Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/hindawi-publishing-corporation/arhgap11a-promotes-the-malignant-progression-of-gastric-cancer-by-L0R0CyQZCz
References
References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.
- Publisher
- Hindawi Publishing Corporation
- Copyright
- Copyright © 2021 Xiaoying Guan et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
- ISSN
- 1687-8450
- eISSN
- 1687-8469
- DOI
- 10.1155/2021/4146910
- Publisher site
- See Article on Publisher Site
Abstract
Hindawi Journal of Oncology Volume 2021, Article ID 4146910, 13 pages https://doi.org/10.1155/2021/4146910 Research Article ARHGAP11A Promotes the Malignant Progression of Gastric Cancer by Regulating the Stability of Actin Filaments through TPM1 1 2 3 3 3 Xiaoying Guan , Xiaoli Guan , Junjie Qin , Long Qin , Wengui Shi , and Zuoyi Jiao Pathology Department, Lanzhou University Second Hospital, Lanzhou, Gansu 730030, China General Medicine Department, Lanzhou University Second Hospital, Lanzhou, Gansu 730030, China Cuiying Biomedical Center, Lanzhou University Second Hospital, Lanzhou, Gansu 730030, China 'e First Department of General Surgery, Lanzhou University Second Hospital, Lanzhou, Gansu 730030, China Correspondence should be addressed to Zuoyi Jiao; zuoyjiao@163.com Received 30 July 2021; Revised 7 October 2021; Accepted 12 November 2021; Published 6 December 2021 Academic Editor: Zhiqian Zhang Copyright © 2021 Xiaoying Guan et al. ,is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ,e mechanism underlying the poor prognosis of gastric cancer, including its high degree of malignancy, invasion, and metastasis, is extremely complicated. Rho GTPases are involved in the occurrence and development of a variety of malignant tumors. ARHGAP11A, in the Rho GTPase activating protein family, is highly expressed in gastric cancer, but its function and mechanism have not yet been explored. In this study, the effect of ARHGAP11A on the occurrence and development of gastric cancer and the mechanism related to this effect were studied. ,e expression of ARHGAP11A was increased in gastric cancer cells and tissues, and high ARHGAP11A expression in tissues was related to the degree of tumor differentiation and poor prognosis. Moreover, ARHGAP11A knockout significantly inhibited cell proliferation, cell migration, and invasion in vitro and significantly inhibited the tumorigenic ability of gastric cancer cells in nude mice in vivo. Further studies revealed that ARHGAP11A promotes the malignant progression of gastric cancer cells by interacting with TPM1 to affect cell migration and invasion and the stability of actin filaments. ,ese results suggest that ARHGAP11A plays an important role in gastric cancer and may become a useful prognostic biomarker and therapeutic target for gastric cancer patients. state and the inactive GDP-bound state. ,is process is 1. Introduction regulated by guanine nucleotide exchange factors (GEFs) Cell migration is a complex and dynamic process involving and Rho GTPase-activating protein (RhoGAP) [4]. the continuous remodeling of cellular structure [1]. Mi- To study the main mechanisms involved in the malignant gration is an important feature of gastric cancer cell progression of gastric cancer, we performed gene expression spreading during metastasis. To successfully metastasize, profiling on 16 pairs of gastric cancer and adjacent tissues. ,e cancer cells must cross the barriers constituted by blood results showed that ARHGAP11A, in the Rho GTPases-ac- vessels, tissues, and the extracellular matrix. Cancer cells can tivating protein family, exhibited significantly increased ex- migrate collectively or individually, and cells can change pression in gastric cancer tissues. ARHGAP11A is a their migration behavior dynamically and reversibly [2]. nonspecific RhoGAP that regulates the conversion of Rho Studies have found that Rho GTPases play an important role GTPases to the GDP-bound form. We found that through in the occurrence of malignant tumors, regulating a variety bioinformatic analysis ARHGAP11A is highly expressed in a of biological processes, such as cytoskeletal reorganization, variety of cancer tissues, and Fan’s research also confirmed cell motility, and cell cycle progression [3]. As molecular this [5]. Another researchers identified 17 highly expressed switches, Rho GTPases cycle between the active GTP-bound key genes in gastric cancer tissues by weighted gene 2 Journal of Oncology coexpression network analysis, and ARHGAP11A is one of (Invitrogen, USA). After 48 hours, the supernatant was col- them. Studies have shown that ARHGAP11A plays a crucial lected and ultracentrifuged for infection of gastric cancer cells. role in the maintenance of gastric cancer stem cells [6]. ,e sequence of sgRNA for TPM1 is ARHGAP11A promotes colon cancer cell invasion and is the GCCCGTAAGCTGGTCATCATT; the specific protocol used main regulator of cancer cell motility [7]. In basal-like breast for plasmid construction is the same as that described above. cancer cells, ARHGAP11A has oncogenic rather than tumor- Regarding construction of the ARHGAP11A over- suppressive effects [8] and is an ideal target for the treatment expression plasmid, to increase the expression of ARH- of invasive tumors. ARHGAP11A is related to the infiltration GAP11A, two pairs of primers were used to construct the of immune cells (CD8+ T cells, CD4+ T cells, macrophages, stable transfection plasmid Lenti-CMV-Flag-ARHGAP11- and dendritic cells) in gastric cancer and may be an important puro and the transient transfection plasmids PRK5-Flag- regulator of immune infiltrating cells and a valuable prog- ARHGAP11A and PRK5-HA-ARHGAP11A; the related nostic marker [5]. However, the role of ARHGAP11A in the primers sequences are shown in Supplemental Table S1. ,e occurrence and development of gastric cancer, as well as primers sequences of truncation mutants of ARHGAP11A whether ARHGAP11A affects the