Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Genetic Diversity in Ficus Sycomorus L. Species (Moraceae) Using Rapd and Irap Markers

Genetic Diversity in Ficus Sycomorus L. Species (Moraceae) Using Rapd and Irap Markers Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 DOI: 10.2478/agri-2013-0011 BASEL SALEH Atomic Energy Commission of Syria, Damascus SALEH, B.: Genetic diversity in Ficus sycomorus L. species (Moraceae) using RAPD and IRAP markers. Agriculture (Ponohospodárstvo), vol. 59, 2013, no. 3, pp. 120­130. This study was conducted in order to assess accuracy, repeatability and reproducibility of the RAPD and IRAP techniques for determining the genetic variability in 10 Ficus sycomorus L. genotypes grown in the coastal regions of Syria. Thirty-six RAPD primers applied gave 352 discernible loci, of which 252 (71.59%) were polymorphic. Polymerase chain reaction (PCR) amplification with 36 RAPD primers gave an average of 9.778 selected markers/primers, with a maximum of 21 (OPA18) and a minimum of five (OPG11, OPK12 and OPT18). The amplification with 22 IRAP primers (single or combination) generated 178 bands, of which 151 (84.83%) were polymorphic, with an average of 11.125 selected markers/ primer, with a maximum of 17 (IRAP-TDK11F) and a minimum of seven (BREP1F+BREP1R, IRAP-TDK1F+IRAP-TDK1R and IRAP-TDK2F+IRAP-TDK2R). In the present investigation, the IRAP marker was more efficient than the RAPD assay, where the latter exhibited a lower marker index (MI) average (1.629) compared with the IRAP technique (2.941). Otherwise, F. sycomor4 genotype showed the highest dissimilarity compared with other genotypes studied in this investigation. Based upon the estimated percent disagreement values (PDV), we can suggest that there are three subspecies present among the 10 samples tested. Key words: Ficus sycomorus L.; genotype; IRAP; marker index; polymorphism; RAPD Ficus sycomorus L. species arranged as a subgenus of the fig, belongs to the Moraceae family. Within the genus Ficus, approximately 400 monoecious and 800 gynodioecious species are in existence (Al Malki & Elmeer 2010). The name, sycomorus, comes from the Greek syca-morus which means mulberry fig. The trees are not as cold-hardy as the common fig Ficus carica L. They are usually grown in the warmer regions of the Middle East and Africa. F. sycomorus L. is a rare perennial tree or sub-tree. It was originally brought from Ethiopia and Central Africa. It has been planted since antiquity in Egypt, Palestine, Lebanon and Syria. It is presently becoming rare because of urban development. Thus, the rest of this species can be found in Sida and Syrian littoral zones (Mouterde 1966). It is known as Sycmore as a common English name, and as Al-Joumayz as a common Arabic name. This species is becoming one of the endangered species leading to extinction, among other plant genetic resources in Syria. However, there are some efforts for characterisation and conservation of the genetic diversity to prevent their potential extinction and further utilisation. This species shows a good tolerance for an abiotic stress (salinity) in addition to being traditionally appreciated for its ripe fruits. It plays an important role in traditional treatment of many diseases and ailments. In coastal regions from Syria, the stem bark of Ficus sycomorus L. is traditionally used to treat fungal diseases. Syria is an important region for different plant genetic resources (wild and cultivated species) in the world because of its diverse ecosystems and cli- Basel Saleh, PhD., Department of Molecular Biology and Biotechnology, Atomic Energy Commission of Syria, P.O. Box 6091, Damascus, Syria. E-mail: bsaleh@aec.org.sy; ascientific@aec.org.sy Agriculture (Ponohospodárstvo), 59, 2013 (3): 120130 matic conditions. Syria is considered to be a centre of origin and biodiversity for many crops, feeds and fruit trees (Zohary 1962, 1973). It is one of the few core centres where numerous species of temperate-zone agricultural specimens originated thousands of years ago, and where third-world relatives and land races of enormous genetic diversity are still present. Estimates indicated that Syrian flora includes about 3,150 species arranged in 919 genus and 133 families (Barkoudah et al. 2000). Different marker systems are currently available for monitoring and assessing genetic diversity. Random amplified polymorphic DNA (RAPD) markers established by Williams et al. (1990) are DNA fragments from PCR amplification of random segments of genomic DNA with a single primer of arbitrary nucleotide sequences, which are able to differentiate between genetically distinct individuals. This technique is simple to use, and does not need any sequence information. The RAPD marker becomes one of the fewer molecular techniques for assessing genetic variation in fig in many countries; for example, in Italy (De-Masi et al. 2005), in Tunisia (Salhi-Hannaci et al. 2006; Baraket et al. 2011), in Egypt (Hadia et al. 2008), in Japan (Ikegami et al. 2009), and also in Turkey (Akbulut et al. 2009; Dalkilic et al. 2011). New techniques based on DNA profiling provide novel approaches to identification of the varieties, which offer advantages over traditional morphological comparisons. Inter-retrotransposon amplified polymorphism (IRAP) displays insertional polymorphisms by amplifying the segments of DNA between two retrotransposons. The IRAP marker detects high levels of polymorphism which does not need DNA digestion, ligations, or probe hybridisation to generate marker data, thus increasing the reliability and robustness of the assay. Mobile genetic elements, retrotransposons, generally show widespread chromosomal dispersion, variable copy number, and random distribution in the genome. The IRAP marker is one among other retrotransposon-based markers which are a new group of markers applied successfully in genetic variation studies in various plant crops, for example, in banana (Nair et al. 2005), in barley (Alavi-Kia et al. 2008), in Aegilops (Saeidi et al. 2008), in potato (Novakova et al. 2009) and recently in flax (Linum usitatissimum L.) (Smýkal et al. 2011). IRAP could be performed as an accurate, repeatable and reproducible marker compared with the RAPD system (Biswas et al. 2009). As yet, our knowledge of the Ficus genus breeding system and its evolution has been shaped by taxonomy, anatomy, ecology, pollinator behaviour and genetic variability. However, phylogenetic studies in F. sycomorus L. species have not yet been examined in detail. Therefore, this investigation was performed to assess genetic variation in F. sycomorus L. species in Syria using RAPD and IRAP markers. Comparative assessment of PCR-based markers (RAPD and IRAP) was carried out, and their potential application as marker systems was investigated for their utility in phylogenetic relationships within this species. MATERIAL AND METHODS Plant materials Ten samples were collected from their natural habitats along the coastal regions of Syria (Table 1). These geographical regions consist of altitudes ranging from 4.5 m to 250 m from the wet coastal regions. Sampling was carried out in autumn from trees spread on clay soil, and where annual rainfall ranged from 650 mm to 850 mm. Total DNA isolation The genomic DNA of the plant was extracted from young leaves of 10 samples of