators of invertebrate biology,” Nature Reviews Mi- An. gambiae and Anopheles funestus in western Kenya de- crobiology, vol. 6, no. 10, pp. 741–751, 2008. tected Spiroplasma in An. funestus [14]. In addition, [11] W. Wang, B. Wen, G. E. Gasparich et al., “A spiroplasma Anopheles mosquito microbiome surveys reported Spi- associated with tremor disease in the Chinese mitten crab roplasma from pathogenic clades [14–34]. (Eriocheir sinensis),” Microbiology, vol. 150, no. 9, pp. 3035–3040, 2004. [12] J. Jaenike, R. Unckless, S. N. Cockburn, L. M. Boelio, and 5. Conclusion S. J. Perlman, “Adaptation via symbiosis: recent spread of a drosophila defensive symbiont,” Science, vol. 329, no. 5988, It emerges from this study that the major vector of malaria pp. 212–215, 2010. transmission in Benin An. gambiae female has a fairly di- [13] P. Lukasik, H. Guo, M. Van-Asch, J. Ferrari, and verse microbiota. It harbors, at high loads, in its midgut, H. C. J. Godfray, “Protection against a fungal pathogen bacteria such as staphylococci, Enterobacteriaceae, and other conferred by the aphid facultative endosymbionts rickettsia bacterial genera regardless of the nature and its condition. In and spiroplasma is expressed in multiple host genotypes and addition to this, it has been found that, besides the wild species and is not influenced by co-infection with another mosquitoes, laboratory ones too can be naturally infected symbiont,” Journal of Evolutionary Biology, vol. 26, no. 12, with the strains of Wolbachia which are known to negatively pp. 2654–2661, 2013. impact the reproductive organs of their host or even induce [14] J. M. Lindh, O. Terenius, and I. Faye, “16S rRNA gene-based cytoplasmic incompatibility. It will thus be useful to con- identification of midgut bacteria from field-caught Anopheles tinue this study to investigate the effect of symbionts on the gambiae sensu lato and A. funestus mosquitoes reveals new life of mosquitoes. species related to known insect symbionts,” Applied and Environmental Microbiology, vol. 71, no. 11, pp. 7217–7223, Data Availability [15] N. Segata, F. Baldini, J. Pompon et al., “*e reproductive tracts of two malaria vectors are populated by a core microbiome *e data used to support the findings of this work are and by gender-and swarm-enriched microbial biomarkers,” available from the corresponding author upon request. Scientific Reports, vol. 6, no. 1, p. 24207, 2016. [16] WHO, Entomologie du paludisme et controle ˆ des vecteurs, Conflicts of Interest pp. 1–102, WHO, Geneva, Switzerland, 2003. [17] J. E. Harbison, E. M. Mathenge, G. O. Misiani, *e authors declare that they have no conflicts of interest. W. R. Mukabana, and J. F. Day, “A simple method for sampling indoor-resting malaria mosquitoes Anopheles gambiae and Anopheles funestus (diptera: culicidae) in References Africa,” Journal of Medical Entomology, vol. 43, no. 3, pp. 473–479, 2006. [1] WHO, World Malaria Report 2019, World Health Organi- [18] M. T. Gillies and M. Coetzee, A Supplement to the Anophe- sation, Geneva, Switzerland, 2019. [2] K. Raghavendra, T. K. Barik, B. P. N. Reddy, P. Sharma, and linae of Africa South of the Sahara (Afrotropical Region), South African Institute for Medical Research, Johannesburg, South A. P. Dash, “Malaria vector control: from past to future,” Parasitology Research, vol. 108, no. 4, pp. 757–779, 2011. Africa, 1987. International Journal of Zoology 9 [19] A. Becker, “How to count colonies in microbiology,” 2021, [33] O. Plantard, A. Bouju-Albert, M.-A. Malard, A. Hermouet, G. Capron, and H. Verheyden, “Detection of Wolbachia in the https://sciencing.com/count-colonies-microbiology-17859. tick ixodes ricinus is due to the presence of the hymenoptera html. endoparasitoid Ixodiphagus hookeri,” PLoS One, vol. 7, no. 1, [20] D. S. Gusmão, A. V. Santos, D. C. Marini, M. Bacci, Article ID e30692, 2012. M. A. Berbert-Molina, and F. J. A. Lemos, “Culture-depen- [34] F. Vavre and P. Mavingui, “Les bacteries ´ symbiotiques dent and culture-independent characterization of microor- d’arthropodes et de nematodes, ´ de nouvelles alliees ´ dans le ganisms associated with Aedes aegypti (diptera: culicidae) (L.) controle ˆ des maladies infectieuses,” Medecine Sciences, vol. 27, and dynamics of bacterial colonization in the midgut,” Acta no. 11, pp. 953–958, 2011. Tropica, vol. 115, no. 3, pp. 275–281, 2010. [21] J. K. Herren and B. Lemaitre, “Spiroplasma and host im- munity: activation of humoral immune responses increases endosymbiont load and susceptibility to certain gram-nega- tive bacterial pathogens in Drosophila melanogaster,” Cellular Microbiology, vol. 13, no. 9, pp. 1385–1396, 2011. [22] J. H. Werren and J. Jaenike, “Wolbachia and cytoplasmic incompatibility in mycophagous Drosophila and their rela- tives,” Heredity, vol. 75, pp. 320–326, 1995. [23] A. Rani, A. Sharma, R. Rajagopal, T. Adak, and R. K. Bhatnagar, “Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture- independent methods in lab-reared and field-collected Anopheles stephensi-an Asian malarial vector,” BMC Mi- crobiology, vol. 9, no. 1, p. 96, 2009. [24] Y. Wang, T. M. Gilbreath, P. Kukutla, G. Yan, and J. Xu, “Dynamic gut microbiome across life history of the malaria mosquito Anopheles gambiae in Kenya,” PLoS One, vol. 6, no. 9, Article ID e24767, 2011. [25] J. Akorli, M. Gendrin, N. A. P. Pels, D. Yeboah-Manu, G. K. Christophides, and M. D. Wilson, “Seasonality and locality affect the diversity of Anopheles gambiae and Anopheles coluzzii midgut microbiota from Ghana,” PLoS One, vol. 11, no. 6, Article ID e0157529, 2016. [26] A. E. Douglas, “*e microbial dimension