Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil

Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and... Hindawi Advances in Virology Volume 2019, Article ID 5697573, 10 pages https://doi.org/10.1155/2019/5697573 Research Article Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil 1 1 1 1 Marina Carrara Dias, Bruna Stuqui, Paola Jocelan Scarin Provazzi, C-ntia Bittar , 1 1 1 Natália Maria Candido, Renata Prandini Adum de Matos, Rodolfo Miglioli Badial, 1 2 3 Caroline Measso do Bonfim, Patricia Pereira dos Santos Melli, Silvana Maria Quintana, 4 1 1 José Antônio Cordeiro, Paula Rahal , and Marilia de Freitas Calmon Institute of Biosciences, Letters and Exact Sciences of Sa˜o Paulo State University, Sao ˜ Jos´e do Rio Preto, SP, Brazil Clinical Hospital of Faculty of Medicine of Ribeirao ˜ Preto, Sa˜o Paulo University, Ribeirao ˜ Preto, SP, Brazil Faculty ofMedicine ofRibeirao ˜ Preto, Sa˜o Paulo University, Ribeirao ˜ Preto, SP, Brazil ˜ ´ Faculty of Medicine of Rio Preto, Sao Jose do Rio Preto, SP, Brazil Correspondence should be addressed to Marilia de Freitas Calmon; macal131@gmail.com Received 27 September 2018; Revised 27 February 2019; Accepted 17 March 2019; Published 2 May 2019 Academic Editor: Jay C. Brown Copyright © 2019 Marina Carrara Dias et al. is Th is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Condyloma acuminata (CA), or genital warts, are benign proliferative epidermal or mucous lesions that are caused by infection with human papillomavirus (HPV), mainly the low-risk types 6 and 11. HPV variants are defined as viral sequences that share identity in the nucleotide sequence of the L1 gene greater than 98%. Based on this criterion, HPV6 and 11 variant lineages have been studied, and there are ongoing attempts to correlate these genetic variants with different clinical findings of infection. Therefore, the aims of this study were to detect variants and nucleotide alterations present in the E6 regions of HPV types 6 and 11 found in CA samples, to correlate the HPV presence with the clinical-pathological data of the patients, and to determine phylogenetic relationships with variants from other places in the world. eTh E6 regions of 25 HPV6 samples and 7 HPV11 samples from CA were amplified using PCR with specific primers. eTh products were ligated to a cloning vector and vfi e colonies of each sample were sequenced to observe the nucleotide alterations. Twelve samples were identified as the HPV6B3 variant, presenting the mutation (guanine) G474A (adenine), and one of them also showed the mutation (thymine) T369G. The other 13 patients were positive for HPV6B1 without nucleotide alterations. In the analysis of the HPV11 samples, all patients showed the mutations T137C and (cytosine) C380T. One patient also presented the nucleotide alteration T410C. None of the mutations found in the 32 analyzed samples resulted in amino acid changes. Patient age, local occurrence, and HIV infection did not show significant association with HPV infection. Besides, the data found in this study did not show a relationship with the geographical region of isolation when compared to other data from different regions of the world. In this way, despite the nucleotide alterations found, it was not possible to observe amino acid changes and variants grouping according to geographical region. 1. Introduction papillomavirus (PV) infections, are observed in animals, including cetaceans [2, 3], monkeys [4], and humans [5, 6]. In Condyloma acuminata (CA), or genital warts, are benign pro- humans, CA is one of the most common sexually transmitted liferative epidermal or mucous lesions. Classical histopatho- diseases; interestingly, gender bias has been associated with logical features of CA were recognized long ago and are human papillomavirus 11 (HPV11) genital warts, whereby the characterized by acanthosis, papillomatosis, hyperkeratosis, proportion of HPV11 genital warts is three times higher in parakeratosis, and koilocytosis [1]. These lesions, related to males than in females [7]. CA is caused by infection with 2 Advances in Virology human papillomavirus (HPV), mainly the low-risk types 6 HPV infection and persistence, leading to the development and 11, though coinfections with high-risk HPV types can also of HPV-associated lesions [33, 34]. The immune response occur [8–10]. has an important role in the elimination of many HPV infections. However, some infections cannot be eliminated Papillomaviruses are circular, double-stranded DNA viruses consisting of an icosahedral capsid 52-55 nm in and persist for many years, which is an additional risk diameter and with a genome length of 8 kb [11]. These factor for cancer development [35]. Individuals infected with human immunodeficiency virus (HIV) are more susceptible viruses are classified in the Papillomaviridae family, which is characterized by large amounts of genetic diversity [12, 13]. to HPV infection. Deficiency in immune cells due to HIV There are currently more than 200 HPV types identiefi d. The infection results in instability of the immune system that viruses can infect the squamous epithelium of the skin or the should combat high- and low-risk HPVs, which facilitates genital and oral mucosa [14–16]. Mucosal HPVs are classified virus persistence and lesion progression [36–38]. Therefore, our aims were to evaluate E6 early gene according to their oncogenic potential: they could be high- risk, such as types 16 and 18, which are involved in oral, genital variability among HPV6 and HPV11 detected in CA samples penile, anal and cervical carcinomas [17–21]; or low-risk, such obtained from a cohort of Brazilian patients and to correlate them with the clinical-pathologic data. We also conducted as types 6 and 11, which are present in genital and anal warts and recurrent respiratory papillomatosis [22]. phylogenetic analysis to compare nucleotide sequences iden- Former studies evaluating the genetic variation of the tified in our study with isolates previously described from other parts of the world. long control region (LCR) and E6 regions used standard reference genomes for comparative purposes [23–25]. These standard reference genomes for HPV6 are denoted as pro- 2. Materials and Methods totypic HPV6b, nonprototypic HPV6a and HPV6vc, and 2.1. Clinical Samples. Ethical permission was obtained from one standard reference genome for HPV11. However, a study the Research Ethics Committee of the Institute of Biosciences, based on phylogenetic analysis of complete genomes derived Letters and Exact Sciences of Sao ˜ Paulo State University, in from published HPV6 and HPV11 variants proposed a new the city of Sao ˜ Jose´ do Rio Preto, with the license number standard nomenclature for HPV6 and HPV11 [26]. Two 1.529.236. deeply separate clades were observed for HPV6. The lineage A This study evaluated 25 samples positive for HPV6 and is formed by the reference genome HPV6b and the lineage B 7 samples positive for HPV11. The 32 samples were isolated formed by the HPV6a, HPV6vc, and CAC301 sequences, cor- from biopsies obtained from surgical sections of genital and responding to HPV6B3, HPV6B2, and HPV6B1 sublineages, perianal lesions from female patients attended at the Clinical respectively. The nomenclature proposed for the HPV11 Hospital of the University of Sao ˜ Paulo Medical School lineage is based on two clades, referred to as sublineage A1, in Ribeirao ˜ Preto. The patient age ranged from 16 to 78 which includes variants clustering with the HPV11 reference years, with a median age of 26 years. The local occurrence genome, and sublineage A2, which includes all other variants. percentages of lesions in the analyzed patients were 50% in Aggressiveness differences between HPVs 6 and 11 and the genital region and 34.4% in the perianal region; 15.6% of between different cases of the same genotype could be related samples showed no information (Table 1). to intratypical genetics variants [27]. Several studies are trying to correlate these genetic alterations with biological and biochemical properties in an attempt to identify possible 2.2. HPV Genotyping. The DNA from these samples was differences in the clinical-pathological characteristics of the extracted using a phenol chloroform protocol [39], and the disease [28]. DNA integrity was evaluated via𝛽 -globin gene amplification, Seedat et al. found duplications in the HPV6 LCR that generating a 315-bp amplicon [40]. To amplify the human could result in enhanced promoter activity. u Th s, the dupli- papillomavirus DNA present in these lesions, we used poly- cation may cause an increase in the oncogenic potential of merase chain reaction (PCR) to target the L1 region of HPV. HPV6 variants ascribed to overexpression of E6 and E7 [29]. The reactions were processed in two amplification steps: in On the other hand, Flores-Dıaz et al. did not observe an the rfi st reaction, PGMy09 and PGMy11 oligonucleotides association of specific HPV11 variants with clinical disease. (Supplementary Table 1) were used to generate a 450-bp These could be explained by the higher conservation of amplicon. The amplification mix consisted of 2.5 U of Taq HPV11 compared to HPV6 [30]. DNA Polymerase (Sinapse Inc., Florida, USA), 2.5𝜇 lof 10X The analysis of HPV diversity is important for future PCR Buffer, 5.6 𝜇 MMgCl , 0.2 mM dNTPs, 0.4 𝜇 Mof vaccine strategies and to estimate the vaccine success in each primer, 500 ng of DNA, and nuclease free water, all immunocompromised individuals [31]. of which added up to a n fi al volume of 25.0 𝜇 l. An initial HPV infection could be associated with some risk factors, denaturation step at 95 C for 9 min was conducted, followed ∘ ∘ ∘ such as high numbers of sexual partners, early age at start by 40 cycles at 95 Cfor 1min, 55 Cfor 1min,and 72 C of sexual activity, tobacco smoking, number of pregnancies, for 2 min and a final extension at 72 Cfor 5 min.In the alcohol, and previous sexually transmitted diseases (STDs) nested PCR, GP5+ (5 -TTTGTTACTGTGGTAGATACTAC- 󸀠 󸀠 󸀠 [32]. For example, tobacco, which contains nicotine, the 3 )and GP6+ (5 -CTTATACTAAATGTCAAATAAAAA-3 ) main immunosuppressive constituent of cigarette smoke, has oligonucleotides were used to generate 150-bp amplicfi ation deleterious effects on systemic and local immunity, suppress- product. The amplicfi ation mix consisted of 2.5 U of Taq ing immune responses and increasing the susceptibility to DNA Polymerase (Sinapse Inc., Florida, USA), 2.5𝜇 lof 10X Advances in Virology 3 Table 1: Characterization of the 32 samples regarding to the factors age, lesion, HIV coinfection, alcohol consumption, and tobacco smoking. Age HIV viral load (HIV-1 Sample Condyloma HPV type HIV Alcohol consumption Tobacco smoking (Years) RNA copies/ml) BR CA26 A2 -HPV11 Neg 51 < 50 - No BR CA13 B1 Perianal HPV6 Neg 26 < 50 No No BR CA01 B3 42 -HPV6 Neg < 50 No Yes BR CA27 A2 Genital HP11 Pos 49 11543 Yes Yes BR CA02 B3 Genital HPV6 Neg 22 < 50 - No BR CA03 B3 Perianal HPV6 Neg 50 < 50 No Yes BR CA14 B1 Perianal HPV6 Neg 20 < 50 Yes No BR CA28 A2 Genital HPV11 Neg 39 < 50 No No BR CA15 B1 Perianal HPV6 Neg 37 < 50 No No BR CA16 B1 -HPV6 Neg 24 < 50 - - BR CA29 A2 Genital HPV11 Pos 26 18656 Yes Yes BR CA04 B3 Genital HPV6 Neg 42 < 50 No No BA CA17 B1 -HPV6 Neg 78 < 50 No No BR CA05 B3 Genital HPV6 Neg 21 < 50 No No BR CA18 B1 Genital HPV6 Neg 21 < 50 No No BR CA06 B3 Genital HPV6 Pos 45 20657 No Yes BR CA30 A2 Genital HPV11 Pos 29 25678 - Yes BR CA32 A2 Genital HPV11 Pos 29 22980 - Yes BR CA07 B3 -HPV6 Pos - 15000 - - BR CA08 B3 Perianal HPV6 Pos 39 35678 - - BR CA31 A2 Perianal HPV11 Neg 22 < 50 - BR CA19 B1 16 Genital HPV6 Neg < 50 No No BR CA09 B3 Genital HPV6 Neg 23 < 50 No Yes BR CA10 B3 Genital HPV6 Neg 21 < 50 - - BR CA20 B1 Perianal HPV6 Neg 53 < 50 - Yes BR CA11 B3 24 Perianal HPV6 Neg < 50 - - BR CA12 B3 Genital HPV6 Neg 21 < 50 No No BR C21 B1 Genital HPV6 Neg 33 < 50 - BR C22 B1 Genital HPV6 Neg 19 < 50 No No BR C23 B1 19 Perianal HPV6 Neg < 50 No No BR C24 B1 Perianal HPV6 Neg 27 < 50 - - BR C25 B1 Perianal HPV6 Neg 17 < 50 No No subtitle:-: lack of information;Neg:negative;Pos:positive. PCR Buffer, 7.6 𝜇 Mmagnesium chloride (MgCl , 0.064 mM specicfi primers (HPV6: F: 5 GGGGGATCCGAATTCATG- 2) 󸀠 󸀠 deoxynucleotides (dNTPs), 0.48𝜇 Mof each primer,5.0𝜇l GAAAGTGCAAATGC 3 and R: 5 GGAAGACATGTT- 󸀠 󸀠 of the product from the PGMy09 and PGMy11 reaction, and ACCCTAGGATCCAAGCTTCAC 3 ; HPV11: F: 5 AAA- 󸀠 󸀠 nuclease free water, all of which added up to a final volume ATTAGCAGACGAGGCATT 3 and R: 5 AGATGAGGT- ∘ 󸀠 of 25.0𝜇 l. An initial denaturation step at 95 Cfor 9min was GGACAAGGTGG 3 ) [42]. The amplicfi ation mix consisted ∘ ∘ conducted, followed by 40 cycles at 94 Cfor 30seconds, 45 C of 6.0 U of a proofreading polymerase (High Fidelity Enzyme for 30 seconds and 72 C for 30 seconds, and a final extension Mix, Fermentas, Vilnius, Lithuania), 5.0 𝜇 lof 10X High at 72 C for 8 min. Purified products were sequenced via the Fidelity PCR Buffer, 1.5 mM MgCl , 0.24 mM dNTPs, 0.4𝜇 M Sanger method using the primers PGMy09/11 and GP5+/6+ of each primer, 500 ng of DNA, and nuclease free water, all [41]. of whichadded uptoafinal volume of50.0 𝜇 l. An initial denaturation step at 95 C for 5 min was conducted, followed ∘ ∘ ∘ 2.3. E6 Amplicfi ation and Cloning. For nucleotide variability by 35 cycles at 95 Cfor 1min, 55 Cfor 1 min,and 72 Cfor 2 analysis, the complete E6 gene sequences of HPV6- and min and a final extension at 72 C for 8 min. The amplification HPV11-positive samples were amplified using PCR with products were 467 bp for HPV6 E6 and 569 bp for HPV11 E6. 4 Advances in Virology To obtain more reliable sequencing data, the ampliefi d of France Bioinformatics Laboratories (http://www.atgc- E6 region from each patient was ligated to the pJET1.2/blunt montpellier.fr/phyml/) [46]. The substitution models were cloning vector of the Clone JET PCR Cloning Kit (Thermo calculated for both HPV types (6 and 11) using jModel Test software [47]. Bootstrapping of 1000 replicates was used to Scientific, Massachusetts, USA) following the manufac- turer’s instructions. The cloned products were transformed calculate branch support. Values over 70% were considered [43] into chemically competent DH5𝛼 Z Escherichia coli significant. (Zymo Research, California, USA) via the thermal shock 2.7. Statistical Analysis. The Kruskal-Wallis test was used to method. Aeft r transformation, bacteria were spread onto Petri plates containing solid Luria-Bertani (LB) medium and determine if there were significant associations between HPV presence and HIV viral load and between HPV presence 0.1 mg/mL of ampicillin. Samples were incubated at 37 C for 16 hours. Subsequently, five colonies of each sample and patient age. The HIV viral load of the samples was determined by the branched-chain DNA assay (Versant were selected and incubated in liquid LB medium with HIV RNA test, Version 3.0, lower limit of quantification 0.1 mg/mL of ampicillin at 37 Cfor 16 hoursand shak- 50 copies/ml; Siemens Healthcare, Erlangen, Germany) and ing at 250 rpm. After bacterial growth, the plasmid DNA values above 50 HIV-1 RNA copies/ml were considered was extracted using the GeneJET Plasmid Miniprep Kit HIV-positive. p-values<0.05 were considered as statistically (Fermentas,Vilnius,Lithuania) following the manufacturer’s significant. instructions. The Pearson Chi-Square, Likelihood Ratio Chi-Square, and Fisher’s exact tests were employed to identify the asso- 2.4. Nucleotide Alteration Detection. Puriefi d products were ciation of HPV infection with the risk factor (HIV pres- sequenced via the Sanger method using cloning vector ence). These tests were also used to analyze the associations primers (pJET1.2 Forward Sequencing Primer: 5 CGA- between nucleotide alterations and the anatomical location CTCACTATAGGGAGAGCGGC 3 and pJET1.2 Reverse of the lesions. p-values<0.05 were considered as statistically Sequencing Primer: 5 CTGCCATGGAAAATCGATGTT- significant. CTT 3 ). 3. Results 2.5. Datasets and Sequence Analysis. Sequence quality was evaluated using the Electropherogram Quality Analysis 3.1. Clinical Characteristics. Regarding the age factor, 61.3% program, available online at<http://asparagin.cenargen.em- of patients were between 16 and 29 years old, and 38.7% were brapa.br/phph/>. Comparisons between the sequences ac- more than 30 years old. However, neither patient age nor quired and those previously added to GenBank were con- local occurrence was significantly associated with HPV6 or ducted using BLAST (Basic Local Alignment Search Tool, HPV11 presence. Related to the risk factors, HIV was detected available at<http://www.ncbi.nlm.nih.gov/BLAST>). in 21.9% of patients, and statistical analysis did not show All sequences were edited using the BioEdit 7.0.9.0 significant association between HPV and HPV coinfection. package to remove vector fragments and to analyze solely It was not possible to perform statistical analysis on HPV the complete sequence of the E6 gene. The alignment infection, alcohol consumption, and tobacco smoking due to between the prototype sequence HPV6A (accession number: missing patient data. X00203), nonprototype sequences HPV6B1 (accession num- ber: AF092932), HPV6B2 (accession number: FM875941), 3.2. Nucleotide Alteration Detection and HPV6B3 (accession number: L41216), HPV11A1 refer- ence sequence (accession number: M14119) and HPV11A2 3.2.1. HPV6. After sequence analysis of the 25 HPV6 sam- (accession number: FN870447), and the sequences obtained ples, it was noted that 12 (48%) samples belong to the in this study was performed using the CLUSTAL W sowa ft re HPV6B3 (L42216) variant and that all of these samples nested in the BioEdit 7.0.9.0 package [44, 45]. presented the G474A mutation compared to the proto- The sequences generated in this study were submitted to type E6 sequence. Moreover, sample BR CA06 B3 showed GenBank; the accession numbers are listed in Supplementary one more nucleotide alteration in position 369 of the Table 2. genome, consisting of a change from T to G (Table 2). To perform the phylogenetic analysis, datasets were The other 13 (52%) HPV6 samples belong to the HPV6B1 assembled, including the nucleotide sequences generated in (AF092932) variant and did not show additional nucleotide this study, the reference sequences, and other sequences alterations. available on GenBank for each HPV type. The HPV6 and Modeltest was performed to determine the best substitu- HPV11 datasets consist of 184 and 101 nucleotide sequences, tion model for phylogenetic reconstruction. The substitution respectively, both with 453 residues. The GenBank accession model selected for the HPV6 dataset was Tamura-Nei + I + G numbers of all of the sequences are presented in Supplemen- (TrN + I +G). A maximum likelihood phylogenetic tree was tary Table 3. reconstructed using PhyML based on the selected model with a bootstrap of 1000 replicates. 2.6. Phylogenetic Analysis. Phylogenetic trees were recon- The phylogenetic tree obtained from the analysis was structed with the Maximum Likelihood method using the splitintotwo main branches, withstrong branchsupport PhyML program through the ATGC platform from the South (Figure 1). One branch, with a bootstrap of 92, grouped Advances in Virology 5 Table 2: Nucleotide alterations in the E6 genes of HPV6 isolates. Genomic positions are indicated in the upper part of the table, and the mutations are vertically indicated. Conserved nucleotides in relation to the reference sequence are shown in gray. eTh column “Number of samples” indicates the number of patients in which the isolates are identical to the specified variant. Nucleotide positions HPV6 samples Number of samples B3 ref T G BR CA01, BR CA02, BR CA03, BR CA04, BR CA05, BR CA07, BR CA08, BR CA09, A11 B3 BR CA10, BR CA11, BR CA12 BR CA06 G A 1 B1 ref T A BR CA13, BR CA14, BR CA15, BR CA16, B1 BR CA17, BR CA18, BR CA19, BR CA20, BR C21, 13 BR C22, BR C23, BR C24, BR C25 Table 3: Nucleotide alterations in the E6 genes of HPV11 isolates. Genomic positions are indicated in the upper part of the table, and the mutation is horizontally indicated. The column “Number of samples” indicates the number of patients in which the isolates are identical to the specified variant. Nucleotide sample HPV 11 sample 410 Number of samples A2 (LP19-FN 870447) T BR CA28 C 1 the HPV6A prototype sequence with the isolates related isolates from other studies (Figure 2). The second branch to this variant. The other branch, also with a bootstrap grouped the HPV11A2 sequences from this study and the of 92, grouped all HPV6B variants and was divided into Brazilian, Slovenian, and Australian isolates. u Th s, it was two secondary branches. One secondary branch included observed that sequences did not group according to either the HPV6B3 sequences, including 12 sequences from this the geographical region from which they were isolated or the study together with the reference sequence. The second anatomical site of detection. branch included the HPV6B1 and HPV6B2 sublineages. The 13 sequences from this study grouped in a monophyletic 4. Discussion branch, with no branch support, with the HPV6B1 sublineage reference sequence and related sequences available in the The HPV11 E6 and E7 proteins play important roles in literature. u Th s, the sequences did not group according to ensuring a productive viral life cycle, facilitating episomal either geographical regions or the anatomical site of infection. maintenance of the viral genome [48]. Mutations in these regions may cause differences in the infection potential of 3.2.2. HPV11. Analysis of seven HPV11 samples revealed that the virus [31], possibly due to the different interactions of the all samples belong to the HPV11A2 variant but only the virus with host cellular mechanisms that may modulate its sample BR CA28 A2 showed the nucleotide alteration T410C clinical course [31]. (Table 3) compared to the sequence LP19 (accession number: In this study, 12 CA samples belong to the HPV6B3 FN870447) classified as HPV11A2 by Burk et al., 2011 [26]. variant, and all of them had a nucleotide alteration in position None of the mutations in the 32 analyzed samples resulted in 474 of the HPV genome. This mutation was also found in amino acid changes. Australian anogenital samples [49] and in Brazilian recurrent Modeltest was used to determine the best substitution respiratory papillomatosis samples [42]. In contrast, the model for phylogenetic reconstruction, and the HKY model nucleotide alteration at position 369 in the virus genome was selected. A maximum likelihood phylogenetic tree was observed in our study was not observed in both studies. Despite the nucleotide substitutions detected in the E6 reconstructed using PhyML based on the selected model with a bootstrap of 1000 replicates. sequence, amino acid changes were not observed in our study. The phylogenetic tree segregated into two main branches. Although the differences between the variants have been One of them, with