F. sycomorus species in Syria (bulk of 5 leaves/tree for each representative genotype) by a CTAB (cetyltrimethylammonium bromide) protocol as described by Doyle and Doyle (1987) with minor modifications. Leaf tissue (150 mg) was ground in liquid nitrogen, the powder was transferred to a 2-ml Eppendorf tube, mixed with 900 l of extraction buffer (100 mM Tris-HCl, pH 8.0, 1.4 M NaCl, 20 mM EDTA, 0.0018 ml ß-mercaptoethanol, 2% CTAB), and incubated at 65°C for 20 min. DNA was extracted with one volume of a chloroform:isoamyl alcohol mix (24:1, v/v), and centrifuged at 12,000 g for 10 min at 4°C. The aqueous phase was transferred to a fresh tube, and the DNA was precipitated with an equal Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 volume of cold isopropanol and kept at -20°C for 10 min, then centrifuged at 12,000 g for 10 min at 4°C, the supernatant was discarded; DNA was then spooled out and washed with 1 M ammonium acetate and 100% ethanol. The cleaned DNA pellet was air dried and dissolved in 100 l of 0.1X TE buffer (1 mM Tris-HCl, 0.1 mM EDTA, pH 8.0). After addition of 5 l of RNase (10 mg/ml), and incubation for 30 min at 37°C, the DNA was washed with 1 M ammonium acetate and 100% ethanol. Then it was centrifuged at 12,000 g for 30 min at 4°C, and the supernatant was discarded; DNA was rinsed twice with 70% ethanol. The cleaned DNA pellet was air dried and dissolved in 100 l of 0.1X TE buffer. The DNA concentration was quantified by DNA fluorimeter and kept at ­80°C until use. RAPD assay Thirty-three RAPD primers belonging to Operon Technologies Inc., USA, and three primers from the University of British Columbia were tested for genetic variability detection within F. sycomorus species. The amplification reaction was carried out in a 25 l reaction volume containing 1X PCR buffer, 2 mM MgCl2, 0.25 mM dNTPs, 25 pmol primer, 1.5 U of Taq DNA polymerase and 50 ng template DNA. PCR amplification was performed in a T-gradient thermal cycler (Bio-Rad; T-Gradient). It was programmed to fulfil 42 cycles after an initial denaturation cycle for 4 min at 94ºC. Each cycle consisted of a denaturation step for 1 min at 94ºC, an annealing step for 2 min at 35ºC, and an extension step at 72ºC for 2 min, followed by an extension cycle for 7 min at 72ºC in the final cycle. The PCR products were separated on a 1.5% ethidium bromide-stained agarose gel (Bio-Rad) in 0.5X TBE buffer. Electrophoresis was performed for 2.5 h for RAPD at 85 V and visualised with a UV transilluminator. A 1 kb DNA ladder standard was used to estimate the molecular weight of the amplification products. IRAP assay For the IRAP marker, 22 (single, or in combination) primers were also examined, as previously described in other species (Guo et al. 2006; Alavi-Kia et al. 2008; Novakova et al. 2009). The amplification reaction was carried out in 25 l reaction volume containing 1X PCR buffer, 2 mM MgCl2, 0.25 mM dNTPs, 25 pmol primer, 1.5 U of Taq DNA polymerase and 50 ng template DNA. PCR amplification was performed in a T-gradient thermal cycler (Bio-Rad; T-Gradient). It was programmed to fulfil 35 cycles after an initial denaturation cycle for 4 min at 94ºC. Each cycle consisted of a denaturation step for 1 min at 94ºC, an annealing step for 2 min at Tm varied according to each primer examined, and an extension step at 72ºC for 2 min, followed by extension cycle for 7 min at 72ºC in the final cycle. The PCR products were separated on a 2% ethidium T a b l e 1 Geographical regions, and description of original sites where the 10 F. sycomorus genotypes were collected Genotype code F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 Original site Lattakia Lattakia Lattakia Lattakia Lattakia Lattakia Jableh Banyas Banyas Banyas Accompanied species Eucalyptus ssp and Azadarachtx indica Azadarachtx indica None Cupressus sempervirens None Ailanthus altissima Azadarachtx indica None Juglans regia L. None Altitude [m] 4.5 4.5 6.3 6.3 6.3 6.3 11.8 10.0 220.0 250.0 Annual rainfall [mm] 650700 650700 650700 650700 650700 650700 650700 700750 ~850 ~850 Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 bromide-stained agarose gel (Bio-Rad) in 0.5X TBE buffer. Electrophoresis was performed for 1.5 h at 85 V and visualised with a UV transilluminator. A 1 kb DNA ladder standard was used to estimate molecular weight of amplification products. RAPD and IRAP data analysis The presence or absence of each size class was scored as 1 or 0, respectively. The percent disagreement values (PDV) found were used to generate a matrix via the Unweighted Pair Group Mean Arithmetic average (UPGMA) using Statistica program (Statistica 2003). This matrix was used to calculate genetic similarity (Jaccard 1908). Polymorphic information content (PIC) values were calculated for each RAPD or IRAP primer according to the formula PIC = 1 (Pij)2 where Pij is the frequency of the ith pattern revealed by the jth primer summed across all patterns revealed by the primers (Botestein et al. 1980). The marker index (MI), as a universal metric to represent the amount of information obtained per experiment for a given kind of markers, as reported by Powell et al. (1996), was also calculated for each RAPD and IRAP primer as MI = PIC × where PIC is the mean PIC value, the number of bands, and is the proportion of polymorphic. As for IRAP analysis, a total of 178 bands were detected, among which 151 bands (84.83%) were polymorphic, with the mean of 11.125 bands/primer or primer combination (Table 3). The highest number of fragments (17) was obtained with the IRAP-TDK11F, whereas, the lowest (7) was revealed by (BREP1F+BREP1R, IRAP-TDK1F+IRAP-TDK1R and IRAP-TDK2F+IRAP-TDK2R) primer combinations. PCR amplification products obtained from Sukkula + Nikita, IRAP-TDK11F and Sukkula + LTR6150-BARE1 primer combinations are illustrated in Figure 2. In this study, two PCR-based systems (RAPD and IRAP) were employed to investigate the genetic diversity among 10 genotypes of F. sycomorus grown in Syria. Our study showed moderate polymorphism level values of 71.59% (RAPD marker), and high values of 84.83% (IRAP marker) among the genotypes examined. Other researches, however, reported a good degree of polymorphism in neotropical Ficus (80%) (Nazareno et al. 2009), in F. carica L. (81.1%) (De-Masi et al. 2005) using the same marker; in F. carica L. (97.5% and 100% using AFLP and SSR markers, respectively) (Baraket et al. 2011) and 84.96% and 90.91% in Arthrocnemum macrostachyum (Saleh 2011) using RAPD and ISSR markers, respectively. Hadia et al. (2008) reported values of 62.4% and 61.2% using RAPD and ISSR markers, respectively, in F. carica, however, Dalkilic et al. (2011) reported a lower value for the same species (27.9% using RAPD marker). Singh et al. (2011) also reported a low polymorphism level (P%) (54.33% and 56.02% using, respectively, RAPD and ISSR markers in Morinda spp). Whereas, our results were in agreement with other findings in F. carica (Salhi-Hannaci et al. 2006; Akbulut et al. 2009; Ikegami et al. 2009). Moreover, Aradhya et al. (2010) used 15 microsatellite loci for genetic diversity in cultivated fig (F. carica L.) to examine the genetic structure and differentiation. Their results revealed weak genetic structure, and they proposed that this was probably due to an inherently narrow genetic base from which the fig was domesticated, combined with historical migration of germplasm, and the outcrossing mode of pollination, all of which have countered human selection in different fig-growing regions of the RESULTS AND DISCUSSION PCR amplification produced by RAPD and IRAP primers are listed in Tables 2 and 3 in terms of the percentage of PCR products appearing in the genotypes studied. The RAPD analysis carried out on the 10 genotypes of F. sycomorus produced a large number of distinct fragments for each primer. The 36 selected arbitrary primers generated a total of 352 scorable bands, of which 252 (71.59%) were polymorphic, with an average of 9.778 amplicons/ primer (Table 2). OPA18 gave the highest number of fragments (21 amplicons), while OPG11, OPK12 and OPT18 primers revealed the lowest number (5 amplicons). Figure 1 shows the RAPD profile for the 10 genotypes yielded by OPK17, UBC132 and OPD20 primers. Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 T a b l e 2 Selected 36 RAPD primers tested in this study Primer name OPA02 OPA04 OPA18 OPB01 OPB04 OPB05 OPB12 OPB17 OPC02 OPC07 OPC08 OPC13 OPC15 OPD08 OPD20 OPE04 OPE07 OPE15 OPE18 OPG11 OPJ01 OPJ07 OPK08 OPK12 OPK13 OPK17 OPQ01 OPQ18 OPR12 OPT18 OPV03 OPW17 OPY10 UBC132 UBC159 UBC702 Total Mean Primer Sequence 5` to 3` TGCCGAGCTG AATCGGGCTG AGGTGACCGT GTTTCGCTCC GGACTGGAGT TGCGCCCTTC CCTTGACGCA AGGGAACGAG GTGAGGCGTC GTCCCGACGA TGGACCGGTG AAGCCTCGTC GACGGATCAG GTGTGCCCCA GGTCTACACC GTGACATGCC AGATGCAGCC ACGCACAACC GGACTGCAGA TGCCCGTCGT CCCGGCATAA CCTCTCGACA GAACACTGGG TGGCCCTCAC GGTTGTACCC CCCAGCTGTG GGGACGATGG AGGCTGGGTG ACAGGTGCGT GATGCCAGAC CTCCCTGCAA GTCCTGGGTT CAAACGTGGG AGGGATCTCC GAGCCCGTAG GGGAGAAGGG Tb 9 10 21 10 16 10 10 10 10 6 6 7 8 9 14 8 11 9 11 5 12 11 10 5 8 13 10 7 10 5 12 10 10 10 12 7 352 9.778 Pb 7 8 16 8 10 9 4 6 8 5 4 4 6 3 10 6 9 7 8 2 11 10 9 3 4 10 6 4 3 2 11 9 8 6 10 6 252 7 P [%] 77.778 80.000 76.190 80.000 62.500 90.000 40.000 60.000 80.000 83.333 66.667 57.143 75.000 33.333 71.429 75.000 81.818 77.778 72.727 40.000 91.667 90.909 90.000 60.000 50.000 76.923 60.000 57.143 30.000 40.000 91.667 90.000 80.000 60.000 83.333 85.714 69.990 PIC 0.258 0.256 0.243 0.288 0.225 0.220 0.110 0.200 0.296 0.250 0.210 0.169 0.310 0.060 0.190 0.190 0.347 0.260 0.230 0.168 0.202 0.330 0.286 0.136 0.190 0.190 0.138 0.171 0.106 0.072 0.313 0.236 0.226 0.186 0.248 0.217 0.215 MI 1.806 2.048 3.888 2.304 2.250 1.980 0.440 1.200 2.368 1.250 0.840 0.676 1.860 0.180 1.900 1.140 3.123 1.820 1.840 0.336 2.222 3.300 2.574 0.408 0.760 1.900 0.828 0.684 0.318 0.144 3.443 2.124 1.808 1.116 2.480 1.302 1.629 Tb Total bands; Pb Polymorphic bands; P [%] Polymorphic %; PIC Polymorphic information content; MI Marker index Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 T a b l e 3 Selected 22 IRAP primers tested in this study Primer name BREP1 F BREP1 R IRAP-TDK1F IRAP-TDK1R IRAP-TDK2F IRAP-TDK2R BREP F BREP R IRAP-TDK10F IRAP-TDK11F IRAP-TDK12F IRAP-TDK12R IRAP-TDK13F IRAP-TDK13R Sukkula 5LT R2-BARE-1 Sukkula LT R6150-BARE-1 Sukkula Nikita 3LT R-BARE-1 5LT R2-BARE-1 3LT R-BARE-1 Nikita 3LT R-BARE-1 P-Tst-6 P-Tst-1 P-Tst-3 Total Mean Primer Sequence 5' to 3' AAGTATTCGGTGTCCAAAATC ACTCCCTGTTGAAAATTCTGA TCAATCGGACTTGTTCAAAACCCCA TACAGACCAAATGCTCACCATCACT GAAGTTAGTGGGAGCAAAAGATGT TACCAATGTCGGGAGGCTTGTGTCA TTCAAGATTTCTGACCTTTCG CCAGTGGCACATCAAAACAAAA CTTTGTGATAGAACTTGGGTTTGCT AGGTATGGTTTCAAGATGATGGATG ATACAACAGACTCAATGCCGACCCT ACCTGCCAACCAACTTCTTTTCCTC TCCTGATGGGAACTTCGTTGCTCGT CCTGACACCTCAAAACCTTCTGGCT GATAGGGTCGCATCTGGGCGTGAC ATCATTCTCTAGGGCATAATTC GATAGGGTCGCATCTGGGCGTGAC CTGGTTCGGCCATGTCTATGTATCACACATGTA GATAGGGTCGCATCTGGGCGTGAC CGCATTGTTCAAGCCTAAACC TGTTCATGCGACGTTCAACA ATCATTCTCTAGGGCATAATTC TGTTCATGCGACGTTCAACA CGCATTGTTCAAGCCTAAACC TGTTCATGCGACGTTCAACA ACTAAATCTGCCTACTCATTCAACACTC ATGACTAAATCTGCCTACTCATTCAACA ACTAAAAATCTGCCTACTCATTCAACACTC Ta [ºC] 45 Tb 7 Pb 5 P [%] 71.429 PIC 0.269 MI 1.345 Ta [ºC] Annealing temperature; Tb Total bands; Pb Polymorphic bands; P [%] Polymorphic %; PIC Polymorphic information content; MI Marker index Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 world. Moreover, in Weiblen's (2000) investigation, separated and combined phylogenetic analyses of ITS and morphological characters indicate that monoecious Sycomorus is monophyletic and nested in a clade of functionally dioecious Ficus. In the present investigation, the PIC value estimated with RAPD assay ranged from 0.060 to 0.347 with an average of 0.215, whereas, this index varied between 0.197 and 0.387 with an average of 0.299 using an IRAP marker. Dalkilic et al. (2011), obtained values that ranged from 0.16 to 0.50 in male fig (Ficus carica caprificus L.) genotypes using an RAPD marker, whereas, this value was recorded to be 0.79 and 0.94 in fig (F. carica L.) using AFLP and SSR markers, respectively (Baraket et al. 2011). For determining the overall usefulness of a given marker system, the MI was calculated for both the marker systems examined. IRAP markers showed the highest MI (2.941; Table 3), which is higher than the estimated value for the RAPD (1.629; Table 2). This analysis highlights the distinctive nature of the IRAP assay. Indeed, the MI, considered to be an overall measurement of the efficiency to detect polymorphism, was higher (2.941) for IRAP than (1.629) for RAPD marker systems (Tables 2 and 3). According to the formula used, the high-value MI calculated for the IRAP assay, makes the IRAP marker system suitable for estimating the level of genetic diversity in F. sycomorus genotypes compared with the RAPD system. Consequently, IRAP fingerprinting was more efficient than the RAPD assay. The present results were in accordance with the observation by Biswas et al. (2009) in citrus, while, this value was 45.2 and 0.94 for AFLP and Figure 1. Polymorphism resultant from the use of OPK17, UBC132 and OPD20 RAPD primers for F. sycomorus genotypes 1, 2, 3 and 10, Lane M, DNA marker 1 kb Figure 2. Polymorphism resultant from the use of Sukkula + Nikita, IRAP-TDK11F and Sukkula + LTR6150BARE-1 IRAP primer combinations for F. sycomorus genotypes 1, 2, 3 and 10, Lane M, DNA marker 1 kb Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 SSR markers, respectively, in F. carica L. (Baraket et al. 2011). Genetic similarity estimated among genotypes was scaled between 0.401 and 0.897, with an average of 0.705 in the case of RAPD, and between 0.205 and 0.976 with an average of 0.623 in the case of IRAP markers. While, this value was higher than that previously reported using the same technique in F. carica L., it was estimated to be (0.21­0.62) with an average of 0.468 in the Akbulut et al. (2009) investigation with RAPD markers, ranging between 0.04 and 0.59, with an average of 0.32 (for AFLP) and between 0.017­0.546 with an average of 0.281 (for SSR) in the Baraket et al. (2011) study, where- Figure 3. UPGMA cluster analysis-based on the percent disagreement value for RAPD and IRAP data combination showing genetic relationship among the 10 genotypes of F. sycomorus L. species T a b l e 4 Percent disagreement values (PDV) produced by RAPD and IRAP (single or in combination) data combination using the UPGMA routine in statistical program Genotype F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 T a b l e 5 Jaccard's similarity matrix produced by RAPD and IRAP (single or combination) data combination for the 10 F. sycomorus