Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

The significance of HERC5, IFIH1, SAMD4, SEMA3A and MCTP1 genes expression in resistance to cytotoxic drugs in ovarian cancer cell lines

The significance of HERC5, IFIH1, SAMD4, SEMA3A and MCTP1 genes expression in resistance to... Resistance to chemotherapy is the main obstacle in contemporary ovarian cancer treatment. The aim of this study was the evaluation of expression of HERC5, IFIH1, SAMD4, MCTP1 and SEMA3A mRNA and as- sessment their role in resistance to cisplatin, paclitaxel, doxorubicin and topotecan in seven ovarian cancer cell lines. MTT assay was used in resistance assessment. Quantitative polymerase chain reaction was per- formed to measure the expression levels of the genes. We observed different levels of resistance among cell lines. The resistance was not related to the expression of drug transporters genes. The expression of HERC5 and IFIH1 genes was upregulated, and the expression of SEMA3A gene was downregulated. Expression of SAMD4 was upregulated in PEA1, PEA2, and PEO23 cell lines, and expression of MCTP1 was downregula- ted in A2780, PEA2, and PEO23 cell lines. Upregulation of HERC5, IFIH1, and SAMD4 and downregulation of SEMA3A and MCTP1 in TOP-resistant ovarian cancer cell lines may suggest some role of those genes in topotecan resistance development. Running title: Expressions of selected genes in ovarian cancer cell lines Keywords: ovarian cancer; cytotoxic drug resistance; new genes Department of Histology and Embryology, Poznań University of Medical Ściences, Poznań, Poland Department of Infectious Diseases, Hepatology and Acquired Immunodeficiency, Poznań University of Medical Ściences, Poland Department of Anatomy and Histology, Collegium Medicum, University of Zielona Góra, Zielona Góra, Poland Division of Histology and Embryology, Department of Human Morphology and Embryology, Wrocław Medical University, Wrocław, Poland *Correspondence: mnowacka@ump.edu.pl Full list of author information is available at the end of article 139 Nowacka et al. Medical Journal of Cell Biology (2021) terferon-induced E3 protein ligase responsible for Introduction the ISGylation of protein targets [23]. During onco- Epithelial ovarian cancer (EOC) is one of the most gene-mediated-transformation HERC5-dependent aggressive tumors and the most common cause of p53 ISGylation plays a role in p53 inactivation [24]. death from gynecological malignancies [1,2]. In most In prostate cancer expression of HERC5 and ISGyla- cases, the diagnosis comes in advanced disease with tion affects the proliferation of cells, indicating their intraperitoneal metastasis [3]. The standard treat- role in malignant transformation [25]. Recently, we ment includes surgery with the following chemo- have observed increased expression of HERC5 gene therapy. The first line of chemotherapy consists of in different TOP-resistant and sensitive EOC cell lines the combination of platinum compounds (cisplatin after first explosion to TOP [20]. IFIH1 encoded by - CIS or carboplatin) and taxanes (paclitaxel - PAC) Melanoma Differentiation-Associated gene 5 (MDA- [4]. Although most patients are sensitive to the first 5) is a cytosolic receptor and plays an important role line of chemotherapy, about five percent of patients in the first line of defense against viral infection [26]. are already resistant at the beginning of treatment. However, the ectopic expression of the IFIH1 gene Among initially sensitive patients, most will devel- can also induce the death of melanoma cells [27]. op drug resistance and will require further therapy We have previously observed increased expression with other drugs [4]. However, the response to the of the IFIH1 gene in TOP-resistant EOC cell lines de- second-line of chemotherapy is usually low because veloped from W1, A2780 and SKOV-3 drug-sensitive of the different existing mechanisms of drug resis- cell lines [21]. SAMD4 (Sterile Alpha Motif Domain tance [4]. CIS is an essential drug used in ovarian containing 4A), also known as a SMAUG1, is a regula- cancer chemotherapy [4]. The effect of its action in tory protein that regulates target mRNAs by binding the cell is an inhibition of DNA replication and RNA to Smaug Recognition Elements (SREs) [28]. It plays transcription in consequence of DNA cross-linking a role in post-transcriptional regulation of genes ex- [5]. Different types of CIS-resistance mechanisms in pression by inhibition of translation and mRNA de- cancer cells have been described so far. The most cay [28, 29]. In our research, we observed increased important are: drug inactivation by sulfhydryl-con- expression of the SAMD4 gene in four TOP-resistant taining molecules like glutathione and metallo- ovarian cancer cell lines of different origin [21]. SE- thioneins, decreased drug uptake, the drug removal MA3A is a member of the semaphorin family, which by transporters from the ABC family such as ABCC2 comprises eight classes where only class 3 SEMAs (MRP2) and the repair of damaged DNA via DNA re- (SEMA3) are secreted type among vertebrates. Dif- pair systems [6]. PAC acts as mitosis blocker, what ferent members of class 3 SEMAs, including SEMA3A, finally causes apoptotic cell death [7]. The most im- have been described as anti-angiogenic agents [30]. portant mechanism of PAC resistance is related to SEMA3A is often downregulated in different types of the expression of drug transporters such as ABCB1 cancer, including gastric cancer [31], tongue cancer (glycoprotein P (P-gp) [8] and ABCB4 [8, 9]. The [32], ovarian cancer [33] and thus is a putative tu- drugs used in the second line of ovarian cancer che- mor suppressor gene. In gastric and ovarian cancer, motherapy affect the replication process [10,11]. downregulation of SEMA3A expression correlated DOX is an inhibitor of DNA topoisomerase II, while with disease progression and poor prognosis [31,33]. TOP of DNA topoisomerase I. Binding of DOX or TOP Recently we described the down-regulation of the to topoisomerase results in the formation of irre- SEMA3A gene in primary and established resistance versible covalent cross-links between topoisomer- to PAC in ovarian cancer cell lines [22]. MCTP1 (mul- ase and DNA, resulting in cell death [12]. The most tiple transmembrane protein 1) is a protein with spe- important mechanism of resistance seems to be ef- cific C2-domains in its structure [34]. The C2 domain fective removal by drug transporters. DOX is a sub- is a Ca2+-binding motif present in proteins involved strate of P-gp (ABCB1) efflux pomp [13], while TOP in membrane trafficking/exchange action that is val- is mainly removed by breast cancer resistant pro- id for cell migration vesicle formation, receptor traf- tein (BCRP, ABCG2) [14], although P-gp dependent ficking, and neurotransmitter release [35]. Different resistance to TOP has also been described [8,15]. expression of MCTP1 was observed among colorectal Recently we also observed increased expression of cancer specimens [36]. In our previous reports, we ECM molecules in DOX- [16], PAC and TOP-resistant described the downregulation of MCTP1 expression ovarian cancer cell lines [17,18,19]. in CIS-, TOP- [20], and PAC-resistant [22] ovarian We have previously proposed that the drug cancer cell lines. Drug resistance remains still a rea- resistance might be a consequence of the drug son for chemotherapy failure in ovarian cancer. About transporters expression but also other pathways five percent of ovarian epithelial tumors are resistant of drug resistance development are possible. We to chemotherapy at the beginning of treatment, and have recently described new genes, the expres- others develop resistance during treatment. We com- sion of which alters in CIS-, PAC- and TOP- resis- pared the expression of described genes in ovarian tant ovarian cancer cell lines [20,21,22]. HERC5 cancer cell lines isolated from untreated and treated (HECT Domain and RCC1-Like Domain-Containing patients. Protein 5, HECT-type E3 protein ligase) is an in- 140 Nowacka et al. Medical Journal of Cell Biology (2021) RPMI-1640 medium supplemented with insulin Materials and Methods (0,1 unit/mL) (OVCAR-3) or Dulbecco’s Modified Reagents Eagle Medium (DMEM) (SKOV-3), supplemented CIS, PAC, DOX, TOP, RPMI-1640, DMEM and MEM with 20% (RPMI-1640 with insulin) or 10% fetal media, fetal bovine serum, antibiotic-antimycotic bovine serum (MEM, RPMI-1640, RPMI-1640 with solution, sodium private, insulin and L-glutamine sodium private, DMEM), 200 mL-glutamine, penicil- were purchased from Sigma (St. Louis, MO, USA). lin (100 units/mL), streptomycin (100 units/mL), and amphotericin B (25 μg/mL) at 37 C in an envi- Cell Lines and Cell Culture ronment of 5% CO2. Cell lines used in this study are summarized in table 1. The human ovarian carcinoma A2780, Examination of Gene Expression by Q-PCR SKOV-3, and OVCAR-3 were purchased from ATCC We examined changes in HERC5, IFIH1, SEMA3A, (American Type Culture Collection, Manassas, VA, SAMD4 and MCTP1 gene expression in all investigat- USA). The human ovarian carcinoma PEA1, PEA2, ed cell lines. According to the manufacturer’s proto- and PEO23 were purchased from Sigma (St. Louis, col, we isolated RNA using a Gene Matrix Universal MO, USA). W1 cell line was isolated from an untreat- RNA Purification Kit (EURx, Ltd., Gdańsk, Poland) ed female patient diagnosed for serous ovarian ad- and performed reverse transcription experiment enocarcinoma by our team, as described previously using 2 μg of RNA for cDNA synthesis and M-MLV [16]. The cells grow as a monolayer and present an reverse transcriptase kit (Invitrogen by Thermo epithelial morphology and adherent growth mod- Fisher, Waltham, MA, USA) and thermal cycler (Ver- el. A2780 [37] and PEA1 [38] cell lines were also iti 96-well Thermal Cycler, Applied Biosystems, isolated from an untreated patient. PEA2 cell line 850 Lincoln Centre Drive, Foster City, CA, USA). Se- was isolated from the same patients as PEA1 after quence-specific primers described in table 2 were ineffective treatment with CIS and Prednimustine used for Real-time PCR analysis performed using a chemotherapy [38] and PEO23 was isolated from 7900HT Fast Real-Time PCR System (Applied Biosys- another ovarian cancer patient after CIS and chlo- tems, 850 Lincoln Centre Drive, Foster City, CA, USA), rambucil treatment failed [38]. SKOV-3 were iso- Maxima SYBR Green/ROX qPCR Master Mix (Ther- lated from patients treated with ThioTEPA therapy mo Fisher Scientific, Waltham, MA, USA). Follow- [37] and OVCAR-3 was isolated from malignant as- ing house-keeping genes were used as normalizing cites of ovarian cancer patients after combination genes: glyceraldehyde-3-phosphate dehydrogenase chemotherapy with cyclophosphamide, DOX and (GADPH), β-actin, hypoxanthine-guanine phosphori- CIS [39]. Cells were cultured in Minimum Essential bosyltransferase 1 (HRPT1) and beta-2-microglobu- Medium Eagle (MEM) medium (A2780), RPMI-1640 lin (β2M). The W1 cell lines were used as the cal- medium (W1), RPMI-1640 medium supplemented ibrator for the relative quantification (RQ) method with 2mM sodium private (PEA1, PEA2, PEO23), TABLE 1 Characterization of cell lines used in this study Treatment Cell line Origin Chemotherapy outcome tumor tissue, ovarian serous W1 No N/A adenocarcinoma tumour tissue, ovarian endometrioid A2780 No N/A adenocarcinoma SKOV-3 ascites, ovarian serous adenocarcinoma ThioTEPA ineffective ascites, ovarian serous adenocarcinoma, cyclophosphamide, OVCAR-3 ineffective high grade DOX, CIS pleural effusion, serous adenocarcinoma, PEA1 No N/A high grade ascites, serous adenocarcinoma, high PEA2 CIS, Prednimustine ineffective grade ascites, serous adenocarcinoma, PEA O23 CIS, chlorambucil ineffective low grade N/A- not applicable 141 Nowacka et al. Medical Journal of Cell Biology (2021) of gene expression analysis. The standard formula additional 4 h. After this time, to each well, a 100 was employed: RQ = [sample (investigated cell line) μl of solubilization solution was added. The absor- calibrator (W1 cell line). The graphs were made us- bance was measured using a microplate reader at ing SigmaPlot (Systat Software GmbH Schimmelbus- 570 nm with a reference wavelength of 720 nm, ac- chstrasse 25 D-40699, Erkrath, Germany). cording to the manufacturer’s protocol. As a nega- The amplification was processed with the use of: tive control, a cell-free culture medium containing 12.5 μL of Maxima ŚYBR Green/ROX qPCR Master both the MTT reagent and solubilization solution Mix (Fermentas by Thermo Fisher, Waltham, MA, was used. Each experiment was repeated three UŚA), 1 μL of each primer (Oligo, Warsaw, Poland, times, and each concentration in a given experiment Tab. 2), 9.5 μL of water, and 1 μL of cDNA solution. was tested in duplicates. IC50 value of each drug in For each experiment as a negative control one RNA each cell line was determined. Cell resistance/sen- sample was processed without the RT-reaction. The sitivity was expressed as the fold of that in the W1 process of amplification included a hot start (95 ◦C, cell line, which was assigned as a 1. 15 min), 45 cycles of denaturation (95 ◦C for 15s), Statistical Analysis annealing (60 ◦C for 30s), and extension (72 ◦C Data are presented as the standard error of the for 30s). After amplification, melting curve analysis mean (SEM) and were analyzed using Student’s was performed and products of amplification were t-test. p < 0.05 was considered to indicate a statisti- resolved by 3% agarose gel electrophoresis and vi- cally significant difference. sualized by ethidium bromide staining. Drug sensitivity assay Results The drug sensitivity/resistance of the investigat- MTT analysis of response to the cytotoxic drug in ed cell lines was determined by an MTT cell surviv- investigated cell lines al assay. 4,000 cells of each cell line were seeded in At the beginning of our investigation, we were each well of 96-well plates. After 48h of culturing, interested if there are any differences in response cells were treated with fresh medium supplement- to the drugs used in ovarian cancer chemotherapy ed with or without increasing concentrations of CIS, between different ovarian cancer cell lines. In our PAC, DOX or TOP. After 72 h incubation at 37 ̊C, the study following ovarian cancer cell lines were ex- medium was supplemented with 10 μl of the MTT amined: high-grade serous—OVCAR3, PEA1, PEA2; labeling reagent (the final concentration of MTT low-grade serous—PEO23; serous—SKOV-3; endo- was 0.5 mg/ml), and the cells were incubated for an metrioid adenocarcinoma - A2780 [37] and primary TABLE 2 Oligonucleotide sequences used for Q-PCR analysis Product Transcript Sequence (5’-3’ direction) ENST number size F AGAACCTCAACCCTGTGTGG MCTP1 00000312216 123 bp R AGGCTGAGCCCATAAAGTCA F GGGGCATGGAGAATAACTCA IFIH1 00000263642 132 bp R TGCCCATGTTGCTGTTATGT F CCAAAGGTGCAAGACACAAA SAMD4 00000251091 146 bp R CGGAGTCAGGATCATCTGGT F CTTCCTGCATGTGGTTTCCT HERC5 00000264350 128 bp R AAACAGTGCCAGTGGGAAAG F TGTTGGAGCAAAGGATCACA SEMA3A 00000265362 109 bp R AGCCCACTTGCATTCATCTC F GAAGGTGAAGGTCGGAGTCA GAPDH 00000229239 199 bp R GACAAGCTTCCCGTTCTCAG F TCTGGCACCACACCTTCTAC β-actin 00000331789 169 bp R GATAGCACAGCCTGGATAGC F CTGAGGATTTGGAAAGGGTG HPRT1 00000298556 156 bp R AATCCAGCAGGTCAGCAAAG F CGCTACTCTCTCTTTCTGGC Β2M 00000558401 133 bp R ATGTCGGATGGATGAAACCC 142 Nowacka et al. Medical Journal of Cell Biology (2021) ovarian cancer cell line—W1 [16]. W1 cell line was ence because this cell line was sensitive to cytotoxic isolated from the untreated patient by our team, as drugs used in ovarian cancer therapy, as we deter- described previously [16]. A2780 [37] and PEA1 mined previously [15]. Thus, the level of resistance [38] cell lines were also isolated from an untreat- in this cell line was assigned as one. We defined dif- ed patient. The PEA2 cell line was isolated from the ference in resistance as a low – increase/decrease same patient as PEA1 after ineffective treatment up to 10-fold, medium - between 10 and 20-fold, with CIS and Prednimustine chemotherapy [38], high - between 20 and 50-fold and very high - over and PEO23 was isolated from another ovarian can- 50-fold. In all cell lines, we observed a statistically cer patient after CIS, and chlorambucil treatment significant increase in IC50 value for CIS with a low failed [38]. SKOV-3 was isolated from patient treat- increase in A2780 and SKOV-3 cell lines and an av- ed with ThioTEPA therapy [37], and OVCAR-3 was erage increase in OVCAR-3, PEA1, PEA2 and PEO23 isolated from malignant ascites of ovarian cancer cell lines (Tab. 3). In the case of PAC resistance, we patient after combination chemotherapy with cy- did not observe statistically significant differences clophosphamide, DOX, and CIS [39]. between W1 and A2780, as well as W1 and PEA1 In order to determine the drug sensitivity, cells cell lines. The low increase we observed in PEA2 were treated with increasing concentration of CIS, cell line, and a very high increase in resistance PAC, DOX, or TOP. We used a W1 cell line as a refer- was observed in OVCAR-3 and PEO23 cell lines. In TABLE 3 Summary of cell lines resistance to cisplatin, paclitaxel, doxorubicin and topotecan treatment Cell line IC50 (ng/ml) cisplatin paclitaxel doxorubicin topotecan 151 3,37 13,6 2,03 W1 (96-216) (3,18-3,62) (9,1-18,0) (1,94-2,11) 1 1 1 1 439 3,43 19,79 3,13 A2780 (283-565) (1,91-4,73) (12,52-24,44) (1,48-4,71) 2,9 ↑* 1,02 ↑ 1,46 ↑ 1,54 ↑ 890 0,784 17,76 51,9 SKOV-3 (595-1222) (0,73-0,84) (13,7-22,84) (40,34-60,71) 5,8 ↑** 4,30 ↓** 1,31 ↑ 25,6 ↑*** 2613 458 354 398 OVCAR-3 (2125-2884) (372-594) (203-571) (283-505) 17,3 ↑*** 136 ↑*** 26 ↑** 196↑*** 2737 5,66 81 29 PEA1 (2031-3763) (3,25-9,07) (72-90) (19,2-46,9) 18,1 ↑** 1,68 ↑ 5,96 ↑** 14,3 ↑** 2469 6,88 173 132 PEA2 (2426-2557) (4,31-8,38) (148-195) (79-188) 16,4 ↑*** 2,04 ↑* 12,7 ↑** 65 ↑** 2171 1404 275 498 PEO23 (1839-2438) (1000-1600) (198-375) (300-750) 14,4 ↑*** 417 ↑*** 20,2 ↑*** 245 ↑** IC50 mean is indicated to cisplatin, paclitaxel, doxorubicin and topotecan. The drug resistance in the W1 cell line was assigned as 1. Underline values indicate multiplicities of resistance with respect to the W1 cell line. *p < 0.05, **p < 0.01, *** p < 0.001 143 Nowacka et al. Medical Journal of Cell Biology (2021) contrast, SKOV-3 cell line was over 4,30-fold more 1B).The expression of the SAMD4 gene was slight- sensitive to PAC in comparison to the W1 cell line ly downregulated in the A2780 cell line (p < 0.05) (Tab. 3). Next, we were interested in drugs from the and slightly upregulated in the PEO23 cell line (p < second line of ovarian cancer chemotherapy. Simi- 0.05). Clear increase in SAMD4 expression was ob- lar sensitivity to DOX was observed in W1, A2780 served in PEA1 and PEA2 cell lines (p < 0.05 and and SKOV-3 cell lines. In the PEA1 cell line, we ob- p < 0.01, respectively), (Fig. 1C). The expression of served a low increase in resistance and in PEA2, we SEMA3A and MCTP1 was downregulated in investi- observed an average increase in DOX resistance. A gated cell lines when compared to the W1 cell line. high increase in DOX resistance was observed in OV- In all investigated cell lines, we observed statisti- CAR-3 and PEO23 cell lines (Tab. 3). We observed cally significant decrease in expression of SEMA3A similar sensitivity to TOP in W1 and A2780 cell gene, with low decrease in A2780, SKOV-3, PEA2 lines. An average increase was observed in PEA1 (p < 0.05) and PEO23 (p < 0.01) cell lines, medium cell line, whereas SKOV-3 showed a high increase in decrease in OVCAR-3 cell line (p < 0.001) and high TOP resistance. The highest increase was observed decrease in PEA1 cell line (p < 0.01) (Fig. 2A). Ex- in PEA2, PEO23, and OVCAR-3 cell lines (Tab. 3). pression of MCTP1 gene was downregulated at me- dium level in A2780 (p < 0.05) and PEO23 (p < 0.01) Gene expression analysis in ovarian cancer cell cell line. High downregulation of MCTP1 gene was lines observed in PEA2 (p < 0.05) cell line (Fig. 2B). Previously we observed increased expression of HERC5 [20], SAMD4, and IFIH1 [21] in TOP-resistant Discussion ovarian cancer cell lines. Decreased expression of Since drug resistance is a significant obstacle in MCTP1 in CIS-, TOP- [20], and PAC-resistant [22] cell the effective treatment of cancer, research on this lines and decreased expression of SEMA3A in PAC-re- phenomenon is still necessary. As some of the ovar- sistant cell lines [22]. Since we observed increased ian cancer patients are initially resistant at the be- resistance to these drugs in investigated cell lines, ginning of the therapy and some of them acquire we were interested if it reflects by changes in gene resistance during treatment, the drug resistance expression. Thus, we examined the genes expression phenomenon seems to be complex and many mo- level of HERC5, SAMD4, IFIH1, MCTP1, and SEMA3A. lecular factors contributing to drug resistance still We observed a statistically significant increase of remain unrevealed. HERC5 gene in all investigated cell lines in compar- Most of the investigations use a model of drug ison to W1 cell line with the low increase in A2780 sensitive-resistant pairs of cell lines and concen- and PEO23 (p < 0.05) as well as OVCAR-3 and PEA2 trate on acquired drug resistance. Much less is (p < 0.01) cell lines and medium increase in SKOV3 known about primary resistance to cytotoxic drugs. (p < 0.001) and PEA1 (p < 0.01) cell lines (Fig. 1A). Previously we described the increased expression Similarly, we observed a statistically significant of a set of new genes in drug-resistant cell lines increase of IFIH1 gene expression in all investigated developed from drug-sensitive ovarian cancer cell cell lines with the low increase in A2780 cell line lines [20, 21, 22]. Here we investigate whether these (p < 0.05), the medium increase in SKOV3 and OV- genes are involved in primary or developed in vivo CAR-3 cell lines (p < 0.05), the high increase in PEA1 drug resistance in EOC. In this study, we used differ- and PEO23 cell lines (p < 0.01), and very high in- ent ovarian cancer cell lines isolated from patients crease (153-fold) in PEA2 cell line (p < 0.05) (Fig. before or after chemotherapy treatment [16,37-39]. FIGURE 1 Expression analysis (Q-PCR) of the HERC5 (A), IFIH1 (B), and SAMD4 (C) transcripts in different ovarian cancer cell lines. The figure presents the relative gene expression in cell lines (grey bars) with respect to the W1 cell line (white bar), which was assigned a value of 1. The values were considered significant at *p<0.05, **p<0. 