Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Advances towards a Marker-Assisted Selection Breeding Program in Prairie Cordgrass, a Biomass Crop

Advances towards a Marker-Assisted Selection Breeding Program in Prairie Cordgrass, a Biomass Crop Hindawi Publishing Corporation International Journal of Plant Genomics Volume 2012, Article ID 313545, 8 pages doi:10.1155/2012/313545 Research Article Advances towards a Marker-Assisted Selection Breeding Program in Prairie Cordgrass, a Biomass Crop K. R. Gedye, J. L. Gonzalez-Hernandez, V. Owens, and A. Boe Department of Plant Sciences, South Dakota State University, Brookings, SD 57007, USA Correspondence should be addressedtoJ.L.Gonzalez-Hernandez, jose.gonzalez@sdstate.edu Received 3 August 2012; Accepted 29 October 2012 Academic Editor: Shizhong Xu Copyright © 2012 K. R. Gedye et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Prairie cordgrass (Spartina pectinata Bosc ex Link) is an indigenous, perennial grass of North America that is being developed into a cellulosic biomass crop suitable for biofuel production. Limited research has been performed into the breeding of prairie cordgrass; this research details an initial investigation into the development of a breeding program for this species. Genomic libraries enriched for four simple sequence repeat (SSR) motifs were developed, 25 clones from each library were sequenced, identifying 70 SSR regions, and primers were developed for these regions, 35 of which were amplified under standard PCR conditions. These SSR markers were used to validate the crossing methodology of prairie cordgrass and it was found that crosses between two plants occurred without the need for emasculation. The successful cross between two clones of prairie cordgrass indicates that this species is not self-incompatible. The results from this research will be used to instigate the production of a molecular map of prairie cordgrass which can be used to incorporate marker-assisted selection (MAS) protocols into a breeding program to improve this species for cellulosic biomass production. 1. Introduction cellulosic biofuel production. A research program at South Dakota State University (SDSU) is underway to develop Recent world issues associated with fuel consumption and native prairie cordgrass into a viable cellulosic biomass crop. supply have turned attention towards biofuel production, The development of a new crop species requires a multidisci- especially cellulosic biofuel. Perennial grasses provide an plinary approach; examining and validating each step before optimal source of cellulosic biomass due to their high commercialization can occur. These steps include, but are yield potential. Prairie cordgrass (Spartina pectinata Bosc not limited to, the assembling of a germplasm collection, the ex Link) is a perennial indigenous grass of North America development of an accelerated breeding program, and the and can be found as a native from Texas to near the optimization of cultivation practices. A fundamental step to Arctic Circle [1]. Ongoing studies on prairie cordgrass in accelerate the breeding of prairie cordgrass is to determine comparison with switchgrass (Panicum virgatum L.) indicate and optimize a crossing protocol. prairie cordgrass has that prairie cordgrass could produce more biomass than been intrinsically believed to be a protogynous outcrossing switchgrass [2]. Furthermore, results from the comparison species, based on the mode of reproduction of its maritime of prairie cordgrass and switchgrass performed by Boe and relative smooth cordgrass (Spartina alterniflora)[4, 5]. From Lee in 2007 [2] indicated that prairie cordgrass has a wider work performed upon other members of the Spartina environmental amplitude and is adapted to poorly drained genus, it has been conjectured that prairie cordgrass will wet areas which can have high salinity and be poorly aerated, have a similar method of reproduction. In the majority of regions not suitable for the production of conventional crops such as maize (Zea mays)[2, 3]. These results are indicative of other Graminaceae species, breeding is performed via the the potential of prairie cordgrass as a source of biomass for initial emasculation of the floret to ensure that only cross 2 International Journal of Plant Genomics pollination can occur. Prairie cordgrass has an inflorescence breeding program can result in a substantial increase in composed of between 0 and 31 short paracladia and 11– the incorporation of Fusarium head blight resistance, a 13 long paracladia [6], bearing a total of 10–80 fertile quantitative trait, in wheat with the shortest possible time. spikelets, of single florets [7]. Physical emasculation of The results of Wilde et al. [19] are indicative of the potential prairie cordgrass is essentially impractical, but this technique of MAS for the breeding of prairie cordgrass. may not be necessary as with protogyny and ascertaining This paper details the first investigation into initial breed- the appropriate timing, directed cross pollination is feasible. ing and crossing of prairie cordgrass, specifically the produc- Self pollination has not been identified previously in prairie tion of F individuals and the validation of a crossing pro- cordgrass and assumptions have been made that prairie tocol. Furthermore, the characterization of 35 microsatellite cordgrass may be self incompatible, if this is the case then loci in prairie cordgrass from genomic DNA is discussed. the classic mapping technique of producing recombinant The validation of the microsatellite loci occurred in a prairie inbred lines will be fundamentally impossible and alternate cordgrass germplasm collection and a reciprocal cross as an strategies will need to be utilized. initial step in the development of a molecular map, which can An initial stage of the prairie cordgrass project is to be further utilized during marker-assisted selection of lines develop a molecular map of the species. Only limited with traits desirable for the improvement of prairie cordgrass molecular analyses have been performed upon prairie as a biofuel crop. cordgrass, notably in contrast to its maritime relative S. alterniflora. In the National Centre for Biotechnology In- 2. Materials and Methods formation (NCBI), only 57 prairie cordgrass sequences have been deposited (predominantly regions of the nuclear and 2.1. Genomic Library Construction. Genomic DNA was ex- organelle genomes utilized for diversity analysis, that is, tracted from four lines of prairie cordgrass using the Waxy (AY508655 and AF372461), ITS (AF019843, AJ489796, method as described by Karakousis and Langridge in and EF153082) and the chloroplast trnL-trnF intergenic 2003 [20], with minor modifications. A mixture of the spacer region (EF137568, EU056305, and AF372625)). A four random prairie cordgrass clones DNA, totaling > recent publication on the analysis of the transcriptome 100 µg, was sent to Genetic Identification Services (GIS) of prairie cordgrass has increased the available knowledge (http://www.genetic-id-services.com/) for the development on the genome of the species [8]. Constructed from the of genomic libraries. The genomic libraries were enriched analysis of the expression sequence tags (ESTs) and identified for the four simple sequence repeat (SSR) motifs (CA) , from the transcriptome of prairie cordgrass, a total of (GA) ,(AAG) ,and (CAG) . Subsamples of 100 clones n n n 26,302 contigs and 71,103 singletons were assembled with were sequenced and primers were designed to flank the SSR all sequence information available as supplemental data regions using DesignerPCR, version 1.03 (Research Genetics, [8]. Additional molecular analysis of genetic diversity of Inc.) and PRIMER 3 [21]. The SSR regions were classified prairie cordgrass in natural populations in Minnesota with according to Jones et al. [22] as being pure repeats (i.e., amplified fragment length polymorphism (AFLP) has been [N N ] ), compound repeats (i.e., [N N ] [N N ] ), and 1 2 1 2 3 4 X X Y performed [9]. interrupted repeats (i.e., [N N ] N [N N ] ). 