tested genotypes Genotype F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 as, it was varied between 0 and 0.78 with an average of 0.39 (Salhi-Hannaci et al. 2006), between 0.20 and 0.85 with an average of 0.51 (Cerqueira-Silva et al. 2010) in Passiflora cincinnata, between 0.181 and 0.562 with an average of 0.543 using an RAPD marker in Arthrocnemum macrostachyum (Saleh 2011), and in the study reported by Ikegami et al. (2009) on F. carica L., the average was 0.717. Combined RAPD and IRAP data produced genetic distances ranging from 0.05 to 0.46 with a mean of 0.28 (Table 4), and the resultant dendrogram (Figure 3) demonstrated that the 10 F. sycomorus genotypes phylogenetics fell into two main groups. The first cluster consisted of F. sycomor4 genotype that formed a distinct cluster with a PDV estimated value higher than 0.38 with other tested genotypes, especially with F. sycomor8 and F. sycomor4, and with F. sycomor10 and F. sycomor4 (PDV = 0.46), whereas, the second cluster included the remaining genotypes. Subsequently, the last cluster was further divided into four subclusters containing the remaining tested genotypes. The first subcluster involved genotypes F. sycomor1 and 2 that were closely related at PDV = 0.09 (similarity 0.857, Table 5). While, the second subcluster included F. sycomor6 and 8, that were closely related at PDV = 0.1 (similarity 0.850, Table 5). This subcluster was closed to F. sycomor7 at PDV = 0.11 (similarity 0.843, Table 5) and with F. sycomor8 at PDV = 0.12 (similarity 0.836, Table 5), whereas, the third subcluster consisted of F. sycomor9 and 10 that were the most related genotypes with a PDV = 0.05) similarity 0.924, Table 5). The fourth and last subcluster involved F. sycomor3 and F. sycomor5 that were also closely related at PDV = 0.12 (similarity 0.798, Table 5). Our results demonstrated that the genotypes studied are clustered independently from their geographical origin. Taking into account that F. sycomorus genotypes aggregated together in the same cluster, this indicated a possible common origin of these genotypes. This is in agreement with the monoecious origin of Ficus that has evolved into two gynodioecious forms as suggested by Machado et al. (2001). It is important to note that similar data have been reported in Tunisian fig using RAPD markers (Salhi Hannachi et al. 2006). CONCLUSION Overall, this study clearly demonstrates a relatively high diversity among F. sycomorus genotypes found in the coastal regions of Syria. Moreover, the two techniques applied may provide useful information on polymorphism levels as well as diversity in F. sycomorus L. species, but the IRAP marker differentiates accessions much better than the RAPD marker system. Consequently, the IRAP technique could be performed as a high-accuracy approach Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 compared with the RAPD tool. Moreover, F. sycomor4 genotype showed the highest dissimilarity compared to the other genotypes studied in this investigation. According to the dendrogram based on a combination of RAPD and IRAP data, it could be suggested, that F. sycomor4 genotype belongs to a subspecies that is different from that of the remaining genotypes. In this investigation, it was not easy to predict the exact number of subspecies studied herein, especially since the exact number of F. sycomorus subspecies found in Syria is not known. Based upon the previous observation, and according to the position of genotypes presented by UPGMA cluster analysis, it may be postulated, however, that there are three subspecies present among the 10 samples tested. The first subspecies involved F. sycomorus3 and F. sycomorus5 genotypes, the second involved F. sycomorus4 which was being suggested as presenting a distinct subspecies from the other genotypes tested, whereas, the third involved the remaining tested genotypes. Based upon the results obtained herein, it is satisfying to confirm the previous data using more potential techniques such as, for example, SSR and universal cytoplasmic molecular markers. Thereby, further analyses are required to confirm the number of subspecies to which F. sycomorus trees growing in Syria belong. Acknowledgements. The author would like to thank Prof. Othman I, Director General of AECS and Prof. MirAli N, Head of Molecular Biology and Biotechnology Department for their support, and also to the Plant Biotechnology group for technical assistance. AL MALKI, A.A.H.S. ELMEER K.M.S. 2010. Influence of auxin and cytokinine on in vitro multiplication of Ficus anastasia. In African Journal of Biotechnology, vol. 9, no. 5, pp. 635639. DOI: 10.5897/ AJB09.1168. ARADHYA, M.K. ­ STOVER, E.D. ­ VELASCO, D. ­ KOEHMSTEDT, A. 2010. Genetic structure and differentiation in cultivated fig (Ficus carica L.). In Genetica, vol. 138, pp. 681­694. DOI: 10.1007/ s10709-010-9442-3. BARAKET, G. ­ CHATTI, K. ­ SADDOUD, O. BEN ABDELKARIM, A. ­ MARS, M. ­ TRIFI, M. SAHI HANNACHI, A. 2011. Comparative assessment of SSR and AFLP markers for evaluation of genetic diversity and conservation of fig, Ficus carica L., genetic resources in Tunisia. In Plant Molecular Biology Reporter, vol. 29, pp. 171­184. DOI: 10.1007/ s11105-010-0217-x. BARKOUDAH, Y. ­ DARWISH, A.I. ABI ANTOUN, M. 2000. Biological diversity, National repot. Biodiversity strategy and action plant and report to conference of the parties NBSAP project SY/97/G31. UNDP ­GEF. BISWAS, M.K. ­ XU, O. ­ DENG, X. 2009. Utility of RAPD, ISSR, IRAP and REMAP markers for genetic analysis of Citrus spp. In Scientia Horticulturae, vol. 124, pp. 245261. BOTSTEIN, D. ­ WHITE, R.L. ­ SKOLINCK, M. ­ DAVIS, R.W. 1980. Contraction of a genetic linkage map in man using restriction fragment length polymorphisms. In American Journal of Human Genetics, vol. 32, pp. 314331. CERQUEIRA-SILVA, C.B.M. ­ CONCEICAO, L.D.H.C.S. ­ SANTOS, E.S.L. CARDOSO-SILVA, C.B. ­ PEREIRA, A.S. ­ OLIVEIRA, A.C. CORREA R.X. 2010. Genetic variability in wild genotypes of Passiflora cincinnata based on RAPD markers. In Genetics and Molecular Research, vol. 9, no. 4, pp. 24212428. DOI: 10.4238/vol9-4gmr981. DALKILIC, Z. ­ MESTAV, H.O. GUNVER-DALKILIC, G. ­ KOCATA, H. 2011. Genetic diversity of male fig (Ficus carica caprificus L.) genotypes with random amplified polymorphic DNA (RAPD) markers. In African Journal of Biotechnology, vol. 10, no. 4, pp. 519526. DOI: 10.5897/AJB10.995. DE MASI, L. ­ CASTADO, D. ­ GALANO, G. ­ MINASI, P. ­ LARATTA, B. 2005. Genotyping of fig (Ficus carica L.) via RAPD markers. In Journal of the Science of Food and Agriculture, vol. 85, pp. 2235­ 2242. DOI: 10.1002/jsfa.2247. DOYLE, J.J. ­ DOYLE, J.L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. In Phytochemical Bulletin, vol. 19, 1987, pp. 11­15. GUO, D. ­ Zhang, H. ­ Luo, Z. 2006. Genetic relationships of Diospyros kaki Thunb. and related species revealed by IRAP and REMAP analysis. In Plant Science, vol. 170, no. 3, pp. 528533. DOI: 10.1016/j. plantsci.2005.10.006. HADIA, H.A. EL-MOKADEM, H.E. EL-TAYEB, H.F. 2008. Phylogenetic relationship of four Ficus species using random amplified polymorphic DNA http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Agriculture de Gruyter

Genetic Diversity in Ficus Sycomorus L. Species (Moraceae) Using Rapd and Irap Markers

Agriculture , Volume 59 (3) – Sep 1, 2013

Loading next page...