0 and ***p<0.001 144 Nowacka et al. Medical Journal of Cell Biology (2021) FIGURE 2 Expression analysis (Q-PCR) of the SEMA3A (A) and MCTP1 (B) transcripts in different ovarian cancer cell lines. The figure presents the relative gene expression in cell lines (grey bars) with respect to the W1 cell line (white bar), which was assigned a value of 1. The values were considered significant at *p<0.05, **p<0.01 and ***p<0.001 As a baseline cell line, we used W1 cell line that The expressions of IFIH1 and SAMD4 have not was sensitive to all drugs used in ovarian cancer been particularly described in the context of drug chemotherapy, as we described previously [15]. The resistance so far. IFIH1 gene plays a role in first-line results of chemoresistance experiments conducted defense against viral infections [26]. In terms of tu- on all investigated cell lines revealed differences in mor progression, the downregulation of this gene response to drugs used in the first and second line was observed in prostate cancer and cell lines resis- of chemotherapy. The expressions of genes encod- tant to docetaxel [46]. IFIH1 was also identified as ing drug transporters like MDR1, MDR3 or MRP2 one of the essential genes in cancer resistance to ra- were low in W1 and even lower in other cell lines diotherapy [47]. Previously, we observed increased (not shown), thus drug resistance in investigated expression of the IFIH1 gene in five TOP-resistant cell lines seems not to be related to the expression cell lines derived from W1, A2780 and SKOV-3 cell of drug transporters. Therefore, we focused on oth- lines as well as in primary response to short-time er genes that we previously described in the context treatment in A2780 and SKOV-3 cell lines [21]. of drug resistance development in EOC cell lines. These results may indicate some role of this gene We observed increased expression of HERC5, IFIH1 in TOP resistance. Here, we also observed increased and SAMD4 genes. The upregulation of the HERC5 expression of IFIH1 in all cell lines resistant to TOP. gene was noted for all cell lines that were simultane- Furthermore, IFIH1 expression increased in PEA2 ously more resistant to TOP than the W1 cell line. It when compared to PEA1, along with increased TOP remains in line with our previous observation where and DOX resistance between these cell lines. It sup- increased expression of HERC5 gene was described in ports the significance of IFHI1 gene expression not TOP-resistant cell lines derived from W1 and A2780 only in TOP but possibly also in DOX resistance. cell lines. Furthermore, short-time treatment of W1 Finally, the last gene observed to be upregulat- and A2780 cell lines with a low dose of TOP also leads ed in PEA1, PEA2, and PEO23 cell lines was SAMD4 to increased expression of HERC5 gene [20]. HERC5 (SMAUG1). As these cell lines were more resistant is part of the ING15 protein degradation system with to CIS, DOX, and TOP, the probable relation between low activity in healthy tissue [23,24]. In contrast, high elevated levels of this protein and drug resistance activity of this system was observed in the prostate may be assumed. However, the role of SAMD4 in [40], pancreatic [41], breast [42] and bladder [43] drug resistance or even in cancer progression was tumors suggesting its role in cancer progression. The not described so far by others. The results ob- expression of HERC5 was upregulated in hepatocellu- tained previously revealed increased expression lar carcinoma tissues and cell lines, and knock-down of the SAMD4 gene in four from five TOP-resistant of HERC5 resulted in increased apoptosis [44]. HERC5 cell lines derived from W1, A2780, and SKOV-3 cell has also been identified as a risk factor in breast can- lines. Furthermore, we observed its increased ex- cer and correlated with tumor stage, grade and lymph pression after short-time exposure to TOP in A2780 node metastases [45]. Summarizing all these results, and SKOV-3 cell lines [21]. Based on these observa- one can hypothesize about a particular role of in- tions, some role of the SAMD4 gene expression in creased expression of HERC5 in drug resistance and TOP-resistance may be assumed. However, more progression of different cancers. detailed studies are required to resolve this issue. 145 Nowacka et al. Medical Journal of Cell Biology (2021) It seems much more complicated to determine as the PEA1 cell line but after chemotherapy [38], it the role of two successive genes which expression is possible that as in our in vitro study [20, 21, 22], in the examined cell lines was decreased when the downregulation of MCTP1 may be a non-specif- compared to the W1 cell line. Previously, we have ic response of cancer cells to contact with cytotoxic reported downregulation of SEMA3A gene in three drugs. Like SEMA3A, the MCTP1 is probably not di- from four PAC-resistant cell lines as well as in short- rectly related to drug resistance, but the loss of its time response to PAC treatment in A2780 cell line function may lead to the activation of some molecu- [22]. Here, we observed downregulation of the SE- lar processes that increase resistance. Thus, deter- MA3A gene in all cell lines, although only OVCAR-3 mining the role of MCTP1 in cancer progression and and PEO23 were simultaneously much more resis- drug resistance requires further investigation. tant to PAC. However, all cell lines were more resis- tant to CIS, and more substantial downregulation of Conclusions SEMA3A gene was observed in OVCAR-3 and PEA1 In summary, we described five new genes that cell lines that were more resistant to CIS. The liter- may play a role in resistance to cytotoxic drugs used ature data show no relationship between SEMA3A in EOC chemotherapy. However, we are aware that downregulation and drug resistance. However, such at this point, our results have some limitations. Re- downregulation was observed in cancers where it vealing the expression pattern of new genes associ- correlated with disease progression. In gastric tu- ated with the drug resistance phenomenon provides mor decreased SEMA3A expression was associated a preliminary insight into its role as a potential ther- with poor differentiation, depth of invasion, num- apeutic agent. The exact role of these genes in drug ber of lymph node and distant metastases, advanced resistance requires further investigation. TNM stage and poor patient’s prognosis [31]. Lower expression of SEMA3A was also observed in EOC in Ethical approval The conducted research is not related to either human or animal comparison to the normal epithelium and correlat- use. ed with poor histological grade, higher clinical ad- vancement (FIGO), lymph node and distant metas- Acknowledgement tases and poor prognosis [33]. Similarly, for tongue This study was supported by Grant No. 2014/13/B/NZ5/00334 cancer, decreased SEMA3A expression correlated from the National Science Centre, Kraków, Poland. with nodal metastasis and predicted shorter pa- Corresponding author tient’s survival [32]. All cases described above indi- Marta Nowacka, Department of Histology and Embryology, cate that the downregulation of SEM3A was mainly Poznan University of Medical Sciences, PL-61-781, Tel.: +48-61- observed in metastases. One of the features of me- 8546455, e-mail: mnowacka@ump.edu.pl. tastases is that they are usually more resistant to Conflicts of interest chemotherapy than primary tumors. However, it The authors declare they have no conflict of interest. cannot be said that SEMA3A is directly involved in drug resistance because this gene is downregulated References in resistant cell lines. Instead, the loss of its function 1. Śiegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. may lead to the activation of some molecular events 2019;69(1):7-34; DOI:10.3322/caac.21551. 2. Webb PM, Jordan ŚJ. Epidemiology of epithelial ovarian cancer. leading to drug resistance. It has been reported that Best Pract Res Clin Obstet Gynaecol. 2017;41:3–14; DOI:10.1016/j. reduced SEMA3A expression can result in higher bpobgyn.2016.08.006. protein phosphorylation and enhanced signal trans- 3. Pignata S, C Cecere S, Du Bois A, Harter P, Heitz F. Treatment of recurrent ovarian cancer. Annals of Oncology. 2017;28:viii51–6; DOI:10.1093/ duction [48]. Higher levels of protein phosphoryla- annonc/mdx441. tion are one of the characteristics of drug-resistant 4. Webber K, Friedlander M. Chemotherapy for epithelial ovarian, fallopian cells [49] that we have also observed in drug-resis- tube and primary peritoneal cancer. Best Pract Res Clin Obstet Gynaecol. 2017;41:126-138; DOI:10.1016/j.bpobgyn.2016.11.004. tant ovarian cancer cell lines previously [50]. 5. Kartalou M, Essigmann JM. Mechanisms of resistance to cisplatin. Mutat The MCTP1 gene has not been described in the Res. 2001;478(1-2):23-43; DOI:10.1016/s0027-5107(01)00141-5. context of drug resistance by others so far. It is 6. Śtewart DJ. Mechanisms of resistance to cisplatin and carbopla- tin. Crit Rev Oncol Hematol. 2007;63(1):12-31; DOI:10.1016/j. poorly described in the literature. Among cancers, critrevonc.2007.02.001. its expression was only investigated in colorectal 7. Jordan A, Hadfield JA, Lawrence NJ, McGown AT. Tubulin as a cancer but did not correlate with any clinical data target for anticancer drugs: agents which interact with the mi- totic spindle. Med Res Rev. 1998;18(4):259-96; DOI:10.1002/ [36]. Here, we observed decreased expression of the (sici)1098-1128(199807)18:4<259::aid-med3>3.0.co;2-u. MCTP1 gene only in A2780, PEA2, and PEO23 cell 8. Januchowski R, Śterzyńska K, Zaorska K, Śosińska P, Klejewski A, Brązert lines. All these cell lines are more resistant to TOP, M, Nowicki M, Zabel M. Analysis of MDR genes expression and cross-re- sistance in eight drug resistant ovarian cancer cell lines. J Ovarian Res. DOX, and CIS than the W1 cell line that suggests its 2016;9(1):65; DOI:10.1186/s13048-016-0278-z. putative, unknown so far, role in resistance to these 9. Januchowski R, Wojtowicz K, Andrzejewska M, Zabel M. Expression of drugs. Significantly lower expression of MCTP1 was MDR1 and MDR3 gene products in paclitaxel-, doxorubicin- and vincri- stine-resistant cell lines. Biomed Pharmacother. 