proliferation and metastasis are shown in Supplemental Table S2. of gastric cancer cells, whether interacting proteins are in- volved in its role, and whether specific molecular signaling 2.4. Immunohistochemistry. A total of 432 pairs of paraffin- pathways are involved in its regulation, needs to be further embedded gastric cancer and adjacent tissues were made studied. into tissue chips. ,e sections were dewaxed and hydrated In this study, we found that ARHGAP11A is the most via routine methods, and endogenous peroxidase activity highly expressed gene of the Rho GTPase-activating protein was blocked with 3% hydrogen peroxide. ,e sections were family in gastric cancer. Its function of regulating the sta- subjected to antigen repair in a pressure cooker containing bility of actin microfilaments and promoting the prolifer- citrate buffer and incubated with immunohistochemical ation, invasion, and migration of gastric cancer cells depends blocking solution at room temperature for 30 minutes. After on TPM1, thus promoting the malignant progression of adding the primary antibody, the sections were placed in a gastric cancer. ,e important role of ARHGAP11A in gastric refrigerator overnight at 4 C. Primary antibody ARH- cancer provides us with a new potential therapeutic target GAP11A (1 : 300, Affinity, USA) was used. Next, the sections for the study of gastric cancer. were developed with diaminobenzidine (DAB), and the coloration reaction was terminated by washing with distilled 2. Material and Methods water. After staining with hematoxylin staining solution, 1% hydrochloric acid-alcohol (75% ethanol: hydrochloric 2.1. Tissue Specimens. A total of 432 pairs of gastric cancer acid � 100 :1) was used for differentiation. The sections were and paracancerous tissues were obtained between 2016 and dehydrated in an alcohol gradient and cleared with xylene, 2019 after written informed consent was obtained. Post- and neutral gum was then used to seal the slides. Scoring was operative pathological sections were diagnosed by experi- performed by experienced senior pathologists according to enced pathologists. None of the patients received the positive staining intensity of tumors and the percentage chemotherapy or radiotherapy before surgery, and the of staining: 0, 0%; 1, <25%, 2, 25%–75%; 3, 75%–100%. ,e procedure was approved by the Ethics Committee of final result was expressed as the H-score value, Lanzhou University Second Hospital. H-Score � (i × Pi), where i is the staining intensity and Pi is the percentage of stained cells. 2.2. Cell Lines and Cell Culture Conditions. GES-1 human gastric mucosal epithelial cells and HGC-27, MKN-45, NCI- 2.5. Quantitative Real-Time PCR Analysis. Quantitative real- N87, and AGS human gastric cancer cell lines were obtained time PCR was performed as described previously [9]. TRIzol from the Institute of Basic Medical Sciences, Chinese reagent (TaKaRa, Japan) was used for total RNA extraction, Academy of Medical Sciences (Beijing, China). and a TaKaRa kit RR047A (TaKaRa, Japan) was used for HEK293T cells were obtained from the ATCC; all cells were reverse transcription according to the protocol. A TB cultured in a cell incubator at 37 C in 5% CO . Green Fast qPCR Mix Kit (TaKaRa, Japan) was used to perform real-time PCR analysis in a Roche LightCycler 96 2.3. Plasmid Construction and Cell Transfection. First, two real-time quantitative PCR instrument (Roche, Switzerland). sgRNA targets were designed and synthesized, the sequences ,e reaction conditions for the standard two-step PCR of sgRNA were KO1: GGCAATGTACGCTTAGCATT, KO2: amplification procedure were as follows: TGGTTTCCACCAATGAGTAC, and the sgRNA was am- Stage1: predenaturation at 95 C 30 s, 1 cycle; Stage 2: ° ° plified and ligated to the Lenti-CRISPR vector (at the BsmBI amplification at 95 C for 5 s and 60 C for 20 s, 40 cycles; Stage ° ° site) using the Gibson Assembly method. ,e plasmid was 3: melting curve analysis at 95 C for 0 s, 65 C for 15 s, and transformed into competent cells and extracted with a 95 C for 0 s. GAPDH was used as the reference gene. ,e Tiangen Plasmid Extraction Kit (Tiangen, China). ,e len- relative fold changes in the mRNA levels were calculated −ΔΔCT tiviral core plasmid Lenti-CRISPR Puro-ARHGAP11A and using the 2 method. ,e sequences of the primers used two packaging plasmids psPAX2 and pMD2G were are shown in Table 1. ,e primers were synthesized by Xi’an cotransfected into HEK293T cells using Lipofectamine 2000 Qingke Zexi Biotechnology Co., Ltd. Journal of Oncology 3 Table 1: Primers for qRT-PCR analysis. Gene Primer (forward: 5′–3′) Primer (reverse: 5′–3′) ARHGAP11A ATATTGGGCGTGTACCAGATTTT CAATGTACGCTTAGCATTTGGTG GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA 2.6. Western Blot Analysis. Cellular protein was extracted with PBS 3 times, and then stained with 1 ml of 1% crystal with RIPA lysis buffer (Solarbio, China), the protein violet, photographed, and counted with Image-Pro Plus concentration was measured with a BCA protein quanti- software. tative kit (Solarbio, China), and the absorbance value was measured at 562 nm in a microplate reader. 