1 2 X 3 4 5 Y An optimal marker system for the development of a molecular map of prairie cordgrass are SSRs or microsatel- lites. Microsatellites are highly utilized molecular markers 2.2. Plant Material. Wild germplasm has been collected from and have been developed for the majority of agronomically throughout the mid-western states of the United States, and economically important crop species [10]; their efficacy creating a core germplasm collection to be utilized in prairie arises predominantly due to their reproducibility, codomi- cordgrass breeding (unpublished data). A geographically nant inheritance, and abundance [11]. Modern techniques diverse sample of sixteen plants, collected from South allow the rapid identification of microsatellite regions in Dakota, North Dakota, Minnesota, and Iowa, was character- species which have limited sequence information, and by ized using the identified SSR loci. A sample from the closely using proprietary genomic library screening techniques, related species S. spartinae was also included to examine cross microsatellites have been developed for numerous non- species amplification. The germplasm collection was grown model organisms, encompassing insects [12], birds [13], fish in standard greenhouse conditions. [14], mammals [15], and plants, including other species Crosses between and amongst these genotypes were in the Spartina genera [16]. Previous studies on other performed. Crossing between two plants of prairie cordgrass members of the Spartina genera have developed 35 markers was performed in the following manner; two inflorescence for microsatellite loci in S. alterniflora [16, 17]. Of these S. at the appropriate stage of development were placed inside a alterniflora markers, three have been found to amplify in crossing bag for seven days, producing F plants (Figure 1). A prairie cordgrass [16]. SSRs have been used extensively in reciprocal cross between two genotypes (designated RR2 and numerous crop species, in wheat (Triticum aestivum L.), and RR21) from the Red River morphotype was produced. The another Poaceae species; SSRs have been used to enhance reciprocal cross produced 45 F plants from the RR21 × RR2 molecular maps begun with restriction fragment length directedcross and49F plants from the RR2× RR21 directed polymorphism (RFLP) and to identify genes of interest cross, a total of 94 plants. Two genotypes identified as clones [18]. Furthermore, Wilde et al. in 2007 [19] found that the (designated SP1.1B and SP1.2A) from the SSR evaluation incorporation of MAS with SSR markers into a traditional were crossed via the same technique, producing a total of International Journal of Plant Genomics 3 3. Results 3.1. Germplasm and Crossing. The crossing of the germplasm collection was successful with the production of a total of 14,813 putatively viable seeds from 110 crosses, performed in lines and collected from 48 distinct collection locations (Table 1). Numerous nonviable seeds were produced from each cross. A seed was determined to be viable if the actual seed (endosperm and embryo) was visible within the glumes (Figure 2). Thenumberofviableseedsproducedper head varied from 6 to 642, with an average of 134 seeds per cross. The crosses can be grouped into two, dependent upon the parents, those that were outcrossed and those that were selfed. Crosses that were designated “out” were between genotypes that were geographically diverse, while crosses designated “self ” were produced from members of the population collected at the same location. The average number of seeds produced from outcrossed individuals was 143, with a range of 12 to 250, while selfed individuals Figure 1: Two prairie cordgrass heads undergoing crossing, con- produced an average of 112 seeds per cross, with a range of 6 tained within a single bag. to 642 (Figure 3). 46 F individuals; a total of 20 F plants were produced 3.2. Microsatellite Characterization. Of the total 100 genomic 1 1 clones sequenced, 70 contained microsatellite motifs, 26 when SP1.1B was used as the maternal parent and 26 F plants when SP1.2A was used as the maternal parent. All F from the (CA) enriched library, 25 from the (GA) enriched n n library, 3 from the (AAG) enriched library, and 16 from the plants and their respective parents were grown in standard n (CAG) enriched library. All 70 loci were examined and 35 greenhouse conditions. were amplified with the standardized conditions (Table 2). The repeat SSR structure that occurred most frequently was 2.3. DNA Extraction and Evaluation of SSR Primers. DNA the pure repeat (27), followed by the compound repeat was extracted from all examined plants using the method (7) and only one interrupted repeat sequence was found as described by Karakousis and Langridge in 2003 [20], (Table 2). with minor modifications. Evaluation of the primers was Only two primers produced monomorphic profiles from performed in a PCR reaction consisting of 2 U Taq DNA the analysis of the sixteen lines, SPSD004 from the (GA) polymerase (Promega GoTaq), 1 × PCR Buffer (Promega library and SPSD048 from the (AAG) library. The remain- GoTaq), 2 mM MgCl , 0.6 mM dNTPs, and 0.6 mM of each ing primers produced between 1 and 12 scorable bands. Of primer, with a final volume of 20 µL[23]. PCR reactions the examined primers, 11 were amplified between 1 and 7 were performed in a BioRad MyCycler (BioRad, Hercules, bands in S. spartinae (Table 2). CA). Initially a gradient of annealing temperatures was used All sequences were examined using BLASTn [27]on to determine optimal T , as these primers were designed the National Center for Biotechnology Information (NCBI) to be utilized in a prairie cordgrass breeding program, server for similarities to other recorded sequences. Only a robust and high-throughput protocol was developed. two of the prairie cordgrass sequences displayed homology Specific thermocycling conditions for the primers used in −20 (e ≤ e ) to recorded sequences, SPSD003 to six sequences this study were as follows: an initial denaturation at 94 C ◦ from rice, wheat, and field mustard (Brassica rapa) (acces- for 5 minutes, followed by 35 cycles of 94 Cfor1minute, sion numbers: AP008214.1, AP005495.3, NM 001067901.1, ◦ ◦ 53 or 55 Cfor 1minute, 72 Cfor 1minute, followed by an AK111788.1, EU660901.1, and AC189183.2) and SPSD050 ◦ ◦ extension step of 72 Cfor 10 minutes, anda10 Chold. PCR to five sequences all from rice (accession numbers: product was visualized on 8% nondenaturing PAGE; bands CR855236.1, AP008210.1, AL606607.3, NM 001059819.1, were scored and sized by comparison to a 100 bp ladder using and AK108706.1) [25]. AlphaEaseFC Software (Alpha Innotech, San Leandro, CA). 2.4. SSR Markers Analysis. Polymorphic bands in the two 3.3. Crossing Population. A total of 94 individuals from examined populations described above were scored on a the RR2 × RR21 and the RR21 × RR2 crosses were presence (1) or absence (0) basis. An estimation of genetic examined with 35 SSR primers. The amplified bands were distance was calculated with Nei and Li’s algorithm [24] scored based on presence or absence, the resulting data was and the resulting matrix was clustered with unweighted analyzed with Nei and Li’s coefficient producing a similarity pair group method with arithmetic mean (UPGMA) [25]. matrix (data not shown), and the data was clustered with Analysis was performed using multivariate statistics package UPGMA producing a dendogram (Figure 4). The results of (MVSP) [26]. the dendogram indicate that each individual was a cross 4 International Journal of Plant Genomics Table 1: Summary of crosses performed amongst the core prairie Table 1: Continued. cordgrass germplasm collection. The type of cross is designated Female Male Number of Total no. “Out” for crosses between geographically diverse members and Type parent parent crosses of seeds “Self ” for members of the population collected at the same location. SP67 SP45 2 Out 583 Female Male Number of Total no. SP67 SP53 1 Out 185 Type parent parent crosses of seeds SP7 SP46 1 Out 160 SP1 SP21 2 Out 126 SP72 SP1 1 Out 125 SP1 SP71 1 Out 71 SP72 SP30 2 Out 459 SP21 SP30 1 Out 51 SP75 SP13 1 Out 59 SP21 SP31 6 Out 484 SP77 SP72 1 Out 163 SP21 SP4 2 Out 248 SP77 SP79 1 Out 184 SP21 SP42 1 Out 78 SP78 SP35 1 Out 94 SP21 SP66 2 Out 233 SP78 SP79 1 Out 113 SP21 SP7 1 Out 82 SP82 SP14 1 Out 642 SP24 SP30 1 Out 180 SP21 SP21 13 Self 1470 SP29 SP22 1 Out 146 SP22 SP22 1 Self 110 SP29 SP30 1 Out 42 SP31 SP31 13 Self 1377 SP3 SP77 1 Out 282 SP40 SP40 1 Self 126 SP30 SP31 1 Out 164 SP41 SP41 2 Self 393 SP30 SP52 1 Out 246 SP53 SP53 1 Self 12 SP31 SP21 4 Out 408 SP74 SP74 2 Self 229 SP31 SP30 1 Out 28 SP31 SP32 1 Out 38 SP31 SP46 3 Out 