a bootstrap of 86, contained the HPV11A1 small, the HPV6B1 variant was slightly more frequent in this prototype sequence (M14119), the LZod45 variant, and study. These data corroborate the report that HPV6B1 is the 92 6 Advances in Virology 0.003 Figure 1: Unrooted maximum likelihood phylogenetic tree for HPV6 variants reconstructed based on a dataset of 184 nucleotide sequences of 453 residues with the TrN + I +G substitution model and a bootstrap of 1000 replicates. Values above 70% were considered significant. (African variants: AF; Australian variants: AUS; Brazilian variants: BR; Slovenian variants: SL.) Red: HPV6A; green: HPV6B1; purple: HPV6B2; blue: HPV6B3. Sequences in black are HPV6B that cannot be classified into sublineages. several anatomical sites are not correlated to the place from most common variant in recurrent respiratory papillomatosis and genital warts [23, 42, 49]. This variant was highly which sample was isolated [23, 42, 48, 53]. We suggest that conserved in genital lesions analyzed in this study since there is no association between the anatomical site of lesions it did not show any nucleotide alteration. One CA sample and the HPV6 and HPV11 variants. Unlike this, Jelen et al. from this study that was HPV11-positive showed alteration [54] observed an association of sublineages B1 and B3 with in relation to the HPV11A2 sequence (accession number: FN anogenital infections. The relation between anogenital lesions FN870447). Nucleotide alteration at position 410 of the virus and sublineage B1 was also found by Danielewski et al. [49]. genome was found in recurrent respiratory papillomatosis More studies will be necessary to analyze the influence [42]. However, this alteration did not result in amino acid of HPV intratypic genetic variants on the increased risk of changes. The presence of HPV11 variants instead of prototype carcinogenic development [55]. Data observed in the present sequences has also been observed in other studies [23, 42]. study and in theliteratureindicatethat types and variants of papillomavirus identicfi ation and risk factor correlations Different sublineages of the same HPV genotype could result in alterations in viral infection persistence and the progres- could be useful for risk analysis and lesion management sion of precursor lesions and could also affect viral assembly, strategies. the immune response, pathogenicity, and p53 degradation Risk factors for HPV infections could include genital [50]. contact, early age at the start of sexual activity, number of life- In the phylogenetic analysis, it was not possible to time sexual partners, previous sexually transmitted diseases, observe the genomic variant distribution according to the tobacco smoking, and alcohol consumption [34]. Evasion geographical region from which the virus was isolated, as of the immune response to HPV is critical for a successful observed with HPVs 16 and 18. These two types of HPV infection [35]. Women infected with HIV have a higher risk to originated and speciated in Africa and then spread and facilitate HPV persistence and a reduced capacity to control diversified through human migrations. us, Th variants are the oncogenic viral processes [56]. However, in the present study we did not observe a significant association of HPV dieff rent in several geographical locations [51, 52]. In contrast togenotypes16and 18, previousstudiesand thisstudy suggest and HIV coinfection corroborating a study conducted in that the genomic diversities of HPV6 and 11 isolated from Africa with men whereupon low-risk HPV was not associated Advances in Virology 7 0.0 Figure 2: Unrooted maximum likelihood phylogenetic tree for HPV11 reconstructed based on a dataset of 101 nucleotide sequences of 453 residues with the TrN + I +G substitution model and a bootstrap of 1000 replicates. Values above 70% were considered significant. (Australian variants: AUS; Brazilian variants: BR; Slovenian variants: SL.) Red: HPV11A1; blue: HPV11A2. with HIV incidence [57]. Regarding the age factor, 61.3% did not present nucleotide alterations. T410C alteration was of the patients were between 16 and 29 years old; the other found in one of the HPV11 samples. Phylogenetic analysis patients were more than 30 years old. The lower occurrence showed no association between geographical or anatomical of HPV in older women could be due to infection elimination site of HPV detection and HPV6 or HPV11 variants. and natural immunity. However, this decrease could also be related to the increase in safe sexual behavior among older Abbreviations women [58]. The statistical analysis in this study revealed no G: Guanine association between HPV persistence and patient age, a result A: Adenine that was also observed in cervical samples [59]. T: yTh mine C: Cytosine 5. Conclusion CA: Condyloma acuminata In the present study, it was possible to observe 12 HPV6B3 HPV: Human papillomavirus variants, all of which presented the G474A mutation. One HIV: Human immunodeficiency virus HPV6B3 sample also showed the T369G mutation. The other PV: Papillomavirus HPV6 samples were determined to be HPV6B1 variants and STD: Sexually transmitted disease 86 8 Advances in Virology PCR: Polymerase chain reaction Obstetrical & Gynecological Survey, vol.33, no. 3,pp.198–200, MgCl :Magnesiumchloride 1978. dNTPs: Deoxynucleotide [2] G.D. Bossart,S.Ghim, M. Rehtanzet al., “Orogenital Neoplasia LB: Luria-Bertani in Atlantic Bottlenose Dolphins (Tursiops truncatus),” Aquatic BLAST: Basic local alignment search tool. Mammals,vol. 31, no.4, pp. 473–480, 2005. [3] A. Rector, H.Stevens,G.Lacave et al.,“Genomic characteriza- tion of novel dolphin papillomaviruses provides indications for Data Availability recombination within the Papillomaviridae,” Virology,vol. 378, no. 1, pp. 151–161, 2008. “Sequence” data that support the findings of this study [4] K. O’Banion, J. P. Sundberg, A. L. Shima, and M. Reichmann, have been deposited in GenBank with the accession codes “Venereal Papilloma and Papillomavirus in a Colobus Monkey “MF375424”, “MF375425”, “MF375426”, “MF375427”, (Colobus guereza),” Intervirology, vol.28, no. 4,pp. 232–237, “MF375428”, “MF375429”, “MF375430”, “MF375431”, “MF375432”, “MF375433”, “MF375434”, “MF375435”, [5] D. J. Ingles, C. M. Pierce Campbell, J. A. Messina et al., “Human “MF375436”, “MF375437”, “MF375438”, “MF375439”, papillomavirus virus (HPV) genotype- and age-specific analy- “MF375440”, “MF375441”, “MF375442”, “MF375443”, ses of external genital lesions among men in the hpv infection “MF375444”, “MF375445”, “MF375446”, “MF375447”, in men (HIM) study,” eTh Journal of Infectious Diseases , vol. 211, “MF375448”, “MF375449”, “MF375450”, “MF375451”, no. 7, pp. 1060–1067, 2015. “MF375452”, “MF375453”, “MF375454”, and “MF375455”. [6] K.P.Maniar,B.M.Ronnett,R. Vang,and A.Yemelyanova, “Coexisting High-grade Vulvar Intraepithelial Neoplasia (VIN) Ethical Approval and Condyloma Acuminatum: independent lesions due to dif- ferent HPV types occurring in immunocompromised patients,” All procedures performed in studies involving human partic- The American Journal of Surgical Pathology , vol.37, no.1,pp. 53– ipants were in accordance with the ethical standards of the 60, 2013. institutional and/or national research committee and with [7] K.F.Komloˇs, B.J. Kocjan,P.Koˇsorok et al., “Tumor-specific the 1964 Helsinki declaration and its later amendments or and gender-specific pre-vaccination distribution of human comparable ethical standards. papillomavirus types 6 and 11 in anogenital warts and laryngeal papillomas: A study on 574 tissue specimens,” Journal of Medical Consent Virology,vol.84,no.8,pp. 1233–1241, 2012. [8] S.Garland,M.Steben, H. Sings etal.,“Naturalhistory of genital Informed consent was obtained from all individual partici- warts: analysis of the placebo arm of 2 randomized phase III pants included in the study. trials of a quadrivalent human papillomavirus (types 6, 11, 16, and 18) vaccine,” eTh Journal of Infectious Diseases , vol.199,no. 6, pp. 805–814, 2009. Disclosure [9] B. Leo ´ nard, F. Kridelka, K. Delbecque et al., “A clinical All authors consent for publication. and pathological overview of vulvar condyloma acuminatum, intraepithelial neoplasia, and squamous cell carcinoma,” Bi- Conflicts of Interest oMed Research International,vol. 2014, Article ID 480573, 11 pages, 2014. The authors declare that they have no conflicts of interests. [10] S. Suzuki, A. Sekizawa, M. Tanaka et al., “Current status of condylomata acuminata in pregnant japanese women,” Japanese Acknowledgments Journal of Infectious Diseases, vol.69, no.4,pp.347–349, 2016. [11] M. Dunowska,J. S.Munday, R.E.Laurie, and S.F.K.Hills, This study was supported by Fundac ¸ao ˜ de Amparo aP ` esquisa “Genomic characterisation of Felis catus papillomavirus 4, a do Estado de Sao Paulo (FAPESP, Grant no. 2015/06628-7). novel papillomavirus detected in the oral cavity of a domestic cat,” Virus Genes,vol.48, no.1,pp.111–119, 2014. Supplementary Materials [12] H. Bernard, R. D. Burk, Z. Chen, K. van Doorslaer, H. Z. Hausen, and E. de Villiers, “Classification of papillomaviruses Supplementary 1. Table 1: oligonucleotides sequences that (PVs) based on 189 PV types and proposal of taxonomic comprise PGMy09 and PGMy11. amendments,” Virology, vol. 401, no. 1, pp. 70–79, 2010. [13] C.E. Lange, K. Tobler,E. M.Schraner et al.,“Complete canine Supplementary 2. Table 2: sequences generated on the study papillomavirus life cycle in pigmented lesions,” Veterinary and their accession numbers on GenBank. Microbiology,vol.162,no. 2-4, pp. 388–395,2013. Supplementary 3. Table 3: HPV6 and HPV11 sequences avail- [14] M.V.Batista,T. A.Ferreira,A.C.Freitas,and V. Q.Balbino,“An able on GenBank used on the phylogenetic analysis [60], [49], entropy-based approach for the identification of phylogeneti- [61], [42], [62], [63], [64], [65], [66], [67]. cally informative genomic regions of Papillomavirus,” Infection, Genetics and Evolution, vol. 11, no. 8, pp. 2026–2033, 2011. [15] M. Dunowska,J. S.Munday, R.E.Laurie, and S.F.K.Hills, References “Genomic characterisation of Felis catus papillomavirus 4, a novel papillomavirus detected in the oral cavity of a domestic [1] A. Meisels, R. Fortin, and M. Roy, “Condylomatous lesions of the cervix. II. Cytologic, colposcopic and histopathologic study,” cat,” Virus Genes,vol.48, no.1,pp.111–119, 2013. Advances in Virology 9 [16] M. Stanley, “Pathology and epidemiology of HPV infection in [32] A. Marcellusi, A. Capone, G. Favato et al., “Health utilities females,” Gynecologic Oncology,vol.117,supplement 2, pp.S5– lost and risk factors associated with HPV-induced diseases in S10, 2010. men and women: The HPV Italian collaborative study group,” Clinical eTh rapeutics ,vol.37,no.1,pp.156–167,2015. [17] C. U. Hubb ¨ ers and B. Akgul, ¨ “HPV and cancer of the oral cavity,” Virulence,vol.6,no.3, pp. 244–248,2015. [33] M. Sopori, “Eec ff ts of cigarette smoke on the immune system,” Nature Reviews Immunology, vol.2,no. 5,pp.372–377, 2002. [18] S. de Sanjose, ´ L. Bruni, and L. Alemany, “HPV in genital cancers (at the exception of cervical cancer) and anal cancers,” La Presse [34] E. Tamer, S. K. C¸akmak, M. N. Ilhan, and F. Artuz ¨ , “Demo- M´edicale,vol.43,no.12,pp.e423–e428, 2014. graphic characteristics and risk factors in Turkish patients with anogenital warts,” Journal of Infection and Public Health,vol.9, [19] A. Flaherty, T. Kim, A. Giuliano et al., “Implications for human no. 5, pp. 661–666, 2016. papillomavirus in penile cancer,” Urologic Oncology: Seminars and Original Investigations, vol.32, no.1,pp.53.e1–53.e8,2014. [35] A.Amador-Molina, J.F.Hernand ´ ez-Valencia, E. Lamoyi, A. Contreras-Paredes, and M. Lizano, “Role of innate immunity [20] C. Reuter,A.Ahmad, R. Warmanetal., “Methylationof HPV against human papillomavirus (HPV) infections and effect of and a tumor suppressor gene reveals anal cancer and precursor adjuvants in promoting specific immune response,” Viruses,vol. lesions,” Oncotarget, vol.8,2017. 