25 micrograms 2.10. Cell Invasion and Migration Assays. ,e cell migration of total protein was added to each well. Proteins were ability was evaluated by a wound-healing assay. Cells separated by 8%–12% sodium dodecyl sulfate- (SDS-) (5.0 ×10 cells/well) were seeded in a 6-well plate. When the polyacrylamide gel electrophoresis (PAGE) and transferred cells were confluent, a 100 μL sterile pipette tip was used to to a PVDF membrane. After blocking with 5% skimmed make three vertical scratches in each well. PBS buffer was milk for 1 hour, the membrane was incubated overnight at gently added from the sidewall and the cells that detached 4 C with primary antibodies specific for the following from the wound were removed by washing. Images were proteins: ARHGAP11A (1 : 1000, Affinity, USA), TPM1 (1 : taken and sampled at 0 h, 24 h, and 48 h, respectively, and the 500, Abcam, UK), GAPDH (1 : 1000, Proteintech, USA), scratch lengths in each group at each time point were and β-actin (1 : 1000, Proteintech, USA). ,e membrane measured with ImageJ software. was washed with TBST on a shaker and was then incubated A Transwell invasion assay was used to evaluate the cell with the corresponding secondary antibody (1 : 10000, invasion ability. ,e membrane in each chamber was coated Proteintech, USA). ,e immunoreactive protein bands with Matrigel matrix (BD Biosciences, USA), and the cell were visualized using an enhanced chemiluminescence kit suspension was resuspended in serum-free medium to adjust (Xinsaimei, China). the cell density to 1 × 10 cells/ml. 200 μL aliquot of the cell suspension was added to each upper chamber, and 600 μL of 2.7. Detection of Cell Proliferation with the High Content complete culture medium containing 10% serum was added Analysis System. ,e cell density was adjusted to 1 × 10 to each lower chamber. Culture was continued at 37 C for cells/ml after conventional trypsin digestion. 200 μL cell 48 h. A clean cotton swab was used to gently wipe away the suspension was added to each well of a 96-well plate so that cells on the upper surface of the chamber membrane. ,en, the number of target cells was 2000. Each group of cells to be the remaining cells were fixed with 4% neutral formaldehyde tested was established with 5 replicate wells. ,e plate was for 10 minutes and stained with 0.1% crystal violet at room put into the High Content Analysis System (PerkinElmer, temperature for 1 hour. ,e membranes were visualized and USA) and prepared for counting. ,e parameters of the imaged under a microscope. Cells were counted with Image- High Content Analysis System were set after the cells had Pro Plus software. adhered to the wall; the cells were counted every 3 h and observed continuously for 120 h. Statistical analysis was conducted according to the number of cells counted at each 2.11. Immunofluorescence. Cells were seeded in a small glass time point. dish, and the culture medium was discarded the next day. Cells were washed three times with PBS, fixed with 4% cold paraformaldehyde for 20 minutes, permeabilized with 0.1% 2.8. EdU Detection of Cell Proliferation. Cells (5 ×10 cells/ Triton X-100 for 5 minutes, and blocked with immuno- ml) were plated in a 48-well plate, labeled with EdU histochemical blocking solution for 30 minutes. ,e pre- (Solarbio, China) according to the protocol, fixed with 4% pared Rhodamine-Phalloidin solution (1 : 300, Solarbio, paraformaldehyde, washed with PBS, and permeabilized China) and prepared DAPI solution (1 : 500, Solarbio, with 0.3% TritonX-100. ,e reaction solution was then China) were added at a volume of 300 μL, and the cells were prepared according to the instructions, 0.1 ml Click reac- placed in a wet box for staining in a 37 C incubator for 2 tion solution was added to each well, and the cells were hours. ,e High Content Analysis System was used to detect incubated at room temperature for 30 minutes and stained and visualize fluorescence and acquire images in the cor- with 1x Hoechst 33342 solution at room temperature for responding channel. ,e Skeleton and Strahler analysis 30 minutes. ,e High Content Analysis System was used to plugins in Fiji ImageJ software were used to extract and perform fluorescence detection at the corresponding analyze the structure of cytoskeletal actin filaments. ,e wavelength. Skeleton plugin can extract the cytoskeleton visualized by immunofluorescence staining to obtain a linear cytoskeleton 2.9. Detection of Colony Formation. Cells (200 cells/well) structure. ,e Strahler analysis plugin can display the cy- were seeded in 35 mm dishes, cultured in 2 ml of DMEM toskeleton in different colors according to the complexity of (Gibco, USA) containing 10% FBS for two weeks, fixed with its connections and can measure a series of parameters, such 1 ml of 4% neutral formaldehyde for 10 minutes, washed as the number of cytoskeletal branches, the length of the 4 Journal of Oncology branches, and the number of connection points, to evaluate 2.15. Statistical Analysis. SPSS 23.0 (IBM, USA) was used to the degree of cytoskeletal variation. ,e website for the perform statistical analyses. ,e chi-square test was used to cytoskeleton analysis process is http://imagej.net/Analyze; compare differences between two or more groups. A t-test the website for the Strahler cytoskeleton analysis plug-in is was used to analyze differences between the mean values of http://imagej.net/Strahler_Analysis#Root_Detection. two groups, and one-way ANOVA was used to analyze differences among more than two groups. ,e data are expressed as percentages and mean± standard deviation. 2.12. Nude Mouse Tumorigenicity Assay. MKN45 cells in the p< 0.05 are considered significant. control group and ARHGAP11A knockout group were prepared into cell suspension, and the cells were counted. 3. Results Twenty 4-week-old male nude mice were randomly divided into two groups, and the mice in each group were injected 3.1. ARHGAP11A Is Overexpressed in Gastric Cancer and Is subcutaneously with 5 ×10 cells. Tumor formation of nude Associated with Poor Outcomes in Gastric Cancer. First, we mice after injection was observed regularly every day. ,e performed gene expression profile analysis on 16 pairs of length and width of the tumors were measured with a gastric cancer and normal tissues and found that ARH- Vernier caliper, the tumor volume was calculated with GAP11A, a member of the RhoGAP family, showed a 2 3 equation V � L × W /2 mm , and a tumor growth curve was signficantly increased expression (Figure 1(a)). ,e mRNA drawn. At week 5, nude mice were anesthetized with 1% expression level of ARHGAP11A was higher in gastric sodium pentobarbital, necropsied, and photographed. ,e cancer tissues than in adjacent normal tissues experiment was approved by the Medical