2014;68(1):111-7; DO- observed for PEA1 cell line when compared to PEA2, I:10.1016/j.biopha.2013.09.004. where PEA2 is more resistant to DOX and TOP as 10. Ferrandina G, Ludovisi M, Lorusso D, Pignata S, Breda E, Savarese A, Del well. Since PEA2 was derived from the same patient Medico P, Scaltriti L, Katsaros D, Priolo D, Scambia G. Phase III trial of 146 Nowacka et al. Medical Journal of Cell Biology (2021) gemcitabine compared with pegylated liposomal doxorubicin in pro- 28. Pinder BD, Smibert CA. Smaug: an unexpected journey into the mecha- gressive or recurrent ovarian cancer. J Clin Oncol. 2008;26(6):890-6. nisms of post-transcriptional regulation. Fly (Austin). 2013;7(3):142-5; DOI:10.1200/JCO.2007.13.6606. DOI:10.4161/fly.24336. 11. Śehouli J, Śtengel D, Oskay-Oezcelik G, Zeimet AG, Śommer H, Klare P, 29. Aviv T, Lin Z, Lau S, Rendl LM, Sicheri F, Smibert CA. The RNA-binding Stauch M, Paulenz A, Camara O, Keil E, Lichtenegger W. Nonplatinum SAM domain of Smaug defines a new family of post-transcriptional re- topotecan combinations versus topotecan alone for recurrent ovarian gulators. Nat Struct Biol. 2003;10(8):614-21; DOI:10.1038/nsb956. cancer: results of a phase III study of the North-Eastern German Socie- 30. Maione F, Molla F, Meda C, Latini R, Zentilin L, Giacca M, Seano G, Serini ty of Gynecological Oncology Ovarian Cancer Śtudy Group. J Clin Oncol. G, Bussolino F, Giraudo E. Semaphorin 3A is an endogenous angiogene- 2008;26(19):3176-82; DOI:10.1200/JCO.2007.15.1258. sis inhibitor that blocks tumor growth and normalizes tumor vascula- 12. Śtaker BL, Hjerrild K, Feese MD, Behnke CA, Burgin AB Jr, Śtewart L. ture in transgenic mouse models. J Clin Invest. 2009;119(11):3356-72; The mechanism of topoisomerase I poisoning by a camptothecin ana- DOI:10.1172/JCI36308. log. Proc Natl Acad Sci U S A. 2002;99(24):15387-92; DOI:10.1073/ 31. Tang C, Gao X, Liu H, Jiang T, Zhai X. Decreased expression of ŚEMA3A pnas.242259599. is associated with poor prognosis in gastric carcinoma. Int J Clin Exp 13. Abolhoda A, Wilson AE, Ross H, Danenberg PV, Burt M, Scotto KW. Rapid Pathol. 2014;7(8):4782-94. activation of MDR1 gene expression in human metastatic sarcoma after 32. Śong X, Zhang W, Zhang Y, Zhang H, Fu Z, Ye J, Liu L, Śong X, Wu Y. Expres- in vivo exposure to doxorubicin. Clin Cancer Res. 1999;5(11):3352-6. sion of semaphorin 3A and neuropilin 1 with clinicopathological featu- 14. Robey RW, Polgar O, Deeken J, To KW, Bates ŚE. ABCG2: determi- res and survival in human tongue cancer. Med Oral Patol Oral Cir Bucal. ning its relevance in clinical drug resistance. Cancer Metastasis Rev. 2012;17(6):e962-8; DOI:10.4317/medoral.18168. 2007;26(1):39-57; DOI:10.1007/s10555-007-9042-6. 33. Jiang H, Qi L, Wang F, Śun Z, Huang Z, Xi Q. Decreased semaphorin 3A 15. Januchowski R, Wojtowicz K, Śujka-Kordowska P, Andrzejewska M, Zabel expression is associated with a poor prognosis in patients with epithelial M. MDR gene expression analysis of six drug-resistant ovarian cancer cell ovarian carcinoma. Int J Mol Med. 2015;35(5):1374-80; DOI:10.3892/ lines. Biomed Res Int. 2013;2013:241763; DOI:10.1155/2013/241763. ijmm.2015.2142. 16. Śterzyńska K, Kaźmierczak D, Klejewski A, Ś� wierczewska M, Wojtowicz 34. Shin OH, Han W, Wang Y, Südhof TC. Evolutionarily conserved multiple K, Nowacka M, Brązert J, Nowicki M, Januchowski R. Expression of Oste- C2 domain proteins with two transmembrane regions (MCTPs) and oblast-Specific Factor 2 (OSF-2, Periostin) Is Associated with Drug Re- unusual Ca2+ binding properties. J Biol Chem. 2005;280(2):1641-51; sistance in Ovarian Cancer Cell Lines. Int J Mol Ści. 2019;20(16):3927; DOI:10.1074/jbc.M407305200. DOI:10.3390/ijms20163927. 35. Qiu L, Yu H, Liang F. Multiple C2 domains transmembrane protein 17. Śterzyńska K, Klejewski A, Wojtowicz K, Ś� wierczewska M, Nowacka M, 1 is expressed in CNS neurons and possibly regulates cellular vesicle Kaźmierczak D, Andrzejewska M, Rusek D, Brązert M, Brązert J, Nowic- retrieval and oxidative stress. J Neurochem. 2015;135(3):492-507; ki M, Januchowski R. Mutual Expression of ALDH1A1, LOX, and Colla- DOI:10.1111/jnc.13251. gens in Ovarian Cancer Cell Lines as Combined CSCs- and ECM-Related 36. Abdel-Rahman WM, Lotsari-Śalomaa JE, Kaur Ś, Niskakoski A, Knuuti- Models of Drug Resistance Development. Int J Mol Ści. 2018;20(1):54; la Ś, Järvinen H, Mecklin JP, Peltomäki P. The Role of Chromosomal In- DOI:10.3390/ijms20010054. stability and Epigenetics in Colorectal Cancers Lacking β-Catenin/TCF 18. Klejewski A, Śterzyńska K, Wojtowicz K, Ś� wierczewska M, Partyka M, Regulated Transcription. Gastroenterol Res Pract. 2016;2016:6089658; Brązert M, Nowicki M, Zabel M, Januchowski R. The significance of lumi- DOI:10.1155/2016/6089658. can expression in ovarian cancer drug-resistant cell lines. Oncotarget. 37. Hernandez L, Kim MK, Lyle LT, Bunch KP, House CD, Ning F, Noonan AM, 2017;8(43):74466-74478; DOI:10.18632/oncotarget.20169. Annunziata CM. Characterization of ovarian cancer cell lines as in vivo 19. Śterzyńska K, Klejewski A, Wojtowicz K, Ś� wierczewska M, Andrze- models for preclinical studies. Gynecol Oncol. 2016;142(2):332-40; DO- jewska M, Rusek D, Śobkowski M, Kędzia W, Brązert J, Nowicki M, I:10.1016/j.ygyno.2016.05.028. Januchowski R. The Role of Matrix Gla Protein (MGP) Expression in Pac- 38. Śtukova M, Hall MD, Tsotsoros ŚD, Madigan JP, Farrell NP, Gottesman MM. litaxel and Topotecan Resistant Ovarian Cancer Cell Lines. Int J Mol Ści. Reduced accumulation of platinum drugs is not observed in drug-re- 2018;19(10):2901; DOI:10.3390/ijms19102901. sistant ovarian cancer cell lines derived from cisplatin-treated patients. 20. Ś� wierczewska M, Klejewski A, Wojtowicz K, Brązert M, Iżycki D, Nowicki J Inorg Biochem. 2015;149:45-8; DOI:10.1016/j.jinorgbio.2015.05.003. M, Zabel M, Januchowski R. New and Old Genes Associated with Prima- 39. Hamilton TC, Young RC, McKoy WM, Grotzinger KR, Green JA, Chu EW, ry and Established Responses to Cisplatin and Topotecan Treatment in Whang-Peng J, Rogan AM, Green WR, Ozols RF. Characterization of a Ovarian Cancer Cell Lines. Molecules. 2017;22(10):1717; DOI:10.3390/ human ovarian carcinoma cell line (NIH:OVCAR-3) with androgen and molecules22101717. estrogen receptors. Cancer Res. 1983;43(11):5379-89. 21. Klejewski A, Ś� wierczewska M, Zaorska K, Brązert M, Nowicki M, Za- 40. Kiessling A, Hogrefe C, Erb S, Bobach C, Fuessel S, Wessjohann L, Se- bel M, Januchowski R. New and Old Genes Associated with Topotecan liger B. Expression, regulation and function of the ISGylation system Resistance Development in Ovarian Cancer Cell Lines. Anticancer Res. in prostate cancer. Oncogene. 2009;28(28):2606-20; DOI:10.1038/ 2017;37(4):1625-1636; DOI:10.21873/anticanres.11493. onc.2009.115. 22. Ś� wierczewska M, Klejewski A, Brązert M, Kaźmierczak D, Iżycki D, 41. Iacobuzio-Donahue CA, Maitra A, Olsen M, Lowe AW, van Heek NT, Rosty Nowicki M, Zabel M, Januchowski R. New and Old Genes Associated C, Walter K, Śato N, Parker A, Ashfaq R, Jaffee E, Ryu B, Jones J, Eshle- with Primary and Established Responses to Paclitaxel Treatment in man JR, Yeo CJ, Cameron JL, Kern ŚE, Hruban RH, Brown PO, Goggins Ovarian Cancer Cell Lines. Molecules. 2018;23(4):891; DOI:10.3390/ M. Exploration of global gene expression patterns in pancreatic adeno- molecules23040891. carcinoma using cDNA microarrays. Am J Pathol. 2003;162(4):1151-62; 23. Wong JJ, Pung YF, Śze NŚ, Chin KC. HERC5 is an IFN-induced HECT- DOI:10.1016/S0002-9440(10)63911-9. -type E3 protein ligase that mediates type I IFN-induced ISGylation 42. Desai ŚD, Reed RE, Burks J, Wood LM, Pullikuth AK, Haas AL, Liu LF, of protein targets. Proc Natl Acad Sci U S A. 2006;103(28):10735-40; Breslin JW, Meiners Ś, Śankar Ś. IŚG15 disrupts cytoskeletal architecture DOI:10.1073/pnas.0600397103. and promotes motility in human breast cancer cells. Exp Biol Med (May- 24. Huang YF, Bulavin DV. Oncogene-mediated regulation of p53 ISGyla- wood). 2012;237(1):38-49; DOI:10.1258/ebm.2011.011236. tion and functions. Oncotarget. 2014;5(14):5808-18; DOI:10.18632/ 43. Andersen JB, Aaboe M, Borden EC, Goloubeva OG, Hassel BA, Orntoft TF. oncotarget.2199. Stage-associated overexpression of the ubiquitin-like protein, ISG15, 25. Kiessling A, Hogrefe C, Erb S, Bobach C, Fuessel S, Wessjohann L, Se- in bladder cancer. Br J Cancer. 2006;94(10):1465-71; DOI:10.1038/ liger B. Expression, regulation and function of the ISGylation system sj.bjc.6603099. in prostate cancer. Oncogene. 2009;28(28):2606-20; DOI:10.1038/ 44. Wang Y, Ding Q, Xu T, Li CY, Zhou DD, Zhang L. HZ-6d targeted HERC5 onc.2009.115. to regulate p53 ISGylation in human hepatocellular carcinoma. Toxicol 26. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uemat- Appl Pharmacol. 2017;334:180-191; DOI:10.1016/j.taap.2017.09.011. su Ś, Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh 45. Tang J, Yang Q, Cui Q, Zhang D, Kong D, Liao X, Ren J, Gong Y, Wu G. We- CS, Reis e Sousa C, Matsuura Y, Fujita T, Akira S. Differential roles of ighted gene correlation network analysis identifies RSAD2, HERC5, MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature. and CCL8 as prognostic candidates for breast cancer. J Cell Physiol. 2006;441(7089):101-5; DOI:10.1038/nature04734. 2020;235(1):394-407; DOI:10.1002/jcp.28980. 27. Lin L, Su Z, Lebedeva IV, Gupta P, Boukerche H, Rai T, Barber GN, Dent P, 46. Marín- � Aguilera M, Codony-Śervat J, Kalko ŚG, Fernández PL, Bermudo Sarkar D, Fisher PB. Activation of Ras/Raf protects cells from melanoma R, Buxo E, Ribal MJ, Gascón P, Mellado B. Identification of docetaxel re- differentiation-associated gene-5-induced apoptosis. Cell Death Differ. sistance genes in castration-resistant prostate cancer. Mol Cancer Ther. 2006;13(11):1982-93; DOI:10.1038/sj.cdd.4401899. 2012;11(2):329-39; DOI:10.1158/1535-7163.MCT-11-0289. 147 Nowacka et al. Medical Journal of Cell Biology (2021) 47. Hou DL, Chen L, Liu B, Song LN, Fang T. Identification of common gene networks responsive to radiotherapy in human cancer cells. Cancer Gene Ther. 2014;21(12):542-8; DOI:10.1038/cgt.2014.62. 48. Huang C, Wang Y, Huang JH, Liu W. Śema3A drastically suppresses tumor growth in oral cancer Xenograft model of mice. BMC Pharmacol Toxicol. 2017 Jul 6;18(1):55; DOI:10.1186/s40360-017-0163-4. 49. Abukhdeir AM, Park BH. P21 and p27: roles in carcinogenesis and drug resistance. Expert Rev Mol Med. 2008;10:e19; DOI:10.1017/ S1462399408000744. 50. Ś� wierczewska M, Śterzyńska K, Wojtowicz K, Kaźmierczak D, Iżycki D, Nowicki M, Zabel M, Januchowski R. PTPRK Expression Is Down- regulated in Drug Resistant Ovarian Cancer Cell Lines, and Espe- cially in ALDH1A1 Positive CŚCs-Like Populations. Int J Mol Ści. 2019;20(8):2053; DOI:10.3390/ijms20082053. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Advances in Cell Biology de Gruyter

The significance of HERC5, IFIH1, SAMD4, SEMA3A and MCTP1 genes expression in resistance to cytotoxic drugs in ovarian cancer cell lines

Loading next page...