 
/lp/de-gruyter/genetic-diversity-in-ficus-sycomorus-l-species-moraceae-using-rapd-and-uFynGNay03
Publisher
de Gruyter
Copyright
Copyright © 2013 by the
ISSN
0551-3677
eISSN
1338-4376
DOI
10.2478/agri-2013-0011
Publisher site
See Article on Publisher Site

Abstract

Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 DOI: 10.2478/agri-2013-0011 BASEL SALEH Atomic Energy Commission of Syria, Damascus SALEH, B.: Genetic diversity in Ficus sycomorus L. species (Moraceae) using RAPD and IRAP markers. Agriculture (Ponohospodárstvo), vol. 59, 2013, no. 3, pp. 120­130. This study was conducted in order to assess accuracy, repeatability and reproducibility of the RAPD and IRAP techniques for determining the genetic variability in 10 Ficus sycomorus L. genotypes grown in the coastal regions of Syria. Thirty-six RAPD primers applied gave 352 discernible loci, of which 252 (71.59%) were polymorphic. Polymerase chain reaction (PCR) amplification with 36 RAPD primers gave an average of 9.778 selected markers/primers, with a maximum of 21 (OPA18) and a minimum of five (OPG11, OPK12 and OPT18). The amplification with 22 IRAP primers (single or combination) generated 178 bands, of which 151 (84.83%) were polymorphic, with an average of 11.125 selected markers/ primer, with a maximum of 17 (IRAP-TDK11F) and a minimum of seven (BREP1F+BREP1R, IRAP-TDK1F+IRAP-TDK1R and IRAP-TDK2F+IRAP-TDK2R). In the present investigation, the IRAP marker was more efficient than the RAPD assay, where the latter exhibited a lower marker index (MI) average (1.629) compared with the IRAP technique (2.941). Otherwise, F. sycomor4 genotype showed the highest dissimilarity compared with other genotypes studied in this investigation. Based upon the estimated percent disagreement values (PDV), we can suggest that there are three subspecies present among the 10 samples tested. Key words: Ficus sycomorus L.; genotype; IRAP; marker index; polymorphism; RAPD Ficus sycomorus L. species arranged as a subgenus of the fig, belongs to the Moraceae family. Within the genus Ficus, approximately 400 monoecious and 800 gynodioecious species are in existence (Al Malki & Elmeer 2010). The name, sycomorus, comes from the Greek syca-morus which means mulberry fig. The trees are not as cold-hardy as the common fig Ficus carica L. They are usually grown in the warmer regions of the Middle East and Africa. F. sycomorus L. is a rare perennial tree or sub-tree. It was originally brought from Ethiopia and Central Africa. It has been planted since antiquity in Egypt, Palestine, Lebanon and Syria. It is presently becoming rare because of urban development. Thus, the rest of this species can be found in Sida and Syrian littoral zones (Mouterde 1966). It is known as Sycmore as a common English name, and as Al-Joumayz as a common Arabic name. This species is becoming one of the endangered species leading to extinction, among other plant genetic resources in Syria. However, there are some efforts for characterisation and conservation of the genetic diversity to prevent their potential extinction and further utilisation. This species shows a good tolerance for an abiotic stress (salinity) in addition to being traditionally appreciated for its ripe fruits. It plays an important role in traditional treatment of many diseases and ailments. In coastal regions from Syria, the stem bark of Ficus sycomorus L. is traditionally used to treat fungal diseases. Syria is an important region for different plant genetic resources (wild and cultivated species) in the world because of its diverse ecosystems and cli- Basel Saleh, PhD., Department of Molecular Biology and Biotechnology, Atomic Energy Commission of Syria, P.O. Box 6091, Damascus, Syria. E-mail: bsaleh@aec.org.sy; ascientific@aec.org.sy Agriculture (Ponohospodárstvo), 59, 2013 (3): 120130 matic conditions. Syria is considered to be a centre of origin and biodiversity for many crops, feeds and fruit trees (Zohary 1962, 1973). It is one of the few core centres where numerous species of temperate-zone agricultural specimens originated thousands of years ago, and where third-world relatives and land races of enormous genetic diversity are still present. Estimates indicated that Syrian flora includes about 3,150 species arranged in 919 genus and 133 families (Barkoudah et al. 2000). Different marker systems are currently available for monitoring and assessing genetic diversity. Random amplified polymorphic DNA (RAPD) markers established by Williams et al. (1990) are DNA fragments from PCR amplification of random segments of genomic DNA with a single primer of arbitrary nucleotide sequences, which are able to differentiate between genetically distinct individuals. This technique is simple to use, and does not need any sequence information. The RAPD marker becomes one of the fewer molecular techniques for assessing genetic variation in fig in many countries; for example, in Italy (De-Masi et al. 2005), in Tunisia (Salhi-Hannaci et al. 2006; Baraket et al. 2011), in Egypt (Hadia et al. 2008), in Japan (Ikegami et al. 2009), and also in Turkey (Akbulut et al. 2009; Dalkilic et al. 2011). New techniques based on DNA profiling provide novel approaches to identification of the varieties, which offer advantages over traditional morphological comparisons. Inter-retrotransposon amplified polymorphism (IRAP) displays insertional polymorphisms by amplifying the segments of DNA between two retrotransposons. The IRAP marker detects high levels of polymorphism which does not need DNA digestion, ligations, or probe hybridisation to generate marker data, thus increasing the reliability and robustness of the assay. Mobile genetic elements, retrotransposons, generally show widespread chromosomal dispersion, variable copy number, and random distribution in the genome. The IRAP marker is one among other retrotransposon-based markers which are a new group of markers applied successfully in genetic variation studies in various plant crops, for example, in banana (Nair et al. 2005), in barley (Alavi-Kia et al. 2008), in Aegilops (Saeidi et al. 2008), in potato (Novakova et al. 2009) and recently in flax (Linum usitatissimum L.) (Smýkal et al. 2011). IRAP could be performed as an accurate, repeatable and reproducible marker compared with the RAPD system (Biswas et al. 2009). As yet, our knowledge of the Ficus genus breeding system and its evolution has been shaped by taxonomy, anatomy, ecology, pollinator behaviour and genetic variability. However, phylogenetic studies in F. sycomorus L. species have not yet been examined in detail. Therefore, this investigation was performed to assess genetic variation in F. sycomorus L. species in Syria using RAPD and IRAP markers. Comparative assessment of PCR-based markers (RAPD and IRAP) was carried out, and their potential application as marker systems was investigated for their utility in phylogenetic relationships within this species. MATERIAL AND METHODS Plant materials Ten samples were collected from their natural habitats along the coastal regions of Syria (Table 1). These geographical regions consist of altitudes ranging from 4.5 m to 250 m from the wet coastal regions. Sampling was carried out in autumn from trees spread on clay soil, and where annual rainfall ranged from 650 mm to 850 mm. Total DNA isolation The genomic DNA of the plant was extracted from