Ethics Committee (Figure 1(b)). of Lanzhou University Second Hospital. All animal exper- ,e expression of ARHGAP11A in various types of iments were carried out in accordance with Guidelines for cancer tissues was further analyzed in the GEPIA2 da- Ethical Review of Laboratory Animal Welfare of China. tabase (http://gepia.cancer-pku.cn/), and the mRNA levels of ARHGAP11A in 408 human gastric cancer samples and 211 normal gastric tissues were detected. ,e 2.13. Comprehensive IP Assays to Screen Interacting Proteins of results showed that ARHGAP11A was highly expressed in ARHGAP11A. Cells in each group were collected and lysed lung cancer, breast cancer, pancreatic cancer, esophageal with lysis buffer containing 1% protease inhibitor (1 ml: 1 M cancer, gastric cancer, and other types of cancers (Sup- Tris-HCl (pH-7.4) 50 μl, 1 M NaCl 150 μl, 0.5 M EDTA 2 μl, plementary Figure S1) and that the mRNA expression 10% TritonX-100 20 μl, and H O 778 μl). After centrifuga- level of ARHGAP11A was higher in gastric cancer tissues tion at 13000 rpm, 50 μl of the cell lysate supernatant was than in adjacent normal tissues (Figure 1(c)). Upregu- taken as the WCL. ,e remaining cell lysate was added to lation of ARHGAP11A was further verified by qRT-PCR 20 μl Flag gel beads and incubated with rotation at 4 C for analysis of gastric cancer/normal tissues (Figure 1(d)), 2 h. ,e gel beads were washed with 1 ml lysis buffer, Western blot analysis of 11 pairs of tissues (Figure 1(e)), centrifuged at 5000 rpm at 4 C for 3 min, and washed again 3 and immunohistochemical analysis of 432 pairs of times. 50 microliters of elution buffer (0.1 M Glycine, ad- samples in a gastric cancer TMA (Figures 1(f ) and 1(g)); justed with HCl to pH 3.5) was added. After incubation for the results were consistent with our previous conclusion 5 min and centrifugation at 8000 rpm for 3 min, the above obtained by bioinformatic analysis. To further explore elution steps were repeated for 4 times, a total of 200 μl whether the expression level of ARHGAP11A is corre- elution solution was obtained, and 24 μl of neutralization lated with the prognosis of gastric cancer patients, buffer (0.5 M Tris-HCl (pH 7.4), 1.5 M NaCl) was then Kaplan-Meier survival analysis was performed on the 432 added. A small amount of the sample was added to 5x SDS patients. ,e prognosis of the ARHGAP11A high-ex- loading buffer, and protein was denatured by boiling for pression group (n � 293) was worse than that of the 10 min. After centrifugation at 2500 rpm and 4 C for 1 min, ARHGAP11A low-expression group (n � 146) Western blot was performed. ,e remaining samples were (p � 0.0006, Figure 1(i)). ,is result shows that high frozen at -80 C and sent to Beijing Haiteng Biotechnology expression of ARHGAP11A is related to the poor Co., Ltd., for mass spectrometry analysis. prognosis of gastric cancer patients. ,e gastric cancer specimens were further studied according to different clinicopathological characteristics, 2.14. Coimmunoprecipitation. ,e experiment was per- and the correlations between the expression level of formed as described previously [10]. ,e cell processing ARHGAP11A and the clinicopathological characteristics of procedure was the same as that described above. Cells were different patients were explored by comparing the differ- eluted with 50 μl of elusion Buffer and centrifuged at ences of ARHGAP11A expression levels between the dif- 8000 rpm for 3 min; the supernatant was then transferred ferent groups. ,e results showed that the expression level of into a new EP tube, and then 6 μl of neutralization Buffer ARHGAP11A was closely related to tumor differentiation (0.5 M Tris-HCl (pH 7.4), 1.5 M NaCl) was added. ,en, 5x (p< 0.05, Figure 1(h) and Table 1) but was not significantly SDS loading buffer was added to the samples and boiled for correlated with age, sex, clinical stage, TNM stage, or other 10 min. After centrifugation at 2500 rpm for 1 min at 4 C, clinicopathological characteristics of the patients (p> 0.05; Western blot was performed. Table 2). Journal of Oncology 5 3.19 0.41 –2.38 3 CXCL3 EHF C15orf48 2 DEPDC1B MLF1IP 5 GDF15 TMEM139 EPB41L4B MMP7 KLK6 PLAU SERPINB5 TPX2 CCNB1 ARHGAP11A HMGB3 IGF2BP3 TRIB3 C20orf24 -1 LEPREL4 FGL2 NAP1L2 ZSCAN18 LAMA2 -2 HSPB8 MSRB3 Cancer Normal SYNPO2 FXYD6 PPP1R14A 0 ITIH5 MITF USP47 COL4A5 Tumor Normal RGMB (T=408) (n=211) RGN Normal Cancer (a) (b) (c) 20 #1 #2 #3 #4 40X 200X TN TNTNT N #5 #6 #7 #8 TTNN T NN T Cancer Normal #9 #10 #11 TT N NTN (d) (e) (f) * 400 P=0.0006 Gastric cancer Normal 0 10203040 50 60 Low High Time (months) ARHGAP11A expression ARHGAP11A-Low (n=146) Poorly ARHGAP11A-High (n=293) Moderately Well (g) (h) (i) Figure 1: Expression of ARHGAP11A in gastric cancer patients and its relationship with prognosis. (a) Bioinformatic analysis showed that ARHGAP11A was highly expressed in various types of cancer tissues. (b) ARHGAP11A expression was increased in gastric cancer tissues compared with normal tissues. (c) Gene chip analysis of the expression profile showed that ARHGAP11A was highly expressed in gastric cancer tissues. (d) qRT-PCR was used to detect the expression of ARHGAP11A mRNA in gastric cancer and normal tissues. (e) Western blot was performed to detect the expression of the ARHGAP11A protein in gastric cancer and normal tissues. (f ) Immunohistochemistry method detects weak and strong positive expression of ARHGAP11A in gastric cancer tissues. ,e scale bar indicates 200 μm. (g) Quantitative analysis of ARHGAP11A expression in gastric cancer and corresponding adjacent tissues after immunohistochemical staining by comparison of H scores. (h) Kaplan-Meier survival analysis was performed on 432 patients with gastric cancer. (i) Comparison of the number of gastric cancer patients with different differentiation levels in the high and low ARHGAP11A expression groups; the difference was statistically significant. p< 0.05. ARHGAP11A H-score ARHGAP11A mRNA level