 
/lp/de-gruyter/the-significance-of-herc5-ifih1-samd4-sema3a-and-mctp1-genes-0WoShAN3MZ
Publisher
de Gruyter
Copyright
© 2021 Marta Nowacka et al., published by Sciendo
ISSN
2080-2218
eISSN
2544-3577
DOI
10.2478/acb-2021-0019
Publisher site
See Article on Publisher Site

Abstract

Resistance to chemotherapy is the main obstacle in contemporary ovarian cancer treatment. The aim of this study was the evaluation of expression of HERC5, IFIH1, SAMD4, MCTP1 and SEMA3A mRNA and as- sessment their role in resistance to cisplatin, paclitaxel, doxorubicin and topotecan in seven ovarian cancer cell lines. MTT assay was used in resistance assessment. Quantitative polymerase chain reaction was per- formed to measure the expression levels of the genes. We observed different levels of resistance among cell lines. The resistance was not related to the expression of drug transporters genes. The expression of HERC5 and IFIH1 genes was upregulated, and the expression of SEMA3A gene was downregulated. Expression of SAMD4 was upregulated in PEA1, PEA2, and PEO23 cell lines, and expression of MCTP1 was downregula- ted in A2780, PEA2, and PEO23 cell lines. Upregulation of HERC5, IFIH1, and SAMD4 and downregulation of SEMA3A and MCTP1 in TOP-resistant ovarian cancer cell lines may suggest some role of those genes in topotecan resistance development. Running title: Expressions of selected genes in ovarian cancer cell lines Keywords: ovarian cancer; cytotoxic drug resistance; new genes Department of Histology and Embryology, Poznań University of Medical Ściences, Poznań, Poland Department of Infectious Diseases, Hepatology and Acquired Immunodeficiency, Poznań University of Medical Ściences, Poland Department of Anatomy and Histology, Collegium Medicum, University of Zielona Góra, Zielona Góra, Poland Division of Histology and Embryology, Department of Human Morphology and Embryology, Wrocław Medical University, Wrocław, Poland *Correspondence: mnowacka@ump.edu.pl Full list of author information is available at the end of article 139 Nowacka et al. Medical Journal of Cell Biology (2021) terferon-induced E3 protein ligase responsible for Introduction the ISGylation of protein targets [23]. During onco- Epithelial ovarian cancer (EOC) is one of the most gene-mediated-transformation HERC5-dependent aggressive tumors and the most common cause of p53 ISGylation plays a role in p53 inactivation [24]. death from gynecological malignancies [1,2]. In most In prostate cancer expression of HERC5 and ISGyla- cases, the diagnosis comes in advanced disease with tion affects the proliferation of cells, indicating their intraperitoneal metastasis [3]. The standard treat- role in malignant transformation [25]. Recently, we ment includes surgery with the following chemo- have observed increased expression of HERC5 gene therapy. The first line of chemotherapy consists of in different TOP-resistant and sensitive EOC cell lines the combination of platinum compounds (cisplatin after first explosion to TOP [20]. IFIH1 encoded by - CIS or carboplatin) and taxanes (paclitaxel - PAC) Melanoma Differentiation-Associated gene 5 (MDA- [4]. Although most patients are sensitive to the first 5) is a cytosolic receptor and plays an important role line of chemotherapy, about five percent of patients in the first line of defense against viral infection [26]. are already resistant at the beginning of treatment. However, the ectopic expression of the IFIH1 gene Among initially sensitive patients, most will devel- can also induce the death of melanoma cells [27]. op drug resistance and will require further therapy We have previously observed increased expression with other drugs [4]. However, the response to the of the IFIH1 gene in TOP-resistant EOC cell lines de- second-line of chemotherapy is usually low because veloped from W1, A2780 and SKOV-3 drug-sensitive of the different existing mechanisms of drug resis- cell lines [21]. SAMD4 (Sterile Alpha Motif Domain tance [4]. CIS is an essential drug used in ovarian containing 4A), also known as a SMAUG1, is a regula- cancer chemotherapy [4]. The effect of its action in tory protein that regulates target mRNAs by binding the cell is an inhibition of DNA replication and RNA to Smaug Recognition Elements (SREs) [28]. It plays transcription in consequence of DNA cross-linking a role in post-transcriptional regulation of genes ex- [5]. Different types of CIS-resistance mechanisms in pression by inhibition of translation and mRNA de- cancer cells have been described so far. The most cay [28, 29]. In our research, we observed increased important are: drug inactivation by sulfhydryl-con- expression of the SAMD4 gene in four TOP-resistant taining molecules like glutathione and metallo- ovarian cancer cell lines of different origin [21]. SE- thioneins, decreased drug uptake, the drug removal MA3A is a member of the semaphorin family, which by transporters from the ABC family such as ABCC2 comprises eight classes where only class 3 SEMAs (MRP2) and the repair of damaged DNA via DNA re- (SEMA3) are secreted type among vertebrates. Dif- pair systems [6]. PAC acts as mitosis blocker, what ferent members of class 3 SEMAs, including SEMA3A, finally causes apoptotic cell death [7]. The most im- have been described as anti-angiogenic agents [30]. portant mechanism of PAC resistance is related to SEMA3A is often downregulated in different types of the expression of drug transporters such as ABCB1 cancer, including gastric cancer [31], tongue cancer (glycoprotein P (P-gp) [8] and ABCB4 [8, 9]. The [32], ovarian cancer [33] and thus is a putative tu- drugs used in the second line of ovarian cancer che- mor suppressor gene. In gastric and ovarian cancer, motherapy affect the replication process [10,11]. downregulation of SEMA3A expression correlated DOX is an inhibitor of DNA topoisomerase II, while with disease progression and poor prognosis [31,33]. TOP of DNA topoisomerase I. Binding of DOX or TOP Recently we described the down-regulation of the to topoisomerase results in the formation of irre- SEMA3A gene in primary and established resistance versible covalent cross-links between topoisomer- to PAC in ovarian cancer cell lines [22]. MCTP1 (mul- ase and DNA, resulting in cell death [12]. The most tiple transmembrane protein 1) is a protein with spe- important mechanism of resistance seems to be ef- cific C2-domains in its structure [34]. The C2 domain fective removal by drug transporters. DOX is a sub- is a Ca2+-binding motif present in proteins involved strate of P-gp (ABCB1) efflux pomp [13], while TOP in membrane trafficking/exchange action that is val- is mainly removed by breast cancer resistant pro- id for cell migration vesicle formation, receptor traf- tein (BCRP, ABCG2) [14], although P-gp dependent ficking, and neurotransmitter release [35]. Different resistance to TOP has also been described [8,15]. expression of MCTP1 was observed among colorectal Recently we also observed increased expression of cancer specimens [36]. In our previous reports, we ECM molecules in DOX- [16], PAC and TOP-resistant described the downregulation of MCTP1 expression ovarian cancer cell lines [17,18,19]. in CIS-, TOP- [20], and PAC-resistant [22] ovarian We have previously proposed that the drug cancer cell lines. Drug resistance remains still a rea- resistance might be a consequence of the drug son for chemotherapy failure in ovarian cancer. About transporters expression but also other pathways five percent of ovarian epithelial tumors are resistant of drug resistance development are possible. We to chemotherapy at the beginning of treatment, and have recently described new genes, the expres- others develop resistance during treatment. We com- sion of which alters in CIS-, PAC- and TOP- resis- pared the expression of described genes in ovarian tant ovarian cancer cell lines [20,21,22]. HERC5 cancer cell lines isolated from untreated and treated (HECT Domain and RCC1-Like Domain-Containing patients. Protein 5, HECT-type E3 protein ligase) is an in- 140 Nowacka et al. Medical Journal of Cell Biology (2021) RPMI-1640 medium supplemented with insulin Materials and Methods (0,1 unit/mL) (OVCAR-3) or Dulbecco’s Modified Reagents Eagle Medium (DMEM) (SKOV-3), supplemented CIS, PAC, DOX, TOP, RPMI-1640, DMEM and MEM with 20% (RPMI-1640 with insulin) or 10% fetal media, fetal bovine serum, antibiotic-antimycotic bovine serum (MEM, RPMI-1640, RPMI-1640 with solution, sodium private, insulin and L-glutamine sodium private, DMEM), 200 mL-glutamine, penicil- were purchased from Sigma (St. Louis, MO, USA). lin (100 units/mL), streptomycin (100 units/mL), and amphotericin B (25 μg/mL) at 37 C in an envi- Cell Lines and Cell Culture ronment of 5% CO2. Cell lines used in this study are summarized in table 1. The human ovarian carcinoma A2780, Examination of Gene Expression by Q-PCR SKOV-3, and OVCAR-3 were purchased from ATCC We examined changes in HERC5, IFIH1, SEMA3A, (American Type Culture Collection, Manassas, VA, SAMD4 and MCTP1 gene expression in all investigat- USA). The human ovarian carcinoma PEA1, PEA2, ed cell lines. According to the manufacturer’s proto- and PEO23 were purchased from Sigma (St. Louis, col, we isolated RNA using a Gene Matrix Universal MO, USA). W1 cell line was isolated from an untreat- RNA Purification Kit (EURx, Ltd., Gdańsk, Poland) ed female patient diagnosed for serous ovarian ad- and performed reverse transcription experiment enocarcinoma by our team, as described previously using 2 μg of RNA for cDNA synthesis and M-MLV [16]. The cells grow as a monolayer and present an reverse transcriptase kit (Invitrogen by Thermo epithelial morphology and adherent growth mod- Fisher, Waltham, MA, USA) and thermal cycler (Ver- el. A2780 [37] and PEA1 [38] cell lines were also iti 96-well Thermal Cycler, Applied Biosystems, isolated from an untreated patient. PEA2 cell line 850 Lincoln Centre Drive, Foster City, CA, USA). Se- was isolated from the same patients as PEA1 after quence-specific primers described in table 2 were ineffective treatment with CIS and Prednimustine used for Real-time PCR analysis performed using a chemotherapy [38] and PEO23 was isolated from 7900HT Fast Real-Time PCR System (Applied Biosys- another ovarian cancer patient after CIS and chlo- tems, 850 Lincoln Centre Drive, Foster City, CA, USA), rambucil treatment failed [38]. SKOV-3 were iso- Maxima SYBR Green/ROX qPCR Master Mix (Ther- lated from patients treated with ThioTEPA therapy mo Fisher Scientific, Waltham, MA, USA). Follow- [37] and OVCAR-3 was isolated from malignant as- ing house-keeping genes were used as normalizing cites of ovarian cancer patients after combination genes: glyceraldehyde-3-phosphate dehydrogenase chemotherapy with cyclophosphamide, DOX and (GADPH), β-actin, hypoxanthine-guanine phosphori- CIS [39]. Cells were cultured in Minimum Essential bosyltransferase 1 (HRPT1) and beta-2-microglobu- Medium Eagle (MEM) medium (A2780), RPMI-1640 lin (β2M). The W1 cell lines were used as the cal- medium (W1), RPMI-1640 medium supplemented ibrator for the relative quantification (RQ) method with 2mM sodium private (PEA1, PEA2, PEO23), TABLE 1 Characterization of cell lines used in this study Treatment Cell line Origin Chemotherapy outcome tumor tissue, ovarian serous W1 No N/A adenocarcinoma tumour tissue, ovarian endometrioid A2780 No N/A adenocarcinoma SKOV-3 ascites, ovarian serous adenocarcinoma ThioTEPA ineffective ascites, ovarian serous adenocarcinoma, cyclophosphamide, OVCAR-3 ineffective high grade DOX, CIS pleural effusion, serous adenocarcinoma, PEA1 No N/A high grade ascites, serous adenocarcinoma, high PEA2 CIS, Prednimustine ineffective grade ascites, serous adenocarcinoma, PEA O23 CIS, chlorambucil ineffective low grade N/A- not applicable 141 Nowacka et al. Medical Journal of Cell Biology (2021) of gene expression analysis. The standard formula additional 4 h. After this time, to each well, a 100 was employed: RQ = [sample (investigated cell line) μl of solubilization solution was added. The absor- calibrator (W1 cell line). The graphs were made us- bance was measured using a microplate reader at ing SigmaPlot (Systat Software GmbH Schimmelbus- 570 nm with a reference wavelength of 720 nm, ac- chstrasse 25 D-40699, Erkrath, Germany). cording to the manufacturer’s protocol. As a nega- The amplification was processed with the use of: tive control, a cell-free culture medium containing 12.5 μL of Maxima ŚYBR Green/ROX qPCR Master both the MTT reagent and solubilization solution Mix (Fermentas by Thermo Fisher, Waltham, MA, was used. Each experiment was repeated three UŚA), 1 μL of each primer (Oligo, Warsaw, Poland, times, and each concentration in a given experiment Tab. 2), 9.5 μL of water, and 1 μL of cDNA solution. was tested in duplicates. IC50 value of each drug in For each experiment as a negative control one RNA each cell line was determined. Cell resistance/sen- sample was processed without the RT-reaction. The sitivity was expressed as the fold of that in the W1 process of amplification included a hot start (95 ◦C, cell line, which was assigned as a 1. 15 min), 45 cycles of denaturation (95 ◦C for 15s), Statistical Analysis annealing (60 ◦C for 30s), and extension (72 ◦C Data are presented as the standard error of the for 30s). After amplification, melting curve analysis mean (SEM) and were analyzed using Student’s was performed and products of amplification were t-test. p < 0.05 was considered to indicate a statisti- resolved by 3% agarose gel electrophoresis and vi- cally significant difference. sualized by ethidium bromide staining. Drug sensitivity assay Results The drug sensitivity/resistance of the investigat- MTT analysis of response to the cytotoxic drug in ed cell lines was determined by an MTT cell surviv- investigated cell lines al assay. 4,000 cells of each cell line were seeded in At the beginning of our investigation, we were each well of 96-well plates. After 48h of culturing, interested if there are any differences in response cells were treated with fresh medium supplement- to the drugs used in ovarian cancer chemotherapy ed with or without increasing concentrations of CIS, between different ovarian cancer cell lines. In our PAC, DOX or TOP. After 72 h incubation at 37 ̊C, the study following ovarian cancer cell lines were ex- medium was supplemented with 10 μl of the MTT amined: high-grade serous—OVCAR3, PEA1, PEA2; labeling reagent (the final concentration of MTT low-grade serous—PEO23; serous—SKOV-3; endo- was 0.5 mg/ml), and the cells were incubated for an metrioid adenocarcinoma - A2780 [37] and primary TABLE 2 Oligonucleotide sequences used for Q-PCR analysis Product Transcript Sequence (5’-3’ direction) ENST number size F AGAACCTCAACCCTGTGTGG MCTP1 00000312216 123 bp R AGGCTGAGCCCATAAAGTCA F GGGGCATGGAGAATAACTCA IFIH1 00000263642 132 bp R TGCCCATGTTGCTGTTATGT F CCAAAGGTGCAAGACACAAA SAMD4 00000251091 146 bp R CGGAGTCAGGATCATCTGGT F CTTCCTGCATGTGGTTTCCT HERC5 00000264350 128 bp R AAACAGTGCCAGTGGGAAAG F TGTTGGAGCAAAGGATCACA SEMA3A 00000265362 109 bp R AGCCCACTTGCATTCATCTC F GAAGGTGAAGGTCGGAGTCA GAPDH 00000229239 199 bp R GACAAGCTTCCCGTTCTCAG F TCTGGCACCACACCTTCTAC β-actin 00000331789 169 bp R GATAGCACAGCCTGGATAGC F CTGAGGATTTGGAAAGGGTG HPRT1 00000298556 156 bp R AATCCAGCAGGTCAGCAAAG F CGCTACTCTCTCTTTCTGGC Β2M 00000558401 133 bp R ATGTCGGATGGATGAAACCC 142 Nowacka et al. Medical Journal of Cell Biology (2021) ovarian cancer cell line—W1 [16]. W1 cell line was ence because this cell line was sensitive to cytotoxic isolated from the untreated patient by our team, as drugs used in ovarian cancer therapy, as we deter- described previously [16]. A2780 [37] and PEA1 mined previously [15]. Thus, the level of resistance [38] cell lines were also isolated from an untreat- in this cell line was assigned as one. We defined dif- ed patient. The PEA2 cell line was isolated from the ference in resistance as a low – increase/decrease same patient as PEA1 after ineffective treatment up to 10-fold, medium - between 10 and 20-fold, with CIS and Prednimustine chemotherapy [38], high - between 20 and 50-fold and very high - over and PEO23 was isolated from another ovarian can- 50-fold. In all cell lines, we observed a statistically cer patient after CIS, and chlorambucil treatment significant increase in IC50 value for CIS with a low failed [38]. SKOV-3 was isolated from patient treat- increase in A2780 and SKOV-3 cell lines and an av- ed with ThioTEPA therapy [37], and OVCAR-3 was erage increase in OVCAR-3, PEA1, PEA2 and PEO23 isolated from malignant ascites of ovarian cancer cell lines (Tab. 3). In the case of PAC resistance, we patient after combination chemotherapy with cy- did not observe statistically significant differences clophosphamide, DOX, and CIS [39]. between W1 and A2780, as well as W1 and PEA1 In order to determine the drug sensitivity, cells cell lines. The low increase we observed in PEA2 were treated with increasing concentration of CIS, cell line, and a very high increase in resistance PAC, DOX, or TOP. We used a W1 cell line as a refer- was observed in OVCAR-3 and PEO23 cell lines. In TABLE 3 Summary of cell lines resistance to cisplatin, paclitaxel, doxorubicin and topotecan treatment Cell line IC50 (ng/ml) cisplatin paclitaxel doxorubicin topotecan 151 3,37 13,6 2,03 W1 (96-216) (3,18-3,62) (9,1-18,0) (1,94-2,11) 1 1 1 1 439 3,43 19,79 3,13 A2780 (283-565) (1,91-4,73) (12,52-24,44) (1,48-4,71) 2,9 ↑* 1,02 ↑ 1,46 ↑ 1,54 ↑ 890 0,784 17,76 51,9 SKOV-3 (595-1222) (0,73-0,84) (13,7-22,84) (40,34-60,71) 5,8 ↑** 4,30 ↓** 1,31 ↑ 25,6 ↑*** 2613 458 354 398 OVCAR-3 (2125-2884) (372-594) (203-571) (283-505) 17,3 ↑*** 136 ↑*** 26 ↑** 196↑*** 2737 5,66 81 29 PEA1 (2031-3763) (3,25-9,07) (72-90) (19,2-46,9) 18,1 ↑** 1,68 ↑ 5,96 ↑** 14,3 ↑** 2469 6,88 173 132 PEA2 (2426-2557) (4,31-8,38) (148-195) (79-188) 16,4 ↑*** 2,04 ↑* 12,7 ↑** 65 ↑** 2171 1404 275 498 PEO23 (1839-2438) (1000-1600) (198-375) (300-750) 14,4 ↑*** 417 ↑*** 20,2 ↑*** 245 ↑** IC50 mean is indicated to cisplatin, paclitaxel, doxorubicin and topotecan. The drug resistance in the W1 cell line was assigned as 1. Underline values indicate multiplicities of resistance with respect to the W1 cell line. *p < 0.05, **p < 0.01, *** p < 0.001 143 Nowacka et al. Medical Journal of Cell Biology (2021) contrast, SKOV-3 cell line was over 4,30-fold more 1B).The expression of the SAMD4 gene was slight- sensitive to PAC in comparison to the W1 cell line ly downregulated in the A2780 cell line (p < 0.05) (Tab. 3). Next, we were interested in drugs from the and slightly upregulated in the PEO23 cell line (p < second line of ovarian cancer chemotherapy. Simi- 0.05). Clear increase in SAMD4 expression was ob- lar sensitivity to DOX was observed in W1, A2780 served in PEA1 and PEA2 cell lines (p < 0.05 and and SKOV-3 cell lines. In the PEA1 cell line, we ob- p < 0.01, respectively), (Fig. 1C). The expression of served a low increase in resistance and in PEA2, we SEMA3A and MCTP1 was downregulated in investi- observed an average increase in DOX resistance. A gated cell lines when compared to the W1 cell line. high increase in DOX resistance was observed in OV- In all investigated cell lines, we observed statisti- CAR-3 and PEO23 cell lines (Tab. 3). We observed cally significant decrease in expression of SEMA3A similar sensitivity to TOP in W1 and A2780 cell gene, with low decrease in A2780, SKOV-3, PEA2 lines. An average increase was observed in PEA1 (p < 0.05) and PEO23 (p < 0.01) cell lines, medium cell line, whereas SKOV-3 showed a high increase in decrease in OVCAR-3 cell line (p < 0.001) and high TOP resistance. The highest increase was observed decrease in PEA1 cell line (p < 0.01) (Fig. 2A). Ex- in PEA2, PEO23, and OVCAR-3 cell lines (Tab. 3). pression of MCTP1 gene was downregulated at me- dium level in A2780 (p < 0.05) and PEO23 (p < 0.01) Gene expression analysis in ovarian cancer cell cell line. High downregulation of MCTP1 gene was lines observed in PEA2 (p < 0.05) cell line (Fig. 2B). Previously we observed increased expression of HERC5 [20], SAMD4, and IFIH1 [21] in TOP-resistant Discussion ovarian cancer cell lines. Decreased expression of Since drug resistance is a significant obstacle in MCTP1 in CIS-, TOP- [20], and PAC-resistant [22] cell the effective treatment of cancer, research on this lines and decreased expression of SEMA3A in PAC-re- phenomenon is still necessary. As some of the ovar- sistant cell lines [22]. Since we observed increased ian cancer patients are initially resistant at the be- resistance to these drugs in investigated cell lines, ginning of the therapy and some of them acquire we were interested if it reflects by changes in gene resistance during treatment, the drug resistance expression. Thus, we examined the genes expression phenomenon seems to be complex and many mo- level of HERC5, SAMD4, IFIH1, MCTP1, and SEMA3A. lecular factors contributing to drug resistance still We observed a statistically significant increase of remain unrevealed. HERC5 gene in all investigated cell lines in compar- Most of the investigations use a model of drug ison to W1 cell line with the low increase in A2780 sensitive-resistant pairs of cell lines and concen- and PEO23 (p < 0.05) as well as OVCAR-3 and PEA2 trate on acquired drug resistance. Much less is (p < 0.01) cell lines and medium increase in SKOV3 known about primary resistance to cytotoxic drugs. (p < 0.001) and PEA1 (p < 0.01) cell lines (Fig. 1A). Previously we described the increased expression Similarly, we observed a statistically significant of a set of new genes in drug-resistant cell lines increase of IFIH1 gene expression in all investigated developed from drug-sensitive ovarian cancer cell cell lines with the low increase in A2780 cell line lines [20, 21, 22]. Here we investigate whether these (p < 0.05), the medium increase in SKOV3 and OV- genes are involved in primary or developed in vivo CAR-3 cell lines (p < 0.05), the high increase in PEA1 drug resistance in EOC. In this study, we used differ- and PEO23 cell lines (p < 0.01), and very high in- ent ovarian cancer cell lines isolated from patients crease (153-fold) in PEA2 cell line (p < 0.05) (Fig. before or after chemotherapy treatment [16,37-39]. FIGURE 1 Expression analysis (Q-PCR) of the HERC5 (A), IFIH1 (B), and SAMD4 (C) transcripts in different ovarian cancer cell lines. The figure presents the relative gene expression in cell lines (grey bars) with respect to the W1 cell line (white bar), which was assigned a value of 1. The values were considered significant at *p<0.05, **p<0. 