in insect nutritional ecology,” Functional Ecology, vol. 23, no. 1, pp. 38–47, 2009. [27] L. B. Dickson, D. Jiolle, G. Minard et al., “Carryover effects of larval exposure to different environmental bacteria drive adult trait variation in a mosquito vector,” Science Advances, vol. 3, no. 8, Article ID e1700585, 2017. [28] G. Gimonneau, M. T. Tchioffo, L. Abate et al., “Composition of Anopheles coluzzii and Anopheles gambiae microbiota from larval to adult stages,” Infection, Genetics and Evolution, vol. 28, pp. 715–724, 2014. [29] S. M. Short, E. F. Mongodin, H. J. MacLeod, O. A. C. Talyuli, and G. Dimopoulos, “Amino acid metabolic signaling in- fluences Aedes aegypti midgut microbiome variability,” PLoS Neglected Tropical Diseases, vol. 11, no. 7, Article ID e0005677, [30] G. Minard, P. Mavingui, and C. V. Moro, “Diversity and function of bacterial microbiota in the mosquito holobiont,” Parasites & Vectors, vol. 6, no. 1, p. 146, 2013. [31] S. *iam, Technique mol´eculaire de d´etection de Wolbachia (wanga Mali) chez Anopheles gambiae sensu lato a l’´etat sauvage au Mali, Ph.D. thesis, Universite´ des Sciences, des Techniques et des Technologies de Bamako, Bamako, Mali, [32] D. Ayala, O. Akone Ella, N. Rahola et al., “Natural Wolbachia infections are common in the major malaria vectors in Central Africa,” Evolutionary Applications, vol. 12, no. 8, pp. 1583–1594, 2019. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png International Journal of Zoology Hindawi Publishing Corporation

Bacteria Load Determination of the Intestinal Microbiota and Identification of Spiroplasma and Wolbachia in Anopheles gambiae

Loading next page...
 
/lp/hindawi-publishing-corporation/bacteria-load-determination-of-the-intestinal-microbiota-and-HbF0sMowWu
Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2022 Haziz Sina et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8477
eISSN
1687-8485
DOI
10.1155/2022/1491648
Publisher site
See Article on Publisher Site

Abstract

Hindawi International Journal of Zoology Volume 2022, Article ID 1491648, 9 pages https://doi.org/10.1155/2022/1491648 Research Article Bacteria Load Determination of the Intestinal Microbiota and Identification of Spiroplasma and Wolbachia in Anopheles gambiae 1 1,2 3 1 1 Haziz Sina , Kamirou Chabi-Sika, Razaki Osse, ` Akim Socohou, Ibrahim A. Abibou, 1 1 4 Hafiz Salami, Germain Gil Padonou, Adolphe Adjanonhoun, and Lamine Baba-Moussa Laboratory of Biology and Molecular Typing in Microbiology, Department of Biochemistry and Cellular Biology, Faculty of Sciences and Techniques, University of Abomey-Calavi, 05 BP 1604 Cotonou, Godomey, Benin Laboratory of Biochemistry and Food & Medicinal Formulations, National University of Sciences, Technologies, Engineering and Mathematics of Abomey, Abomey, Benin School of Management and Operation of Livestock Systems, National University of Agriculture, Ketou, Benin National Institute of Agronomic Research of Benin, Cotonou, Benin Correspondence should be addressed to Haziz Sina; sina.haziz@gmail.com Received 28 November 2021; Revised 31 May 2022; Accepted 2 July 2022; Published 19 July 2022 Academic Editor: Edson Gandiwa Copyright © 2022 Haziz Sina et al. �is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. �e gut microbiota of mosquitoes is composed of a range of microorganisms. Among its microorganisms, some a‚ect the vectorial capacity of mosquitoes. �e aim of this study was to characterize some bacteria of the intestinal microbiota in Anopheles gambiae (An. gambiae) females, a major vector of malaria transmission in Benin. �e symbiote bacteria of the microbiota of female laboratory An. gambiae and female wild An. gambiae were identi‡ed by the culture method. �e count was done on media plate count agar (PCA), and subsequently, the bacterial load was calculated. Comparison of batches bacterial load was carried out with the variance analysis test (ANOVA). Finally, polymerase chain reaction (PCR) was performed to investigate the presence of a few bacterial genera in‘uencing the vector capacity of An. gambiae. �e study found that the microbiota of female An. gambiae is home to the bacteria belonging to the Staphylococcus, Enterobacteriaceae, and other unidenti‡ed bacterial gene regardless of its nature and condition. Similarly, there was no statistically signi‡cant di‚erence between the bacterial load of the laboratory and wild mosquitoes depending on the parous and gorged states; on the other hand, there was a signi‡cant di‚erence between the bacterial loads of the laboratory and wild mosquitoes according to the nulliparous and nongorged states. �e search for a few bacterial genera in‘uencing the vector capacity of female An. gambiae has been negative for Spiroplasma bacteria regardless of its nature and condition. PCR revealed the presence of Wolbachia bacteria for only gorged Kisumu sensitive An. gambiae. Wol- bachia’s presence at An. gambiae suggests that this type of bacteria could be used to develop new e‚ective and sustainable approaches in the vector control. is the most common strategy in endemic countries [2]. 