Normalized fold expression of ARHGAP11A Number of gastric cancer samples Overall Survival (%) Gastric cancer Gastric cancer (Strong) (Weak) Normal ARHGAP11A mRNA level 6 Journal of Oncology Table 2: Clinical correlation of ARHGAP11A expression in gastric cancer. ARHGAP11A expression Clinical characteristic Variable N χ2 p value Low High Male 331 110 221 Gender 0.037 0.908 Female 111 38 73 ≤50 113 37 76 Age (y) 0.037 0.908 >50 329 111 218 ≤5 317 112 205 Tumor size (cm ) 1.717 0.219 >5 125 36 89 Well 28 8 20 Tumor differentiation Moderate 238 95 143 9.676 0.008 Poor 176 45 131 I 79 26 53 II 166 52 114 Clinical stage 1.839 0.606 III 177 65 112 IV 20 5 15 T1 51 21 30 T2 79 30 49 T classification 2.914 0.405 T3 186 57 129 T4 126 40 86 N0 160 57 103 N1 89 37 52 N classification 5.699 0.127 N2 71 21 50 N3 122 33 89 M0 428 146 282 M classification 2.393 0.156 M1 14 2 12 Yes 372 124 248 Nerve and vascular invasion 0.024 0.891 NO 70 24 46 3.2. ARHGAP11A Promoted Gastric Cancer Cell Proliferation negative control MKN45 cells. After 4 weeks of culture, it In Vitro and In Vivo. AGS, MKN45, and HGC27 gastric was found that the tumors volumes and weights in the cancer cells were transduced with lentiviral vectors. After ARHGAP11A knockout group were significantly lower than puromycin screening, Western blot was performed to verify those in the control group (Figures 2(f)–2(h)), which was the knockout efficiency of the two targets KO1 and KO2 of consistent with the results of the in vitro cell proliferation ARHGAP11A. ,e results showed that the knockout effi- and EdU incorporation assays. Moreover, the expressions of ARHGAP11A and Ki-67 in tumor tissues were detected by ciency of KO1 was obvious, while the target of KO2 was invalid (Figure 2(a)). After successfully constructing immunohistochemistry. Tumors derived from ARH- ARHGAP11A knockout cell lines in AGS, MKN45, and GAP11A knockout cells exhibited much weaker staining of HGC27 cells using the KO1 target, we studied the effect of Ki-67 and ARHGAP11A (Figure 2(i)). ,erefore, we this gene on the proliferation of gastric cancer cells. ,e inferred that ARHGAP11A is closely related to the pro- High Content Analysis System was used to continuously gression of gastric cancer. observe and count the cells of these three lines in a 96-well plate, and the results showed that cell proliferation slowed down after ARHGAP11A knockout (Figure 2(b)). Consis- 3.3. ARHGAP11A Affects the Migration and Invasion Ability of Gastric Cancer Cells and Regulates Stress Fibers. tent with this finding, the results of colony formation assays To investigate the effect of ARHGAP11A expression on the showed that the number of colonies formed decreased after migration and invasion abilities of gastric cancer cells, ARHGAP11A knockout (Figure 2(c)). In addition, the wound-healing assays and Transwell invasion assays were proliferation ability of gastric cancer cells was evaluated by an EdU incorporation assay, and it was found that the used in this study. ,e results of the cell wound-healing assays showed that, compared with the control group, the proliferation of gastric cancer cells slowed down after ARHGAP11A knockout (Figures 2(d) and 2(e)). ,us, we ARHGAP11A knockout group had a poorer ability to repair the intercellular wound (Figures 3(a)–3(c)), indicating that concluded that ARHGAP11A can promote the proliferation of gastric cancer cells. ARHGAP11A has an effect on the migration ability of gastric cancer cells. ,e results of the Transwell invasion assay To further confirm the influence of the change in the ARHGAP11A expression level on tumor growth in vivo, we showed that the number of cells passing through the Matrigel-coated membrane in the ARHGAP11A knockout established a subcutaneous xenograft model in nude mice by group was significantly reduced compared with that in the subcutaneous injection of ARHGAP11A knockout and Journal of Oncology 7 MKN45 HGC27 AGS WT KO1 KO2 WT KO1 KO2 WT KO1 KO2 ARHGAP11A ARHGAP11A ARHGAP11A β-actin β-actin β-actin (a) HGC27 AGS MKN45 1500 1000 0 0 12 24 36 48 60 72 84 96 108 120 12 24 36 48 60 72 84 96 108 120 12 24 36 48 60 72 84 96 108 120 Time(h) Times(h) Times(h) WT WT WT KO-ARHGAP11A KO-ARHGAP11A KO-ARHGAP11A (b) WT KO-ARHGAP11A WT KO-ARHGAP11A 0.6 * HGC27 0.4 100 μm 100 μm AGS 0.2 0.0 100 μm 100 μm HGC27 AGS MKN45 MKN45 WT KO-ARHGAP11A 100 μm 100 μm (c) (d) HGC27 AGS MKN45 100 * 80 200 60 150 40 100 40 20 50 0 0 WT KO- WT KO- WT KO- ARHGAP11A ARHGAP11A ARHGAP11A (e) 0 3 6 9 12 15 18 Time(day) WT KO-ARHGAP11A (f) (g) Figure 2: Continued. MKN45 AGS HGC27 Cell number Number of clones Percentage of Edu-positive cells (%) Cell number Number of clones Number of clones Cell number Tumor volume (mm ) 8 Journal of Oncology * HE Ki67 ARHGAP11A 1.00 0.75 0.5 0.25 0.00 -0.25 -0.5 WT KO-ARHGAP11A (h) (i) Figure 2: ,e effect of ARHGAP11A on the proliferation of gastric cancer cells in vivo and in vitro. (a) Western blot verified the ARHGAP11A knockout efficiency. (b) ,rough continuous observation and counting of gastric cancer cells. It was found that the proliferation rate of ARHGAP11A knockout cells was significantly reduced. (c) Cell proliferation ability was evaluated by an EdU in- corporation assay, and it was found that the cell proliferation ability of gastric cancer cells with ARHGAP11A knockout was reduced. Scale bar: 100 μm. ((d) and (e)) Colony formation experiments showed that the proliferation ability of ARHGAP11A knockout cells was reduced. (f) Subcutaneous tumor growth in nude mice in the control group and ARHGAP11A knockout group. (g) Tumor volumes were measured every other day. (h) Tumor weights in the two groups. p< 0.05. (i) Representative images of tumor HE staining and Ki-67 and ARHGAP11A immunohistochemistry staining. Scale bar: 200 μm. control group (Figure 3(d)). ,ese findings show that Next, to identify the domain via which ARHGAP11A ARHGAP11A is involved in the invasion of gastric cancer interacts with