211 between the two parents. When the population derived from SP31 SP5 1 Out 81 the cross between the two plants (SP1.1B and SP1.2A) and SP31 SP66 1 Out 46 determined to be clones was examined, bands present in both parents were found to segregate in the progeny (data SP31 SP79 1 Out 198 not shown), indicative of sexual recombination; this result SP32 SP21 1 Out 173 provides validation that successful crossing occurred. SP32 SP31 2 Out 310 SP32 SP45 1 Out 296 SP32 SP66 1 Out 240 4. Discussion SP32 SP67 1 Out 193 The primary requirement of any breeding program is to SP32 SP78 1 Out 94 ensure that accurate crosses are made; in many other SP35 SP78 1 Out 279 members of the Poaceae this is achieved by physical or SP41 SP42 1 Out 6 chemical emasculation. The prolific numbers of flowers SP41 SP45 1 Out 86 per head in addition to the small size of the flowers SP44 SP54 1 Out 312 make physical emasculation unfeasible. Furthermore, due to limited knowledge about the nature of the fertility of this SP44 SP59 1 Out 274 species, chemical emasculation has not been developed for SP45 SP31 1 Out 282 prairie cordgrass. The results from the SSR analysis indicate SP45 SP49 1 Out 225 that utilizing the inherent protogyny of prairie cordgrass SP45 SP67 1 Out 138 allows successful crossing between two individuals without SP49 SP40 1 Out 203 the need for emasculation, confirming the validity of the SP49 SP45 1 Out 176 breeding methodology used. The presence of individuals in SP49 SP66 2 Out 237 the F mapping populations which show limited genetic SP5 SP31 1 Out 189 dissimilarity from the parents could be evidence of selfing; further investigations are required. The presence of these SP5 SP78 1 Out 407 potential selfed individuals indicates that future breeding SP53 SP67 2 Out 43 and/or mapping populations should be examined with the SP54 SP44 1 Out 145 molecular markers devised in this research to remove suspect SP54 SP59 2 Out 81 individuals. Subsequently, the successful crossing between SP56 SP58 1 Out 235 two clones is indicative that prairie cordgrass may not be self- SP65 SP57 1 Out 70 incompatible and that it may be possible to develop in this SP66 SP31 1 Out 93 species conventional mapping populations, such as recom- SP67 SP32 1 Out 99 binant inbred lines. Further studies into self-compatibility International Journal of Plant Genomics 5 50 100 150 200 250 300 350 400 450 500 550 600 650 Seeds per cross Figure 3: Summary graph of results of crosses between members of the core germplasm collection of prairie cordgrass. White bars indicate self crosses and black bars indicate out crosses. (a) 0.4 0.5 0.6 0.7 0.8 0.9 1 Nei and Li’s coefficient Parent 1—RR21 Parent 2—RR2 F progeny with RR21 as maternal parent F progeny with RR2 as maternal parent Figure 4: Unrooted dendogram clustered with UPGMA of the genetic association of the F progeny from a cross between prairie (b) cordgrass lines RR21 and RR2, from the analysis of SSR regions with Nei and Li’s Coefficient of genetic similarity. Figure 2: Prairie cordgrass seeds photographs taken over a light box. Illuminating prairie cordgrass with light box is used to distinguish the presence of a developed embryo in the seeds. (a) Non-viable seeds. (b) Viable seeds. to examine genes identified in related species in prairie cordgrass, specifically genes utilized to examine phylogeny with investigations into potential apomictic prairie cordgrass (i.e., the waxy gene for granule bound starch synthase). plants are underway. The number of seeds observed in The prevalence and distribution of SSR regions across this research appears to be larger than what was previously plant genomes are extremely variable. Variation in SSRs is described by Clayton et al. [7]. The variation between the two not limited to their location, but also their motif, putative studies can be attributed to both environmental and genetic function, abundance, and repeat number [28]. The results variations. Genetic variation in seed set in prairie cordgrass, of this analysis indicate that the two dinucleotide repeats although at this stage not quantified, is demonstrated by the (CA) and (GA) are more prevalent in prairie cordgrass n n range in viable seed set observed in this research. (31% and 46%, resp.), than the two trinucleotide repeats The amplification of S. spartinae with the SSR primers (AAG) and (CAG) (6% and 17%, resp.). The prevalence n n developed in this research are indicative of the potential of the dinucleotide motif in prairie cordgrass is similar colinearity amongst the genomes of Spartina spp. and other to what was observed in the characterization of SSRs in grass species; this colinearity will allow easier identification other Spartina sp., where Blum et al. [16] found 82% and characterization of genes. The colinearity between of isolated SSRs contained dinucleotide repeats and Sloop prairie cordgrass and other Poaceae is currently utilized et al. [17] found 71% containing similar motifs. In all three Count 6 International Journal of Plant Genomics Table 2: Summary and description of primer sequences designed for SSR regions identified in prairie cordgrass and their amplification products. Expected size Size range T Locus Library Primer sequence (5 3 ) SSR motif GenBank ID (bp) (bp) ( C) F: GCTGCTCCTCTTCTCTGTCT (CA) ( ) 180 212–386 55 SPSD001 CA GQ354531 R: ACGGCACACTTAGTTTTCTG Perfect F: GCACTGTTTGGTGATGCTC (CA) ( ) 249 100–655 55 SPSD002 CA GQ354532 R: CTGACGCAAGGTTGATGAG Perfect F: ATGGTTTCACAAGTCGGAAGT (GT) ( ) 166 215–432 55 SPSD009 CA GQ354533 R: CAGGGCTGCCTACAAGATG Perfect F: AACCAAAAGGATAGACCCTA (CA) (CA) 168 127–310 53 GQ354534 SPSD010 R: ACGAAATATGTGACCGATAC Perfect F: CTAACGTATGTCGTTCATGTGG (GT) (CA) 135 147–251 53 GQ354535 SPSD011 R: AAGGCGATTTTAAGAGGCTAAG Perfect F: GGGATGCTTTGTAGATAAGAAA (CA) (CA) 157 85–173 55 GQ354536 SPSD013 R: TCTTCCTCTTTACTCTGTCACC Perfect F: CCGACTACGAGCCACATT (CA) (CA) 155 156–268 53 GQ354537 SPSD016 R: GTTCCACACATACGAAGGAGA Perfect F: CCTGCTTACTCTTACTCCGTC (CA) (GA) 13 7 (CA) 134 220–365 53 GQ354538 SPSD019 R: ACCCTTTTTTCTTTTGGTCTC Compound F: ATGAGACGATAGCAGGATGAC (CA) (CA) 178 146–288 55 GQ354539 SPSD020 R: AGCAGATTACGATTCAGATGG Perfect F: CAGTCCATGCAACTCAGAAGTA (CT) (CA) 10 38 (CA) 269 204–748 55 GQ354540 SPSD025 R: AACCTGATAGAAGTGGTCATGC Compound F: GTGGAATCAACAACACCAGA (GA) (GT) 13 20 (CA) 209 196–539 55 GQ354541 SPSD026 R: GTCGCTTTAGCCCGTAAG Compound F: ATGGAAACTGTCTGGAACTGAC (CT) (GA) 294 231–263 55 GQ354542 SPSD003 R: AGCAATAACCACAGAAGAGACC Perfect F: TCAAACAATGGCGGAGAAG (CT) (GA) 214 188–224 55 GQ354543 SPSD027 R: CTGGCTCCACCTCTTTGG Perfect F: GTTGCTCGGTTCCAGTTG (GA) 178 133 & 164 55 (GA) GQ354544 SPSD004 R: CGCCACACAAAAGTAGCC Perfect F: TCGCACTTTTGATTCTCTTTAC (CT) 188 155–346 53 (GA) GQ354545 SPSD031 R: TGGATGGATTAGGTTACTGTTG Perfect F: CTCTCGCCCATTGCTACTTA (CT) 196 146–193 53 (GA) GQ354546 SPSD032 R: CCATTGCTATGTTGTTTGAGC Perfect F: CAGGTCTACGGAGGTCACTAC (CT) 160 144–306 53 (GA) GQ354564 SPSD034 R: TCAAAAGAAGAGCACATACACA Perfect F: TTCACCACACCACTTTATCC (CT) 271 222–260 53 (GA) GQ354547 SPSD036 R: GGAAGCAACAAACATTGATG Perfect F: CTTTCAGATAGCTCCACTGATC (GA) 206 193–448 55 (GA) GQ354548 SPSD039 R: AGCAATAACTGTGCATACCTCT Perfect F: AATCGAAGTAGCAGACACCAAC (GA) 214 190–416 55 (GA) GQ354549 SPSD040 R: CATGCGTTTTTCACTCATGTAG Perfect F: CCCAACGATGATTTCTCTTG (GA) 135 104–180 53 (GA) GQ354550 SPSD041 R: TCACGGTAACACGATTAGTCC Perfect F: ACCTCCCACTCGTTGCTAC (CT) 211 131–257 53 SPSD042 (GA) GQ354551 R: GCCATTGCTCTGTTGTTTG Perfect F: GTTCAAATGCGAACAAATCAG (GA) 277 231–252 53 SPSD043 (GA) GQ354552 R: ATTCGATCTCACATGCAACAC Perfect International Journal of Plant Genomics 7 Table 2: Continued. Expected size Size range T Library Primer sequence (5 3 ) SSR motif GenBank ID Locus (bp) (bp) ( C) F: AGCTATATGACCCGAGACTGTG (GA) 275 254–276 55 (GA) GQ354553 SPSD044 R: GGAATGGTCCCATACTTAATCC Perfect F: AACGGAGGAAGTAATAAATAGC (CT) 241 214–426 53 (GA) GQ354554 SPSD045 R: AGCACACACTAGCAAGGAC Perfect F: CAGGTTTATCAGTGAAGACATC (TA) (GA) 9 12 278 57–426 53 (GA) GQ354555 SPSD046 R: GAGGTTCTTAAAGGAACATAGC Compound F: CCACCTTCCTTGGATACAC (CT) 194 156–326 53 (GA) GQ354556 SPSD047 R: CCACAACTACCACCTC Perfect F: TGAACCAACATAACCTACCTG (TTC) 297 192–452 55 (AAG) GQ354557 SPSD005 R: CCACACTAAACCGAAACTTG Perfect F: AAGGGCATAGTTTCAACCAAG (AAG) 197 88 55 (AAG) GQ354565 SPSD048 R: CTTTTGCTTGTTCATCAACATG Perfect F: AATCCTTCGCCTATCCTACAC (CTG) (CT) 8 9 168 146–519 55 (CAG) GQ354558 SPSD007 R: TTCACACAGCAGACAGAACTG Compound F: GCAAGAACAGACTCAAGAGC (CAG) (CAA) (CAG) (CAA) 9 4 4 2 276 144–309 55 (CAG) GQ354559 SPSD008 R: CTGCTGCTGAAGTAAAAGTTG Compound F: TGGATTGTTTCCTGATACTCCA (TTG) (CTG) 5 5 299 303–667 53 SPSD049 (CAG) GQ354560 R: CCATAAATTGCTGCATTATTCC Compound F: GAAGCAGAAAACACAGTATTGC (CTG) 225 225–505 53 SPSD050 (CAG) GQ354561 R: TTGCTGGAATTTAACCTATCTG Perfect F: ACGCCTTCTTCACTCCAAC (CTG) 208 166–316 53 SPSD053 (CAG) GQ354562 R: GCCACCAGTTTTCATCACC Perfect F: GTTCTCCAAAGTCTCCTCCT (TCC) TTC(TCC) 6 2 79–230 53 SPSD056 (CAG) GQ354563 R: ATCTTTACCTTCCTTCTGGG Interrupted studies the di- and trinucleotide repeats occurred as perfect, References compound, and interrupted motifs. Based on the results [1] USDA-NRCS, Plants Database, USDA-NRCS, Urbandale, found in this research, the genomic libraries enriched with Iowa, USA, 2008. the dinucleotide repeats have been extensively sequenced; the [2] A. Boe and D. K. Lee, “Genetic variation for biomass pro- resulting sequence information will be screened to isolate duction in prairie cordgrass and switchgrass,” Crop Science, additional SSR regions, primers will be designed, and the vol. 47, no. 3, pp. 929–934, 2007. resulting markers will be used to develop a molecular map [3] J. L. Gonzalez-Hernandez, G. Sarath, J. M. Stein, V. Owens, K. of prairie cordgrass. The molecular map will then be used Gedye, and A. Boe, “A multiple species approach to biomass to find linkage between SSR markers and traits of interest production from native herbaceous perennial feedstocks,” In allowing future MAS to be performed. Vitro Cellular and Developmental Biology-Plant, vol. 45, no. 3, pp. 267–281, 2009. [4] X. Fang, P. K. Subudhi, B. C. Venuto, and S. A. Harrison, “Mode of pollination, pollen germination, and seed set in smooth cordgrass (Spartina alterniflora, Poaceae),” Interna- Acknowledgments tional Journal of Plant Sciences, vol. 165, no. 3, pp. 395–401, The authors want to thank S. G. Dwire for his technical [5] X. Fang, P. K. Subudhi, B. C. Venuto, S. A. Harrison, and A. B. assistance. The research described in this paper was funded Ryan, “Influence of flowering phenology on seed production in part by grants from the North Central Sun Grant Initiative in smooth cordgrass (Spartina alterniflora Loisel.),” Aquatic and from the USDA Feedstock Genomics Program to J. L. Botany, vol. 80, no. 2, pp. 139–151, 2004. Gonzalez-Hernandez, A. Boe, and V. Owens and additional [6] V.G.Kern, N. J. Guarise, andA.C.Vegetti,“Inflorescence support from the South Dakota Agricultural Experimental structure in species of Spartina Schreb. (Poaceae: Chlori- Station. The authors acknowledge the use of the SDSU-FGCF doideae: Cynodonteae),” Plant Systematics and Evolution, vol. supported in part by NSF/EPSCoR Grant no. 0091948 and by 273, no. 1-2, pp. 51–61, 2008. the State of South Dakota. [7] W.D.Clayton,M.S.Vorontsova, K. T. Harman,and H. 8 International Journal of Plant Genomics Williamson, GrassBase-The Online World Grass Flora, 2006. Town & Country Convention Center, San Diego, Calif, USA, [8] K. Gedye, J. Gonzalez-Hernandez, Y. Ban et al., “Investigation January 2011. of the transcriptome of Prairie Cord grass, a new cellulosic [24] M. Nei and W. H. Li, “Mathematical model for studying biomass crop,” The Plant Genome Journal,vol. 3, no.2,pp. genetic variation in terms of restriction endonucleases,” Pro- 69–80, 2010. ceedings of the National Academy of Sciences of the United States [9] K.M.Moncada,N.J.Ehlke,G.J.Muehlbauer, C. C. Sheaffer, of America, vol. 76, no. 10, pp. 5269–5273, 1979. D. L. Wyse, and L. R. DeHaan, “Genetic variation in three [25] P. H. A. Sneath and R. R. Sokal, Numerical Taxonomy, W.H. native plant species across the State of Minnesota,” Crop Freeman and Company, San Francisco, Calif, USA, 1973. Science, vol. 47, no. 6, pp. 2379–2389, 2007. [26] W. L. Kovach, MVSP-A Multivariate Statistical Package For [10] L. Cardle, L. Ramsay, D. Milbourne, M. Macaulay, D. Marshall, Windows, Kovach Computing Services: Pentraeth, Walesm, and R. Waugh, “Computational and experimental charac- UK, 1998. terization of physically clustered simple sequence repeats in [27] Z. Zhang, S. Schwartz, L. Wagner, and W. Miller, “A greedy plants,” Genetics, vol. 156, no. 2, pp. 847–854, 2000. algorithm for aligning DNA sequences,” Journal of Computa- [11] R. K. Varshney, A. Graner, and M. E. Sorrells, “Genic tional Biology, vol. 7, no. 1-2, pp. 203–214, 2000. microsatellite markers in plants: features and applications,” [28] Y.-C. Li, A. B. Korol, T. Fahima, A. Beiles, and E. Nevo, “Mic- Trends in Biotechnology, vol. 23, no. 1, pp. 48–55, 2005. rosatellites: genomic distribution, putative functions and [12] A. E. Van’tHof,B.J.Zwaan,I.J.Saccheri, D. Daly,A.N.M. mutational mechanisms: a review,” Molecular Ecology, vol. 11, Bot, and P. M. Brakefield, “Characterization of 28 microsatel- no. 12, pp. 2453–2465, 2002. lite loci for the butterfly Bicyclus anynana,” Molecular Ecology Notes, vol. 5, no. 1, pp. 169–172, 2005. [13] V. Saladin, D. Bonfils, T. Binz, and H. Richner, “Isolation and characterization of 16 microsatellite loci in the Great Tit Parus major,” Molecular Ecology Notes, vol. 3, no. 4, pp. 520–522, [14] T. L. King, M. S. Eackles, and B. H. Letcher, “Microsatellite DNA markers for the study of Atlantic salmon (Salmo salar) kinship, population structure, and mixed-fishery analyses,” Molecular Ecology Notes, vol. 5, no. 1, pp. 130–132, 2005. [15] M. M. Peacock, V. S. Kirchoff, and S. J. Merideth, “Identifica- tion and characterization of nine polymorphic microsatellite loci in the North American pika, Ochotona princeps,” Molec- ular Ecology Notes, vol. 2, no. 3, pp. 360–362, 2002. [16] M. J. Blum,C.M.Sloop,D.R.Ayres,and D. R. Strong, “Characterization of microsatellite loci in Spartina species (Poaceae),” Molecular Ecology Notes, vol. 4, no. 1, pp. 39–42, [17] C. M. Sloop, H. G. McGray,M.J.Blum, andD.R.Strong, “Characterization of 24 additional microsatellite loci in Spartina species (Poaceae),” Conservation Genetics, vol. 6, no. 6, pp. 1049–1052, 2005. [18] S. Landjeva, V. Korzun, and A. Bor ¨ ner, “Molecular markers: actual and potential contributions to wheat genome character- ization and breeding,” Euphytica, vol. 156, no. 3, pp. 271–296, [19] F. Wilde, V. Korzun, E. Ebmeyer, H. H. Geiger, and T. Miedaner, “Comparison of phenotypic and marker-based se- lection for Fusarium head blight resistance and DON content in spring wheat,” Molecular Breeding, vol. 19, no. 4, pp. 357– 370, 2007. [20] A. Karakousis and P. Langridge, “High-throughput plant DNA extraction method formarkeranalysis,” Plant Molecular Biology Reporter, vol. 21, no. 1, 2003. [21] S. Rozen and H. Skaletsky, “Primer3 on the WWW for general users and for biologist programmers.,” Methods in Molecular Biology, vol. 132, pp. 365–386, 2000. [22] E. S. Jones, M. P. Dupal, R. Kol ¨ liker, M. C. Drayton, and J. W. Forster, “Development and characterization of simple sequence repeat (SSR) markers for perennial ryegrass (Lolium perenne L.),” Theoretical and Applied Genetics, vol. 102, no. 2- 3, pp. 405–415, 2001. [23] K. Gedye, J. Gonzalez-Hernandez, R. Schuelke, V. Owens, and A. Boe, “Development of SSR markers from genomic DNA and ESTs in prairie cordgrass, a cellulosic biomass crop,” in Proceedings of the Plant & Animal Genomes XIX Conference, International Journal of Peptides Advances in International Journal of BioMed Stem Cells Virolog y Research International International Genomics Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Journal of Nucleic Acids International Journal of Zoology Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Submit your manuscripts at http://www.hindawi.com The Scientific Journal of Signal Transduction World Journal Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 International Journal of Advances in Genetics Anatomy Biochemistry Research International Research International Microbiology Research International Bioinformatics Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Enzyme Journal of International Journal of Molecular Biology Archaea Research Evolutionary Biology International Marine Biology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png International Journal of Plant Genomics Hindawi Publishing Corporation

Advances towards a Marker-Assisted Selection Breeding Program in Prairie Cordgrass, a Biomass Crop

Loading next page...