1. Introduction However, the heavy use of insecticides to carry out this Malaria remains a public health problem in many devel- strategy modi‡es the trophic behavior of the vectors [3]. �is oping countries, particularly in Sub-Saharan Africa [1]. �e has the consequence of negatively impacting the e‚ort to dynamics of malaria transmission depend on certain aspects reduce the burden of the disease due to malaria. As a result, of the physiology and ecology of their vectors, mosquitoes. new strategies are desperately needed to control mosquito To break the cycle of the disease transmission, vector control populations or their ability to transmit parasites. One of the 2 International Journal of Zoology promising strategies to reduce vector transmission is to 2. Materials and Methods involve bacterial symbionts which have the potential to 2.1. Sample Collection. Batches of mosquitoes (wild or decrease the vectorial capacity of their hosts [4]. Indeed, reared) were made for this study. *e reared mosquitoes’ these symbionts are maintained by maternal transmission batches (Kisumu and Kdr) come from the Centre de and can therefore spread within populations. With these Recherche en Entomologie de Cotonou (CREC) insecta- characteristics, the symbionts appear to be a much more rium. *e parity parameters (parous and nulliparous) and sustainable and cost-effective strategy for controlling the nutritional status (gorged and not gorged) were considered transmission of vector-borne diseases such as malaria [5]. for the constitution of the batches. *us, for Kisumu’s and *ese microorganisms, including bacteria, viruses, fungi, Kdr, four batches (parous, nulliparous, gorged, and not protozoa, nematodes, and mites, are more or less stable in gorged) were made up. Each batch of mosquitoes consisted the exoskeleton, intestine, hemocoel, and/or in mosquito of five randomly selected individuals from the same clutch cells [6]. and were stored in a 1.5 ml Eppendorf tube at 4 C for later To advance the prospect of a symbiont-based malaria microbiological analysis. control strategy, it will be important to continue to For wild mosquitoes, they were captured by the pyre- identify, generate, and study a wide range of anopheles- thrum spray catches (PSC) technique as described in the symbiont systems. *e mosquito microbiota is of par- Manual of Malaria Entomology and Vector Control [16]. ticular interest because of its influence on certain factors Before performing the PSC, all large pieces of furniture were determining the mosquito’s ability to transmit pathogens removed, and the floor was covered with white bed sheets. such as immunity, longevity, fertility, and metabolism [6]. Insecticide was first sprayed from the outside of the house *ey can be pathogens, commensals, or mutualists and onto the windows and the doors before spraying on the rely on vertical or horizontal transmission [7]. In addi- inside of the house. All doors and windows remained closed tion, the symbiont bacteria are functionally diverse, for about 10 min to induce mosquito knockdown [17]. After exhibiting a wide range of infection and transmission exposition time (10 minutes), mosquitoes knocked down strategies. *e mosquito gut is naturally inhabited by a were collected, and a preliminary sorting was done on the community of bacteria that can disrupt the development basis of macroscopic observation. *e identification of the of human parasites such as Plasmodium [8]. In some species An. gambiae was made according to the taxonomic mosquitoes, as in many species of arthropods, two major key [17, 18] using the stereo microscope ez4 w binocular taxa of facultative endosymbionts have been identified, (Leica, Germany). *e wild mosquitoes were also divided Wolbachia and Spiroplasma. Since these bacteria are into four batches (parous, nulliparous, gorged, and not transmitted vertically from the mother, they have ac- gorged) in different 1.5 ml Eppendorf tubes. quired the particularity of modifying the reproduction of their host, thus increasing their spread, by mechanisms that vary according to the species of arthropod and the bacterial strain [6]. 2.2. Microbial Analysis. Five mosquitoes were randomly Wolbachia has recently been reported in low per- selected from each category (parous, nulliparous, gorged, centages in some populations of Anopheles coluzzi and and not gorged), from each batch of An. gambiae female Anopheles gambiae [9]. Wolbachia appears to induce cy- (Kisumu, Kdr, and wild). Each mosquito abdomen was toplasmic incompatibility since spermatozoa from the separated from the thorax using a sterile scalpel for each infected males could not fertilize oocytes from the unin- sample. *e abdomens of selected mosquitoes from the same fected females. *is promotes the reproduction of infected batches were rinsed in sterile water and then was sterilized in females over uninfected females in a population. *ese 70% ethanol (1 minute). *us, each abdomen batches were bacteria can also increase the proportion of females in a crushed [19] into 1.5 ml Eppendorf tube containing 500 μl of population by the induction of parthenogenesis, by male- sterile saline solution to have the stock solution. Finally, 25 μl specific lethality during development or by feminization of was taken from each stock solution in order to carry out − 7 males [10]. In addition, Spiroplasmas are “specialists” in successive decimal dilutions up to 10 . arthropods, and all known species have some form of Eosin-methylene blue (EMB), Muller Hinton (MH), and interaction with this clade [11], and they can confer a Chapman agars were used for seeding the stock solutions, in variety of resistant insect hosts on a range of eukaryotic tight streaks on the first half of the agar, and wide streaks on parasites, including nematodes, parasitoids, and patho- the second half so as to obtain the isolated colonies. All the genic fungi [12, 13]. *erefore, they are a good candidate inoculated dishes were incubated at 30 C overnight. A first for a symbiont which could be useful for the control of layer of the plate count agar (PCA) was poured into the Plasmodium. kneaded