0 and ***p<0.001 144 Nowacka et al. Medical Journal of Cell Biology (2021) FIGURE 2 Expression analysis (Q-PCR) of the SEMA3A (A) and MCTP1 (B) transcripts in different ovarian cancer cell lines. The figure presents the relative gene expression in cell lines (grey bars) with respect to the W1 cell line (white bar), which was assigned a value of 1. The values were considered significant at *p<0.05, **p<0.01 and ***p<0.001 As a baseline cell line, we used W1 cell line that The expressions of IFIH1 and SAMD4 have not was sensitive to all drugs used in ovarian cancer been particularly described in the context of drug chemotherapy, as we described previously [15]. The resistance so far. IFIH1 gene plays a role in first-line results of chemoresistance experiments conducted defense against viral infections [26]. In terms of tu- on all investigated cell lines revealed differences in mor progression, the downregulation of this gene response to drugs used in the first and second line was observed in prostate cancer and cell lines resis- of chemotherapy. The expressions of genes encod- tant to docetaxel [46]. IFIH1 was also identified as ing drug transporters like MDR1, MDR3 or MRP2 one of the essential genes in cancer resistance to ra- were low in W1 and even lower in other cell lines diotherapy [47]. Previously, we observed increased (not shown), thus drug resistance in investigated expression of the IFIH1 gene in five TOP-resistant cell lines seems not to be related to the expression cell lines derived from W1, A2780 and SKOV-3 cell of drug transporters. Therefore, we focused on oth- lines as well as in primary response to short-time er genes that we previously described in the context treatment in A2780 and SKOV-3 cell lines [21]. of drug resistance development in EOC cell lines. These results may indicate some role of this gene We observed increased expression of HERC5, IFIH1 in TOP resistance. Here, we also observed increased and SAMD4 genes. The upregulation of the HERC5 expression of IFIH1 in all cell lines resistant to TOP. gene was noted for all cell lines that were simultane- Furthermore, IFIH1 expression increased in PEA2 ously more resistant to TOP than the W1 cell line. It when compared to PEA1, along with increased TOP remains in line with our previous observation where and DOX resistance between these cell lines. It sup- increased expression of HERC5 gene was described in ports the significance of IFHI1 gene expression not TOP-resistant cell lines derived from W1 and A2780 only in TOP but possibly also in DOX resistance. cell lines. Furthermore, short-time treatment of W1 Finally, the last gene observed to be upregulat- and A2780 cell lines with a low dose of TOP also leads ed in PEA1, PEA2, and PEO23 cell lines was SAMD4 to increased expression of HERC5 gene [20]. HERC5 (SMAUG1). As these cell lines were more resistant is part of the ING15 protein degradation system with to CIS, DOX, and TOP, the probable relation between low activity in healthy tissue [23,24]. In contrast, high elevated levels of this protein and drug resistance activity of this system was observed in the prostate may be assumed. However, the role of SAMD4 in [40], pancreatic [41], breast [42] and bladder [43] drug resistance or even in cancer progression was tumors suggesting its role in cancer progression. The not described so far by others. The results ob- expression of HERC5 was upregulated in hepatocellu- tained previously revealed increased expression lar carcinoma tissues and cell lines, and knock-down of the SAMD4 gene in four from five TOP-resistant of HERC5 resulted in increased apoptosis [44]. HERC5 cell lines derived from W1, A2780, and SKOV-3 cell has also been identified as a risk factor in breast can- lines. Furthermore, we observed its increased ex- cer and correlated with tumor stage, grade and lymph pression after short-time exposure to TOP in A2780 node metastases [45]. Summarizing all these results, and SKOV-3 cell lines [21]. Based on these observa- one can hypothesize about a particular role of in- tions, some role of the SAMD4 gene expression in creased expression of HERC5 in drug resistance and TOP-resistance may be assumed. However, more progression of different cancers. detailed studies are required to resolve this issue. 145 Nowacka et al. Medical Journal of Cell Biology (2021) It seems much more complicated to determine as the PEA1 cell line but after chemotherapy [38], it the role of two successive genes which expression is possible that as in our in vitro study [20, 21, 22], in the examined cell lines was decreased when the downregulation of MCTP1 may be a non-specif- compared to the W1 cell line. Previously, we have ic response of cancer cells to contact with cytotoxic reported downregulation of SEMA3A gene in three drugs. Like SEMA3A, the MCTP1 is probably not di- from four PAC-resistant cell lines as well as in short- rectly related to drug resistance, but the loss of its time response to PAC treatment in A2780 cell line function may lead to the activation of some molecu- [22]. Here, we observed downregulation of the SE- lar processes that increase resistance. Thus, deter- MA3A gene in all cell lines, although only OVCAR-3 mining the role of MCTP1 in cancer progression and and PEO23 were simultaneously much more resis- drug resistance requires further investigation. tant to PAC. However, all cell lines were more resis- tant to CIS, and more substantial downregulation of Conclusions SEMA3A gene was observed in OVCAR-3 and PEA1 In summary, we described five new genes that cell lines that were more resistant to CIS. The liter- may play a role in resistance to cytotoxic drugs used ature data show no relationship between SEMA3A in EOC chemotherapy. However, we are aware that downregulation and drug resistance. However, such at this point, our results have some limitations. Re- downregulation was observed in cancers where it vealing the expression pattern of new genes associ- correlated with disease progression. In gastric tu- ated with the drug resistance phenomenon provides mor decreased SEMA3A expression was associated a preliminary insight into its role as a potential ther- with poor differentiation, depth of invasion, num- apeutic agent. The exact role of these genes in drug ber of lymph node and distant metastases, advanced resistance requires further investigation. TNM stage and poor patient’s prognosis [31]. Lower expression of SEMA3A was also observed in EOC in Ethical approval The conducted research is not related to either human or animal comparison to the normal epithelium and correlat- use. ed with poor histological grade, higher clinical ad- vancement (FIGO), lymph node and distant metas- Acknowledgement tases and poor prognosis [33]. Similarly, for tongue This study was supported by Grant No. 2014/13/B/NZ5/00334 cancer, decreased SEMA3A expression correlated from the National Science Centre, Kraków, Poland. with nodal metastasis and predicted shorter pa- Corresponding author tient’s survival [32]. All cases described above indi- Marta Nowacka, Department of Histology and Embryology, cate that the downregulation of SEM3A was mainly Poznan University of Medical Sciences, PL-61-781, Tel.: +48-61- observed in metastases. One of the features of me- 8546455, e-mail: mnowacka@ump.edu.pl. tastases is that they are usually more resistant to Conflicts of interest chemotherapy than primary tumors. However, it The authors declare they have no conflict of interest. cannot be said that SEMA3A is directly involved in drug resistance because this gene is downregulated References in resistant cell lines. Instead, the loss of its function 1. Śiegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. may lead to the activation of some molecular events 2019;69(1):7-34; DOI:10.3322/caac.21551. 2. Webb PM, Jordan ŚJ. Epidemiology of epithelial ovarian cancer. leading to drug resistance. It has been reported that Best Pract Res Clin Obstet Gynaecol. 2017;41:3–14; DOI:10.1016/j. reduced SEMA3A expression can result in higher bpobgyn.2016.08.006. protein phosphorylation and enhanced signal trans- 3. Pignata S, C Cecere S, Du Bois A, Harter P, Heitz F. Treatment of recurrent ovarian cancer. Annals of Oncology. 2017;28:viii51–6; DOI:10.1093/ duction [48]. Higher levels of protein phosphoryla- annonc/mdx441. tion are one of the characteristics of drug-resistant 4. Webber K, Friedlander M. Chemotherapy for epithelial ovarian, fallopian cells [49] that we have also observed in drug-resis- tube and primary peritoneal cancer. Best Pract Res Clin Obstet Gynaecol. 2017;41:126-138; DOI:10.1016/j.bpobgyn.2016.11.004. tant ovarian cancer cell lines previously [50]. 5. Kartalou M, Essigmann JM. Mechanisms of resistance to cisplatin. Mutat The MCTP1 gene has not been described in the Res. 2001;478(1-2):23-43; DOI:10.1016/s0027-5107(01)00141-5. context of drug resistance by others so far. It is 6. Śtewart DJ. Mechanisms of resistance to cisplatin and carbopla- tin. Crit Rev Oncol Hematol. 2007;63(1):12-31; DOI:10.1016/j. poorly described in the literature. Among cancers, critrevonc.2007.02.001. its expression was only investigated in colorectal 7. Jordan A, Hadfield JA, Lawrence NJ, McGown AT. Tubulin as a cancer but did not correlate with any clinical data target for anticancer drugs: agents which interact with the mi- totic spindle. Med Res Rev. 1998;18(4):259-96; DOI:10.1002/ [36]. Here, we observed decreased expression of the (sici)1098-1128(199807)18:4<259::aid-med3>3.0.co;2-u. MCTP1 gene only in A2780, PEA2, and PEO23 cell 8. Januchowski R, Śterzyńska K, Zaorska K, Śosińska P, Klejewski A, Brązert lines. All these cell lines are more resistant to TOP, M, Nowicki M, Zabel M. Analysis of MDR genes expression and cross-re- sistance in eight drug resistant ovarian cancer cell lines. J Ovarian Res. DOX, and CIS than the W1 cell line that suggests its 2016;9(1):65; DOI:10.1186/s13048-016-0278-z. putative, unknown so far, role in resistance to these 9. Januchowski R, Wojtowicz K, Andrzejewska M, Zabel M. Expression of drugs. Significantly lower expression of MCTP1 was MDR1 and MDR3 gene products in paclitaxel-, doxorubicin- and vincri- stine-resistant cell lines. Biomed Pharmacother. 