young leaves of 10 samples of F. sycomorus species in Syria (bulk of 5 leaves/tree for each representative genotype) by a CTAB (cetyltrimethylammonium bromide) protocol as described by Doyle and Doyle (1987) with minor modifications. Leaf tissue (150 mg) was ground in liquid nitrogen, the powder was transferred to a 2-ml Eppendorf tube, mixed with 900 l of extraction buffer (100 mM Tris-HCl, pH 8.0, 1.4 M NaCl, 20 mM EDTA, 0.0018 ml ß-mercaptoethanol, 2% CTAB), and incubated at 65°C for 20 min. DNA was extracted with one volume of a chloroform:isoamyl alcohol mix (24:1, v/v), and centrifuged at 12,000 g for 10 min at 4°C. The aqueous phase was transferred to a fresh tube, and the DNA was precipitated with an equal Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 volume of cold isopropanol and kept at -20°C for 10 min, then centrifuged at 12,000 g for 10 min at 4°C, the supernatant was discarded; DNA was then spooled out and washed with 1 M ammonium acetate and 100% ethanol. The cleaned DNA pellet was air dried and dissolved in 100 l of 0.1X TE buffer (1 mM Tris-HCl, 0.1 mM EDTA, pH 8.0). After addition of 5 l of RNase (10 mg/ml), and incubation for 30 min at 37°C, the DNA was washed with 1 M ammonium acetate and 100% ethanol. Then it was centrifuged at 12,000 g for 30 min at 4°C, and the supernatant was discarded; DNA was rinsed twice with 70% ethanol. The cleaned DNA pellet was air dried and dissolved in 100 l of 0.1X TE buffer. The DNA concentration was quantified by DNA fluorimeter and kept at ­80°C until use. RAPD assay Thirty-three RAPD primers belonging to Operon Technologies Inc., USA, and three primers from the University of British Columbia were tested for genetic variability detection within F. sycomorus species. The amplification reaction was carried out in a 25 l reaction volume containing 1X PCR buffer, 2 mM MgCl2, 0.25 mM dNTPs, 25 pmol primer, 1.5 U of Taq DNA polymerase and 50 ng template DNA. PCR amplification was performed in a T-gradient thermal cycler (Bio-Rad; T-Gradient). It was programmed to fulfil 42 cycles after an initial denaturation cycle for 4 min at 94ºC. Each cycle consisted of a denaturation step for 1 min at 94ºC, an annealing step for 2 min at 35ºC, and an extension step at 72ºC for 2 min, followed by an extension cycle for 7 min at 72ºC in the final cycle. The PCR products were separated on a 1.5% ethidium bromide-stained agarose gel (Bio-Rad) in 0.5X TBE buffer. Electrophoresis was performed for 2.5 h for RAPD at 85 V and visualised with a UV transilluminator. A 1 kb DNA ladder standard was used to estimate the molecular weight of the amplification products. IRAP assay For the IRAP marker, 22 (single, or in combination) primers were also examined, as previously described in other species (Guo et al. 2006; Alavi-Kia et al. 2008; Novakova et al. 2009). The amplification reaction was carried out in 25 l reaction volume containing 1X PCR buffer, 2 mM MgCl2, 0.25 mM dNTPs, 25 pmol primer, 1.5 U of Taq DNA polymerase and 50 ng template DNA. PCR amplification was performed in a T-gradient thermal cycler (Bio-Rad; T-Gradient). It was programmed to fulfil 35 cycles after an initial denaturation cycle for 4 min at 94ºC. Each cycle consisted of a denaturation step for 1 min at 94ºC, an annealing step for 2 min at Tm varied according to each primer examined, and an extension step at 72ºC for 2 min, followed by extension cycle for 7 min at 72ºC in the final cycle. The PCR products were separated on a 2% ethidium T a b l e 1 Geographical regions, and description of original sites where the 10 F. sycomorus genotypes were collected Genotype code F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 Original site Lattakia Lattakia Lattakia Lattakia Lattakia Lattakia Jableh Banyas Banyas Banyas Accompanied species Eucalyptus ssp and Azadarachtx indica Azadarachtx indica None Cupressus sempervirens None Ailanthus altissima Azadarachtx indica None Juglans regia L. None Altitude [m] 4.5 4.5 6.3 6.3 6.3 6.3 11.8 10.0 220.0 250.0 Annual rainfall [mm] 650700 650700 650700 650700 650700 650700 650700 700750 ~850 ~850 Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 bromide-stained agarose gel (Bio-Rad) in 0.5X TBE buffer. Electrophoresis was performed for 1.5 h at 85 V and visualised with a UV transilluminator. A 1 kb DNA ladder standard was used to estimate molecular weight of amplification products. RAPD and IRAP data analysis The presence or absence of each size class was scored as 1 or 0, respectively. The percent disagreement values (PDV) found were used to generate a matrix via the Unweighted Pair Group Mean Arithmetic average (UPGMA) using Statistica program (Statistica 2003). This matrix was used to calculate genetic similarity (Jaccard 1908). Polymorphic information content (PIC) values were calculated for each RAPD or IRAP primer according to the formula PIC = 1 (Pij)2 where Pij is the frequency of the ith pattern revealed by the jth primer summed across all patterns revealed by the primers (Botestein et al. 1980). The marker index (MI), as a universal metric to represent the amount of information obtained per experiment for a given kind of markers, as reported by Powell et al. (1996), was also calculated for each RAPD and IRAP primer as MI = PIC × where PIC is the mean PIC value, the number of bands, and is the proportion of polymorphic. As for IRAP analysis, a total of 178 bands were detected, among which 151 bands (84.83%) were polymorphic, with the mean of 11.125 bands/primer or primer combination (Table 3). The highest number of fragments (17) was obtained with the IRAP-TDK11F, whereas, the lowest (7) was revealed by (BREP1F+BREP1R, IRAP-TDK1F+IRAP-TDK1R and IRAP-TDK2F+IRAP-TDK2R) primer combinations. PCR amplification products obtained from Sukkula + Nikita, IRAP-TDK11F and Sukkula + LTR6150-BARE1 primer combinations are illustrated in Figure 2. In this study, two PCR-based systems (RAPD and IRAP) were employed to investigate the genetic diversity among 10 genotypes of F. sycomorus grown in Syria. Our study showed moderate polymorphism level values of 71.59% (RAPD marker), and high values of 84.83% (IRAP marker) among the genotypes examined. Other researches, however, reported a good degree of polymorphism in neotropical Ficus (80%) (Nazareno et al. 2009), in F. carica L. (81.1%) (De-Masi et al. 2005) using the same marker; in F. carica L. (97.5% and 100% using AFLP and SSR markers, respectively) (Baraket et al. 2011) and 84.96% and 90.91% in Arthrocnemum macrostachyum (Saleh 2011) using RAPD and ISSR markers, respectively. Hadia et al. (2008) reported values of 62.4% and 61.2% using RAPD and ISSR markers, respectively, in F. carica, however, Dalkilic et al. (2011) reported a lower value for the same species (27.9% using RAPD marker). Singh et al. (2011) also reported a low polymorphism level (P%) (54.33% and 56.02% using, respectively, RAPD and ISSR markers in Morinda spp). Whereas, our results were in agreement with other findings in F. carica (Salhi-Hannaci et al. 2006; Akbulut et al. 2009; Ikegami et al. 2009). Moreover, Aradhya et al. (2010) used 15 microsatellite loci for genetic diversity in cultivated fig (F. carica L.) to examine the genetic structure and differentiation. Their results revealed weak genetic structure, and they proposed that this was probably due to an inherently narrow genetic base from which the fig was domesticated, combined with historical migration of germplasm, and the outcrossing mode of pollination, all of which have countered human selection in different fig-growing regions of the RESULTS AND DISCUSSION PCR amplification produced by RAPD and IRAP primers are listed in Tables 2 and 3 in terms of the percentage of PCR products appearing in the genotypes studied. The RAPD analysis carried out on the 10 genotypes of F. sycomorus produced a large number of distinct fragments for each primer. The 36 selected arbitrary primers generated a total of 352 scorable bands, of which 252 (71.59%) were polymorphic, with an average of 9.778 amplicons/ primer (Table 2). OPA18 gave the highest number of fragments (21 amplicons), while OPG11, OPK12 and OPT18 primers revealed the lowest number (5 amplicons). Figure 1 shows the RAPD profile for the 10 genotypes yielded by OPK17, UBC132 and OPD20 primers. Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 T a b l e 2 Selected 36 RAPD primers tested in this study Primer name OPA02 OPA04 OPA18 OPB01 OPB04 OPB05 OPB12 OPB17 OPC02 OPC07 OPC08 OPC13 OPC15 OPD08 OPD20 OPE04 OPE07 OPE15 OPE18 OPG11 OPJ01 OPJ07 OPK08 OPK12 OPK13 OPK17 OPQ01 OPQ18 OPR12 OPT18 OPV03 OPW17 OPY10 UBC132 UBC159 UBC702 Total Mean Primer Sequence 5` to 3` TGCCGAGCTG AATCGGGCTG AGGTGACCGT GTTTCGCTCC GGACTGGAGT TGCGCCCTTC CCTTGACGCA AGGGAACGAG GTGAGGCGTC GTCCCGACGA TGGACCGGTG AAGCCTCGTC GACGGATCAG GTGTGCCCCA GGTCTACACC GTGACATGCC AGATGCAGCC ACGCACAACC GGACTGCAGA TGCCCGTCGT CCCGGCATAA CCTCTCGACA GAACACTGGG TGGCCCTCAC GGTTGTACCC CCCAGCTGTG GGGACGATGG AGGCTGGGTG ACAGGTGCGT GATGCCAGAC CTCCCTGCAA GTCCTGGGTT CAAACGTGGG AGGGATCTCC GAGCCCGTAG GGGAGAAGGG Tb 9 10 21 10 16 10 10 10 10 6 6 7 8 9 14 8 11 9 11 5 12 11 10 5 8 13 10 7 10 5 12 10 10 10 12 7 352 9.778 Pb 7 8 16 8 10 9 4 6 8 5 4 4 6 3 10 6 9 7 8 2 11 10 9 3 4 10 6 4 3 2 11 9 8 6 10 6 252 7 P [%] 77.778 80.000 76.190 80.000 62.500 90.000 40.000 60.000 80.000 83.333 66.667 57.143 75.000 33.333 71.429 75.000 81.818 77.778 72.727 40.000 91.667 90.909 90.000 60.000 50.000 76.923 60.000 57.143 30.000 40.000 91.667 90.000 80.000 60.000 83.333 85.714 69.990 PIC 0.258 0.256 0.243 0.288 0.225 0.220 0.110 0.200 0.296 0.250 0.210 0.169 0.310 0.060 0.190 0.190 0.347 0.260 0.230 0.168 0.202 0.330 0.286 0.136 0.190 0.190 0.138 0.171 0.106 0.072 0.313 0.236 0.226 0.186 0.248 0.217 0.215 MI 1.806 2.048 3.888 2.304 2.250 1.980 0.440 1.200 2.368 1.250 0.840 0.676 1.860 0.180 1.900 1.140 3.123 1.820 1.840 0.336 2.222 3.300 2.574 0.408 0.760 1.900 0.828 0.684 0.318 0.144 3.443 2.124 1.808 1.116 2.480 1.302 1.629 Tb Total bands; Pb Polymorphic bands; P [%] Polymorphic %; PIC Polymorphic information content; MI Marker index Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 T a b l e 3 Selected 22 IRAP primers tested in this study Primer name BREP1 F BREP1 R IRAP-TDK1F IRAP-TDK1R IRAP-TDK2F IRAP-TDK2R BREP F BREP R IRAP-TDK10F IRAP-TDK11F IRAP-TDK12F IRAP-TDK12R IRAP-TDK13F IRAP-TDK13R Sukkula 5LT R2-BARE-1 Sukkula LT R6150-BARE-1 Sukkula Nikita 3LT R-BARE-1 5LT R2-BARE-1 3LT R-BARE-1 Nikita 3LT R-BARE-1 P-Tst-6 P-Tst-1 P-Tst-3 Total Mean Primer Sequence 5' to 3' AAGTATTCGGTGTCCAAAATC ACTCCCTGTTGAAAATTCTGA TCAATCGGACTTGTTCAAAACCCCA TACAGACCAAATGCTCACCATCACT GAAGTTAGTGGGAGCAAAAGATGT TACCAATGTCGGGAGGCTTGTGTCA TTCAAGATTTCTGACCTTTCG CCAGTGGCACATCAAAACAAAA CTTTGTGATAGAACTTGGGTTTGCT AGGTATGGTTTCAAGATGATGGATG ATACAACAGACTCAATGCCGACCCT ACCTGCCAACCAACTTCTTTTCCTC TCCTGATGGGAACTTCGTTGCTCGT CCTGACACCTCAAAACCTTCTGGCT GATAGGGTCGCATCTGGGCGTGAC ATCATTCTCTAGGGCATAATTC GATAGGGTCGCATCTGGGCGTGAC CTGGTTCGGCCATGTCTATGTATCACACATGTA GATAGGGTCGCATCTGGGCGTGAC CGCATTGTTCAAGCCTAAACC TGTTCATGCGACGTTCAACA ATCATTCTCTAGGGCATAATTC TGTTCATGCGACGTTCAACA CGCATTGTTCAAGCCTAAACC TGTTCATGCGACGTTCAACA ACTAAATCTGCCTACTCATTCAACACTC ATGACTAAATCTGCCTACTCATTCAACA ACTAAAAATCTGCCTACTCATTCAACACTC Ta [ºC] 45 Tb 7 Pb 5 P [%] 71.429 PIC 0.269 MI 1.345 Ta [ºC] Annealing temperature; Tb Total bands; Pb Polymorphic bands; P [%] Polymorphic %; PIC Polymorphic information content; MI Marker index Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 world. Moreover, in Weiblen's (2000) investigation, separated and combined phylogenetic analyses of ITS and morphological characters indicate that monoecious Sycomorus is monophyletic and nested in a clade of functionally dioecious Ficus. In the present investigation, the PIC value estimated with RAPD assay ranged from 0.060 to 0.347 with an average of 0.215, whereas, this index varied between 0.197 and 0.387 with an average of 0.299 using an IRAP marker. Dalkilic et al. (2011), obtained values that ranged from 0.16 to 0.50 in male fig (Ficus carica caprificus L.) genotypes using an RAPD marker, whereas, this value was recorded to be 0.79 and 0.94 in fig (F. carica L.) using AFLP and SSR markers, respectively (Baraket et al. 2011). For determining the overall usefulness of a given marker system, the MI was calculated for both the marker systems examined. IRAP markers showed the highest MI (2.941; Table 3), which is higher than the estimated value for the RAPD (1.629; Table 2). This analysis highlights the distinctive nature of the IRAP assay. Indeed, the MI, considered to be an overall measurement of the efficiency to detect polymorphism, was higher (2.941) for IRAP than (1.629) for RAPD marker systems (Tables 2 and 3). According to the formula used, the high-value MI calculated for the IRAP assay, makes the IRAP marker system suitable for estimating the level of genetic diversity in F. sycomorus genotypes compared with the RAPD system. Consequently, IRAP fingerprinting was more efficient than the RAPD assay. The present results were in accordance with the observation by Biswas et al. (2009) in citrus, while, this value was 45.2 and 0.94 for AFLP and Figure 1. Polymorphism resultant from the use of OPK17, UBC132 and OPD20 RAPD primers for F. sycomorus genotypes 1, 2, 3 and 10, Lane M, DNA marker 1 kb Figure 2. Polymorphism resultant from the use of Sukkula + Nikita, IRAP-TDK11F and Sukkula + LTR6150BARE-1 IRAP primer combinations for F. sycomorus genotypes 1, 2, 3 and 10, Lane M, DNA marker 1 kb Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 SSR markers, respectively, in F. carica L. (Baraket et al. 2011). Genetic similarity estimated among genotypes was scaled between 0.401 and 0.897, with an average of 0.705 in the case of RAPD, and between 0.205 and 0.976 with an average of 0.623 in the case of IRAP markers. While, this value was higher than that previously reported using the same technique in F. carica L., it was estimated to be (0.21­0.62) with an average of 0.468 in the Akbulut et al. (2009) investigation with RAPD markers, ranging between 0.04 and 0.59, with an average of 0.32 (for AFLP) and between 0.017­0.546 with an average of 0.281 (for SSR) in the Baraket et al. (2011) study, where- Figure 3. UPGMA cluster analysis-based on the percent disagreement value for RAPD and IRAP data combination showing genetic relationship among the 10 genotypes of F. sycomorus L. species T a b l e 4 Percent disagreement values (PDV) produced by RAPD and IRAP (single or in combination) data combination using the UPGMA routine in statistical program Genotype F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 T a b l e 5 Jaccard's similarity matrix produced by RAPD and IRAP (single or combination) data combination