dishes, then 25 μl of each successive dilution serving Some studies on the microbiome of anopheles have as an inoculum was transferred into the precast dishes, and identified Spiroplasma from pathogenic clades [14, 15]. then homogenized correctly. *e second layer was poured as However, in Benin, we have very little data on the bacterial soon as the homogenate started to solidify. *e cast boxes symbionts of the major vector of malaria transmission. It is were placed in an oven at 37 C for 72 hours. *e inoculated in this dynamic that fits this study that aim to investigate this boxes were read after 72 hours. microbial diversity, focusing on some bacteria, of the in- Since the PCA agar is a nutrient medium, it was used to testinal microbiota in female An. gambiae. enumerate the total aerobic-mesophilic flora of the International Journal of Zoology 3 ° ° abdominal microbiota of each mosquito. Only dishes with a denaturation (95 C for 30 s), hybridization (60 C for 30 s), number of colonies greater than or equal to 30 and less than and elongation (72 C for 30 s), followed by final elongation 300 are taken into account for the enumeration. To deter- (72 C for 10 minutes). mine the bacterial load of the microbiota of each mosquito, For each gene, the reaction was performed in a 20 μl mix the standard formula used is as follows: bacterial containing 10x Eurogentec buffer (2 μl), dNTP (0.2 μl), load � number of colonies counted × seeded vol- 10 μM of each primer (1 μl), MgCl (1.2 μl), Taq DNA po- ume × dilution factor [20]. lymerase (0.2 μl), and DNA (3 μl). *e DNA extracted from mosquitoes was used as a negative control. *e amplification products were migrated on a 1.5% agarose gel containing 2.3. Molecular Analysis ethidium bromide at 110 V for 30 minutes. 2.3.1. DNA Extraction. Deoxyribose nucleic acid (DNA) extraction was performed from a pool of mosquitoes using 2.4. Data Analysis. *e data collected was entered into an the QIAamp DNA Mini Kit (Quiagen, Germany). *e Excel 2016 spreadsheet and then was analyzed with the extraction protocol provided by the manufacturer with the Minitab R 18 software. *e following steps were taken after kit was strictly followed. *us, in brief, the abdomens of the information was collected: (i) checking the normality of each mosquito were pooled in a 1.5 ml Eppendorf and the data and the homogeneity of variances, (ii) calculation of filled with 180 (microliter/microliter) μl of ALT buf- means, variances, sum of squares, degree of freedom, mean fer + proteinase K. *e homogenized mixture was incu- of squares, and of the value of the probability, and (iii) bated in the oven at 56 C for about 3 hours. After comparisons of the bacterial load of An. gambiae batches. incubation, the mixture was supplemented with 200 μl of *e one-way analysis of the variance and the Fisher test were buffer AL and was homogenized carefully for 15 seconds. used to compare the means. *e test is considered statis- Incubated in the oven at 70 C for 10 minutes, the tubes tically significant when p< 0.05. were centrifuged briefly to remove any drops from the lid. After homogenization of the mixture for 15 s, 200 μl of 3. Results ethanol (96%) was added, briefly centrifuged, and the supernatant was transferred to the QIAamp Mini ex- 3.1. Bacterial Loads of Anopheles gambiae Samples. traction columns for another centrifugation (8000 rpm for Anopheles gambiae females had a high bacterial load re- 1 minute). *e QIAamp Mini Spin extraction column was gardless of the pool and category of mosquito (Figure 1). It placed in a new 2 ml collection tube and 500 μl of buffer was noted that the wild, nongorged female An. gambiae had AW1 was added before centrifugation at 8000 rpm for 1 the highest bacterial load, while the wild nulliparous female minute, and the collection tube was discarded. *e An. gambiae mosquitoes had the lowest bacterial load. *e QIAamp Mini extraction column was placed again in a sensitive nongorged Kisumu also had a high bacterial load, 2 ml collection tube and then 500 μl of buffer AW2 was whereas gorged Kisumu had the lowest bacterial load. Fi- added. *e mixture was centrifuged at 14,000 rpm for 3 nally, An. gambiae Kdr parous had a high bacterial load as minutes. *e QIAamp Mini Extraction column was placed opposed to nulliparous Kisumu which had the lowest in a new 2 ml collection tube and was centrifuged at full bacterial load. speed for 1 minute to eliminate the risk of possible car- Based on one-way analysis of the variance (ANOVA), ryover of Buffer AW2. To end, 200 μl of AE buffer was used the value for the probability (0.095) was greater than 0.05 for DNA elution in a new 1.5 ml Eppendorf tube and (Table 1). *erefore, there was no statistically significant maintained at 4 C. difference between the bacterial load of An. gambiae mos- quitoes from laboratory and wild batches in the parous 2.3.2. Search for Alleles of Genes Use for the Identification of category at 0.05 level. Spiroplasma and Wolbachia. For the identification of Spi- Figure 2 shows the difference in bacterial loads, two by roplasma, the DnaA genetic determinant was the target [21]. two of the different pool of mosquitoes studied in the parous *e primers used for this purpose were DnaA109F: category. *is difference in bacterial load is represented on 5′TTAAGAGCAGTTTCAAAATCGGG3′ and DnaA246R: the graph by a confidence interval. It can be seen that all the 5′-CAAACAAATTGTTATTACTTC-3′. *e PCR reactions intervals contain the value zero. *erefore, considering the parous category, there was no statistically significant dif- were performed using the thermal cycler