5, no. 11, pp. 2624–2642, 2013. [21] M.Schiffman, P.E.Castle, J. Jeronimo, A.C. Rodriguez, and S. [36] L. F. Barroso, “er Th oleofHuman Papilloma Virus (HPV) Wacholder, “Human papillomavirus and cervical cancer,” The vaccination in the prevention of anal cancer in individuals Lancet,vol.370, no.9590, pp. 890–907,2007. with Human Immunodeficiency Virus-1 (HIV-1) infection,” [22] E. Hemper,M.Wittau,J.Lemke, M.Kornmann, and D. Therapeutic Advances in Vaccines , vol.1,no. 2,pp. 81–92,2013. Henne-Bruns, “Management of a giant perineal condylomata [37] L. Darwich, M. Canad ˜ as, S. Videla et al., “Prevalence, clearance, acuminata Case report,” GMS Interdiscip, vol.5,pp.1–5,2016. and incidence of human papillomavirus type–specific infection [23] J. God´ınez, S. Nicolas ´ -Parraga, ´ V. Pimenoff et al., “Phyloge- at the anal and penile site of HIV-infected men,” Sexually netically related, clinically different: human papillomaviruses Transmitted Diseases, vol.40,no.8,pp.611–618, 2013. 6 and 11 variants distribution in genital warts and in laryngeal [38] C. C. Soares, I. Georg, E. Lampe et al., “HIV-1, HBV, HCV, papillomatosis,” Clinical Microbiology and Infection,vol.20,no. HTLV, HPV-16/18, and treponema pallidum infections in a 6, pp. O406–O413, 2014. sample of brazilian men who have sex with men,” PLoS ONE, [24] K. F. Komloˇs, P. Koˇsorok, B. J. Kocjan, and M. Poljak, “Genetic vol. 9, no. 8, Article ID e102676, 2014. diversity of HPV-6 in concurrent multiple anogenital warts,” [39] J. Isola, S. DeVries, L. Chu, S. Ghazvini, and F. Waldman, “Anal- Acta Dermatovenerologica Alpina, Pannonica et Adriatica,vol. ysis of changes in DNA sequence copy number by comparative 22, no. 1, pp. 31–33, 2013. genomic hybridization in archival paraffin-embedded tumor [25] D. Krige, H. Mills, E. Berrie et al., “Sequence variation in the samples,” eTh American Journal of Pathology ,vol. 145, no. 6, pp. Early genes E1∧E4, E6 and E7 of Human Papilloma Virus type 1301–1308, 1994. 6,” Virus Research, vol.49, no.2, pp. 187–191,1997. [40] H. Bernard, S. Chan, M. M. Manos et al., “Identification and [26] R. D. Burk, Z. Chen, A. Harari et al., “Classification and assessment of known and novel human papillomaviruses by nomenclature system for human Alphapapillomavirus variants: polymerase chain reaction amplification, restriction fragment General features, nucleotide landmarks and assignment of length polymorphisms, nucleotide sequence, and phylogenetic HPV6 and HPV11 isolates to variant lineages,” Acta Derma- algorithms,” eTh Journal of Infectious Diseases ,vol.170,no.5, pp. tovenerologica Alpina, Pannonica et Adriatica,vol.20, no.3,pp. 1077–1085, 1994. 113–123, 2011. [41] A. L. Fuessel Haws, Q. He,P.L. Rady etal.,“Nested PCR with [27] J. Chansaenroj, A. eTh amboonlers, P. Junyangdikul, P. Supiya- the PGMY09/11 and GP5+/6+ primer sets improves detection of phan, and Y. Poovorawan, “Whole genome analysis of human HPV DNA in cervical samples,” Journal of Virological Methods, papillomavirus genotype 11 from cervix, larynx and lung,” Asian vol. 122, no. 1, pp. 87–93, 2004. Pacific Journal of Cancer Prevention ,vol.13,no.6,pp.2619–2623, 2012. [42] R. P. de Matos, L. Sichero, I. M. Mansur et al., “Nucleotide and phylogenetic analysis of human papillomavirus types 6 and 11 [28] S. Pande, N. Jain, B. K. Prusty et al., “Human papillomavirus isolated from recurrent respiratory papillomatosis in Brazil,” type 16 variant analysis of E6, E7, and L1 genes and long control Infection, Genetics and Evolution, vol.16,pp.282–289, 2013. region in biopsy samples from cervical cancer patients in North India,” Journal of Clinical Microbiology,vol.46,no. 3,pp.1060– [43] Y. E. Kim, J. Chen, R. Langen, and J. R. Chan, “Monitoring 1066, 2008. apoptosis and neuronal degeneration by real-time detection of phosphatidylserine externalization using a polarity-sensitive [29] R. Y. Seedat,C.E. Combrinck, P.A.Bester, J. Lee,and F. J.Burt, indicator of viability and apoptosis,” Nature Protocols,vol. 5, no. “Determination of the complete genome and functional analysis 8, pp. 1396–1405, 2010. of HPV6 isolate VBD19/10 from a patient with aggressive recur- rent respiratory papillomatosis,” Epidemiology and Infection, [44] T. Hall, “BioEdit: a user-friendly biological sequence alignment vol. 144, no. 10, pp. 2128–2135, 2016. editor and analysis program for Windows 95/98/NT,” Nucleic Acids Symposium Series, 1999. [30] E. Flores-D´ıaz, K. A. Sereday, S. Ferreira et al., “HPV-11 varia- bility, persistence and progression to genital warts in men: the [45] J. D. o Th mpson, T. J. Gibson, F. Plewniak, F. Jeanmougin, and HIM study,” Journal of General Virology,vol.98, no.9,pp.2339– D. G. Higgins, “eTh CLUSTAL X windows interface: flexible 2342, 2017. strategies for multiple sequence alignment aided by quality analysis tools,” Nucleic Acids Research,vol. 25,no.24, pp. 4876– [31] I. N. Mammas, D. A. Spandidos, and G. Sourvinos, “Genomic 4882, 1997. diversity of human papillomaviruses (HPV) and clinical impli- cations: An overview in adulthood and childhood,” Infection, [46] S. Guindon, J. Dufayard, V. Lefort, M. Anisimova, W. Hordijk, Genetics and Evolution, vol. 21, pp. 220–226, 2014. and O. Gascuel, “New algorithms and methods to estimate 10 Advances in Virology maximum-likelihood phylogenies: assessing the performance [62] K. J. Hofmann, J. C. Cook, J. G. Joyce et al., “Sequence of PhyML 3.0,” Systematic Biology,vol.59, no. 3,pp.307–321, determination of human papillomavirus type 6a and assembly 2010. of virus-like particles in saccharomyces cerevisiae,” Virology, vol.209, no.2,pp.506–518, 1995. [47] D. Posada, “jModelTest: phylogenetic model averaging,” Molec- ular Biology and Evolution,vol.25,no. 7,pp. 1253–1256, 2008. [63] B. J. Kocjan, M. M. Jelen, P. J. Maver, K. Seme, and M. Poljak, “Pre-vaccination genomic diversity of human papillomavirus [48] B. J. Kocjan, M. Poljak, M. Cimerman et al., “Prevaccination genotype 6 (HPV 6): A comparative analysis of 21 full-length genomic diversity of human papillomavirus genotype 6 (HPV genome sequences,” Infection, Genetics and Evolution,vol.11,no. 6),” Virology,vol.391, no. 2,pp.274–283, 2009. 7, pp. 1805–1810, 2011. [49] J. A. Danielewski, S. M. Garland, J. McCloskey, R. J. Hillman, S. [64] R.Kovelman,G. K.Bilter,A.Roman, D.R.Brown, and M. N. Tabrizi, and R. D. Burk, “Human Papillomavirus Type 6 and 11 Genetic Variants Found in 71 Oral and Anogenital Epithelial S. Barbosa, “Human papillomavirus type 6: Classification of clinical isolates and functional analysis of E2 proteins,” Journal Samples from Australia,” PLoS ONE,vol.8, no.5, Article ID e63892, pp. 1–9, 2013. of General Virology,vol. 80,pp.2445–2451, 1999. [50] J. P. Mosmann, M. S. Monetti, M. C. Frutos, A. X. Kiguen, R. [65] P. J. Maver, M. Poljak, K. Seme, and B. J. Kocjan, “Detection F. Venezuela, and C. G. Cuffini, “Mutation detection of E6 and and typing of low-risk human papillomavirus genotypes HPV LCR genes from HPV 16 associated with carcinogenesis,” Asian 6, HPV 11, HPV 42, HPV 43 and HPV 44 by polymerase Pacific Journal of Cancer Prevention , vol. 16, no. 3, pp. 1151–1157, chain reaction and restriction fragment length polymorphism,” 2015. Journal of Virological Methods, vol. 169, no. 1, pp. 215–218, 2010. [51] L. Ho,S.-Y. Chan, R. D.Burk etal.,“eTh genetic drift ofhuman [66] E. Schwarz, M. Durs ¨ t, C. Demankowski et al., “DNA sequence papillomavirus type 16 is a means of reconstructing prehistoric and genome organization of genital human papillomavirus type viral spread and the movement of ancient human populations,” 6b,” EMBO Journal,vol.2,no. 12,pp. 2341–2348, 1983. Journal of Virology,vol.67,no.11,pp. 6413–6423, 1993. [67] X. Wu, C.Zhang,S.Feng et al., “Detection ofHPV types and [52] C.-K. Ong, S.-Y. Chan, M. S. Campo et al., “Evolution of human neutralizing antibodies in Gansu province, China,” Journal of papillomavirus type 18: An ancient phylogenetic root in Africa Medical Virology, vol.81, no. 4,pp. 693–702, 2009. and intratype diversity reflect coevolution with human ethnic groups,” Journal of Virology, vol.67,no. 11, pp.6424–6431, 1993. [53] P. A. Heinzel, S.-Y. Chan, L. Ho et al., “Variation of human papillomavirus type 6 (HPV-6) and HPV-11 genomes sampled throughout the world,” Journal of Clinical Microbiology,vol. 33, no.7,pp.1746–1754, 1995. [54] M. M. Jelen, Z. Chen, B. J. Kocjan et al., “Global genomic diversity of human papillomavirus 6 based on 724 isolates and 190 complete genome sequences,” Journal of Virology, vol. 88, pp. 7307–7316, 2014. [55] E. Lavezzo, G. Masi, S. Toppo et al., “Characterization of intra- type variants of oncogenic human papillomaviruses by next- generation deep sequencing of the E6/E7 region,” Viruses,vol. 8, no. 3,p.79,2016. [56] C.-C. J. Wang, J. Sparano, and J. M. Palefsky, “Human immun- odeficiency virus/AIDS, human papillomavirus, and anal can- cer,” Surgical Oncology Clinics of North America,vol.26,no.1, pp. 17–31, 2017. [57] B.Auvert, P. Lissouba,E. Cutler,K.Zarca, A.Puren, and D. Taljaard, “Association of oncogenic and nononcogenic human papillomavirus with HIV incidence,” Journal of Acquired Immune Deficiency Syndromes , vol. 53, no. 1, pp. 111–116, 2010. [58] M. Soohoo, M. Blas, G. Byraiah, C. Carcamo, and B. Brown, “Cervical HPV infection in female sex workers: a global perspective,” The Open AIDS Journal ,vol.7,no.1,pp. 58–66, [59] A. A. Elmi, D. Bansal, A. Acharya et al., “Human papillomavirus (HPV) infection: molecular epidemiology, genotyping, sero- prevalence and associated risk factors among arab women in Qatar,” PLoS ONE,vol.12,no.1,Article ID e0169197, 2017. [60] C. E. Combrinck, R. Y. Seedat, C. Randall, Y. Roodt, and F. J. Burt, “Novel HPV-6 variants of human papillomavirus causing recurrent respiratory papillomatosis in southern Africa,” Epi- demiology and Infection, vol. 140, no. 06, pp. 1095–1101, 2012. [61] K. Dartmann, E. Schwarz, L. Gissmann, and H. zur Hausen, “eTh nucleotide sequence and genome organization of human papilloma virus type 11,” Virology,vol.151,no. 1,pp. 124–130, 1986. International Journal of Journal of Nucleic Acids Peptides The Scientific International Journal of International Journal of World Journal Cell Biology Microbiology Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi Hindawi http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Anatomy Biochemistry Research International Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com Advances in Genetics Bioinformatics Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Advances in International Journal of International Journal of Stem Cells BioMed Zoology Virolog y Genomics International Research International Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Neuroscience Journal Enzyme Journal of Journal of Research Parasitology Research Marine Biology Archaea Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Advances in Virology Hindawi Publishing Corporation

Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil

Download PDF
11 pages

Loading next page...