TPM1, according to the predicted domains cells. Based on the above in vitro experimental results, it was of ARHGAP11A (Figure 4(f)) reported in the literature suggested that ARHGAP11A plays a role as a protooncogene [13], truncation mutants of ARHGAP11A 1–45, 46–246, 247–516, and 517–1024 were constructed, and the designed in the occurrence and development of gastric cancer, pro- motes tumor cell invasion and migration, and leads to primer sequences are shown in Table S2. An anti-Flag malignant tumor progression. antibody was used as “bait” for immunoprecipitation of Cell migration is powered by the continuous contraction TPM1, and the results showed that the domain of ARH- of stress fibers and the growth and extension of actin fila- GAP11A involved in its interaction with TPM1 was ments; thus, we further studied whether ARHGAP11A can 517–1024 (Figure 4(g)). induce stress fiber changes in gastric cancer cells. ,e results showed that the number of stress fibers in the ARHGAP11A knockout group was significantly reduced and that the stress 3.5. TPM1 Plays a Central Role in the Malignant Transfor- mation of Gastric Cancer Induced by ARHGAP11A. To fibers were slender (Figures 3(e) and 3(g)). Strahler analysis further confirm that ARHGAP11A promotes the invasion showed that, compared with the control group, the number and migration of gastric cancer through TPM1, TPM1 was of stress fiber branches, the length of the stress fibers, and the knocked out in AGS and HGC27 cells with stable and high degree of branching complexity were decreased significantly in the ARHGAP11A knockout group compared with the expression of ARHGAP11A (OE-GAP11A + KO-TPM1). Cells were divided into three groups: WT, OE-ARH- control group (Figures 3(f) and 3(h)), indicating that ARHGAP11A promotes cell migration by regulating stress GAP11A, and OE-GAP11A + KO-TPM1. We used wound- healing assays to evaluate the cell migration ability, and the fibers formation. results showed that ARHGAP11A overexpression pro- moted the migration ability of gastric cancer cells com- 3.4. ARHGAP11A Interacts with TPM1 in Gastric Cancer. pared with that of the WTcells (Figure 5(a)). ,e migration ARHGAP11A overexpression cell lines were generated with ability of OE-GAP11A + KO-TPM1 cells was significantly decreased compared with that of ARHGAP11A over- AGS, HGC27, and NCI-N87 cells, and the overexpression efficiency was verified by Western blot analysis (Figure 4(a)). expressing cells (Figures 5(b) and 5(c)). ,e invasion ability In AGS cells, protein-protein interactions were identified by of gastric cancer cells was further evaluated by Transwell mass spectrometry combined with bioinformatics analysis, assays, and similar conclusions were drawn. ,e invasion and it was found that the actin-binding protein TPM1 ability of OE-GAP11A + KO-TPM1 cells was significantly interacted with ARHGAP11A (Figures 4(b) and 4(c)). lower than that of the ARHGAP11A overexpressing cells TPM1, a member of the tropomyosin family, is a cytoskeletal (Figure 5(d)). ,e above findings show that ARHGAP11A’s protein that binds to actin in various cells [11]. TPM1 has ability to promote migration and invasion depends on increased functional complexity in nonmuscle cells, and its TPM1. main role is to stabilize the cytoskeleton [12]. ,e interaction Immunofluorescence staining was performed to detect between ARHGAP11A and TPM1 was confirmed in both the stress fibers labeled with Rhodamine-phalloidin in the WT, OE-ARHGAP11A, and OE-GAP11A + KO-TPM1 HEK293T and AGS cells by coimmunoprecipitation (Figures 4(d) and 4(e)). groups, and the results showed that the stress fibers exhibited Tumor weight (g) KO-ARHGAP11A WT Journal of Oncology 9 AGS HGC27 WT KO-ARHGAP11A WT KO-ARHGAP11A 0 h 0 h 48 h 48 h (a) AGS HGC27 * * WT KO- WT KO- ARHGAP11A ARHGAP11A (b) (c) WT KO-ARHGAP11A * AGS HGC27 WT KO-ARHGAP11A (d) AGS * 6000 2000 Merge F-actin Extracted skeleton Strahler analysis 4500 1500 3000 1000 0 0 WT KO- WT KO- ARHGAP11A ARHGAP11A 0 0 WT KO- WT KO- ARHGAP11A ARHGAP11A (e) (f) Figure 3: Continued. KO-ARHGAP11A WT Percentage of wound healing (%) HGC27 AGS Number of branches Number of total length Average invasion cells Percentage of wound healing (%) Number of trees Number of Junctions 10 Journal of Oncology HGC27 5000 Merge F-actin Extracted skeleton Strahler analysis 0 0 WT KO- WT KO- ARHGAP11A ARHGAP11A 0 0 WT KO- WT KO- ARHGAP11A ARHGAP11A (g) (h) Figure 3: ARHGAP11A promotes the invasion and migration of gastric cancer cells and affects the formation of stress fibers. (a, c) Wound-healing assay showed that ARHGAP11A promotes gastric cancer cell migration. Scale bar: 200 μm. (d) ,e Transwell assay showed that ARHGAP11A promotes gastric cancer cell invasion. Scale bar: 200 μm. (e) Strahler analysis of stress fibers in AGS cells. Stress fiber formation was inhibited in the ARHGAP11A knockout group. Scale bar: 50 μm. (f) Statistical analysis of the total length and the numbers of trees, branches, and junctions of stress fiber in AGS cells. (g) Strahler analysis of stress fiber in HGC27 cells. Scale bar: 50 μm. (h) Statistical analysis of the total length, as well as the numbers of trees, branches, and junctions of the stress fiber in HGC27 cells. p< 0.05. fluorescence in a filamentous pattern. Compared with those ,e cytoskeleton mainly consists of microfilaments, in the WT group, the number and length of stress fibers in microtubules, and intermediate filaments, and the main the OE-ARHGAP11A group was significantly increased, and component of microfilaments is actin [14]. In cells cultured the stress fibers were thicker. Strahler analysis showed that in vitro, there are a large number of stable and parallel microfilament structures on the inner side of the plasma the total length of the stress fibers and the numbers of trees, branches, and junctions in the OE-GAP11A group were membrane close to focal adhesion; these structures are called significantly higher than those in the