 
/lp/hindawi-publishing-corporation/advances-towards-a-marker-assisted-selection-breeding-program-in-dg5u3yQ2L0
Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2012 K. R. Gedye et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-5370
DOI
10.1155/2012/313545
Publisher site
See Article on Publisher Site

Abstract

Hindawi Publishing Corporation International Journal of Plant Genomics Volume 2012, Article ID 313545, 8 pages doi:10.1155/2012/313545 Research Article Advances towards a Marker-Assisted Selection Breeding Program in Prairie Cordgrass, a Biomass Crop K. R. Gedye, J. L. Gonzalez-Hernandez, V. Owens, and A. Boe Department of Plant Sciences, South Dakota State University, Brookings, SD 57007, USA Correspondence should be addressedtoJ.L.Gonzalez-Hernandez, jose.gonzalez@sdstate.edu Received 3 August 2012; Accepted 29 October 2012 Academic Editor: Shizhong Xu Copyright © 2012 K. R. Gedye et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Prairie cordgrass (Spartina pectinata Bosc ex Link) is an indigenous, perennial grass of North America that is being developed into a cellulosic biomass crop suitable for biofuel production. Limited research has been performed into the breeding of prairie cordgrass; this research details an initial investigation into the development of a breeding program for this species. Genomic libraries enriched for four simple sequence repeat (SSR) motifs were developed, 25 clones from each library were sequenced, identifying 70 SSR regions, and primers were developed for these regions, 35 of which were amplified under standard PCR conditions. These SSR markers were used to validate the crossing methodology of prairie cordgrass and it was found that crosses between two plants occurred without the need for emasculation. The successful cross between two clones of prairie cordgrass indicates that this species is not self-incompatible. The results from this research will be used to instigate the production of a molecular map of prairie cordgrass which can be used to incorporate marker-assisted selection (MAS) protocols into a breeding program to improve this species for cellulosic biomass production. 1. Introduction cellulosic biofuel production. A research program at South Dakota State University (SDSU) is underway to develop Recent world issues associated with fuel consumption and native prairie cordgrass into a viable cellulosic biomass crop. supply have turned attention towards biofuel production, The development of a new crop species requires a multidisci- especially cellulosic biofuel. Perennial grasses provide an plinary approach; examining and validating each step before optimal source of cellulosic biomass due to their high commercialization can occur. These steps include, but are yield potential. Prairie cordgrass (Spartina pectinata Bosc not limited to, the assembling of a germplasm collection, the ex Link) is a perennial indigenous grass of North America development of an accelerated breeding program, and the and can be found as a native from Texas to near the optimization of cultivation practices. A fundamental step to Arctic Circle [1]. Ongoing studies on prairie cordgrass in accelerate the breeding of prairie cordgrass is to determine comparison with switchgrass (Panicum virgatum L.) indicate and optimize a crossing protocol. prairie cordgrass has that prairie cordgrass could produce more biomass than been intrinsically believed to be a protogynous outcrossing switchgrass [2]. Furthermore, results from the comparison species, based on the mode of reproduction of its maritime of prairie cordgrass and switchgrass performed by Boe and relative smooth cordgrass (Spartina alterniflora)[4, 5]. From Lee in 2007 [2] indicated that prairie cordgrass has a wider work performed upon other members of the Spartina environmental amplitude and is adapted to poorly drained genus, it has been conjectured that prairie cordgrass will wet areas which can have high salinity and be poorly aerated, have a similar method of reproduction. In the majority of regions not suitable for the production of conventional crops such as maize (Zea mays)[2, 3]. These results are indicative of other Graminaceae species, breeding is performed via the the potential of prairie cordgrass as a source of biomass for initial emasculation of the floret to ensure that only cross 2 International Journal of Plant Genomics pollination can occur. Prairie cordgrass has an inflorescence breeding program can result in a substantial increase in composed of between 0 and 31 short paracladia and 11– the incorporation of Fusarium head blight resistance, a 13 long paracladia [6], bearing a total of 10–80 fertile quantitative trait, in wheat with the shortest possible time. spikelets, of single florets [7]. Physical emasculation of The results of Wilde et al. [19] are indicative of the potential prairie cordgrass is essentially impractical, but this technique of MAS for the breeding of prairie cordgrass. may not be necessary as with protogyny and ascertaining This paper details the first investigation into initial breed- the appropriate timing, directed cross pollination is feasible. ing and crossing of prairie cordgrass, specifically the produc- Self pollination has not been identified previously in prairie tion of F individuals and the validation of a crossing pro- cordgrass and assumptions have been made that prairie tocol. Furthermore, the characterization of 35 microsatellite cordgrass may be self incompatible, if this is the case then loci in prairie cordgrass from genomic DNA is discussed. the classic mapping technique of producing recombinant The validation of the microsatellite loci occurred in a prairie inbred lines will be fundamentally impossible and alternate cordgrass germplasm collection and a reciprocal cross as an strategies will need to be utilized. initial step in the development of a molecular map, which can An initial stage of the prairie cordgrass project is to be further utilized during marker-assisted selection of lines develop a molecular map of the species. Only limited with traits desirable for the improvement of prairie cordgrass molecular analyses have been performed upon prairie as a biofuel crop. cordgrass, notably in contrast to its maritime relative S. alterniflora. In the National Centre for Biotechnology In- 2. Materials and Methods formation (NCBI), only 57 prairie cordgrass sequences have been deposited (predominantly regions of the nuclear and 2.1. Genomic Library Construction. Genomic DNA was ex- organelle genomes utilized for diversity analysis, that is, tracted from four lines of prairie cordgrass using the Waxy (AY508655 and AF372461), ITS (AF019843, AJ489796, method as described by Karakousis and Langridge in and EF153082) and the chloroplast trnL-trnF intergenic 2003 [20], with minor modifications. A mixture of the spacer region (EF137568, EU056305, and AF372625)). A four random prairie cordgrass clones DNA, totaling > recent publication on the analysis of the transcriptome 100 µg, was sent to Genetic Identification Services (GIS) of prairie cordgrass has increased the available knowledge (http://www.genetic-id-services.com/) for the development on the genome of the species [8]. Constructed from the of genomic libraries. The genomic libraries were enriched analysis of the expression sequence tags (ESTs) and identified for the four simple sequence repeat (SSR) motifs (CA) , from the transcriptome of prairie cordgrass, a total of (GA) ,(AAG) ,and (CAG) . Subsamples of 100 clones n n n 26,302 contigs and 71,103 singletons were assembled with were sequenced and primers were designed to flank the SSR all sequence information available as supplemental data regions using DesignerPCR, version 1.03 (Research Genetics, [8]. Additional molecular analysis of genetic diversity of Inc.) and PRIMER 3 [21]. The SSR regions were classified prairie cordgrass in natural populations in Minnesota with according to Jones et al. [22] as being pure repeats (i.e., amplified fragment length polymorphism (AFLP) has been [N N ] ), compound repeats (i.e., [N N ] [N N ] ), and 1 2 1 2 3 4 X X Y performed [9]. interrupted repeats (i.e., [N N ] N [N N ] ). 