for the 10 F. sycomorus tested genotypes Genotype F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 F. sycomor1 F. sycomor2 F. sycomor3 F. sycomor4 F. sycomor5 F. sycomor6 F. sycomor7 F. sycomor8 F. sycomor9 F. sycomor10 as, it was varied between 0 and 0.78 with an average of 0.39 (Salhi-Hannaci et al. 2006), between 0.20 and 0.85 with an average of 0.51 (Cerqueira-Silva et al. 2010) in Passiflora cincinnata, between 0.181 and 0.562 with an average of 0.543 using an RAPD marker in Arthrocnemum macrostachyum (Saleh 2011), and in the study reported by Ikegami et al. (2009) on F. carica L., the average was 0.717. Combined RAPD and IRAP data produced genetic distances ranging from 0.05 to 0.46 with a mean of 0.28 (Table 4), and the resultant dendrogram (Figure 3) demonstrated that the 10 F. sycomorus genotypes phylogenetics fell into two main groups. The first cluster consisted of F. sycomor4 genotype that formed a distinct cluster with a PDV estimated value higher than 0.38 with other tested genotypes, especially with F. sycomor8 and F. sycomor4, and with F. sycomor10 and F. sycomor4 (PDV = 0.46), whereas, the second cluster included the remaining genotypes. Subsequently, the last cluster was further divided into four subclusters containing the remaining tested genotypes. The first subcluster involved genotypes F. sycomor1 and 2 that were closely related at PDV = 0.09 (similarity 0.857, Table 5). While, the second subcluster included F. sycomor6 and 8, that were closely related at PDV = 0.1 (similarity 0.850, Table 5). This subcluster was closed to F. sycomor7 at PDV = 0.11 (similarity 0.843, Table 5) and with F. sycomor8 at PDV = 0.12 (similarity 0.836, Table 5), whereas, the third subcluster consisted of F. sycomor9 and 10 that were the most related genotypes with a PDV = 0.05) similarity 0.924, Table 5). The fourth and last subcluster involved F. sycomor3 and F. sycomor5 that were also closely related at PDV = 0.12 (similarity 0.798, Table 5). Our results demonstrated that the genotypes studied are clustered independently from their geographical origin. Taking into account that F. sycomorus genotypes aggregated together in the same cluster, this indicated a possible common origin of these genotypes. This is in agreement with the monoecious origin of Ficus that has evolved into two gynodioecious forms as suggested by Machado et al. (2001). It is important to note that similar data have been reported in Tunisian fig using RAPD markers (Salhi Hannachi et al. 2006). CONCLUSION Overall, this study clearly demonstrates a relatively high diversity among F. sycomorus genotypes found in the coastal regions of Syria. Moreover, the two techniques applied may provide useful information on polymorphism levels as well as diversity in F. sycomorus L. species, but the IRAP marker differentiates accessions much better than the RAPD marker system. Consequently, the IRAP technique could be performed as a high-accuracy approach Agriculture (Ponohospodárstvo), 59, 2013 (3): 120-130 compared with the RAPD tool. Moreover, F. sycomor4 genotype showed the highest dissimilarity compared to the other genotypes studied in this investigation. According to the dendrogram based on a combination of RAPD and IRAP data, it could be suggested, that F. sycomor4 genotype belongs to a subspecies that is different from that of the remaining genotypes. In this investigation, it was not easy to predict the exact number of subspecies studied herein, especially since the exact number of F. sycomorus subspecies found in Syria is not known. Based upon the previous observation, and according to the position of genotypes presented by UPGMA cluster analysis, it may be postulated, however, that there are three subspecies present among the 10 samples tested. The first subspecies involved F. sycomorus3 and F. sycomorus5 genotypes, the second involved F. sycomorus4 which was being suggested as presenting a distinct subspecies from the other genotypes tested, whereas, the third involved the remaining tested genotypes. Based upon the results obtained herein, it is satisfying to confirm the previous data using more potential techniques such as, for example, SSR and universal cytoplasmic molecular markers. Thereby, further analyses are required to confirm the number of subspecies to which F. sycomorus trees growing in Syria belong. Acknowledgements. The author would like to thank Prof. Othman I, Director General of AECS and Prof. MirAli N, Head of Molecular Biology and Biotechnology Department for their support, and also to the Plant Biotechnology group for technical assistance. AL MALKI, A.A.H.S. ELMEER K.M.S. 2010. Influence of auxin and cytokinine on in vitro multiplication of Ficus anastasia. In African Journal of Biotechnology, vol. 9, no. 5, pp. 635639. DOI: 10.5897/ AJB09.1168. ARADHYA, M.K. ­ STOVER, E.D. ­ VELASCO, D. ­ KOEHMSTEDT, A. 2010. Genetic structure and differentiation in cultivated fig (Ficus carica L.). In Genetica, vol. 138, pp. 681­694. DOI: 10.1007/ s10709-010-9442-3. BARAKET, G. ­ CHATTI, K. ­ SADDOUD, O. BEN ABDELKARIM, A. ­ MARS, M. ­ TRIFI, M. SAHI HANNACHI, A. 2011. Comparative assessment of SSR and AFLP markers for evaluation of genetic diversity and conservation of fig, Ficus carica L., genetic resources in Tunisia. In Plant Molecular Biology Reporter, vol. 29, pp. 171­184. DOI: 10.1007/ s11105-010-0217-x. BARKOUDAH, Y. ­ DARWISH, A.I. ABI ANTOUN, M. 2000. Biological diversity, National repot. Biodiversity strategy and action plant and report to conference of the parties NBSAP project SY/97/G31. UNDP ­GEF. BISWAS, M.K. ­ XU, O. ­ DENG, X. 2009. Utility of RAPD, ISSR, IRAP and REMAP markers for genetic analysis of Citrus spp. In Scientia Horticulturae, vol. 124, pp. 245261. BOTSTEIN, D. ­ WHITE, R.L. ­ SKOLINCK, M. ­ DAVIS, R.W. 1980. Contraction of a genetic linkage map in man using restriction fragment length polymorphisms. In American Journal of Human Genetics, vol. 32, pp. 314331. CERQUEIRA-SILVA, C.B.M. ­ CONCEICAO, L.D.H.C.S. ­ SANTOS, E.S.L. CARDOSO-SILVA, C.B. ­ PEREIRA, A.S. ­ OLIVEIRA, A.C. CORREA R.X. 2010. Genetic variability in wild genotypes of Passiflora cincinnata based on RAPD markers. In Genetics and Molecular Research, vol. 9, no. 4, pp. 24212428. DOI: 10.4238/vol9-4gmr981. DALKILIC, Z. ­ MESTAV, H.O. GUNVER-DALKILIC, G. ­ KOCATA, H. 2011. Genetic diversity of male fig (Ficus carica caprificus L.) genotypes with random amplified polymorphic DNA (RAPD) markers. In African Journal of Biotechnology, vol. 10, no. 4, pp. 519526. DOI: 10.5897/AJB10.995. DE MASI, L. ­ CASTADO, D. ­ GALANO, G. ­ MINASI, P. ­ LARATTA, B. 2005. Genotyping of fig (Ficus carica L.) via RAPD markers. In Journal of the Science of Food and Agriculture, vol. 85, pp. 2235­ 2242. DOI: 10.1002/jsfa.2247. DOYLE, J.J. ­ DOYLE, J.L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. In Phytochemical Bulletin, vol. 19, 1987, pp. 11­15. GUO, D. ­ Zhang, H. ­ Luo, Z. 2006. Genetic relationships of Diospyros kaki Thunb. and related species revealed by IRAP and REMAP analysis. In Plant Science, vol. 170, no. 3, pp. 528533. DOI: 10.1016/j. plantsci.2005.10.006. HADIA, H.A. EL-MOKADEM, H.E. EL-TAYEB, H.F. 2008. Phylogenetic relationship of four Ficus species using random amplified polymorphic DNA

Journal

Agriculturede Gruyter

Published: Sep 1, 2013

There are no references for this article.