WT group. Compared stress fibers and are composed of actin, myosin, tropomy- with the OE-GAP11A group, the OE-GAP11A + KO-TPM1 osin, and so forth [15]. ,e contractile force produced by the group had a simpler microfilament skeleton structure and a relative movement of actin and myosin is the main driver of reduced number of stress fibers (Figure 5(e) and Supple- cell migration. Studies have shown that, in addition to mentary Figure S2), suggesting that the function of ARH- contributing to cell migration and morphogenesis, stress GAP11A in regulating stress fiber formation is dependent on fibers also contribute to adhesion, mechanical conduction, TPM1. endothelial barrier integrity, and myofibril assembly [16]. In summary, TPM1 is an interacting protein of ARH- Our study showed that the number of cellular stress fibers GAP11A that plays a key role in the ARHGAP11A-induced was significantly reduced after ARHGAP11A knockout and that the invasion and migration abilities of the knockout malignant progression of gastric cancer. cells were significantly decreased, suggesting that ARH- GAP11A may be involved in the malignant transformation of cells by affecting the mechanism of stress fiber poly- 4. Discussion merization and depolymerization. ARHGAP11A is a member of the Rho GTPase-activating TPM1 is a member of the tropomyosin family and is a protein family, but its role in gastric cancer has not been cytoskeletal protein that binds to actin in a variety of cells elucidated, and the related mechanisms have not been [17]. TPM1 plays a role in the troponin complex, which thoroughly explored. In this study, we found that the ex- regulates the contraction of muscle cells in a calcium-de- pression of ARHGAP11A is positively correlated with a low pendent manner, while its functional complexity is increased degree of tumor differentiation and low survival rate of in nonmuscle cells, in which it mainly stabilizes the cyto- human gastric cancer patients. Further in vivo and in vitro skeleton [12]. It is reported that TPM1 is a new predictive analyses confirmed that the role of ARHGAP11A in gastric biomarker for gastric cancer diagnosis and prognosis [17]. cancer cells is to promote cell proliferation, migration, and Our study showed that ARHGAP11A can interact with invasion. ,e above data indicate that ARHGAP11A plays TPM1 in gastric cancer cells, thereby promoting gastric an important role in the malignant progression of gastric cancer progression by affecting the formation and stability of cancer. the actin filaments. KO-ARHGAP11A WT Number of branches Number of total length Number of trees Number of Junctions Journal of Oncology 11 HGC27 AGS NCI-N87 WT+WT+WT+ ARHGAP11A β-actin (a) (b) >tr|B7Z596|B7Z596_HUMAN Tropomyosin HEK293T HEK293T alpha-1 chain OS=Homo sapiens OX=9606 Flag-ARHGAP11A - + HA-ARHGAP11A + + GN=TPM1 PE=1 SV=1 HA-TPM1 + + Flag-TPM1 - + MAGSSSLEAVRRKIRSLQEQADAAEERAGTL Flag-5’GFP + - Flag-5’GFP + - QRELDHERKLRETAEADVASLNRRIQLVEEE LDRAQERLATALQKLEEAEKAADESERGMK IB:HA IB:HA VIESRAQKDEEKMEIQEIQLKEAK IP:Flag IP:Flag IB:Flag IB:Flag Flag-5’GFP Flag-5’GFP IB:HA IB:HA WCL WCL IB:Flag IB:Flag Flag-5’GFP Flag-5’GFP (c) (d) AGS RhoGAP domain globular domain 2 globular domain3 Flag-ARHGAP11A - + 1 46-246 387-516 590-997 1024 Flag-5’GFP + - IB:TPM1 IP:Flag IB:Flag Flag-5’GFP IB:TPM1 WCL IB:Flag Flag-5’GFP (e) (f) Flag-ARHGAP11A - Flag-ARHGAP11A - Flag-5’GFP + --- -- Flag-5’GFP + ----- HA-TPM1 + HA-TPM1 + +++ + + +++ + + IB:HA TPM1 IB:HA TPM1 WCL IP:Flag IB:Flag ARHGAP11A IB:Flag ARHGAP11A (g) Figure 4: ARHGAP11A interacts with TPM1 in gastric cancer cells. (a) Western blot analysis verified the overexpression efficiency of ARHGAP11A in gastric cancer cells. (b) Western blot detection after IP. (c) Matching peptides in ARHGAP11A and TPM1. (d) Left: Flag- tagged ARHGAP11A and HA-tagged TPM1 plasmids were co-transfected into HEK293T cells for 36 h followed by cell lysate preparation and IP assay with anti-Flag beads followed by immunoblotting with indicated antibodies. Right: HA-tagged ARHGAP11A and Flag-tagged TPM1 plasmids were cotransfected into HEK293T cells for 36 h followed by cell lysate preparation and IP assay with anti-Flag beads followed by immunoblotting with indicated antibodies. IP: immunoprecipitates, WCL: whole-cell lysates. (e) ,e interaction of ARH- GAP11A and TPM1 was tested in AGS cells. AGS cells overexpressing Flag-ARHGAP11A were lysed with cell lysate, followed by IP assay with anti-Flag beads followed by immunoblotting with indicated antibodies. (f) ARHGAP11A domain. (g) Analysis of the domain involved in the interaction between ARHGAP11A and TPM1. HEK293T cells were transiently cotransfected with plasmids expressing Flag-tagged of indicated ARHGAP11A mutant plasmids and HA-tagged TPM1 plasmids, followed by cell lysate preparation and IP assay with anti-Flag beads followed by immunoblotting with indicated antibodies. IP: immunoprecipitates, WCL: whole-cell lysates. wild-type 1-45 46-246 247-516 517-1024 Input Flag-GFP wild-type Flag- ARHGAP11A 1-45 46-246 247-516 517-1024 12 Journal of Oncology AGS NS AGS WT KO-TPM1 WT OE-ARHGAP11A OE-GAP11A+KO-TPM1 80 TPM1 β-actin 0 h HGC27 WT KO-TPM1 48 h TPM1 WT OE-ARHGAP11A OE-GAP11A+KO-TPM1 β-actin (a) (b) HGC27 NS HGC27 WT OE-ARHGAP11A OE-GAP11A+KO-TPM1 0 h 48 h WT OE-ARHGAP11A OE-GAP11A+KO-TPM1 (c) AGS HGC27 WT OE-ARHGAP11A OE-GAP11A+KO-TPM1 NS NS 1000 * * 800 * 0 0 WT WT OE-ARHGAP11A OE-ARHGAP11A OE-GAP11A+KO-TPM1 OE-GAP11A+KO-TPM1 (d) NS NS HGC27 * * * * Merge F-actin Extracted skeleton Strahler analysis 4000 6 3000 4000 2000 10 WT WT 2 OE-ARHGAP11A OE-ARHGAP11A OE-GAP11A+KO-TPM1 OE-GAP11A+KO-TPM1 NS NS 4 5000 0 400 3000 300 1000 100 0 0 WT WT OE-ARHGAP11A OE-ARHGAP11A OE-GAP11A+KO-TPM1 OE-GAP11A+KO-TPM1 (e) Figure 5: TPM1 is essential for cell invasion and migration induced by ARHGAP11A. (a) ,e overexpression efficiency of TPM1 was verified by Western blot analysis. (b) ,e cell migration ability of WT, OE-ARHGAP11A, and