1 2 X 3 4 5 Y An optimal marker system for the development of a molecular map of prairie cordgrass are SSRs or microsatel- lites. Microsatellites are highly utilized molecular markers 2.2. Plant Material. Wild germplasm has been collected from and have been developed for the majority of agronomically throughout the mid-western states of the United States, and economically important crop species [10]; their efficacy creating a core germplasm collection to be utilized in prairie arises predominantly due to their reproducibility, codomi- cordgrass breeding (unpublished data). A geographically nant inheritance, and abundance [11]. Modern techniques diverse sample of sixteen plants, collected from South allow the rapid identification of microsatellite regions in Dakota, North Dakota, Minnesota, and Iowa, was character- species which have limited sequence information, and by ized using the identified SSR loci. A sample from the closely using proprietary genomic library screening techniques, related species S. spartinae was also included to examine cross microsatellites have been developed for numerous non- species amplification. The germplasm collection was grown model organisms, encompassing insects [12], birds [13], fish in standard greenhouse conditions. [14], mammals [15], and plants, including other species Crosses between and amongst these genotypes were in the Spartina genera [16]. Previous studies on other performed. Crossing between two plants of prairie cordgrass members of the Spartina genera have developed 35 markers was performed in the following manner; two inflorescence for microsatellite loci in S. alterniflora [16, 17]. Of these S. at the appropriate stage of development were placed inside a alterniflora markers, three have been found to amplify in crossing bag for seven days, producing F plants (Figure 1). A prairie cordgrass [16]. SSRs have been used extensively in reciprocal cross between two genotypes (designated RR2 and numerous crop species, in wheat (Triticum aestivum L.), and RR21) from the Red River morphotype was produced. The another Poaceae species; SSRs have been used to enhance reciprocal cross produced 45 F plants from the RR21 × RR2 molecular maps begun with restriction fragment length directedcross and49F plants from the RR2× RR21 directed polymorphism (RFLP) and to identify genes of interest cross, a total of 94 plants. Two genotypes identified as clones [18]. Furthermore, Wilde et al. in 2007 [19] found that the (designated SP1.1B and SP1.2A) from the SSR evaluation incorporation of MAS with SSR markers into a traditional were crossed via the same technique, producing a total of International Journal of Plant Genomics 3 3. Results 3.1. Germplasm and Crossing. The crossing of the germplasm collection was successful with the production of a total of 14,813 putatively viable seeds from 110 crosses, performed in lines and collected from 48 distinct collection locations (Table 1). Numerous nonviable seeds were produced from each cross. A seed was determined to be viable if the actual seed (endosperm and embryo) was visible within the glumes (Figure 2). Thenumberofviableseedsproducedper head varied from 6 to 642, with an average of 134 seeds per cross. The crosses can be grouped into two, dependent upon the parents, those that were outcrossed and those that were selfed. Crosses that were designated “out” were between genotypes that were geographically diverse, while crosses designated “self ” were produced from members of the population collected at the same location. The average number of seeds produced from outcrossed individuals was 143, with a range of 12 to 250, while selfed individuals Figure 1: Two prairie cordgrass heads undergoing crossing, con- produced an average of 112 seeds per cross, with a range of 6 tained within a single bag. to 642 (Figure 3). 46 F individuals; a total of 20 F plants were produced 3.2. Microsatellite Characterization. Of the total 100 genomic 1 1 clones sequenced, 70 contained microsatellite motifs, 26 when SP1.1B was used as the maternal parent and 26 F plants when SP1.2A was used as the maternal parent. All F from the (CA) enriched library, 25 from the (GA) enriched n n library, 3 from the (AAG) enriched library, and 16 from the plants and their respective parents were grown in standard n (CAG) enriched library. All 70 loci were examined and 35 greenhouse conditions. were amplified with the standardized conditions (Table 2). The repeat SSR structure that occurred most frequently was 2.3. DNA Extraction and Evaluation of SSR Primers. DNA the pure repeat (27), followed by the compound repeat was extracted from all examined plants using the method (7) and only one interrupted repeat sequence was found as described by Karakousis and Langridge in 2003 [20], (Table 2). with minor modifications. Evaluation of the primers was Only two primers produced monomorphic profiles from performed in a PCR reaction consisting of 2 U Taq DNA the analysis of the sixteen lines, SPSD004 from the (GA) polymerase (Promega GoTaq), 1 × PCR Buffer (Promega library and SPSD048 from the (AAG) library. The remain- GoTaq), 2 mM MgCl , 0.6 mM dNTPs, and 0.6 mM of each ing primers produced between 1 and 12 scorable bands. Of primer, with a final volume of 20 µL[23]. PCR reactions the examined primers, 11 were amplified between 1 and 7 were performed in a BioRad MyCycler (BioRad, Hercules, bands in S. spartinae (Table 2). CA). Initially a gradient of annealing temperatures was used All sequences were examined using BLASTn [27]on to determine optimal T , as these primers were designed the National Center for Biotechnology Information (NCBI) to be utilized in a prairie cordgrass breeding program, server for similarities to other recorded sequences. Only a robust and high-throughput protocol was developed. two of the prairie cordgrass sequences displayed homology Specific thermocycling conditions for the primers used in −20 (e ≤ e ) to recorded sequences, SPSD003 to six sequences this study were as follows: an initial denaturation at 94 C ◦ from rice, wheat, and field mustard (Brassica rapa) (acces- for 5 minutes, followed by 35 cycles of 94 Cfor1minute, sion numbers: AP008214.1, AP005495.3, NM 001067901.1, ◦ ◦ 53 or 55 Cfor 1minute, 72 Cfor 1minute, followed by an AK111788.1, EU660901.1, and AC189183.2) and SPSD050 ◦ ◦ extension step of 72 Cfor 10 minutes, anda10 Chold. PCR to five sequences all from rice (accession numbers: product was visualized on 8% nondenaturing PAGE; bands CR855236.1, AP008210.1, AL606607.3, NM 001059819.1, were scored and sized by comparison to a 100 bp ladder using and AK108706.1) [25]. AlphaEaseFC Software (Alpha Innotech, San Leandro, CA). 2.4. SSR Markers Analysis. Polymorphic bands in the two 3.3. Crossing Population. A total of 94 individuals from examined populations described above were scored on a the RR2 × RR21 and the RR21 × RR2 crosses were presence (1) or absence (0) basis. An estimation of genetic examined with 35 SSR primers. The amplified bands were distance was calculated with Nei and Li’s algorithm [24] scored based on presence or absence, the resulting data was and the resulting matrix was clustered with unweighted analyzed with Nei and Li’s coefficient producing a similarity pair group method with arithmetic mean (UPGMA) [25]. matrix (data not shown), and the data was clustered with Analysis was performed using multivariate statistics package UPGMA producing a dendogram (Figure 4). The results of (MVSP) [26]. the dendogram indicate that each individual was a cross 4 International Journal of Plant Genomics Table 1: Summary of crosses performed amongst the core prairie Table 1: Continued. cordgrass germplasm collection. The type of cross is designated Female Male Number of Total no. “Out” for crosses between geographically diverse members and Type parent parent crosses of seeds “Self ” for members of the population collected at the same location. SP67 SP45 2 Out 583 Female Male Number of Total no. SP67 SP53 1 Out 185 Type parent parent crosses of seeds SP7 SP46 1 Out 160 SP1 SP21 2 Out 126 SP72 SP1 1 Out 125 SP1 SP71 1 Out 71 SP72 SP30 2 Out 459 SP21 SP30 1 Out 51 SP75 SP13 1 Out 59 SP21 SP31 6 Out 484 SP77 SP72 1 Out 163 SP21 SP4 2 Out 248 SP77 SP79 1 Out 184 SP21 SP42 1 Out 78 SP78 SP35 1 Out 94 SP21 SP66 2 Out 233 SP78 SP79 1 Out 113 SP21 SP7 1 Out 82 SP82 SP14 1 Out 642 SP24 SP30 1 Out 180 SP21 SP21 13 Self 1470 SP29 SP22 1 Out 146 SP22 SP22 1 Self 110 SP29 SP30 1 Out 42 SP31 SP31 13 Self 1377 SP3 SP77 1 Out 282 SP40 SP40 1 Self 126 SP30 SP31 1 Out 164 SP41 SP41 2 Self 393 SP30 SP52 1 Out 246 SP53 SP53 1 Self 12 SP31 SP21 4 Out 