under the following conditions: a cycle of initial denaturation (95 C for 10 ference between the bacterial load of mosquitoes from laboratory and wild’s (Figure 2). Fisher’s test therefore minutes), followed by 35 cycles of denaturation (95 C for ° ° 30 s), hybridization (55 C for 30 s), and elongation (72 C for confirms the result obtained from the ANOVA test. 30 s), followed by a final elongation (72 C for 10 minutes). Based on one-way analysis of the variance (ANOVA), *e molecular identification of Wolbachia was made the value of the probability of 0.048 was less than 0.05. *ere targeting ftsZ [22]. For this, the used primers were ftsZf1 5′- was a significant difference between the bacterial load of GTTGTCGCAAATACCGATGC-3′ and ftsZr1 5′- female An. gambiae mosquitoes from laboratory and wilds in CTTAAGTAAGCTGGTATATC-3′. In this case, the am- the nongorged category (p< 0.05) (Table 2). plification conditions were the following: initial denatur- Figure 3 shows the difference in the bacterial loads two ation (95 C for 10 minutes), followed by 40 cycles of by two of the different pool of mosquitoes studied in the 4 International Journal of Zoology 1.00E+08 1.00E+07 1.00E+06 1.00E+05 1.00E+04 1.00E+03 1.00E+02 1.00E+01 1.00E+00 Wild Sensitive Kisumu Kdr resistant Kisumu Parous Gorged Nulliparous Non-gorged Figure 1: Di‚erent pool of Anopheles gambiae according to their bacterial loads. Table 1: Results of the analysis of the variance test of the di‚erent batches of Anopheles gambiae mosquito in the parous category. Source of variations Sum of squares Degree of freedom Average of squares F Probability (%) Critical value for F 14 13 Between pools 1.89 ×10 2 9.46 ×10 3.574 9.50 5.143 14 13 Inside the pools 1.59 ×10 6 2.65 ×10 Total 3.48 ×10 8 -5000000 -10000000 -15000000 -20000000 -25000000 parous ssv-kis- parous wild- parous wild- parous Kdr-kis parous Kdr-kis parous ssv-kis ssv = sensitive Kis = Kisumu Figure 2: Graph resulting from Fisher’s test of parous mosquitoes. Table 2: Results of the analysis of the variance test of the di‚erent pools of Anopheles gambiae in the nongorged category. Source of variations Sum of squares Degree of freedom Average of squares F Probability Critical value for F +15 +15 Between pools 4.06 ×10 2 2.03 ×10 5.27 +15 +14 Inside the pools 2.31 × 10 6 3.81 × 10 4.77% 5.14 Total 6.36 ×10 8 parous category. �is di‚erence in bacterial loads two by two zero. Consequently, there is a statistically signi‡cant dif- was represented on the graph by a con‡dence interval. It can ference between the bacterial load of mosquitoes from be seen that at least one interval does not contain the value laboratory and wild batches in the nongorged category International Journal of Zoology 5 -50000000 -100000000 N-ES-kis-N-E Kdr-Kis N-E Wild-N-ES-Kis N-E Wild-N-E Kdr-Kis N-E = Non gorged S = sensitive Kis = Kisumu Figure 3: Graph results of Fisher’s test of nongorged mosquitoes. (Figure 3). Fisher’s test therefore con‡rms the result ob- independently to the pools of mosquito. However, it can be observed in a diversity of mosquitoes’ microbiota, whatever tained from the ANOVA test. Based on the one-way analysis of variance (ANOVA), is the batch and the category of the mosquito. �us, bacteria there is no statistically signi‡cant di‚erence between the belonging to Enterobacteriacea, Staphylococcus spp. and bacterial load of mosquitoes from laboratory pools and wilds other bacterial genera are found in the abdomen of the in the gorged category (Table 3). analyzed female. However, the nulliparous kdr do not have Figure 4 shows the di‚erence in bacterial loads of two by bacteria belonging to the genus Enterobacteriaceae, while two of the di‚erent pools of mosquitoes studied in the sensitive parous Kisumu do not have bacteria belonging to gorged category. �is di‚erence in bacterial loads two by two the genus Staphylococcus. is represented on the graph by a con‡dence interval. It can be seen that all the intervals contain the value zero. Conse- 3.3. Con‘rmation of the Presence of Spiroplasma and quently, there is no statistically signi‡cant di‚erence be- Wolbachia. �e anopheline DNA extracted from batches of tween the bacterial load of mosquitoes from laboratory and female An. gambiae mosquitoes (laboratory and wild) was wild batches in the gorged category (Figure 4). Fisher’s test used to test for the presence or absence of Wolbachia and therefore con‡rms the result obtained from the ANOVA Spiroplasma. None of the pools displays the presence of test. According to the one-way analysis of variance Spiroplasma spp. As for the search for the Wolbachia gene, it (ANOVA), there is a statistically signi‡cant di‚erence be- was detected among a sample of laboratory An. gambiae tween the bacterial load of mosquitoes from laboratory lots (sensitive gorged Kisumu) (Table 6). and wilds in the nulliparous category (Table 4). Figure 5 shows the di‚erence in bacterial loads two by 4. Discussion two of the di‚erent batches of mosquitoes studied in the nulliparous category. �is di‚erence in bacterial loads two Bacteria belonging to the Enterobacteriaceae and Staphy- by two is represented on the graph by a con‡dence interval. lococcus group were identi‡ed from An. gambiae samples It can be seen that at least one interval does not contain the collected. �e Gram staining of the di‚erent colonies value zero. Consequently, there is a statistically signi‡cant revealed the presence of Gram-positive bacilli, Gram-neg- di‚erence between the bacterial load of mosquitoes from ative bacilli, and Gram-positive cocci. �e presence of laboratory and wild batches in the nulliparous