 
/lp/hindawi-publishing-corporation/analysis-of-nucleotide-alterations-in-the-e6-genomic-region-of-human-irBo7Q0nQm

References (68)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2019 Marina Carrara Dias et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8639
eISSN
1687-8647
DOI
10.1155/2019/5697573
Publisher site
See Article on Publisher Site

Abstract

Hindawi Advances in Virology Volume 2019, Article ID 5697573, 10 pages https://doi.org/10.1155/2019/5697573 Research Article Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil 1 1 1 1 Marina Carrara Dias, Bruna Stuqui, Paola Jocelan Scarin Provazzi, C-ntia Bittar , 1 1 1 Natália Maria Candido, Renata Prandini Adum de Matos, Rodolfo Miglioli Badial, 1 2 3 Caroline Measso do Bonfim, Patricia Pereira dos Santos Melli, Silvana Maria Quintana, 4 1 1 José Antônio Cordeiro, Paula Rahal , and Marilia de Freitas Calmon Institute of Biosciences, Letters and Exact Sciences of Sa˜o Paulo State University, Sao ˜ Jos´e do Rio Preto, SP, Brazil Clinical Hospital of Faculty of Medicine of Ribeirao ˜ Preto, Sa˜o Paulo University, Ribeirao ˜ Preto, SP, Brazil Faculty ofMedicine ofRibeirao ˜ Preto, Sa˜o Paulo University, Ribeirao ˜ Preto, SP, Brazil ˜ ´ Faculty of Medicine of Rio Preto, Sao Jose do Rio Preto, SP, Brazil Correspondence should be addressed to Marilia de Freitas Calmon; macal131@gmail.com Received 27 September 2018; Revised 27 February 2019; Accepted 17 March 2019; Published 2 May 2019 Academic Editor: Jay C. Brown Copyright © 2019 Marina Carrara Dias et al. is Th is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Condyloma acuminata (CA), or genital warts, are benign proliferative epidermal or mucous lesions that are caused by infection with human papillomavirus (HPV), mainly the low-risk types 6 and 11. HPV variants are defined as viral sequences that share identity in the nucleotide sequence of the L1 gene greater than 98%. Based on this criterion, HPV6 and 11 variant lineages have been studied, and there are ongoing attempts to correlate these genetic variants with different clinical findings of infection. Therefore, the aims of this study were to detect variants and nucleotide alterations present in the E6 regions of HPV types 6 and 11 found in CA samples, to correlate the HPV presence with the clinical-pathological data of the patients, and to determine phylogenetic relationships with variants from other places in the world. eTh E6 regions of 25 HPV6 samples and 7 HPV11 samples from CA were amplified using PCR with specific primers. eTh products were ligated to a cloning vector and vfi e colonies of each sample were sequenced to observe the nucleotide alterations. Twelve samples were identified as the HPV6B3 variant, presenting the mutation (guanine) G474A (adenine), and one of them also showed the mutation (thymine) T369G. The other 13 patients were positive for HPV6B1 without nucleotide alterations. In the analysis of the HPV11 samples, all patients showed the mutations T137C and (cytosine) C380T. One patient also presented the nucleotide alteration T410C. None of the mutations found in the 32 analyzed samples resulted in amino acid changes. Patient age, local occurrence, and HIV infection did not show significant association with HPV infection. Besides, the data found in this study did not show a relationship with the geographical region of isolation when compared to other data from different regions of the world. In this way, despite the nucleotide alterations found, it was not possible to observe amino acid changes and variants grouping according to geographical region. 1. Introduction papillomavirus (PV) infections, are observed in animals, including cetaceans [2, 3], monkeys [4], and humans [5, 6]. In Condyloma acuminata (CA), or genital warts, are benign pro- humans, CA is one of the most common sexually transmitted liferative epidermal or mucous lesions. Classical histopatho- diseases; interestingly, gender bias has been associated with logical features of CA were recognized long ago and are human papillomavirus 11 (HPV11) genital warts, whereby the characterized by acanthosis, papillomatosis, hyperkeratosis, proportion of HPV11 genital warts is three times higher in parakeratosis, and koilocytosis [1]. These lesions, related to males than in females [7]. CA is caused by infection with 2 Advances in Virology human papillomavirus (HPV), mainly the low-risk types 6 HPV infection and persistence, leading to the development and 11, though coinfections with high-risk HPV types can also of HPV-associated lesions [33, 34]. The immune response occur [8–10]. has an important role in the elimination of many HPV infections. However, some infections cannot be eliminated Papillomaviruses are circular, double-stranded DNA viruses consisting of an icosahedral capsid 52-55 nm in and persist for many years, which is an additional risk diameter and with a genome length of 8 kb [11]. These factor for cancer development [35]. Individuals infected with human immunodeficiency virus (HIV) are more susceptible viruses are classified in the Papillomaviridae family, which is characterized by large amounts of genetic diversity [12, 13]. to HPV infection. Deficiency in immune cells due to HIV There are currently more than 200 HPV types identiefi d. The infection results in instability of the immune system that viruses can infect the squamous epithelium of the skin or the should combat high- and low-risk HPVs, which facilitates genital and oral mucosa [14–16]. Mucosal HPVs are classified virus persistence and lesion progression [36–38]. Therefore, our aims were to evaluate E6 early gene according to their oncogenic potential: they could be high- risk, such as types 16 and 18, which are involved in oral, genital variability among HPV6 and HPV11 detected in CA samples penile, anal and cervical carcinomas [17–21]; or low-risk, such obtained from a cohort of Brazilian patients and to correlate them with the clinical-pathologic data. We also conducted as types 6 and 11, which are present in genital and anal warts and recurrent respiratory papillomatosis [22]. phylogenetic analysis to compare nucleotide sequences iden- Former studies evaluating the genetic variation of the tified in our study with isolates previously described from other parts of the world. long control region (LCR) and E6 regions used standard reference genomes for comparative purposes [23–25]. These standard reference genomes for HPV6 are denoted as pro- 2. Materials and Methods totypic HPV6b, nonprototypic HPV6a and HPV6vc, and 2.1. Clinical Samples. Ethical permission was obtained from one standard reference genome for HPV11. However, a study the Research Ethics Committee of the Institute of Biosciences, based on phylogenetic analysis of complete genomes derived Letters and Exact Sciences of Sao ˜ Paulo State University, in from published HPV6 and HPV11 variants proposed a new the city of Sao ˜ Jose´ do Rio Preto, with the license number standard nomenclature for HPV6 and HPV11 [26]. Two 1.529.236. deeply separate clades were observed for HPV6. The lineage A This study evaluated 25 samples positive for HPV6 and is formed by the reference genome HPV6b and the lineage B 7 samples positive for HPV11. The 32 samples were isolated formed by the HPV6a, HPV6vc, and CAC301 sequences, cor- from biopsies obtained from surgical sections of genital and responding to HPV6B3, HPV6B2, and HPV6B1 sublineages, perianal lesions from female patients attended at the Clinical respectively. The nomenclature proposed for the HPV11 Hospital of the University of Sao ˜ Paulo Medical School lineage is based on two clades, referred to as sublineage A1, in Ribeirao ˜ Preto. The patient age ranged from 16 to 78 which includes variants clustering with the HPV11 reference years, with a median age of 26 years. The local occurrence genome, and sublineage A2, which includes all other variants. percentages of lesions in the analyzed patients were 50% in Aggressiveness differences between HPVs 6 and 11 and the genital region and 34.4% in the perianal region; 15.6% of between different cases of the same genotype could be related samples showed no information (Table 1). to intratypical genetics variants [27]. Several studies are trying to correlate these genetic alterations with biological and biochemical properties in an attempt to identify possible 2.2. HPV Genotyping. The DNA from these samples was differences in the clinical-pathological characteristics of the extracted using a phenol chloroform protocol [39], and the disease [28]. DNA integrity was evaluated via𝛽 -globin gene amplification, Seedat et al. found duplications in the HPV6 LCR that generating a 315-bp amplicon [40]. To amplify the human could result in enhanced promoter activity. u Th s, the dupli- papillomavirus DNA present in these lesions, we used poly- cation may cause an increase in the oncogenic potential of merase chain reaction (PCR) to target the L1 region of HPV. HPV6 variants ascribed to overexpression of E6 and E7 [29]. The reactions were processed in two amplification steps: in On the other hand, Flores-Dıaz et al. did not observe an the rfi st reaction, PGMy09 and PGMy11 oligonucleotides association of specific HPV11 variants with clinical disease. (Supplementary Table 1) were used to generate a 450-bp These could be explained by the higher conservation of amplicon. The amplification mix consisted of 2.5 U of Taq HPV11 compared to HPV6 [30]. DNA Polymerase (Sinapse Inc., Florida, USA), 2.5𝜇 lof 10X The analysis of HPV diversity is important for future PCR Buffer, 5.6 𝜇 MMgCl , 0.2 mM dNTPs, 0.4 𝜇 Mof vaccine strategies and to estimate the vaccine success in each primer, 500 ng of DNA, and nuclease free water, all immunocompromised individuals [31]. of which added up to a n fi al volume of 25.0 𝜇 l. An initial HPV infection could be associated with some risk factors, denaturation step at 95 C for 9 min was conducted, followed ∘ ∘ ∘ such as high numbers of sexual partners, early age at start by 40 cycles at 95 Cfor 1min, 55 Cfor 1min,and 72 C of sexual activity, tobacco smoking, number of pregnancies, for 2 min and a final extension at 72 Cfor 5 min.In the alcohol, and previous sexually transmitted diseases (STDs) nested PCR, GP5+ (5 -TTTGTTACTGTGGTAGATACTAC- 󸀠 󸀠 󸀠 [32]. For example, tobacco, which contains nicotine, the 3 )and GP6+ (5 -CTTATACTAAATGTCAAATAAAAA-3 ) main immunosuppressive constituent of cigarette smoke, has oligonucleotides were used to generate 150-bp amplicfi ation deleterious effects on systemic and local immunity, suppress- product. The amplicfi ation mix consisted of 2.5 U of Taq ing immune responses and increasing the susceptibility to DNA Polymerase (Sinapse Inc., Florida, USA), 2.5𝜇 lof 10X Advances in Virology 3 Table 1: Characterization of the 32 samples regarding to the factors age, lesion, HIV coinfection, alcohol consumption, and tobacco smoking. Age HIV viral load (HIV-1 Sample Condyloma HPV type HIV Alcohol consumption Tobacco smoking (Years) RNA copies/ml) BR CA26 A2 -HPV11 Neg 51 < 50 - No BR CA13 B1 Perianal HPV6 Neg 26 < 50 No No BR CA01 B3 42 -HPV6 Neg < 50 No Yes BR CA27 A2 Genital HP11 Pos 49 11543 Yes Yes BR CA02 B3 Genital HPV6 Neg 22 < 50 - No BR CA03 B3 Perianal HPV6 Neg 50 < 50 No Yes BR CA14 B1 Perianal HPV6 Neg 20 < 50 Yes No BR CA28 A2 Genital HPV11 Neg 39 < 50 No No BR CA15 B1 Perianal HPV6 Neg 37 < 50 No No BR CA16 B1 -HPV6 Neg 24 < 50 - - BR CA29 A2 Genital HPV11 Pos 26 18656 Yes Yes BR CA04 B3 Genital HPV6 Neg 42 < 50 No No BA CA17 B1 -HPV6 Neg 78 < 50 No No BR CA05 B3 Genital HPV6 Neg 21 < 