408 SP74 SP74 2 Self 229 SP31 SP30 1 Out 28 SP31 SP32 1 Out 38 SP31 SP46 3 Out 211 between the two parents. When the population derived from SP31 SP5 1 Out 81 the cross between the two plants (SP1.1B and SP1.2A) and SP31 SP66 1 Out 46 determined to be clones was examined, bands present in both parents were found to segregate in the progeny (data SP31 SP79 1 Out 198 not shown), indicative of sexual recombination; this result SP32 SP21 1 Out 173 provides validation that successful crossing occurred. SP32 SP31 2 Out 310 SP32 SP45 1 Out 296 SP32 SP66 1 Out 240 4. Discussion SP32 SP67 1 Out 193 The primary requirement of any breeding program is to SP32 SP78 1 Out 94 ensure that accurate crosses are made; in many other SP35 SP78 1 Out 279 members of the Poaceae this is achieved by physical or SP41 SP42 1 Out 6 chemical emasculation. The prolific numbers of flowers SP41 SP45 1 Out 86 per head in addition to the small size of the flowers SP44 SP54 1 Out 312 make physical emasculation unfeasible. Furthermore, due to limited knowledge about the nature of the fertility of this SP44 SP59 1 Out 274 species, chemical emasculation has not been developed for SP45 SP31 1 Out 282 prairie cordgrass. The results from the SSR analysis indicate SP45 SP49 1 Out 225 that utilizing the inherent protogyny of prairie cordgrass SP45 SP67 1 Out 138 allows successful crossing between two individuals without SP49 SP40 1 Out 203 the need for emasculation, confirming the validity of the SP49 SP45 1 Out 176 breeding methodology used. The presence of individuals in SP49 SP66 2 Out 237 the F mapping populations which show limited genetic SP5 SP31 1 Out 189 dissimilarity from the parents could be evidence of selfing; further investigations are required. The presence of these SP5 SP78 1 Out 407 potential selfed individuals indicates that future breeding SP53 SP67 2 Out 43 and/or mapping populations should be examined with the SP54 SP44 1 Out 145 molecular markers devised in this research to remove suspect SP54 SP59 2 Out 81 individuals. Subsequently, the successful crossing between SP56 SP58 1 Out 235 two clones is indicative that prairie cordgrass may not be self- SP65 SP57 1 Out 70 incompatible and that it may be possible to develop in this SP66 SP31 1 Out 93 species conventional mapping populations, such as recom- SP67 SP32 1 Out 99 binant inbred lines. Further studies into self-compatibility International Journal of Plant Genomics 5 50 100 150 200 250 300 350 400 450 500 550 600 650 Seeds per cross Figure 3: Summary graph of results of crosses between members of the core germplasm collection of prairie cordgrass. White bars indicate self crosses and black bars indicate out crosses. (a) 0.4 0.5 0.6 0.7 0.8 0.9 1 Nei and Li’s coefficient Parent 1—RR21 Parent 2—RR2 F progeny with RR21 as maternal parent F progeny with RR2 as maternal parent Figure 4: Unrooted dendogram clustered with UPGMA of the genetic association of the F progeny from a cross between prairie (b) cordgrass lines RR21 and RR2, from the analysis of SSR regions with Nei and Li’s Coefficient of genetic similarity. Figure 2: Prairie cordgrass seeds photographs taken over a light box. Illuminating prairie cordgrass with light box is used to distinguish the presence of a developed embryo in the seeds. (a) Non-viable seeds. (b) Viable seeds. to examine genes identified in related species in prairie cordgrass, specifically genes utilized to examine phylogeny with investigations into potential apomictic prairie cordgrass (i.e., the waxy gene for granule bound starch synthase). plants are underway. The number of seeds observed in The prevalence and distribution of SSR regions across this research appears to be larger than what was previously plant genomes are extremely variable. Variation in SSRs is described by Clayton et al. [7]. The variation between the two not limited to their location, but also their motif, putative studies can be attributed to both environmental and genetic function, abundance, and repeat number [28]. The results variations. Genetic variation in seed set in prairie cordgrass, of this analysis indicate that the two dinucleotide repeats although at this stage not quantified, is demonstrated by the (CA) and (GA) are more prevalent in prairie cordgrass n n range in viable seed set observed in this research. (31% and 46%, resp.), than the two trinucleotide repeats The amplification of S. spartinae with the SSR primers (AAG) and (CAG) (6% and 17%, resp.). The prevalence n n developed in this research are indicative of the potential of the dinucleotide motif in prairie cordgrass is similar colinearity amongst the genomes of Spartina spp. and other to what was observed in the characterization of SSRs in grass species; this colinearity will allow easier identification other Spartina sp., where Blum et al. [16] found 82% and characterization of genes. The colinearity between of isolated SSRs contained dinucleotide repeats and Sloop prairie cordgrass and other Poaceae is currently utilized et al. [17] found 71% containing similar motifs. In all three Count 6 International Journal of Plant Genomics Table 2: Summary and description of primer sequences designed for SSR regions identified in prairie cordgrass and their amplification products. Expected size Size range T Locus Library Primer sequence (5 3 ) SSR motif GenBank ID (bp) (bp) ( C) F: GCTGCTCCTCTTCTCTGTCT (CA) ( ) 180 212–386 55 SPSD001 CA GQ354531 R: ACGGCACACTTAGTTTTCTG Perfect F: GCACTGTTTGGTGATGCTC (CA) ( ) 249 100–655 55 SPSD002 CA GQ354532 R: CTGACGCAAGGTTGATGAG Perfect F: ATGGTTTCACAAGTCGGAAGT (GT) ( ) 166 215–432 55 SPSD009 CA GQ354533 R: CAGGGCTGCCTACAAGATG Perfect F: AACCAAAAGGATAGACCCTA (CA) (CA) 168 127–310 53 GQ354534 SPSD010 R: ACGAAATATGTGACCGATAC Perfect F: CTAACGTATGTCGTTCATGTGG (GT) (CA) 135 147–251 53 GQ354535 SPSD011 R: AAGGCGATTTTAAGAGGCTAAG Perfect F: GGGATGCTTTGTAGATAAGAAA (CA) (CA) 157 85–173 55 GQ354536 SPSD013 R: TCTTCCTCTTTACTCTGTCACC Perfect F: CCGACTACGAGCCACATT (CA) (CA) 155 156–268 53 GQ354537 SPSD016 R: GTTCCACACATACGAAGGAGA Perfect F: CCTGCTTACTCTTACTCCGTC (CA) (GA) 13 7 (CA) 134 220–365 53 GQ354538 SPSD019 R: ACCCTTTTTTCTTTTGGTCTC Compound F: ATGAGACGATAGCAGGATGAC (CA) (CA) 178 146–288 55 GQ354539 SPSD020 R: AGCAGATTACGATTCAGATGG Perfect F: CAGTCCATGCAACTCAGAAGTA (CT) (CA) 10 38 (CA) 269 204–748 55 GQ354540 SPSD025 R: AACCTGATAGAAGTGGTCATGC Compound F: GTGGAATCAACAACACCAGA (GA) (GT) 13 20 (CA) 209 196–539 55 GQ354541 SPSD026 R: GTCGCTTTAGCCCGTAAG Compound F: ATGGAAACTGTCTGGAACTGAC (CT) (GA) 294 231–263 55 GQ354542 SPSD003 R: AGCAATAACCACAGAAGAGACC Perfect F: TCAAACAATGGCGGAGAAG (CT) (GA) 214 188–224 55 GQ354543 SPSD027 R: CTGGCTCCACCTCTTTGG Perfect F: GTTGCTCGGTTCCAGTTG (GA) 178 133 & 164 55 (GA) GQ354544 SPSD004 R: CGCCACACAAAAGTAGCC Perfect F: TCGCACTTTTGATTCTCTTTAC (CT) 188 155–346 53 (GA) GQ354545 SPSD031 R: TGGATGGATTAGGTTACTGTTG Perfect F: CTCTCGCCCATTGCTACTTA (CT) 196 146–193 53 (GA) GQ354546 SPSD032 R: CCATTGCTATGTTGTTTGAGC Perfect F: CAGGTCTACGGAGGTCACTAC (CT) 160 144–306 53 (GA) GQ354564 SPSD034 R: TCAAAAGAAGAGCACATACACA Perfect F: TTCACCACACCACTTTATCC (CT) 271 222–260 53 (GA) GQ354547 SPSD036 R: GGAAGCAACAAACATTGATG Perfect F: CTTTCAGATAGCTCCACTGATC (GA) 206 193–448 55 (GA) GQ354548 SPSD039 R: AGCAATAACTGTGCATACCTCT Perfect F: AATCGAAGTAGCAGACACCAAC (GA) 214 190–416 55 (GA) GQ354549 SPSD040 R: CATGCGTTTTTCACTCATGTAG Perfect F: CCCAACGATGATTTCTCTTG (GA) 135 104–180 53 (GA) GQ354550 SPSD041 R: TCACGGTAACACGATTAGTCC Perfect F: ACCTCCCACTCGTTGCTAC (CT) 211 131–257 53 SPSD042 (GA) GQ354551 R: GCCATTGCTCTGTTGTTTG Perfect F: GTTCAAATGCGAACAAATCAG (GA) 277 231–252 53 SPSD043 (GA) GQ354552 R: ATTCGATCTCACATGCAACAC Perfect International Journal of Plant Genomics 7 Table 2: Continued. Expected size Size range T Library Primer sequence (5 3 ) SSR motif GenBank ID Locus (bp) (bp) ( C) F: AGCTATATGACCCGAGACTGTG (GA) 275 254–276 55 (GA) GQ354553 SPSD044 R: GGAATGGTCCCATACTTAATCC Perfect F: AACGGAGGAAGTAATAAATAGC (CT) 241 214–426 53 (GA) GQ354554 SPSD045 R: AGCACACACTAGCAAGGAC Perfect F: CAGGTTTATCAGTGAAGACATC (TA) (GA) 9 12 278 57–426 53 (GA) GQ354555 SPSD046 R: GAGGTTCTTAAAGGAACATAGC Compound F: CCACCTTCCTTGGATACAC (CT) 194 156–326 53 (GA) GQ354556 SPSD047 R: CCACAACTACCACCTC Perfect F: TGAACCAACATAACCTACCTG (TTC) 297 192–452 55 (AAG) GQ354557 SPSD005 R: CCACACTAAACCGAAACTTG Perfect F: AAGGGCATAGTTTCAACCAAG (AAG) 197 88 55 (AAG) GQ354565 SPSD048 R: CTTTTGCTTGTTCATCAACATG