category Gram-negative bacilli and Gram-positive cocci then con- (Figure 5). Fisher’s test therefore con‡rms the result ob- ‡rms the results of the inoculation. In addition, the presence tained from the ANOVA test. of Gram-positive bacilli suggests the presence of other bacterial genera not identi‡ed in this study. �ere was 3.2. Microbiological Diversity of the Microbiota. �e analysis similarity between the bacterial community of the laboratory of Table 5 reveals the presence of the di‚erent components of mosquitoes (Kdr and sensitive Kisumu) compared to the the bacterial microbiota in the abdomen of the female An. wild considering the category (parous, nulliparous, gorged, gambiae from the di‚erent batches (wild and laboratory) and non-gorged). Regarding the bacterial genus Staphylo- and in relation to the category (parous, nulliparous, gorged, coccus identi‡ed during our research, these results are and nongorged). It can be seen that the results are similar contrary to that of a study carried out in India in 2009 on the 6 International Journal of Zoology Table 3: Results of the analysis of the variance test of the di‚erent batches of Anopheles gambiae mosquito in the gorged category. Source of variations Sum of squares Degree of freedom Average of squares F Probability (%) Critical value for F 12 11 Between pools 1.31 × 10 2 6.54 ×10 5.14 1.185 12 11 Inside the pools 3.31 × 10 6 5.52 ×10 36.83 Total 4.62 ×10 8 -1000000 -2000000 gorged ssv-kis- gorged wild- gorged wild- gorged Kdr-Kis- gorged Kdr-kis gorged ssv-kis ssv = sensitive Kis = Kisumu Figure 4: Graph of Fisher’s test results of gorged mosquitoes. Table 4: Results of the analysis of variance test for di‚erent Anopheles gambiae according to the category of nulliparous. Source of variations Sum of squares Degree of freedom Average of squares F Probability (%) Critical value for F 14 14 Between pools 4 ×10 2 2 ×10 13 12 Inside the pools 1.3 ×10 6 2.17 ×10 92.04 0.003 5.14 Total 4.13 ×10 8 -10000000 -20000000 nulliparous Kdr-kis- nulliparous wild- nulliparous wild- nulliparous ssv-Kis nulliparous Kdr-Kis nulliparous ssv-kis ssv = sensitive Kis = Kisumu Figure 5: Graph of Fisher’s test results for nulliparous mosquitoes. International Journal of Zoology 7 Table 5: Microbiological diversity of the microbiota according to batches of mosquitoes. Pools Categories Enterobacteria Staphylococcus Other genera Gram Nongorged + + + B− , B+, C+ Parous + + + B− , B+, C+ Kdr Gorged + + + B− , B+, C+ Nulliparous - + + B− , B+, C+ Nongorged + + + B− , B+, C+ Parous + - + B− , B+, C+ Kiss Gorged + + + B− , B+, C+ Nulliparous + + + B− , B+, C+ Nongorged + + + B− , B+, C+ Parous + + + B− , B+, C+ Wild Gorged + + + B− , B+, C+ Nulliparous + + + B− , B+, C+ + � presence; − � absence; B+ � Gram-positive bacillus; B+ � Gram-negative bacillus; C+ � Gram-positive cocci; Kdr � Kdr resistant; kiss � sensitive kisumu. Table 6: Search for Wolbachia ssp and Spiroplama ssp genes. particular [24]. Concerning the comparison of the bacterial load, it was observed that there is no significant difference Pools Categories Wolbachia gene Spiroplasma gene between the bacterial load of the laboratory and wild Parous − − mosquitoes in the gorged and nulliparous category. In ad- Nulliparous − − Kdr dition, there is a significant difference between the bacterial Gorged − − load of the laboratory and wild mosquitoes among the Nongorged − − nulliparous and nongorged). *e gorged and parous labo- Parous − − ratory mosquitoes (Kdr and sensitive Kisumu) and the wild Nulliparous − − Kisumu Gorged − − ones have in common the taking of blood meals. Vertebrate Nongorged − − blood generally contains very few or no germs [27]. Several Parous − − studies show that the consumption of a blood meal per- Nulliparous − − sistently or transiently modifies the composition of the Wild Gorged − − intestinal microbiota through alterations in redox status or Nongorged − − metabolism [28,29]. Does the blood test also change the + � positive; − � negative. bacterial load? or is it a coincidence? Environmental factors [30], and diet [24], must be considered having an impact on the load and composition of mosquito bacteria. field and laboratory populations of the malaria vector *e research of bacterial genera influencing the An. gambiae vectorial capacity revealed the presence of Wol- Anopheles stephensi which revealed the presence of bacteria from the genera Bacillus and Staphylococcus in males [23]. bachia in sensitive gorged Kisumu which are mosquitoes reared in the laboratory. Indeed, several studies have *is difference may be related to the sex of the mosquitoes, the species of the mosquito, and the living environment. revealed the presence of Wolbachia in the population of wild mosquitoes, major vectors of malaria transmission, An. Regarding the Enterobacteriaceae family found in our study, our results are similar to those of a study conducted in gambiae’s head and thorax in Mali [31] and ovaries in Kenya [24],but their work does not take to account Burkina Faso [8], and An. gambiae and An. coluzzii in Gabon Staphylococcus. *is difference observed from the present [32]. *ese results are contrary to those provided by this study could be explained by the difference in sample size or study. *is difference can be explained by the limited size of by the ecosystem of rearing laboratory mosquitoes or har- the samples processed or by the fact that the extraction was vesting wild mosquitoes. However, several studies using done only from the abdomen of the mosquitoes in our case. *is difference can also be explained by the environment or metagenomics