50 No No BR CA18 B1 Genital HPV6 Neg 21 < 50 No No BR CA06 B3 Genital HPV6 Pos 45 20657 No Yes BR CA30 A2 Genital HPV11 Pos 29 25678 - Yes BR CA32 A2 Genital HPV11 Pos 29 22980 - Yes BR CA07 B3 -HPV6 Pos - 15000 - - BR CA08 B3 Perianal HPV6 Pos 39 35678 - - BR CA31 A2 Perianal HPV11 Neg 22 < 50 - BR CA19 B1 16 Genital HPV6 Neg < 50 No No BR CA09 B3 Genital HPV6 Neg 23 < 50 No Yes BR CA10 B3 Genital HPV6 Neg 21 < 50 - - BR CA20 B1 Perianal HPV6 Neg 53 < 50 - Yes BR CA11 B3 24 Perianal HPV6 Neg < 50 - - BR CA12 B3 Genital HPV6 Neg 21 < 50 No No BR C21 B1 Genital HPV6 Neg 33 < 50 - BR C22 B1 Genital HPV6 Neg 19 < 50 No No BR C23 B1 19 Perianal HPV6 Neg < 50 No No BR C24 B1 Perianal HPV6 Neg 27 < 50 - - BR C25 B1 Perianal HPV6 Neg 17 < 50 No No subtitle:-: lack of information;Neg:negative;Pos:positive. PCR Buffer, 7.6 𝜇 Mmagnesium chloride (MgCl , 0.064 mM specicfi primers (HPV6: F: 5 GGGGGATCCGAATTCATG- 2) 󸀠 󸀠 deoxynucleotides (dNTPs), 0.48𝜇 Mof each primer,5.0𝜇l GAAAGTGCAAATGC 3 and R: 5 GGAAGACATGTT- 󸀠 󸀠 of the product from the PGMy09 and PGMy11 reaction, and ACCCTAGGATCCAAGCTTCAC 3 ; HPV11: F: 5 AAA- 󸀠 󸀠 nuclease free water, all of which added up to a final volume ATTAGCAGACGAGGCATT 3 and R: 5 AGATGAGGT- ∘ 󸀠 of 25.0𝜇 l. An initial denaturation step at 95 Cfor 9min was GGACAAGGTGG 3 ) [42]. The amplicfi ation mix consisted ∘ ∘ conducted, followed by 40 cycles at 94 Cfor 30seconds, 45 C of 6.0 U of a proofreading polymerase (High Fidelity Enzyme for 30 seconds and 72 C for 30 seconds, and a final extension Mix, Fermentas, Vilnius, Lithuania), 5.0 𝜇 lof 10X High at 72 C for 8 min. Purified products were sequenced via the Fidelity PCR Buffer, 1.5 mM MgCl , 0.24 mM dNTPs, 0.4𝜇 M Sanger method using the primers PGMy09/11 and GP5+/6+ of each primer, 500 ng of DNA, and nuclease free water, all [41]. of whichadded uptoafinal volume of50.0 𝜇 l. An initial denaturation step at 95 C for 5 min was conducted, followed ∘ ∘ ∘ 2.3. E6 Amplicfi ation and Cloning. For nucleotide variability by 35 cycles at 95 Cfor 1min, 55 Cfor 1 min,and 72 Cfor 2 analysis, the complete E6 gene sequences of HPV6- and min and a final extension at 72 C for 8 min. The amplification HPV11-positive samples were amplified using PCR with products were 467 bp for HPV6 E6 and 569 bp for HPV11 E6. 4 Advances in Virology To obtain more reliable sequencing data, the ampliefi d of France Bioinformatics Laboratories (http://www.atgc- E6 region from each patient was ligated to the pJET1.2/blunt montpellier.fr/phyml/) [46]. The substitution models were cloning vector of the Clone JET PCR Cloning Kit (Thermo calculated for both HPV types (6 and 11) using jModel Test software [47]. Bootstrapping of 1000 replicates was used to Scientific, Massachusetts, USA) following the manufac- turer’s instructions. The cloned products were transformed calculate branch support. Values over 70% were considered [43] into chemically competent DH5𝛼 Z Escherichia coli significant. (Zymo Research, California, USA) via the thermal shock 2.7. Statistical Analysis. The Kruskal-Wallis test was used to method. Aeft r transformation, bacteria were spread onto Petri plates containing solid Luria-Bertani (LB) medium and determine if there were significant associations between HPV presence and HIV viral load and between HPV presence 0.1 mg/mL of ampicillin. Samples were incubated at 37 C for 16 hours. Subsequently, five colonies of each sample and patient age. The HIV viral load of the samples was determined by the branched-chain DNA assay (Versant were selected and incubated in liquid LB medium with HIV RNA test, Version 3.0, lower limit of quantification 0.1 mg/mL of ampicillin at 37 Cfor 16 hoursand shak- 50 copies/ml; Siemens Healthcare, Erlangen, Germany) and ing at 250 rpm. After bacterial growth, the plasmid DNA values above 50 HIV-1 RNA copies/ml were considered was extracted using the GeneJET Plasmid Miniprep Kit HIV-positive. p-values<0.05 were considered as statistically (Fermentas,Vilnius,Lithuania) following the manufacturer’s significant. instructions. The Pearson Chi-Square, Likelihood Ratio Chi-Square, and Fisher’s exact tests were employed to identify the asso- 2.4. Nucleotide Alteration Detection. Puriefi d products were ciation of HPV infection with the risk factor (HIV pres- sequenced via the Sanger method using cloning vector ence). These tests were also used to analyze the associations primers (pJET1.2 Forward Sequencing Primer: 5 CGA- between nucleotide alterations and the anatomical location CTCACTATAGGGAGAGCGGC 3 and pJET1.2 Reverse of the lesions. p-values<0.05 were considered as statistically Sequencing Primer: 5 CTGCCATGGAAAATCGATGTT- significant. CTT 3 ). 3. Results 2.5. Datasets and Sequence Analysis. Sequence quality was evaluated using the Electropherogram Quality Analysis 3.1. Clinical Characteristics. Regarding the age factor, 61.3% program, available online at<http://asparagin.cenargen.em- of patients were between 16 and 29 years old, and 38.7% were brapa.br/phph/>. Comparisons between the sequences ac- more than 30 years old. However, neither patient age nor quired and those previously added to GenBank were con- local occurrence was significantly associated with HPV6 or ducted using BLAST (Basic Local Alignment Search Tool, HPV11 presence. Related to the risk factors, HIV was detected available at<http://www.ncbi.nlm.nih.gov/BLAST>). in 21.9% of patients, and statistical analysis did not show All sequences were edited using the BioEdit 7.0.9.0 significant association between HPV and HPV coinfection. package to remove vector fragments and to analyze solely It was not possible to perform statistical analysis on HPV the complete sequence of the E6 gene. The alignment infection, alcohol consumption, and tobacco smoking due to between the prototype sequence HPV6A (accession number: missing patient data. X00203), nonprototype sequences HPV6B1 (accession num- ber: AF092932), HPV6B2 (accession number: FM875941), 3.2. Nucleotide Alteration Detection and HPV6B3 (accession number: L41216), HPV11A1 refer- ence sequence (accession number: M14119) and HPV11A2 3.2.1. HPV6. After sequence analysis of the 25 HPV6 sam- (accession number: FN870447), and the sequences obtained ples, it was noted that 12 (48%) samples belong to the in this study was performed using the CLUSTAL W sowa ft re HPV6B3 (L42216) variant and that all of these samples nested in the BioEdit 7.0.9.0 package [44, 45]. presented the G474A mutation compared to the proto- The sequences generated in this study were submitted to type E6 sequence. Moreover, sample BR CA06 B3 showed GenBank; the accession numbers are listed in Supplementary one more nucleotide alteration in position 369 of the Table 2. genome, consisting of a change from T to G (Table 2). To perform the phylogenetic analysis, datasets were The other 13 (52%) HPV6 samples belong to the HPV6B1 assembled, including the nucleotide sequences generated in (AF092932) variant and did not show additional nucleotide this study, the reference sequences, and other sequences alterations. available on GenBank for each HPV type. The HPV6 and Modeltest was performed to determine the best substitu- HPV11 datasets consist of 184 and 101 nucleotide sequences, tion model for phylogenetic reconstruction. The substitution respectively, both with 453 residues. The GenBank accession model selected for the HPV6 dataset was Tamura-Nei + I + G numbers of all of the sequences are presented in Supplemen- (TrN + I +G). A maximum likelihood phylogenetic tree was tary Table 3. reconstructed using PhyML based on the selected model with a bootstrap of 1000 replicates. 2.6. Phylogenetic Analysis. Phylogenetic trees were recon- The phylogenetic tree obtained from the analysis was structed with the Maximum Likelihood method using the splitintotwo main branches, withstrong branchsupport PhyML program through the ATGC platform from the South (Figure 1). One branch, with a bootstrap of 92, grouped Advances in Virology 5 Table 2: Nucleotide alterations in the E6 genes of HPV6 isolates. Genomic positions are indicated in the upper part of the table, and the mutations are vertically indicated. Conserved nucleotides in relation to the reference sequence are shown in gray. eTh column “Number of samples” indicates the number of patients in which the isolates are identical to the specified variant. Nucleotide positions HPV6 samples Number of samples B3 ref T G BR CA01, BR CA02, BR CA03, BR CA04, BR CA05, BR CA07, BR CA08, BR CA09, A11 B3 BR CA10, BR CA11, BR CA12 BR CA06 G A 1 B1 ref T A BR CA13, BR CA14, BR CA15, BR CA16, B1 BR CA17, BR CA18, BR CA19, BR CA20, BR C21, 13 BR C22, BR C23, BR C24, BR C25 Table 3: Nucleotide alterations in the E6 genes of HPV11 isolates. Genomic positions are indicated in the upper part of the table, and the mutation is horizontally indicated. The column “Number of samples” indicates the number of patients in which the isolates are identical to the specified variant. Nucleotide sample HPV 11 sample 410 Number of samples A2 (LP19-FN 870447) T BR CA28 C 1 the HPV6A prototype sequence with the isolates related isolates from other studies (Figure 2). The second branch to this variant. The other branch, also with a bootstrap grouped the HPV11A2 sequences from this study and the of 92, grouped all HPV6B variants and was divided into Brazilian, Slovenian, and Australian isolates. u Th s, it was two secondary branches. One secondary branch included observed that sequences did not group according to either the HPV6B3 sequences, including 12 sequences from this the geographical region from which they were isolated or the study together with the reference sequence. The second anatomical site of detection. branch included the HPV6B1 and HPV6B2 sublineages. The 13 sequences from this study grouped in a monophyletic 4. Discussion branch, with no branch support, with the HPV6B1 sublineage reference sequence and related sequences available in the The HPV11 E6 and E7 proteins play important roles in literature. u Th s, the sequences did not group according to ensuring a productive viral life cycle, facilitating episomal either geographical regions or the anatomical site of infection. maintenance of the viral genome [48]. Mutations in these regions may cause differences in the infection potential of 3.2.2. HPV11. Analysis of seven HPV11 samples revealed that the virus [31], possibly due to the different interactions of the all samples belong to the HPV11A2 variant but only the virus with host cellular mechanisms that may modulate its sample BR CA28 A2 showed the nucleotide alteration T410C clinical course [31]. (Table 3) compared to the sequence LP19 (accession number: In this study, 12 CA samples belong to the HPV6B3 FN870447) classified as HPV11A2 by Burk et al., 2011 [26]. variant, and all of them had a nucleotide alteration in position None of the mutations in the 32 analyzed samples resulted in 474 of the HPV genome. This mutation was also found in amino acid changes. Australian anogenital samples [49] and in Brazilian recurrent Modeltest was used to determine the best substitution respiratory papillomatosis samples [42]. In contrast, the model for phylogenetic reconstruction, and the HKY model nucleotide alteration at position 369 in the virus genome was selected. A maximum likelihood phylogenetic tree was observed in our study was not observed in both studies. Despite the nucleotide substitutions detected in the E6 reconstructed using PhyML based on the selected model with a bootstrap of 1000 replicates. sequence, amino acid changes were not observed in our