Perfect F: AATCCTTCGCCTATCCTACAC (CTG) (CT) 8 9 168 146–519 55 (CAG) GQ354558 SPSD007 R: TTCACACAGCAGACAGAACTG Compound F: GCAAGAACAGACTCAAGAGC (CAG) (CAA) (CAG) (CAA) 9 4 4 2 276 144–309 55 (CAG) GQ354559 SPSD008 R: CTGCTGCTGAAGTAAAAGTTG Compound F: TGGATTGTTTCCTGATACTCCA (TTG) (CTG) 5 5 299 303–667 53 SPSD049 (CAG) GQ354560 R: CCATAAATTGCTGCATTATTCC Compound F: GAAGCAGAAAACACAGTATTGC (CTG) 225 225–505 53 SPSD050 (CAG) GQ354561 R: TTGCTGGAATTTAACCTATCTG Perfect F: ACGCCTTCTTCACTCCAAC (CTG) 208 166–316 53 SPSD053 (CAG) GQ354562 R: GCCACCAGTTTTCATCACC Perfect F: GTTCTCCAAAGTCTCCTCCT (TCC) TTC(TCC) 6 2 79–230 53 SPSD056 (CAG) GQ354563 R: ATCTTTACCTTCCTTCTGGG Interrupted studies the di- and trinucleotide repeats occurred as perfect, References compound, and interrupted motifs. Based on the results [1] USDA-NRCS, Plants Database, USDA-NRCS, Urbandale, found in this research, the genomic libraries enriched with Iowa, USA, 2008. the dinucleotide repeats have been extensively sequenced; the [2] A. Boe and D. K. Lee, “Genetic variation for biomass pro- resulting sequence information will be screened to isolate duction in prairie cordgrass and switchgrass,” Crop Science, additional SSR regions, primers will be designed, and the vol. 47, no. 3, pp. 929–934, 2007. resulting markers will be used to develop a molecular map [3] J. L. Gonzalez-Hernandez, G. Sarath, J. M. Stein, V. Owens, K. of prairie cordgrass. The molecular map will then be used Gedye, and A. Boe, “A multiple species approach to biomass to find linkage between SSR markers and traits of interest production from native herbaceous perennial feedstocks,” In allowing future MAS to be performed. Vitro Cellular and Developmental Biology-Plant, vol. 45, no. 3, pp. 267–281, 2009. [4] X. Fang, P. K. Subudhi, B. C. Venuto, and S. A. Harrison, “Mode of pollination, pollen germination, and seed set in smooth cordgrass (Spartina alterniflora, Poaceae),” Interna- Acknowledgments tional Journal of Plant Sciences, vol. 165, no. 3, pp. 395–401, The authors want to thank S. G. Dwire for his technical [5] X. Fang, P. K. Subudhi, B. C. Venuto, S. A. Harrison, and A. B. assistance. The research described in this paper was funded Ryan, “Influence of flowering phenology on seed production in part by grants from the North Central Sun Grant Initiative in smooth cordgrass (Spartina alterniflora Loisel.),” Aquatic and from the USDA Feedstock Genomics Program to J. L. Botany, vol. 80, no. 2, pp. 139–151, 2004. Gonzalez-Hernandez, A. Boe, and V. Owens and additional [6] V.G.Kern, N. J. Guarise, andA.C.Vegetti,“Inflorescence support from the South Dakota Agricultural Experimental structure in species of Spartina Schreb. (Poaceae: Chlori- Station. The authors acknowledge the use of the SDSU-FGCF doideae: Cynodonteae),” Plant Systematics and Evolution, vol. supported in part by NSF/EPSCoR Grant no. 0091948 and by 273, no. 1-2, pp. 51–61, 2008. the State of South Dakota. [7] W.D.Clayton,M.S.Vorontsova, K. T. Harman,and H. 8 International Journal of Plant Genomics Williamson, GrassBase-The Online World Grass Flora, 2006. Town & Country Convention Center, San Diego, Calif, USA, [8] K. Gedye, J. Gonzalez-Hernandez, Y. Ban et al., “Investigation January 2011. of the transcriptome of Prairie Cord grass, a new cellulosic [24] M. Nei and W. H. Li, “Mathematical model for studying biomass crop,” The Plant Genome Journal,vol. 3, no.2,pp. genetic variation in terms of restriction endonucleases,” Pro- 69–80, 2010. ceedings of the National Academy of Sciences of the United States [9] K.M.Moncada,N.J.Ehlke,G.J.Muehlbauer, C. C. Sheaffer, of America, vol. 76, no. 10, pp. 5269–5273, 1979. D. L. Wyse, and L. R. DeHaan, “Genetic variation in three [25] P. H. A. Sneath and R. R. Sokal, Numerical Taxonomy, W.H. native plant species across the State of Minnesota,” Crop Freeman and Company, San Francisco, Calif, USA, 1973. Science, vol. 47, no. 6, pp. 2379–2389, 2007. [26] W. L. Kovach, MVSP-A Multivariate Statistical Package For [10] L. Cardle, L. Ramsay, D. Milbourne, M. Macaulay, D. Marshall, Windows, Kovach Computing Services: Pentraeth, Walesm, and R. Waugh, “Computational and experimental charac- UK, 1998. terization of physically clustered simple sequence repeats in [27] Z. Zhang, S. Schwartz, L. Wagner, and W. Miller, “A greedy plants,” Genetics, vol. 156, no. 2, pp. 847–854, 2000. algorithm for aligning DNA sequences,” Journal of Computa- [11] R. K. Varshney, A. Graner, and M. E. Sorrells, “Genic tional Biology, vol. 7, no. 1-2, pp. 203–214, 2000. microsatellite markers in plants: features and applications,” [28] Y.-C. Li, A. B. Korol, T. Fahima, A. Beiles, and E. Nevo, “Mic- Trends in Biotechnology, vol. 23, no. 1, pp. 48–55, 2005. rosatellites: genomic distribution, putative functions and [12] A. E. Van’tHof,B.J.Zwaan,I.J.Saccheri, D. Daly,A.N.M. mutational mechanisms: a review,” Molecular Ecology, vol. 11, Bot, and P. M. Brakefield, “Characterization of 28 microsatel- no. 12, pp. 2453–2465, 2002. lite loci for the butterfly Bicyclus anynana,” Molecular Ecology Notes, vol. 5, no. 1, pp. 169–172, 2005. [13] V. Saladin, D. Bonfils, T. Binz, and H. Richner, “Isolation and characterization of 16 microsatellite loci in the Great Tit Parus major,” Molecular Ecology Notes, vol. 3, no. 4, pp. 520–522, [14] T. L. King, M. S. Eackles, and B. H. Letcher, “Microsatellite DNA markers for the study of Atlantic salmon (Salmo salar) kinship, population structure, and mixed-fishery analyses,” Molecular Ecology Notes, vol. 5, no. 1, pp. 130–132, 2005. [15] M. M. Peacock, V. S. Kirchoff, and S. J. Merideth, “Identifica- tion and characterization of nine polymorphic microsatellite loci in the North American pika, Ochotona princeps,” Molec- ular Ecology Notes, vol. 2, no. 3, pp. 360–362, 2002. [16] M. J. Blum,C.M.Sloop,D.R.Ayres,and D. R. Strong, “Characterization of microsatellite loci in Spartina species (Poaceae),” Molecular Ecology Notes, vol. 4, no. 1, pp. 39–42, [17] C. M. Sloop, H. G. McGray,M.J.Blum, andD.R.Strong, “Characterization of 24 additional microsatellite loci in Spartina species (Poaceae),” Conservation Genetics, vol. 6, no. 6, pp. 1049–1052, 2005. [18] S. Landjeva, V. Korzun, and A. Bor ¨ ner, “Molecular markers: actual and potential contributions to wheat genome character- ization and breeding,” Euphytica, vol. 156, no. 3, pp. 271–296, [19] F. Wilde, V. Korzun, E. Ebmeyer, H. H. Geiger, and T. Miedaner, “Comparison of phenotypic and marker-based se- lection for Fusarium head blight resistance and DON content in spring wheat,” Molecular Breeding, vol. 19, no. 4, pp. 357– 370, 2007. [20] A. Karakousis and P. Langridge, “High-throughput plant DNA extraction method formarkeranalysis,” Plant Molecular Biology Reporter, vol. 21, no. 1, 2003. [21] S. Rozen and H. Skaletsky, “Primer3 on the WWW for general users and for biologist programmers.,” Methods in Molecular Biology, vol. 132, pp. 365–386, 2000. [22] E. S. Jones, M. P. Dupal, R. Kol ¨ liker, M. C. Drayton, and J. W. Forster, “Development and characterization of simple sequence repeat (SSR) markers for perennial ryegrass (Lolium perenne L.),” Theoretical and Applied Genetics, vol. 102, no. 2- 3, pp. 405–415, 2001. [23] K. Gedye, J. Gonzalez-Hernandez, R. Schuelke, V. Owens, and A. Boe, “Development of SSR markers from genomic DNA and ESTs in prairie cordgrass, a cellulosic biomass crop,” in Proceedings of the Plant & Animal Genomes XIX Conference, International Journal of Peptides Advances in International Journal of BioMed Stem Cells Virolog y Research International International Genomics Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Journal of Nucleic Acids International Journal of Zoology Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Submit your manuscripts at http://www.hindawi.com The Scientific Journal of Signal Transduction World Journal Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 International Journal of Advances in Genetics Anatomy Biochemistry Research International Research International Microbiology Research International Bioinformatics Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Enzyme Journal of International Journal of Molecular Biology Archaea Research Evolutionary Biology International Marine Biology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Journal

International Journal of Plant GenomicsHindawi Publishing Corporation

Published: Nov 26, 2012

References