provide more comprehensive information on the composition of the mosquito midgut microbiota [25,26]. the season of collecting samples from the wild mosquitoes. In addition, the fragments obtained in the present study are *e enumeration of the total mesophilic aerobic flora reveals their presence in both laboratory and wild An. around 500 bp, which suggests a species of Wolbachia dif- gambiae. It has been found that regardless of the nature and ferent from the others obtained in some works. Interestingly, category of the mosquitoes, the bacterial load is high. A this study shows that, in addition to wild An. gambiae, the study conducted in the United States to better understand laboratory ones also harbor Wolbachia. *e presence of the potential fluctuations in the microbial load and species Wolbachia has been identified in sensitive gorged An. composition between laboratory-reared mosquitoes of dif- gambiae Kisumu line. So, this presence could be by blood ferent generations and within the same generation also supply or a natural presence within the microbiota. Until showed that the bacterial load is high [8]. Similarly, a study now, few studies mention the presence of Wolbachia in the blood of vertebrates; however, a study carried out in France carried out in Kenya indicates that, during the life of an adult, a sharp increase in the bacterial load is observed in shows that the presence of Wolbachia pipientis in ticks, 8 International Journal of Zoology [3] F. G. Kabbale, A. M. Akol, J. B. Kaddu, and A. W. Onapa, already reported in various publications, was in fact due to “Biting patterns and seasonality of Anopheles gambiae sensu the cryptic presence of the endo-parasitoid hymenoptera lato and Anopheles funestus mosquitoes in Kamuli district, Ixodiphagus hookeri [33]. *is association has remained Uganda,” Parasites & Vectors, vol. 6, no. 1, p. 340, 2013. unsuspected until now because parasitoids cannot be de- [4] I. Iturbe-Ormaetxe, T. Walker, and S. L. O’Neill, “Wolbachia tected until the tick nymphs become gorged with blood [33]. and the biological control of mosquito-borne disease,” EMBO In addition, natural infections by Wolbachia have been Reports, vol. 12, no. 6, pp. 508–518, 2011. detected in several species of Anopheles. For example, in An. [5] E. A. McGraw and S. L. O’Neill, “Beyond insecticides: new gambiae in Mali [31] and in An. gambiae and An. coluzzii in thinking on an ancient problem,” Nature Reviews Microbi- Gabon [32]. However, Wolbachia being transmitted verti- ology, vol. 11, no. 3, pp. 181–193, 2013. cally by the mother has acquired the particularity of mod- [6] K. Heu and M. Gendrin, “Le microbiote de moustique et son ifying the reproduction of its host. *us, Wolbachia induces influence sur la transmission vectorielle,” Biologie Aujourd’- cytoplasmic incompatibility [10]. For example, the intro- hui, vol. 212, no. 3-4, pp. 119–136, 2018. duction of Wolbachia to Aedes aegypti, not only leads to a [7] L. B. Regassa and G. E. Gasparich, “Spiroplasmas: evolu- decrease in infection with pathogens transmissible to tionary relationships and biodiversity,” Frontiers in Biosci- humans but can also induce cytoplasmic incompatibility ence, vol. 11, no. 1, p. 2983, 2006. [8] Y. Dong, F. Manfredini, and G. Dimopoulos, “Implication of [34]. Some experiments have shown that infection of the mosquito midgut microbiota in the defense against mosquitoes with Wolbachia is not a threat to humans. *is malaria parasites,” PLoS Pathogens, vol. 5, no. 5, Article ID bacterium is too large to pass through the salivary duct of e1000423, 2009. mosquitoes into human blood. *is makes this bacterium a [9] F. Baldini, N. Segata, J. Pompon et al., “Evidence of natural good candidate for vector control of malaria. Wolbachia infections in field populations of Anopheles As for the bacterial genera Spiroplasma, the research by gambiae,” Nature Communications, vol. 5, no. 1, p. 3985, 2014. the technique of PCR was negative for An. gambiae for all [10] J. H. Werren, L. Baldo, and M. E. Clark, “Wolbachia: master our samples. However, an investigation of midgut bacteria in manipulators of invertebrate biology,” Nature Reviews Mi- An. gambiae and Anopheles funestus in western Kenya de- crobiology, vol. 6, no. 10, pp. 741–751, 2008. tected Spiroplasma in An. funestus [14]. In addition, [11] W. Wang, B. Wen, G. E. Gasparich et al., “A spiroplasma Anopheles mosquito microbiome surveys reported Spi- associated with tremor disease in the Chinese mitten crab roplasma from pathogenic clades [14–34]. (Eriocheir sinensis),” Microbiology, vol. 150, no. 9, pp. 3035–3040, 2004. [12] J. Jaenike, R. Unckless, S. N. Cockburn, L. M. Boelio, and 5. Conclusion S. J. Perlman, “Adaptation via symbiosis: recent spread of a drosophila defensive symbiont,” Science, vol. 329, no. 5988, It emerges from this study that the major vector of malaria pp. 212–215, 2010. transmission in Benin An. gambiae female has a fairly di- [13] P. Lukasik, H. Guo, M. Van-Asch, J. Ferrari, and verse microbiota. It harbors, at high loads, in its midgut, H. C. J. Godfray, “Protection against a fungal pathogen bacteria such as staphylococci, Enterobacteriaceae, and other conferred by the aphid facultative endosymbionts rickettsia bacterial genera regardless of the nature and its condition. In and spiroplasma is expressed in multiple host genotypes and addition to this, it has been found that, besides the wild species and is not influenced by co-infection with another mosquitoes, laboratory ones too can be naturally infected symbiont,” Journal of Evolutionary Biology, vol. 26, no. 12, with the strains of