study. The phylogenetic tree segregated into two main branches. Although the differences between the variants have been One of them, with a bootstrap of 86, contained the HPV11A1 small, the HPV6B1 variant was slightly more frequent in this prototype sequence (M14119), the LZod45 variant, and study. These data corroborate the report that HPV6B1 is the 92 6 Advances in Virology 0.003 Figure 1: Unrooted maximum likelihood phylogenetic tree for HPV6 variants reconstructed based on a dataset of 184 nucleotide sequences of 453 residues with the TrN + I +G substitution model and a bootstrap of 1000 replicates. Values above 70% were considered significant. (African variants: AF; Australian variants: AUS; Brazilian variants: BR; Slovenian variants: SL.) Red: HPV6A; green: HPV6B1; purple: HPV6B2; blue: HPV6B3. Sequences in black are HPV6B that cannot be classified into sublineages. several anatomical sites are not correlated to the place from most common variant in recurrent respiratory papillomatosis and genital warts [23, 42, 49]. This variant was highly which sample was isolated [23, 42, 48, 53]. We suggest that conserved in genital lesions analyzed in this study since there is no association between the anatomical site of lesions it did not show any nucleotide alteration. One CA sample and the HPV6 and HPV11 variants. Unlike this, Jelen et al. from this study that was HPV11-positive showed alteration [54] observed an association of sublineages B1 and B3 with in relation to the HPV11A2 sequence (accession number: FN anogenital infections. The relation between anogenital lesions FN870447). Nucleotide alteration at position 410 of the virus and sublineage B1 was also found by Danielewski et al. [49]. genome was found in recurrent respiratory papillomatosis More studies will be necessary to analyze the influence [42]. However, this alteration did not result in amino acid of HPV intratypic genetic variants on the increased risk of changes. The presence of HPV11 variants instead of prototype carcinogenic development [55]. Data observed in the present sequences has also been observed in other studies [23, 42]. study and in theliteratureindicatethat types and variants of papillomavirus identicfi ation and risk factor correlations Different sublineages of the same HPV genotype could result in alterations in viral infection persistence and the progres- could be useful for risk analysis and lesion management sion of precursor lesions and could also affect viral assembly, strategies. the immune response, pathogenicity, and p53 degradation Risk factors for HPV infections could include genital [50]. contact, early age at the start of sexual activity, number of life- In the phylogenetic analysis, it was not possible to time sexual partners, previous sexually transmitted diseases, observe the genomic variant distribution according to the tobacco smoking, and alcohol consumption [34]. Evasion geographical region from which the virus was isolated, as of the immune response to HPV is critical for a successful observed with HPVs 16 and 18. These two types of HPV infection [35]. Women infected with HIV have a higher risk to originated and speciated in Africa and then spread and facilitate HPV persistence and a reduced capacity to control diversified through human migrations. us, Th variants are the oncogenic viral processes [56]. However, in the present study we did not observe a significant association of HPV dieff rent in several geographical locations [51, 52]. In contrast togenotypes16and 18, previousstudiesand thisstudy suggest and HIV coinfection corroborating a study conducted in that the genomic diversities of HPV6 and 11 isolated from Africa with men whereupon low-risk HPV was not associated Advances in Virology 7 0.0 Figure 2: Unrooted maximum likelihood phylogenetic tree for HPV11 reconstructed based on a dataset of 101 nucleotide sequences of 453 residues with the TrN + I +G substitution model and a bootstrap of 1000 replicates. Values above 70% were considered significant. (Australian variants: AUS; Brazilian variants: BR; Slovenian variants: SL.) Red: HPV11A1; blue: HPV11A2. with HIV incidence [57]. Regarding the age factor, 61.3% did not present nucleotide alterations. T410C alteration was of the patients were between 16 and 29 years old; the other found in one of the HPV11 samples. Phylogenetic analysis patients were more than 30 years old. The lower occurrence showed no association between geographical or anatomical of HPV in older women could be due to infection elimination site of HPV detection and HPV6 or HPV11 variants. and natural immunity. However, this decrease could also be related to the increase in safe sexual behavior among older Abbreviations women [58]. The statistical analysis in this study revealed no G: Guanine association between HPV persistence and patient age, a result A: Adenine that was also observed in cervical samples [59]. T: yTh mine C: Cytosine 5. Conclusion CA: Condyloma acuminata In the present study, it was possible to observe 12 HPV6B3 HPV: Human papillomavirus variants, all of which presented the G474A mutation. One HIV: Human immunodeficiency virus HPV6B3 sample also showed the T369G mutation. The other PV: Papillomavirus HPV6 samples were determined to be HPV6B1 variants and STD: Sexually transmitted disease 86 8 Advances in Virology PCR: Polymerase chain reaction Obstetrical & Gynecological Survey, vol.33, no. 3,pp.198–200, MgCl :Magnesiumchloride 1978. dNTPs: Deoxynucleotide [2] G.D. Bossart,S.Ghim, M. Rehtanzet al., “Orogenital Neoplasia LB: Luria-Bertani in Atlantic Bottlenose Dolphins (Tursiops truncatus),” Aquatic BLAST: Basic local alignment search tool. Mammals,vol. 31, no.4, pp. 473–480, 2005. [3] A. Rector, H.Stevens,G.Lacave et al.,“Genomic characteriza- tion of novel dolphin papillomaviruses provides indications for Data Availability recombination within the Papillomaviridae,” Virology,vol. 378, no. 1, pp. 151–161, 2008. “Sequence” data that support the findings of this study [4] K. O’Banion, J. P. Sundberg, A. L. Shima, and M. Reichmann, have been deposited in GenBank with the accession codes “Venereal Papilloma and Papillomavirus in a Colobus Monkey “MF375424”, “MF375425”, “MF375426”, “MF375427”, (Colobus guereza),” Intervirology, vol.28, no. 4,pp. 232–237, “MF375428”, “MF375429”, “MF375430”, “MF375431”, “MF375432”, “MF375433”, “MF375434”, “MF375435”, [5] D. J. Ingles, C. M. Pierce Campbell, J. A. Messina et al., “Human “MF375436”, “MF375437”, “MF375438”, “MF375439”, papillomavirus virus (HPV) genotype- and age-specific analy- “MF375440”, “MF375441”, “MF375442”, “MF375443”, ses of external genital lesions among men in the hpv infection “MF375444”, “MF375445”, “MF375446”, “MF375447”, in men (HIM) study,” eTh Journal of Infectious Diseases , vol. 211, “MF375448”, “MF375449”, “MF375450”, “MF375451”, no. 7, pp. 1060–1067, 2015. “MF375452”, “MF375453”, “MF375454”, and “MF375455”. [6] K.P.Maniar,B.M.Ronnett,R. Vang,and A.Yemelyanova, “Coexisting High-grade Vulvar Intraepithelial Neoplasia (VIN) Ethical Approval and Condyloma Acuminatum: independent lesions due to dif- ferent HPV types occurring in immunocompromised patients,” All procedures performed in studies involving human partic- The American Journal of Surgical Pathology , vol.37, no.1,pp. 53– ipants were in accordance with the ethical standards of the 60, 2013. institutional and/or national research committee and with [7] K.F.Komloˇs, B.J. Kocjan,P.Koˇsorok et al., “Tumor-specific the 1964 Helsinki declaration and its later amendments or and gender-specific pre-vaccination distribution of human comparable ethical standards. papillomavirus types 6 and 11 in anogenital warts and laryngeal papillomas: A study on 574 tissue specimens,” Journal of Medical Consent Virology,vol.84,no.8,pp. 1233–1241, 2012. [8] S.Garland,M.Steben, H. Sings etal.,“Naturalhistory of genital Informed consent was obtained from all individual partici- warts: analysis of the placebo arm of 2 randomized phase III pants included in the study. trials of a quadrivalent human papillomavirus (types 6, 11, 16, and 18) vaccine,” eTh Journal of Infectious Diseases , vol.199,no. 6, pp. 805–814, 2009. Disclosure [9] B. Leo ´ nard, F. Kridelka, K. Delbecque et al., “A clinical All authors consent for publication. and pathological overview of vulvar condyloma acuminatum, intraepithelial neoplasia, and squamous cell carcinoma,” Bi- Conflicts of Interest oMed Research International,vol. 2014, Article ID 480573, 11 pages, 2014. The authors declare that they have no conflicts of interests. [10] S. Suzuki, A. Sekizawa, M. Tanaka et al., “Current status of condylomata acuminata in pregnant japanese women,” Japanese Acknowledgments Journal of Infectious Diseases, vol.69, no.4,pp.347–349, 2016. [11] M. Dunowska,J. S.Munday, R.E.Laurie, and S.F.K.Hills, This study was supported by Fundac ¸ao ˜ de Amparo aP ` esquisa “Genomic characterisation of Felis catus papillomavirus 4, a do Estado de Sao Paulo (FAPESP, Grant no. 2015/06628-7). novel papillomavirus detected in the oral cavity of a domestic cat,” Virus Genes,vol.48, no.1,pp.111–119, 2014. Supplementary Materials [12] H. Bernard, R. D. Burk, Z. Chen, K. van Doorslaer, H. Z. Hausen, and E. de Villiers, “Classification of papillomaviruses Supplementary 1. Table 1: oligonucleotides sequences that (PVs) based on 189 PV types and proposal of taxonomic comprise PGMy09 and PGMy11. amendments,” Virology, vol. 401, no. 1, pp. 70–79, 2010. [13] C.E. Lange, K. Tobler,E. M.Schraner et al.,“Complete canine Supplementary 2. Table 2: sequences generated on the study papillomavirus life cycle in pigmented lesions,” Veterinary and their accession numbers on GenBank. Microbiology,vol.162,no. 2-4, pp. 388–395,2013. Supplementary 3. Table 3: HPV6 and HPV11 sequences avail- [14] M.V.Batista,T. A.Ferreira,A.C.Freitas,and V. Q.Balbino,“An able on GenBank used on the phylogenetic analysis [60], [49], entropy-based approach for the identification of phylogeneti- [61], [42], [62], [63], [64], [65], [66], [67]. cally informative genomic regions of Papillomavirus,” Infection, Genetics and Evolution, vol. 11, no. 8, pp. 2026–2033, 2011. [15] M. Dunowska,J. S.Munday, R.E.Laurie, and S.F.K.Hills, References “Genomic characterisation of Felis catus papillomavirus 4, a novel papillomavirus detected in the oral cavity of a domestic [1] A. Meisels, R. Fortin, and M. Roy, “Condylomatous lesions of the cervix. II. Cytologic, colposcopic and histopathologic study,” cat,” Virus Genes,vol.48, no.1,pp.111–119, 2013. Advances in Virology 9 [16] M. Stanley, “Pathology and epidemiology of HPV infection in [32] A. Marcellusi, A. Capone, G. Favato et al., “Health utilities females,” Gynecologic Oncology,vol.117,supplement 2, pp.S5– lost and risk factors associated with HPV-induced diseases in S10, 2010. men and women: The HPV Italian collaborative study group,” Clinical eTh rapeutics ,vol.37,no.1,pp.156–167,2015. [17] C. U. Hubb ¨ ers and B. Akgul, ¨ “HPV and cancer of the oral cavity,” Virulence,vol.6,no.3, pp. 244–248,2015. [33] M. Sopori, “Eec ff ts of cigarette smoke on the immune system,” Nature Reviews Immunology, vol.2,no. 5,pp.372–377, 2002. [18] S. de Sanjose, ´ L. Bruni, and L. Alemany, “HPV in genital cancers (at the exception of cervical cancer) and anal cancers,” La Presse [34] E. Tamer, S. K. C¸akmak, M. N. Ilhan, and F. Artuz ¨ , “Demo- M´edicale,vol.43,no.12,pp.e423–e428, 2014. graphic characteristics and risk factors in Turkish patients with anogenital warts,” Journal of Infection and Public Health,vol.9, [19] A. Flaherty, T. Kim, A. Giuliano et al., “Implications for human no. 5, pp. 661–666, 2016. papillomavirus in penile cancer,” Urologic Oncology: Seminars and Original Investigations, vol.32, no.1,pp.53.e1–53.e8,2014. [35] A.Amador-Molina, J.F.Hernand ´ ez-Valencia, E. Lamoyi, A. Contreras-Paredes, and M. Lizano, “Role of innate immunity [20] C. Reuter,A.Ahmad, R. Warmanetal., “Methylationof HPV against human papillomavirus (HPV) infections and effect of and a tumor suppressor gene reveals anal cancer and precursor adjuvants in promoting specific immune response,” Viruses,vol. lesions,” Oncotarget, vol.8,2017. 