OE-ARHGAP11A + KO-TPM1 cells was evaluated by a wound-healing assay. (c) A Transwell assay was used to evaluate the invasion ability of WT, OE-ARHGAP11A, and OE- GAP11A + KO-TPM1 cells. Scale bar: 200 μm. (d) Detection of stress fibers in HGC27 gastric cancer cells. (e) Statistical analysis of the total length, as well as the number of trees, branches, and junctions of stress fibers in HGC27 cells. Scale bar: 50 μm. p< 0.05. OE-GAP11A+ HGC27 AGS KO-TPM1 OE-ARHGAP11A WT Average invasion cells Number of branches Number of total length Percentage of wound healing (%) Percentage of wound healing (%) Average invasion cells Number of trees Number of junctions Journal of Oncology 13 [2] S. Jansen, R. Gosens, T. Wieland, and M. Schmidt, “Paving the 5. Conclusion Rho in cancer metastasis: Rho GTPases and beyond,” Phar- macology & 'erapeutics, vol. 183, pp. 1–21, 2018. In summary, our research reveals the promoting role of [3] S. J. Heasman and A. J. Ridley, “Mammalian Rho GTPases: ARHGAP11A in the malignant development of gastric new insights into their functions from in vivo studies,” Nature cancer and identifies the mechanism by which ARH- Reviews Molecular Cell Biology, vol. 9, no. 9, pp. 690–701, GAP11A plays its role. As an oncogene in gastric cancer, ARHGAP11A is dependent on TPM1 to regulate cell stress [4] B. A. Humphries, Z. Wang, and C. Yang, “MicroRNA reg- fiber formation and stability and promote gastric cancer cell ulation of the small Rho GTPase regulators-complexities and proliferation, invasion, and migration, thus promoting opportunities in targeting cancer metastasis,” Cancers, vol. 12, gastric cancer progression. no. 5, 2020. [5] B. Fan, K. Ji, and Z. Bu, “ARHGAP11A is a prognostic biomarker and correlated with immune infiltrates in gastric Data Availability cancer,” Frontiers Molecular Biosciences, vol. 8, 2021. ,e data used to support the findings of this study are in- [6] X. Chen, D. Zhang, and F. Jiang, “Prognostic prediction using a stemness index-related signature in a cohort of gastric cluded within the article. cancer,” Frontiers Molecular Biosciences, vol. 7, 2020. [7] Y. Kagawa, S. Matsumoto, Y. Kamioka et al., “Cell cycle- Conflicts of Interest dependent Rho GTPase activity dynamically regulates cancer cell motility and invasion in vivo,” PLoS One, vol. 8, no. 12, ,e authors declare that they have no conflicts of interest. Article ID e83629, 2013. [8] C. D. Lawson, C. Fan, N. Mitin et al., “Rho GTPase tran- Authors’ Contributions scriptome analysis reveals oncogenic roles for Rho GTPase- activating proteins in basal-like breast cancers,” Cancer Re- Xiaoying Guan, Xiaoli Guan, and Junjie Qin contributed search, vol. 76, no. 13, pp. 3826–3837, 2016. equally to this work. Xiaoying Guan, Xiaoli Guan, and Junjie [9] X. Tian and Z. Zhang, “miR-191/DAB2 axis regulates the Qin developed the concept and the design and operated all tumorigenicity of estrogen receptor-positive breast cancer,” the in vitro and in vivo experiments. Long Qin and Wengui IUBMB Life, vol. 70, no. 1, pp. 71–80, 2018. Shi conducted the data collection and analysis. Zuoyi Jiao [10] J. Li, B. Zhang, and M. Liu, “KLF5 is crucial for androgen-AR signaling to transactivate genes and promote cell proliferation wrote and revised the manuscript. ,is manuscript was also in prostate cancer cells,” Cancers, vol. 12, no. 3, 2020. checked and revised by Xiaoying Guan, Xiaoli Guan, and [11] J. Lin, J. Shen, and H. Yue, “miRNA-183-5p.1 promotes the Junjie Qin. migration and invasion of gastric cancer AGS cells by tar- geting TPM1,” Oncology Reports, vol. 42, no. 6, pp. 2371–2381, Acknowledgments [12] S. V. Perry, “Vertebrate tropomyosin: distribution, properties ,is work was supported by Science and Technology Plan and function,” Journal of Muscle Research and Cell Motility, Project of Gansu Province (20JR5RA323), Lanzhou Science vol. 22, no. 1, pp. 5–49, 2001. and Technology Development Guiding Plan Project (2019- [13] J. Xu, X. Zhou, J. Wang et al., “RhoGAPs attenuate cell ZD-54), Health Industry Scientific Research Program of proliferation by direct interaction with p53 tetramerization Gansu Province (GSWSKY2020-78), and 2020 Talent In- domain,” Cell Reports, vol. 3, no. 5, pp. 1526–1538, 2013. [14] R. Suresh and R. J. Diaz, “,e remodelling of actin compo- novation and Entrepreneurship Project in Chengguan sition as a hallmark of cancer,” Translational Oncology, vol. 14, District, Lanzhou City (2020-2-11-8). no. 6, Article ID 101051, 2021. [15] S. Sugita, T. Adachi, Y. Ueki, and M. Sato, “A novel method Supplementary Materials for measuring tension generated in stress fibers by applying external forces,” Biophysical Journal, vol. 101, no. 1, pp. 53–60, Table S1: primer sequences of the stable transfection plasmid and transient transfection plasmid for ARHGAP11A. Table [16] S. Tojkander, G. Gateva, A. Husain, R Krishnan, and S2: primer sequences of truncation mutants for ARH- P Lappalainen, “Generation of contractile actomyosin bundles GAP11A. Figure S1: expression of ARHGAP11A in various depends on mechanosensitive actin filament assembly and cancers of the digestive system. p< 0.05. Figure S2: stress disassembly,” Elife, vol. 4, Article ID e06126, 2015. fibers in the WT, OE-ARHGAP11A, and OE- [17] L. Hu, L. Fang, and Z. P. Zhang, “TPM1 is a novel predictive GAP11A + KO-TPM1 groups of AGS gastric cancer cells. biomarker for gastric cancer diagnosis and prognosis,” Clinical Laboratory, vol. 66, no. 4, 2020. (A) Representative images of stress fibers in each group. Scale bars: 50 μm. (B) Statistical analysis of the total length, and the numbers of trees, branches, and junctions of stress fibers in AGS cells. p< 0.05 . (Supplementary Materials) References [1] S. SenGupta, C. A. Parent, and J. E. Bear, “,e principles of directed cell migration,” Nature Reviews. Molecular Cell Bi- ology, vol. 22, no. 8, pp. 529–547, 2021.
Journal
Journal of Oncology – Hindawi Publishing Corporation
Published: Dec 6, 2021