Wolbachia which are known to negatively pp. 2654–2661, 2013. impact the reproductive organs of their host or even induce [14] J. M. Lindh, O. Terenius, and I. Faye, “16S rRNA gene-based cytoplasmic incompatibility. It will thus be useful to con- identification of midgut bacteria from field-caught Anopheles tinue this study to investigate the effect of symbionts on the gambiae sensu lato and A. funestus mosquitoes reveals new life of mosquitoes. species related to known insect symbionts,” Applied and Environmental Microbiology, vol. 71, no. 11, pp. 7217–7223, Data Availability [15] N. Segata, F. Baldini, J. Pompon et al., “*e reproductive tracts of two malaria vectors are populated by a core microbiome *e data used to support the findings of this work are and by gender-and swarm-enriched microbial biomarkers,” available from the corresponding author upon request. Scientific Reports, vol. 6, no. 1, p. 24207, 2016. [16] WHO, Entomologie du paludisme et controle ˆ des vecteurs, Conflicts of Interest pp. 1–102, WHO, Geneva, Switzerland, 2003. [17] J. E. Harbison, E. M. Mathenge, G. O. Misiani, *e authors declare that they have no conflicts of interest. W. R. Mukabana, and J. F. Day, “A simple method for sampling indoor-resting malaria mosquitoes Anopheles gambiae and Anopheles funestus (diptera: culicidae) in References Africa,” Journal of Medical Entomology, vol. 43, no. 3, pp. 473–479, 2006. [1] WHO, World Malaria Report 2019, World Health Organi- [18] M. T. Gillies and M. Coetzee, A Supplement to the Anophe- sation, Geneva, Switzerland, 2019. [2] K. Raghavendra, T. K. Barik, B. P. N. Reddy, P. Sharma, and linae of Africa South of the Sahara (Afrotropical Region), South African Institute for Medical Research, Johannesburg, South A. P. Dash, “Malaria vector control: from past to future,” Parasitology Research, vol. 108, no. 4, pp. 757–779, 2011. Africa, 1987. International Journal of Zoology 9 [19] A. Becker, “How to count colonies in microbiology,” 2021, [33] O. Plantard, A. Bouju-Albert, M.-A. Malard, A. Hermouet, G. Capron, and H. Verheyden, “Detection of Wolbachia in the https://sciencing.com/count-colonies-microbiology-17859. tick ixodes ricinus is due to the presence of the hymenoptera html. endoparasitoid Ixodiphagus hookeri,” PLoS One, vol. 7, no. 1, [20] D. S. Gusmão, A. V. Santos, D. C. Marini, M. Bacci, Article ID e30692, 2012. M. A. Berbert-Molina, and F. J. A. Lemos, “Culture-depen- [34] F. Vavre and P. Mavingui, “Les bacteries ´ symbiotiques dent and culture-independent characterization of microor- d’arthropodes et de nematodes, ´ de nouvelles alliees ´ dans le ganisms associated with Aedes aegypti (diptera: culicidae) (L.) controle ˆ des maladies infectieuses,” Medecine Sciences, vol. 27, and dynamics of bacterial colonization in the midgut,” Acta no. 11, pp. 953–958, 2011. Tropica, vol. 115, no. 3, pp. 275–281, 2010. [21] J. K. Herren and B. Lemaitre, “Spiroplasma and host im- munity: activation of humoral immune responses increases endosymbiont load and susceptibility to certain gram-nega- tive bacterial pathogens in Drosophila melanogaster,” Cellular Microbiology, vol. 13, no. 9, pp. 1385–1396, 2011. [22] J. H. Werren and J. Jaenike, “Wolbachia and cytoplasmic incompatibility in mycophagous Drosophila and their rela- tives,” Heredity, vol. 75, pp. 320–326, 1995. [23] A. Rani, A. Sharma, R. Rajagopal, T. Adak, and R. K. Bhatnagar, “Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture- independent methods in lab-reared and field-collected Anopheles stephensi-an Asian malarial vector,” BMC Mi- crobiology, vol. 9, no. 1, p. 96, 2009. [24] Y. Wang, T. M. Gilbreath, P. Kukutla, G. Yan, and J. Xu, “Dynamic gut microbiome across life history of the malaria mosquito Anopheles gambiae in Kenya,” PLoS One, vol. 6, no. 9, Article ID e24767, 2011. [25] J. Akorli, M. Gendrin, N. A. P. Pels, D. Yeboah-Manu, G. K. Christophides, and M. D. Wilson, “Seasonality and locality affect the diversity of Anopheles gambiae and Anopheles coluzzii midgut microbiota from Ghana,” PLoS One, vol. 11, no. 6, Article ID e0157529, 2016. [26] A. E. Douglas, “*e microbial dimension in insect nutritional ecology,” Functional Ecology, vol. 23, no. 1, pp. 38–47, 2009. [27] L. B. Dickson, D. Jiolle, G. Minard et al., “Carryover effects of larval exposure to different environmental bacteria drive adult trait variation in a mosquito vector,” Science Advances, vol. 3, no. 8, Article ID e1700585, 2017. [28] G. Gimonneau, M. T. Tchioffo, L. Abate et al., “Composition of Anopheles coluzzii and Anopheles gambiae microbiota from larval to adult stages,” Infection, Genetics and Evolution, vol. 28, pp. 715–724, 2014. [29] S. M. Short, E. F. Mongodin, H. J. MacLeod, O. A. C. Talyuli, and G. Dimopoulos, “Amino acid metabolic signaling in- fluences Aedes aegypti midgut microbiome variability,” PLoS Neglected Tropical Diseases, vol. 11, no. 7, Article ID e0005677, [30] G. Minard, P. Mavingui, and C. V. Moro, “Diversity and function of bacterial microbiota in the mosquito holobiont,” Parasites & Vectors, vol. 6, no. 1, p. 146, 2013. [31] S. *iam, Technique mol´eculaire de d´etection de Wolbachia (wanga Mali) chez Anopheles gambiae sensu lato a l’´etat sauvage au Mali, Ph.D. thesis, Universite´ des Sciences, des Techniques et des Technologies de Bamako, Bamako, Mali, [32] D. Ayala, O. Akone Ella, N. Rahola et al., “Natural Wolbachia infections are common in the major malaria vectors in Central Africa,” Evolutionary Applications, vol. 12, no. 8, pp. 1583–1594, 2019.

Journal

International Journal of ZoologyHindawi Publishing Corporation

Published: Jul 19, 2022

References