5, no. 11, pp. 2624–2642, 2013. [21] M.Schiffman, P.E.Castle, J. Jeronimo, A.C. Rodriguez, and S. [36] L. F. Barroso, “er Th oleofHuman Papilloma Virus (HPV) Wacholder, “Human papillomavirus and cervical cancer,” The vaccination in the prevention of anal cancer in individuals Lancet,vol.370, no.9590, pp. 890–907,2007. with Human Immunodeficiency Virus-1 (HIV-1) infection,” [22] E. Hemper,M.Wittau,J.Lemke, M.Kornmann, and D. Therapeutic Advances in Vaccines , vol.1,no. 2,pp. 81–92,2013. Henne-Bruns, “Management of a giant perineal condylomata [37] L. Darwich, M. Canad ˜ as, S. Videla et al., “Prevalence, clearance, acuminata Case report,” GMS Interdiscip, vol.5,pp.1–5,2016. and incidence of human papillomavirus type–specific infection [23] J. God´ınez, S. Nicolas ´ -Parraga, ´ V. Pimenoff et al., “Phyloge- at the anal and penile site of HIV-infected men,” Sexually netically related, clinically different: human papillomaviruses Transmitted Diseases, vol.40,no.8,pp.611–618, 2013. 6 and 11 variants distribution in genital warts and in laryngeal [38] C. C. Soares, I. Georg, E. Lampe et al., “HIV-1, HBV, HCV, papillomatosis,” Clinical Microbiology and Infection,vol.20,no. HTLV, HPV-16/18, and treponema pallidum infections in a 6, pp. O406–O413, 2014. sample of brazilian men who have sex with men,” PLoS ONE, [24] K. F. Komloˇs, P. Koˇsorok, B. J. Kocjan, and M. Poljak, “Genetic vol. 9, no. 8, Article ID e102676, 2014. diversity of HPV-6 in concurrent multiple anogenital warts,” [39] J. Isola, S. DeVries, L. Chu, S. Ghazvini, and F. Waldman, “Anal- Acta Dermatovenerologica Alpina, Pannonica et Adriatica,vol. ysis of changes in DNA sequence copy number by comparative 22, no. 1, pp. 31–33, 2013. genomic hybridization in archival paraffin-embedded tumor [25] D. Krige, H. Mills, E. Berrie et al., “Sequence variation in the samples,” eTh American Journal of Pathology ,vol. 145, no. 6, pp. Early genes E1∧E4, E6 and E7 of Human Papilloma Virus type 1301–1308, 1994. 6,” Virus Research, vol.49, no.2, pp. 187–191,1997. [40] H. Bernard, S. Chan, M. M. Manos et al., “Identification and [26] R. D. Burk, Z. Chen, A. Harari et al., “Classification and assessment of known and novel human papillomaviruses by nomenclature system for human Alphapapillomavirus variants: polymerase chain reaction amplification, restriction fragment General features, nucleotide landmarks and assignment of length polymorphisms, nucleotide sequence, and phylogenetic HPV6 and HPV11 isolates to variant lineages,” Acta Derma- algorithms,” eTh Journal of Infectious Diseases ,vol.170,no.5, pp. tovenerologica Alpina, Pannonica et Adriatica,vol.20, no.3,pp. 1077–1085, 1994. 113–123, 2011. [41] A. L. Fuessel Haws, Q. He,P.L. Rady etal.,“Nested PCR with [27] J. Chansaenroj, A. eTh amboonlers, P. Junyangdikul, P. Supiya- the PGMY09/11 and GP5+/6+ primer sets improves detection of phan, and Y. Poovorawan, “Whole genome analysis of human HPV DNA in cervical samples,” Journal of Virological Methods, papillomavirus genotype 11 from cervix, larynx and lung,” Asian vol. 122, no. 1, pp. 87–93, 2004. Pacific Journal of Cancer Prevention ,vol.13,no.6,pp.2619–2623, 2012. [42] R. P. de Matos, L. Sichero, I. M. Mansur et al., “Nucleotide and phylogenetic analysis of human papillomavirus types 6 and 11 [28] S. Pande, N. Jain, B. K. Prusty et al., “Human papillomavirus isolated from recurrent respiratory papillomatosis in Brazil,” type 16 variant analysis of E6, E7, and L1 genes and long control Infection, Genetics and Evolution, vol.16,pp.282–289, 2013. region in biopsy samples from cervical cancer patients in North India,” Journal of Clinical Microbiology,vol.46,no. 3,pp.1060– [43] Y. E. Kim, J. Chen, R. Langen, and J. R. Chan, “Monitoring 1066, 2008. apoptosis and neuronal degeneration by real-time detection of phosphatidylserine externalization using a polarity-sensitive [29] R. Y. Seedat,C.E. Combrinck, P.A.Bester, J. Lee,and F. J.Burt, indicator of viability and apoptosis,” Nature Protocols,vol. 5, no. “Determination of the complete genome and functional analysis 8, pp. 1396–1405, 2010. of HPV6 isolate VBD19/10 from a patient with aggressive recur- rent respiratory papillomatosis,” Epidemiology and Infection, [44] T. Hall, “BioEdit: a user-friendly biological sequence alignment vol. 144, no. 10, pp. 2128–2135, 2016. editor and analysis program for Windows 95/98/NT,” Nucleic Acids Symposium Series, 1999. [30] E. Flores-D´ıaz, K. A. Sereday, S. Ferreira et al., “HPV-11 varia- bility, persistence and progression to genital warts in men: the [45] J. D. o Th mpson, T. J. Gibson, F. Plewniak, F. Jeanmougin, and HIM study,” Journal of General Virology,vol.98, no.9,pp.2339– D. G. Higgins, “eTh CLUSTAL X windows interface: flexible 2342, 2017. strategies for multiple sequence alignment aided by quality analysis tools,” Nucleic Acids Research,vol. 25,no.24, pp. 4876– [31] I. N. Mammas, D. A. Spandidos, and G. Sourvinos, “Genomic 4882, 1997. diversity of human papillomaviruses (HPV) and clinical impli- cations: An overview in adulthood and childhood,” Infection, [46] S. Guindon, J. Dufayard, V. Lefort, M. Anisimova, W. Hordijk, Genetics and Evolution, vol. 21, pp. 220–226, 2014. and O. Gascuel, “New algorithms and methods to estimate 10 Advances in Virology maximum-likelihood phylogenies: assessing the performance [62] K. J. Hofmann, J. C. Cook, J. G. Joyce et al., “Sequence of PhyML 3.0,” Systematic Biology,vol.59, no. 3,pp.307–321, determination of human papillomavirus type 6a and assembly 2010. of virus-like particles in saccharomyces cerevisiae,” Virology, vol.209, no.2,pp.506–518, 1995. [47] D. Posada, “jModelTest: phylogenetic model averaging,” Molec- ular Biology and Evolution,vol.25,no. 7,pp. 1253–1256, 2008. [63] B. J. Kocjan, M. M. Jelen, P. J. Maver, K. Seme, and M. Poljak, “Pre-vaccination genomic diversity of human papillomavirus [48] B. J. Kocjan, M. Poljak, M. Cimerman et al., “Prevaccination genotype 6 (HPV 6): A comparative analysis of 21 full-length genomic diversity of human papillomavirus genotype 6 (HPV genome sequences,” Infection, Genetics and Evolution,vol.11,no. 6),” Virology,vol.391, no. 2,pp.274–283, 2009. 7, pp. 1805–1810, 2011. [49] J. A. Danielewski, S. M. Garland, J. McCloskey, R. J. Hillman, S. [64] R.Kovelman,G. K.Bilter,A.Roman, D.R.Brown, and M. N. Tabrizi, and R. D. Burk, “Human Papillomavirus Type 6 and 11 Genetic Variants Found in 71 Oral and Anogenital Epithelial S. Barbosa, “Human papillomavirus type 6: Classification of clinical isolates and functional analysis of E2 proteins,” Journal Samples from Australia,” PLoS ONE,vol.8, no.5, Article ID e63892, pp. 1–9, 2013. of General Virology,vol. 80,pp.2445–2451, 1999. [50] J. P. Mosmann, M. S. Monetti, M. C. Frutos, A. X. Kiguen, R. [65] P. J. Maver, M. Poljak, K. Seme, and B. J. Kocjan, “Detection F. Venezuela, and C. G. Cuffini, “Mutation detection of E6 and and typing of low-risk human papillomavirus genotypes HPV LCR genes from HPV 16 associated with carcinogenesis,” Asian 6, HPV 11, HPV 42, HPV 43 and HPV 44 by polymerase Pacific Journal of Cancer Prevention , vol. 16, no. 3, pp. 1151–1157, chain reaction and restriction fragment length polymorphism,” 2015. Journal of Virological Methods, vol. 169, no. 1, pp. 215–218, 2010. [51] L. Ho,S.-Y. Chan, R. D.Burk etal.,“eTh genetic drift ofhuman [66] E. Schwarz, M. Durs ¨ t, C. Demankowski et al., “DNA sequence papillomavirus type 16 is a means of reconstructing prehistoric and genome organization of genital human papillomavirus type viral spread and the movement of ancient human populations,” 6b,” EMBO Journal,vol.2,no. 12,pp. 2341–2348, 1983. Journal of Virology,vol.67,no.11,pp. 6413–6423, 1993. [67] X. Wu, C.Zhang,S.Feng et al., “Detection ofHPV types and [52] C.-K. Ong, S.-Y. Chan, M. S. Campo et al., “Evolution of human neutralizing antibodies in Gansu province, China,” Journal of papillomavirus type 18: An ancient phylogenetic root in Africa Medical Virology, vol.81, no. 4,pp. 693–702, 2009. and intratype diversity reflect coevolution with human ethnic groups,” Journal of Virology, vol.67,no. 11, pp.6424–6431, 1993. [53] P. A. Heinzel, S.-Y. Chan, L. Ho et al., “Variation of human papillomavirus type 6 (HPV-6) and HPV-11 genomes sampled throughout the world,” Journal of Clinical Microbiology,vol. 33, no.7,pp.1746–1754, 1995. [54] M. M. Jelen, Z. Chen, B. J. Kocjan et al., “Global genomic diversity of human papillomavirus 6 based on 724 isolates and 190 complete genome sequences,” Journal of Virology, vol. 88, pp. 7307–7316, 2014. [55] E. Lavezzo, G. Masi, S. Toppo et al., “Characterization of intra- type variants of oncogenic human papillomaviruses by next- generation deep sequencing of the E6/E7 region,” Viruses,vol. 8, no. 3,p.79,2016. [56] C.-C. J. Wang, J. Sparano, and J. M. Palefsky, “Human immun- odeficiency virus/AIDS, human papillomavirus, and anal can- cer,” Surgical Oncology Clinics of North America,vol.26,no.1, pp. 17–31, 2017. [57] B.Auvert, P. Lissouba,E. Cutler,K.Zarca, A.Puren, and D. Taljaard, “Association of oncogenic and nononcogenic human papillomavirus with HIV incidence,” Journal of Acquired Immune Deficiency Syndromes , vol. 53, no. 1, pp. 111–116, 2010. [58] M. Soohoo, M. Blas, G. Byraiah, C. Carcamo, and B. Brown, “Cervical HPV infection in female sex workers: a global perspective,” The Open AIDS Journal ,vol.7,no.1,pp. 58–66, [59] A. A. Elmi, D. Bansal, A. Acharya et al., “Human papillomavirus (HPV) infection: molecular epidemiology, genotyping, sero- prevalence and associated risk factors among arab women in Qatar,” PLoS ONE,vol.12,no.1,Article ID e0169197, 2017. [60] C. E. Combrinck, R. Y. Seedat, C. Randall, Y. Roodt, and F. J. Burt, “Novel HPV-6 variants of human papillomavirus causing recurrent respiratory papillomatosis in southern Africa,” Epi- demiology and Infection, vol. 140, no. 06, pp. 1095–1101, 2012. [61] K. Dartmann, E. Schwarz, L. Gissmann, and H. zur Hausen, “eTh nucleotide sequence and genome organization of human papilloma virus type 11,” Virology,vol.151,no. 1,pp. 124–130, 1986. International Journal of Journal of Nucleic Acids Peptides The Scientific International Journal of International Journal of World Journal Cell Biology Microbiology Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi Hindawi http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Anatomy Biochemistry Research International Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com Advances in Genetics Bioinformatics Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Advances in International Journal of International Journal of Stem Cells BioMed Zoology Virolog y Genomics International Research International Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Neuroscience Journal Enzyme Journal of Journal of Research Parasitology Research Marine Biology Archaea Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal

Advances in Virology – Hindawi Publishing Corporation

Published: May 2, 2019

There are no references for this article.