2014;68(1):111-7; DO- observed for PEA1 cell line when compared to PEA2, I:10.1016/j.biopha.2013.09.004. where PEA2 is more resistant to DOX and TOP as 10. Ferrandina G, Ludovisi M, Lorusso D, Pignata S, Breda E, Savarese A, Del well. Since PEA2 was derived from the same patient Medico P, Scaltriti L, Katsaros D, Priolo D, Scambia G. Phase III trial of 146 Nowacka et al. Medical Journal of Cell Biology (2021) gemcitabine compared with pegylated liposomal doxorubicin in pro- 28. Pinder BD, Smibert CA. Smaug: an unexpected journey into the mecha- gressive or recurrent ovarian cancer. J Clin Oncol. 2008;26(6):890-6. nisms of post-transcriptional regulation. Fly (Austin). 2013;7(3):142-5; DOI:10.1200/JCO.2007.13.6606. DOI:10.4161/fly.24336. 11. Śehouli J, Śtengel D, Oskay-Oezcelik G, Zeimet AG, Śommer H, Klare P, 29. Aviv T, Lin Z, Lau S, Rendl LM, Sicheri F, Smibert CA. The RNA-binding Stauch M, Paulenz A, Camara O, Keil E, Lichtenegger W. Nonplatinum SAM domain of Smaug defines a new family of post-transcriptional re- topotecan combinations versus topotecan alone for recurrent ovarian gulators. Nat Struct Biol. 2003;10(8):614-21; DOI:10.1038/nsb956. cancer: results of a phase III study of the North-Eastern German Socie- 30. Maione F, Molla F, Meda C, Latini R, Zentilin L, Giacca M, Seano G, Serini ty of Gynecological Oncology Ovarian Cancer Śtudy Group. J Clin Oncol. G, Bussolino F, Giraudo E. Semaphorin 3A is an endogenous angiogene- 2008;26(19):3176-82; DOI:10.1200/JCO.2007.15.1258. sis inhibitor that blocks tumor growth and normalizes tumor vascula- 12. Śtaker BL, Hjerrild K, Feese MD, Behnke CA, Burgin AB Jr, Śtewart L. ture in transgenic mouse models. J Clin Invest. 2009;119(11):3356-72; The mechanism of topoisomerase I poisoning by a camptothecin ana- DOI:10.1172/JCI36308. log. Proc Natl Acad Sci U S A. 2002;99(24):15387-92; DOI:10.1073/ 31. Tang C, Gao X, Liu H, Jiang T, Zhai X. Decreased expression of ŚEMA3A pnas.242259599. is associated with poor prognosis in gastric carcinoma. Int J Clin Exp 13. Abolhoda A, Wilson AE, Ross H, Danenberg PV, Burt M, Scotto KW. Rapid Pathol. 2014;7(8):4782-94. activation of MDR1 gene expression in human metastatic sarcoma after 32. Śong X, Zhang W, Zhang Y, Zhang H, Fu Z, Ye J, Liu L, Śong X, Wu Y. Expres- in vivo exposure to doxorubicin. Clin Cancer Res. 1999;5(11):3352-6. sion of semaphorin 3A and neuropilin 1 with clinicopathological featu- 14. Robey RW, Polgar O, Deeken J, To KW, Bates ŚE. ABCG2: determi- res and survival in human tongue cancer. Med Oral Patol Oral Cir Bucal. ning its relevance in clinical drug resistance. Cancer Metastasis Rev. 2012;17(6):e962-8; DOI:10.4317/medoral.18168. 2007;26(1):39-57; DOI:10.1007/s10555-007-9042-6. 33. Jiang H, Qi L, Wang F, Śun Z, Huang Z, Xi Q. Decreased semaphorin 3A 15. Januchowski R, Wojtowicz K, Śujka-Kordowska P, Andrzejewska M, Zabel expression is associated with a poor prognosis in patients with epithelial M. MDR gene expression analysis of six drug-resistant ovarian cancer cell ovarian carcinoma. Int J Mol Med. 2015;35(5):1374-80; DOI:10.3892/ lines. Biomed Res Int. 2013;2013:241763; DOI:10.1155/2013/241763. ijmm.2015.2142. 16. Śterzyńska K, Kaźmierczak D, Klejewski A, Ś� wierczewska M, Wojtowicz 34. Shin OH, Han W, Wang Y, Südhof TC. Evolutionarily conserved multiple K, Nowacka M, Brązert J, Nowicki M, Januchowski R. Expression of Oste- C2 domain proteins with two transmembrane regions (MCTPs) and oblast-Specific Factor 2 (OSF-2, Periostin) Is Associated with Drug Re- unusual Ca2+ binding properties. J Biol Chem. 2005;280(2):1641-51; sistance in Ovarian Cancer Cell Lines. Int J Mol Ści. 2019;20(16):3927; DOI:10.1074/jbc.M407305200. DOI:10.3390/ijms20163927. 35. Qiu L, Yu H, Liang F. Multiple C2 domains transmembrane protein 17. Śterzyńska K, Klejewski A, Wojtowicz K, Ś� wierczewska M, Nowacka M, 1 is expressed in CNS neurons and possibly regulates cellular vesicle Kaźmierczak D, Andrzejewska M, Rusek D, Brązert M, Brązert J, Nowic- retrieval and oxidative stress. J Neurochem. 2015;135(3):492-507; ki M, Januchowski R. Mutual Expression of ALDH1A1, LOX, and Colla- DOI:10.1111/jnc.13251. gens in Ovarian Cancer Cell Lines as Combined CSCs- and ECM-Related 36. Abdel-Rahman WM, Lotsari-Śalomaa JE, Kaur Ś, Niskakoski A, Knuuti- Models of Drug Resistance Development. Int J Mol Ści. 2018;20(1):54; la Ś, Järvinen H, Mecklin JP, Peltomäki P. The Role of Chromosomal In- DOI:10.3390/ijms20010054. stability and Epigenetics in Colorectal Cancers Lacking β-Catenin/TCF 18. Klejewski A, Śterzyńska K, Wojtowicz K, Ś� wierczewska M, Partyka M, Regulated Transcription. Gastroenterol Res Pract. 2016;2016:6089658; Brązert M, Nowicki M, Zabel M, Januchowski R. The significance of lumi- DOI:10.1155/2016/6089658. can expression in ovarian cancer drug-resistant cell lines. Oncotarget. 37. Hernandez L, Kim MK, Lyle LT, Bunch KP, House CD, Ning F, Noonan AM, 2017;8(43):74466-74478; DOI:10.18632/oncotarget.20169. Annunziata CM. Characterization of ovarian cancer cell lines as in vivo 19. Śterzyńska K, Klejewski A, Wojtowicz K, Ś� wierczewska M, Andrze- models for preclinical studies. Gynecol Oncol. 2016;142(2):332-40; DO- jewska M, Rusek D, Śobkowski M, Kędzia W, Brązert J, Nowicki M, I:10.1016/j.ygyno.2016.05.028. Januchowski R. The Role of Matrix Gla Protein (MGP) Expression in Pac- 38. Śtukova M, Hall MD, Tsotsoros ŚD, Madigan JP, Farrell NP, Gottesman MM. litaxel and Topotecan Resistant Ovarian Cancer Cell Lines. Int J Mol Ści. Reduced accumulation of platinum drugs is not observed in drug-re- 2018;19(10):2901; DOI:10.3390/ijms19102901. sistant ovarian cancer cell lines derived from cisplatin-treated patients. 20. Ś� wierczewska M, Klejewski A, Wojtowicz K, Brązert M, Iżycki D, Nowicki J Inorg Biochem. 2015;149:45-8; DOI:10.1016/j.jinorgbio.2015.05.003. M, Zabel M, Januchowski R. New and Old Genes Associated with Prima- 39. Hamilton TC, Young RC, McKoy WM, Grotzinger KR, Green JA, Chu EW, ry and Established Responses to Cisplatin and Topotecan Treatment in Whang-Peng J, Rogan AM, Green WR, Ozols RF. Characterization of a Ovarian Cancer Cell Lines. Molecules. 2017;22(10):1717; DOI:10.3390/ human ovarian carcinoma cell line (NIH:OVCAR-3) with androgen and molecules22101717. estrogen receptors. Cancer Res. 1983;43(11):5379-89. 21. Klejewski A, Ś� wierczewska M, Zaorska K, Brązert M, Nowicki M, Za- 40. Kiessling A, Hogrefe C, Erb S, Bobach C, Fuessel S, Wessjohann L, Se- bel M, Januchowski R. New and Old Genes Associated with Topotecan liger B. Expression, regulation and function of the ISGylation system Resistance Development in Ovarian Cancer Cell Lines. Anticancer Res. in prostate cancer. Oncogene. 2009;28(28):2606-20; DOI:10.1038/ 2017;37(4):1625-1636; DOI:10.21873/anticanres.11493. onc.2009.115. 22. Ś� wierczewska M, Klejewski A, Brązert M, Kaźmierczak D, Iżycki D, 41. Iacobuzio-Donahue CA, Maitra A, Olsen M, Lowe AW, van Heek NT, Rosty Nowicki M, Zabel M, Januchowski R. New and Old Genes Associated C, Walter K, Śato N, Parker A, Ashfaq R, Jaffee E, Ryu B, Jones J, Eshle- with Primary and Established Responses to Paclitaxel Treatment in man JR, Yeo CJ, Cameron JL, Kern ŚE, Hruban RH, Brown PO, Goggins Ovarian Cancer Cell Lines. Molecules. 2018;23(4):891; DOI:10.3390/ M. Exploration of global gene expression patterns in pancreatic adeno- molecules23040891. carcinoma using cDNA microarrays. Am J Pathol. 2003;162(4):1151-62; 23. Wong JJ, Pung YF, Śze NŚ, Chin KC. HERC5 is an IFN-induced HECT- DOI:10.1016/S0002-9440(10)63911-9. -type E3 protein ligase that mediates type I IFN-induced ISGylation 42. Desai ŚD, Reed RE, Burks J, Wood LM, Pullikuth AK, Haas AL, Liu LF, of protein targets. Proc Natl Acad Sci U S A. 2006;103(28):10735-40; Breslin JW, Meiners Ś, Śankar Ś. IŚG15 disrupts cytoskeletal architecture DOI:10.1073/pnas.0600397103. and promotes motility in human breast cancer cells. Exp Biol Med (May- 24. Huang YF, Bulavin DV. Oncogene-mediated regulation of p53 ISGyla- wood). 2012;237(1):38-49; DOI:10.1258/ebm.2011.011236. tion and functions. Oncotarget. 2014;5(14):5808-18; DOI:10.18632/ 43. Andersen JB, Aaboe M, Borden EC, Goloubeva OG, Hassel BA, Orntoft TF. oncotarget.2199. Stage-associated overexpression of the ubiquitin-like protein, ISG15, 25. Kiessling A, Hogrefe C, Erb S, Bobach C, Fuessel S, Wessjohann L, Se- in bladder cancer. Br J Cancer. 2006;94(10):1465-71; DOI:10.1038/ liger B. Expression, regulation and function of the ISGylation system sj.bjc.6603099. in prostate cancer. Oncogene. 2009;28(28):2606-20; DOI:10.1038/ 44. Wang Y, Ding Q, Xu T, Li CY, Zhou DD, Zhang L. HZ-6d targeted HERC5 onc.2009.115. to regulate p53 ISGylation in human hepatocellular carcinoma. Toxicol 26. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uemat- Appl Pharmacol. 2017;334:180-191; DOI:10.1016/j.taap.2017.09.011. su Ś, Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh 45. Tang J, Yang Q, Cui Q, Zhang D, Kong D, Liao X, Ren J, Gong Y, Wu G. We- CS, Reis e Sousa C, Matsuura Y, Fujita T, Akira S. Differential roles of ighted gene correlation network analysis identifies RSAD2, HERC5, MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature. and CCL8 as prognostic candidates for breast cancer. J Cell Physiol. 2006;441(7089):101-5; DOI:10.1038/nature04734. 2020;235(1):394-407; DOI:10.1002/jcp.28980. 27. Lin L, Su Z, Lebedeva IV, Gupta P, Boukerche H, Rai T, Barber GN, Dent P, 46. Marín- � Aguilera M, Codony-Śervat J, Kalko ŚG, Fernández PL, Bermudo Sarkar D, Fisher PB. Activation of Ras/Raf protects cells from melanoma R, Buxo E, Ribal MJ, Gascón P, Mellado B. Identification of docetaxel re- differentiation-associated gene-5-induced apoptosis. Cell Death Differ. sistance genes in castration-resistant prostate cancer. Mol Cancer Ther. 2006;13(11):1982-93; DOI:10.1038/sj.cdd.4401899. 2012;11(2):329-39; DOI:10.1158/1535-7163.MCT-11-0289. 147 Nowacka et al. Medical Journal of Cell Biology (2021) 47. Hou DL, Chen L, Liu B, Song LN, Fang T. Identification of common gene networks responsive to radiotherapy in human cancer cells. Cancer Gene Ther. 2014;21(12):542-8; DOI:10.1038/cgt.2014.62. 48. Huang C, Wang Y, Huang JH, Liu W. Śema3A drastically suppresses tumor growth in oral cancer Xenograft model of mice. BMC Pharmacol Toxicol. 2017 Jul 6;18(1):55; DOI:10.1186/s40360-017-0163-4. 49. Abukhdeir AM, Park BH. P21 and p27: roles in carcinogenesis and drug resistance. Expert Rev Mol Med. 2008;10:e19; DOI:10.1017/ S1462399408000744. 50. Ś� wierczewska M, Śterzyńska K, Wojtowicz K, Kaźmierczak D, Iżycki D, Nowicki M, Zabel M, Januchowski R. PTPRK Expression Is Down- regulated in Drug Resistant Ovarian Cancer Cell Lines, and Espe- cially in ALDH1A1 Positive CŚCs-Like Populations. Int J Mol Ści. 2019;20(8):2053; DOI:10.3390/ijms20082053.

Journal

Advances in Cell Biologyde Gruyter

Published: Sep 1, 2021

Keywords: ovarian cancer; cytotoxic drug resistance; new genes

There are no references for this article.